WO2001009325A2 - Mutations du gene p53 humain, et systeme genetique de levures utilise pour l'identification fonctionnelle des mutations du gene p53 humain - Google Patents

Mutations du gene p53 humain, et systeme genetique de levures utilise pour l'identification fonctionnelle des mutations du gene p53 humain Download PDF

Info

Publication number
WO2001009325A2
WO2001009325A2 PCT/US2000/020538 US0020538W WO0109325A2 WO 2001009325 A2 WO2001009325 A2 WO 2001009325A2 US 0020538 W US0020538 W US 0020538W WO 0109325 A2 WO0109325 A2 WO 0109325A2
Authority
WO
WIPO (PCT)
Prior art keywords
human
mutation
colonies
nucleic acid
mutant
Prior art date
Application number
PCT/US2000/020538
Other languages
English (en)
Other versions
WO2001009325A3 (fr
WO2001009325A9 (fr
Inventor
Michael A. Resnick
Alberto Inga
Original Assignee
The Government Of The United States Of America, Asrepresented By The Secretary, Dept. Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States Of America, Asrepresented By The Secretary, Dept. Of Health And Human Services filed Critical The Government Of The United States Of America, Asrepresented By The Secretary, Dept. Of Health And Human Services
Priority to AU62395/00A priority Critical patent/AU784293B2/en
Priority to JP2001514117A priority patent/JP2003506041A/ja
Priority to US10/048,502 priority patent/US7256260B1/en
Priority to CA002380631A priority patent/CA2380631A1/fr
Priority to EP00948979A priority patent/EP1204745A2/fr
Publication of WO2001009325A2 publication Critical patent/WO2001009325A2/fr
Publication of WO2001009325A3 publication Critical patent/WO2001009325A3/fr
Publication of WO2001009325A9 publication Critical patent/WO2001009325A9/fr
Priority to AU2006202361A priority patent/AU2006202361A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4746—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used p53
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • This invention relates to mutants of human p53 and methods of identifying mutants of p53. Specifically, the invention relates to isolated polypeptides containing human p53 mutations and to isolated nucleic acids encoding the polypeptides. The invention further relates to the methods of detecting human p53 mutations that are toxic, supertransactivating or tox-suppressor mutations as well as to the identification of compounds, agents or interactive factors, such as peptides, that mimic the toxic or the supertransactivating mutations.
  • the most commonly inactivated gene target associated with neoplastic transformation is the tumor suppressor gene p53, a key regulator of cellular mechanisms that maintain genome integrity (Prives and Hall).
  • p53 a key regulator of cellular mechanisms that maintain genome integrity
  • cellular stresses including DNA damage, hypoxia, suboptimal growth conditions, nucleotide pool unbalance, and activated oncogenes can induce signaling cascades that converge at p53 and result in greater stability of the protein, primarily through post-translational modifications (Giacca and Kastan; Meek).
  • the p53 half life is increased due to inhibition of the normal MDM2 associated degradation pathway (Freedman and Levine) leading to greater nuclear retention and also through a coordinated regulation of the stability of the p53 tetramer (Stommel). This produces a rapid, transient increase in nuclear levels of active p53 which causes either growth arrest or apoptosis.
  • the p53 mediated stress responses occur primarily through sequence-specific transcriptional activation (Prives and Hall) involving several p53 functional domains (Ko and Prives). Beginning at the N-terminus of p53, the first 43 amino acids correspond to an acidic region that contains a major transactivation domain; the region between amino acid 43 and 73 represents a second transactivation domain (Venot et al a). The next region (up to amino acid 92) is proline rich and may be involved in apoptosis induction (Venot et al b) and this is followed by a large DNA binding domain (amino acids. 100 to 300) responsible for sequence-specific DNA recognition.
  • the remaining carboxy terminal portion codes for the nuclear localization and export signals, the oligomerization domain, and a basic regulatory region.
  • the p53 monomer recognizes a pentameric DNA sequence (consensus 5'-RRRCW-3'), and a complete binding site consists of two closely spaced head-to-head pentamers (McLure and Lee, Cho et al.,).
  • the transcriptionally active form of the protein is a tetramer.
  • downstream p53 activated genes are associated with the induction of programmed cell death (e.g. bax, IGF-BP3, PIG3), regulation of cell cycle through induction of arrest at the Gl/S or G2/M checkpoints in response to DNA damage (e.g. p21, GADD45, cyclin G), and modification of p53 stability/activity (MDM2).
  • programmed cell death e.g. bax, IGF-BP3, PIG3
  • regulation of cell cycle through induction of arrest at the Gl/S or G2/M checkpoints in response to DNA damage e.g. p21, GADD45, cyclin G
  • MDM2 modification of p53 stability/activity
  • p53 can affect gene expression through physical interactions with TATA binding protein and associated factors (Ko and Prives, Oren fos). Other protein-protein interactions are also likely to play an important role in mediating the p53 response. While the number of proteins interacting with p53 is high, the physiological role of these interactions in many cases is unknown (Prives and Hall). In addition p53 may play a direct role in DNA metabolism as evidenced by nuclease activity and p53 binding to recombinant-like structures (Deppert; Griffith).
  • Loss of p53 function is highly selected during tumor development as evidenced by p53 mutations in nearly 50% of human tumors (Grennblatt). Most alterations result from single missense mutations in the DNA binding domain that prevent or reduce DNA binding and they generally occur at the most p53 invariant residues (Walker et al). These residues usually directly contact DNA or affect the correct folding and stability of the large DNA binding domain (Cho). The strong selection for missense mutations is probably due to dominant-negative interactions with the wild type protein to generate partially inactive heterotetramers, and possibly to gain of function (Gualberto et al.,). In addition, tumor cells generally accumulate high levels of p53 mutant proteins in the nucleus.
  • p53 functional mutants were placed under the control of the galactose inducible GAL1 promoter, whose expression can be variably regulated. Growth inhibition was generally directly correlated with transactivation proficiency in that over-expression of wild type p53 caused severe reduction in colony size while transactivation mutants had a minor impact on growth. Tmncated p53, which cannot form tetramers, caused no apparent growth delay while a mutant retaining partial activity had an impact on growth similar to normal p53. Based on this it is expected that certain p53 alleles can exhibit a stronger effect on growth than the wild type, possibly leading to inviability.
  • Such alleles are expected to function more effectively than wild type p53 in mammalian cells as well.
  • This invention has identified such a class of mutants in yeast and novel p53 alleles that cause lethality in yeast and growth suppression in a human tumor cell line.
  • This invention further provides a screening system that can be used to isolate a variety of toxic or novel p53 alleles in yeast that are normally not detectable and these may prove useful in developing new therapeutic approaches.
  • the invention provides a novel screen in yeast that allows the identification of p53 alleles exhibiting increased transcriptional activation compared to the wild type. p53 alleles showing supertransactivating transcriptional activity are also provided.
  • the invention therefore allows one skilled in the art to tailor p53 functional control for the various promoters recognized by p53 in terms of strength of induction by p53 (from no induction to supertransactivation) and for combinations of p53 responsive genes (i.e. some genes turned on, some genes turned off). This allows the skilled artisan to change the p53 responsive pathways and therefore the biological outcomes in response to environmental challenges.
  • Supertransactivating mutants expected to represent a better choice in p53 gene therapy approaches because they can retain biological activity in the presence of highly expressed endogenous p53 tumor mutants
  • the invention provides an isolated polypeptide comprising residues 117 to 127 of human p53 containing the mutation V122A, an isolated polypeptide comprising residues 272 to 282 of human p53 containing the mutation C277W, an isolated polypeptide comprising residues 272 to 282 of human p53 containing the mutation C277R, an isolated polypeptide comprising residues 333 to 343 of human p53 containing the mutation F338L, an isolated polypeptide comprising residues 153 to 163 of human p53 containing the mutation V157I, an isolated polypeptide comprising residues 70 to 80 of human p53 containing the mutation A76T, an isolated polypeptide comprising residues 145 to 155 of human p53 containing the mutation T150A, an isolated polypeptide comprising residues 115 to 125 of human p53 containing the mutation S121C, an isolated polypeptide comprising residues 90 to 100 of human p53 containing the mutation S96P, an isolated polypeptide comprising
  • W91C the mutation C124R, the mutation Q136K, and the mutation T150A
  • an isolated polypeptide comprising residues 100 to 200 of human p53 containing the mutation C124R, the mutation Q136K, and the mutation T150A.
  • the invention also provides mutant polypeptides of human p53 containing combinations of the above-mentioned mutations.
  • the present invention further provides isolated nucleic acids encoding any of the mutant polypeptides of this invention.
  • Also provided by this invention is a method of detecting a supertransactivating mutation in the human p53 gene comprising: a) obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; b)introducing into the yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human 53 coding sequence; c) plating the yeast cell on raffinose as a carbon source; and d)identifying colonies on plates, wherein colonies expressing wild type p53 yield red colonies and colonies expressing a supertransactivating mutation in p53 yield white or pink colonies.
  • the invention also provides a method of detecting a toxic mutation in the human p53 gene comprising: a) obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; b)introducing into the yeast cell a nucleic acid which encodes an unidentified human p53 in the cell, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human p53 coding sequence; c) plating the yeast cell on each of glucose, raffinose or galactose; and d) identifying colonies on plates, wherein colonies expressing wild type p53 yield red colonies on glucose, red colonies on raffinose and white colonies on galactose, and wherein colonies expressing a toxic mutation in p53 yield redcolonies on glucose, red colonies or white colonies or no colonies on raffinose, and no colonies on galactose.
  • a method of detecting a toxic mutation in the human p53 gene comprising: a) introducing into the yeast cell a nucleic acid which encodes an unidentified human p53 in the cell, the nucleic acid comprising an on-off promoter linked to the human p53 coding sequence; b) incubating the yeast cell in synthetic yeast medium in the presence and absence of an inducer for the promoter; and c) identifying a toxic mutant, wherein yeast expressing wildtype p53 yield growth in the presence or absence of an inducer for the promoter, and wherein yeast expressing a toxic mutation in p53 yields growth in the presence of an inducer for the promoter.
  • the invention also provides a method of inducing toxicity in a cell by administering to the cell a human p53 that contains a toxic mutation. Further provided by this invention is a method of inducing toxicity in a cell by administering to the cell a human p53 that contains a supertransactivating mutation.
  • Also provided by this invention is a method of screening for compounds that can mimic a toxic p53 mutation
  • a method of screening for compounds that can mimic a toxic p53 mutation comprising: a)obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; b) introducing into the yeast cell a nucleic acid which encodes a non-toxic mutant or wildtype human p53 in the cell, the nucleic acid comprising an inducible promoter linked to a non-toxic mutant or wildtype human 53 coding sequence; c)introducing the compound to the yeast cell; d) plating the yeast cell on each of glucose, raffinose or galactose; and e) identifying a compound that mimics a toxic mutation preventing growth of colonies expressing wildtype or non-toxic mutant p53 to yield red colonies on glucose, red colonies or white colonies or no colonies on raffinose, and no colonies on galactose.
  • the present invention also provides a method of screening for compounds that can mimic a toxic p53 mutation comprising: a) introducing into the yeast cell a nucleic acid which encodes a non-toxic mutant or wildtype human p53 in the cell, the nucleic acid comprising an on-off promoter linked to a non-toxic mutant or wildtype human p53 coding sequence; b) introducing the compound to the yeast cell; c) incubating the yeast cell in artificial yeast medium in the presence and absence of an inducer for the promoter; and d) identifying a compound that mimics a toxic mutation, thereby preventing growth of yeast in the presence of an inducer for the promoter.
  • a method of screening for a compound that can mimic a supertransactivating mutation in the human p53 gene comprising: a) obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; b) introducing a nucleic acid into the yeast cell which encodes a wildtype or a non-supertransactivating mutant human p53 in the cell, the nucleic acid comprising an inducible promoter linked to a nonsupertransactivating mutant or wildtype human 53 coding sequence; c) plating the yeast cell and compound on raffinose; and d) identifying a compound that mimics a supertransactivating mutation in p53 to yield white or pink colonies, wherein the compound has no effect in the absence of p53.
  • FIG. 1 Phenotypic analysis of p53 alleles integrated in yeast. Transformants of yIG397 that had p53 or mutant p53 under GALl control integrated into the LYS2 were streaked onto YPD and YPGAL plates and incubated at 30°C for three days. Clone yIRp53-5 shows the wild-type p53 phenotype in that it becomes white on galactose due to the ability of p53 to transcriptionally activate the promoter next to the ADE2 reporter gene. Clones 7 and 9 behave like p53 mutants (red colonies and very limited growth delay). Clone yIRp53-19 cannot grow on galactose.
  • the toxic p53 protein is full length and has a slightly reduced expression compared to wild type p53.
  • Cells containing the toxic mutant p53 were incubated in galactose medium and extracts were prepared two or four hours later. 20g of protein extract were loaded per lane.
  • p53 was detected using antibodies pAbl801 and DO-1 (Santa Cmz).
  • YIRp53-5, 7 and 19 showed full size p53 whereas p53 was truncated in clone-9.
  • the lower bands are likely due to degradation since there is much less material in extracts obtained from a protease deficient strain.
  • Figure 3 Lethal effects of expressed mutant p53. Clones yIRp53-5, yIRp53-19 and the parental strain lacking a p53 integrant were grown overnight in glucose medium, washed and diluted to 10 cells/ml and grown in galactose medium for 24 hours. Aliquots were taken at the indicated times, titers were determined, and cells were plated to glucose to assess viability. The curves identify the mean and standard errors for a triplicate set of experiments. Squares correspond to cell number; triangles correspond to viability.
  • Fig. 4 Evaluation of the transactivation capabilities of toxic p53 mutants inyPH-bax and yPH-p21 strains.
  • FIG. 1 Growth suppression by expressed p53 in Saos-2 cells.
  • Saos-2 cells were transfected by lipofectin using 1.5g of pCMV-Neo-Bam based plasmid DNA containing different p53 alleles under the control of a CMV promoter. The relative average number of colonies and standard errors for at least triplicate experiments are presented. Percentages are relative to the number of colonies obtained in transfections with the vector control.
  • FIG. 6 Analysis of p21 induction by p53 V122A in Saos-2 cells.
  • Saos-2 cells were transiently transfected by pCMV based plasmids containing wild type p53 or mutants using a lipofectin reagent. lOOng of expression plasmid were transfected. Cells were recovered after 48 hours, extracts were prepared and 50-150 ⁇ g of extract was loaded in each lane. After transfer, the membrane was cut at a position corresponding to a 40 KD marker, in order to separately detect induction of p21 and alpha-tubulin. To detect p53 the membrane was stripped and reprobed.
  • Figure 7. p53 induction of a luciferase reporter in Saos-2 cells.
  • luciferase based gene reporter assay was used to evaluate the transactivation potential of p53-V122A and p53 double mutants.
  • Panels A and B plasmids pGL1012 and pGLl 138 contain the bax andp21 responsive elements next to a minimal promoter for the luciferase gene, respectively.
  • Panel C plasmid PG13 contains 13 copies of the RGC p53 responsive element. Transient transfections were performed with 50 or 100 ng of p53 expression plasmids and 1 ⁇ g of reporter plasmid. Cells were recovered 24 hours after transfection.
  • Figure 8 A novel screen for p53 variants exhibiting increased transactivation.
  • Panel A on glucose plates with low adenine wild type p53 expression under pADHl leads to white colonies. p53 transactivation mutants produce small red colonies.
  • Panel B on raffinose plates containing low adenine expression under pGALlis low so that wild type p53 produces red colonies.
  • White colonies (arrow) may reveal p53 alleles with increased transcriptional activation potential.
  • FIG. 9 The p53 cDNA fragment from nucleotide 124 to 1122 is responsible for increased transactivation.
  • Left side GAP repair cloning in pGALl plasmid of a PCR fragment generated using as template a rescued p53 plasmid showing increased transactivation in yeast.
  • Right side wild type p53 was used as template for the same kind of experiment. Cells are grown on raffinose as the carbon source, so that expression is low.
  • FIG. 10 Phenotypic analysis of variable expression of p53 variants disclosing increased transactivation compared to wild type p53. Transformants with pGALl plasmids expressing wild type p53 (top) or with three different "supertrans” alleles were tested on glucose (left), raffinose (center), and galactose (right) plates. "Supertrans" alleles are more growth inhibitory than wild type p53.
  • Figure 11 ⁇ -galactosidase induction confirms the increased transactivation potential of the novel p53 alleles. ⁇ -galactosidase activity was measured after 8 hours of growth in raffinose liquid culture.
  • Fig. 12 Comparison of wild type p53 and supertrans mutant p53 protein expression levels.
  • Protein extracts were prepared from glucose (lane 1,2) or raffinose (lanes 3-12) cultures of yIG397 transformants containing pGAL 1 p53 expression plasmids. lO ⁇ g of protein extract was loaded on lanes 3,5,7,9,11. 50 ⁇ g were loaded on lanes 1,2,4,6,8,10,12. p53 was detected by DO-1 and pAb-1801 antibodies .
  • FIG. 13 p53-T123A is resistant to the dominant negative phenotype of p53-G279E.
  • Panel A yeast transformants with two vectors expressing wild type and p53-G279E under the ADH1 promoter. Pink colonies reflects the dominant negative phenotype of the mutant.
  • Panel B yeast transformants with two vectors expressing p53-T123A and p53-G279E under the ADH1 promoter. Colonies are white, indicating wild type p53 activity.
  • Fig. 14 Growth suppression by wild type and supertrans p53 alleles in human Saos-2 cells.
  • Saos-2 cells were transfected by lipofectin using 1 ⁇ g of vectors containing the different p53 alleles under the control of a CMV promoter. The relative average number of G418 resistant colonies and the standard errors for at least three experiments are presented.
  • Fig. 15 Growth suppression by wild type and supertrans p53 alleles in the presence of a dominant negative tumor mutant.
  • Saos-2 cells were co-transfected with with 250ng of an identical vector expressing the indicated p53 alleles and with 1 ⁇ g of a pCMV-based vector expressing the G279E mutant (i.e., 1:4) and G418 resistant colonies were selected. The relative average number and the standard errors for three independent experiments are presented. Fig. 16. Analysis of transactivation by supertrans p53 alleles by a luciferase reporter assay in Saos-2 cells.
  • Luciferase activity for each mutant and control vector is expressed relative to that obtained with wild type p53.
  • the MDM2 a d p21 promoters and the b ⁇ x responsive elements were tested in panels A, B and C, respectively.
  • Transient transfections using Fugene were performed with 20 ng of p53 expression plasmid and 500 ng of reporter plasmid in 12-well plate clusters. Cells were recovered 48 hours after transfection.
  • Fig. 17 p53 levels and endogenous p21 induction by wild type and supertrans p53 alleles in Saos-2 cells.
  • p53 and p21 protein levels in the same extracts used in the luciferase assays of Figure 7 were determined by Western Blots. 100 ⁇ g of protein were loaded in each lane. After transfer, the membrane was cut at a position corresponding to a 40 KD marker in order to detect p21 and p53 separately.
  • Fig. 18 Localization of the supertrans mutants in the p53 DNA binding domain.
  • the position of the supertrans mutants decribed in Table 1 is shown on a ribbon representation of the monomeric DNA binding domain based on the crystal stmcture.
  • Human p53 mutants The present invention provides mutant forms of human p53. These mutations can cause certain phenotypes and may exert their effects via increased DNA binding affinity, alterations of DNA, altered specificity for p53 responsive elements, increased stability, a shift toward the tetrameric form of p53 or even via stronger or unidentified proteimprotein interactions.
  • mutants can include a toxic mutation of human p53.
  • toxic is meant a mutated human p53 that exhibits stronger growth inhibition of cells than wildtype p53 and could lead to cell death.
  • the toxic mutation may exhibit strong growth inhibition or lead to cell death with or without the transactivating activity, i.e. the ability to induce transcription of a reporter gene via binding of the mutant to a promoter element containing p53 binding domains, for example, as measured in the yeast expression system of this invention.
  • Cell death may occur via apoptosis, the transcription of genes involved in apoptosis, inappropriate transcription of genes possibly leading to necrosis, or other mechanisms of cell death, or DNA damage.
  • apoptosis refers to programmed cell death that has distinctive mo ⁇ hological and stmctural features that are different from those of pathological cell death or necrosis.
  • the apoptotic process is characterized by nuclear fragmentation and cytoplasmic budding that lead to the formation of apoptotic bodies. These bodies are phagocytosed and destroyed by nearby macrophages. The fragmentation of the cells does not lead to the release of cellular contents, and the phagocytosis of the apoptotic bodies does not lead to inflammation. As a result, cell death can occur without damage to adjacent cells or tissues.
  • mutants identified by the present invention is the supertransactivating mutations or the supertransactivators.
  • supertransactivating or “supertransactivators” is meant a mutant p53 that possesses increased transcriptional activation in comparison to wildtype p53. These supertransactivating mutants may lead to stronger growth inhibition in cells when compared to wildtype p53 and could also lead to cell death. Therefore, some supertransactivating mutants are also toxic mutants.
  • the activity of supertransactivators can be modulated under certain conditions such as variations in the levels of supertransactivator protein expression as well as the type of responsive elements present for interaction with the supertransactivator. Examples of this activity are shown in Table 7, where it is shown that several supertransactivators possess varying levels of activity depending on the level of expression and/or selectivity for responsive elements.
  • the supertransactivating mutations can be dominant over the dominant negative effects that common tumor mutants exhibit, i.e. the supertransactivating mutation overcomes the dominant negative effect on transactivation that common tumor mutants exhibit over wild-type p53.
  • dominant negative is meant that in the presence of both the wild-type p53 and a mutant p53, the phenotype resulting from the mutant p53 is observed.
  • tox-suppressor mutations By “tox- suppressor” is meant a mutation in p53 that is capable of suppressing the toxic phenotype in cells produced by a toxic mutation in p53. By “suppressing” is meant a range of effects, ranging from a decrease in the effects of the toxic p53 mutation to complete reversal of the toxic phenotype where the toxic effects are no longer apparent.
  • the tox-suppressor mutation can be a second mutation on a toxic p53 or a mutation on another p53 that leads to the suppression of the toxic mutant's effects on the cell.
  • a second mutation can be introduced in the toxic mutant p53. If the second mutation suppresses the toxic p53 mutant's effects, cell growth should be observed, thus suppressing the toxic mutation's effects, i.e. strong growth inhibion or cell death.
  • Other mutations include mutant p53s that retain their transcriptional capabilities similar to wildtype p53, and trans-minus mutations of p53 which are mutant p53s that are not able to transactivate, i.e. bind to the p53 DNA binding element and induce the transcription of a gene, e.g. a reporter gene in a yeast expression assay.
  • the present p53 mutants provide opportunities to address structure-function relationships of p53.
  • several LI loop mutations have defined different activities, including loss of transcriptional activity, supertransactivity (super-trans), toxicity and suppression of known mutations.
  • super-trans or toxic mutants can be altered by the presence of a second mutations, such as a tmncation in the same gene.
  • toxic or supertransactivating mutations in different regions of the DNA binding domain or in the tetramerization domain could be combined to provide additional active variants.
  • the mutants also provide opportunities to examine dominance.
  • This invention shows that levels of dominance can be investigated by varying the level of expression of the mutants. This was done for intragenic suppression. This invention also demonstrates intergenic suppression dominance, but this was only at one expression level. Mutants with varying levels of dominance are revealed using variable expression of the mutants.
  • the mutants can be used to examine p53 mutants from human tissue. For example, a chimera can be generated (by transformation associated recombination) that contains one of the identified mutants (such as a supertransactivating or toxic) and a potential mutation from human tissue. Thus, naturally occurring mutations can be examined (or screened) in terms of their ability to reverse or modify the identified mutant. This intragenic suppressor/dominance screen provides an important tool for examining p53 cancer mutations.
  • the mutants can also be used to generate even stronger mutants of the same type. Once a mutant is identified, it is anticipated that subsequent second-site mutations can be generated that can further enhance the impact of the first mutation. For example, a supertransactivating mutation can be enhanced by a second mutation which would permit it to be detected at even lower levels of transcription than the single-mutation supertrans mutant thus resulting in a super-supertransactivating mutant. Similarly, a growth-inhibiting toxic mutant may be further mutated to generate a lethal mutant or result in lethality at lower expression levels.
  • mutants also provide opportunities to examine chemical or dmg interactions with wildtype or mutant p53, possibly relieving toxic effects, creating toxic effects, or creating or removing a supertransactivating effect.
  • the present invention provides mutant polypeptides of human p53.
  • polypeptides can range in size from 10 amino acids in length to the full-length human p53.
  • the invention provides an isolated polypeptide comprising residues 117 to 127 of human p53 containing the mutation V122A, an isolated polypeptide comprising residues 272 to 282 of human p53 containing the mutation C277W, an isolated polypeptide comprising residues 70 to 80 of human p53 containing the mutation A76T, an isolated polypeptide comprising residues 272 to 282 of human p53 containing the mutation C277R, an isolated polypeptide comprising residues 145 to 155 of human p53 containing the mutation T150A, an isolated polypeptide comprising residues 115 to 125 of human p53 containing the mutation S121C, an isolated polypeptide comprising residues 120 to 130 of human p53 containing the mutation C124Y, an isolated polypeptide comprising residues 120 to 130 of human p53 containing the mutation C124F, an isolated polypeptide comprising residues 283 to
  • the invention also provides mutant polypeptides of human p53 containing combinations of the above- mentioned mutations.
  • the coordinates used herein to define the mutant p53 polypeptides of the invention are based on the published sequence of the human p53 (Zakut-Houri R., Bienz-Tadmor B., Givol D., Oren M. 1985. "Human p53 cellular tumor antigen: cDNA sequence and expression in COS cells" EMBO J. 4:1251-1255).
  • the Zakut-Houri et al. reference is hereby inco ⁇ orated in its entirety by this reference.
  • polypeptides of this invention as used herein, “isolated” and/or “purified” means a polypeptide which is substantially free from the naturally occurring materials with which the polypeptide is normally associated in nature.
  • polypeptide refers to a molecule comprised of amino acids which correspond to those encoded by a nucleic acid.
  • the polypeptides of this invention can consist of the entire amino acid sequence of the mutant human p53 protein or fragments thereof of at least 5 amino acids in length.
  • the polypeptides or fragments thereof of the present invention can be obtained by isolation and purification of the polypeptides from cells where they are produced naturally or by expression of exogenous nucleic acid encoding the mutant human p53 polypeptide.
  • polypeptides can also be obtained in any of a number of procedures well known in the art.
  • One method of producing a polypeptide is to link two peptides or polypeptides together by protein chemistry techniques.
  • peptides or polypeptides can be chemically synthesized using currently available laboratory equipment using either Fmoc (9-fluorenylmethyloxycarbonyl) or Boc (tert - butyloxycarbonoyl) chemistry. (Applied Biosystems, Inc., Foster City, CA).
  • Fmoc 9-fluorenylmethyloxycarbonyl
  • Boc tert - butyloxycarbonoyl
  • a peptide or polypeptide can be synthesized and not cleaved from its synthesis resin whereas the other fragment of a hybrid peptide can be synthesized and subsequently cleaved from the resin, thereby exposing a terminal group which is functionally blocked on the other fragment.
  • peptide condensation reactions these two fragments can be covalently joined via a peptide bond at their carboxyl and amino termini, respectively, to form a larger polypeptide.
  • the peptide or polypeptide can be independently synthesized in vivo as described above. Once isolated, these independent peptides or polypeptides may be linked to form a larger protein via similar peptide condensation reactions.
  • enzymatic ligation of cloned or synthetic peptide segments can allow relatively short peptide fragments to be joined to produce larger peptide fragments, polypeptides or whole protein domains (Abrahmsen et al. Biochemistry, 30:4151 (1991)).
  • native chemical ligation of synthetic peptides can be utilized to synthetically constmct large peptides or polypeptides from shorter peptide fragments. This method consists of a two step chemical reaction (Dawson et al. A Synthesis of Proteins by Native Chemical Ligation, Science, 266:776-779 (1994)).
  • the first step is the chemoselective reaction of an unprotected synthetic peptide-%-thioester with another unprotected peptide segment containing an amino-terminal Cys residue to give a thioester-linked intermediate as the initial covalent product. Without a change in the reaction conditions, this intermediate undergoes spontaneous, rapid intramolecular reaction to form a native peptide bond at the ligation site.
  • Application of this native chemical ligation method to the total synthesis of a protein molecule is illustrated by the preparation of human interleukin 8 (IL-8) (Clark-Lewis et al.
  • unprotected peptide segments can be chemically linked where the bond formed between the peptide segments as a result of the chemical ligation is an unnatural (non-peptide) bond (Schnolzer et al. Science, 256:221 (1992)).
  • This technique has been used to synthesize analogs of protein domains as well as large amounts of relatively pure proteins with full biological activity (deLisle Milton et al. Techniques in Protein Chemistry IV, Academic Press, New York, pp. 257-267 (1992)).
  • Fragments of the mutant human p53 polypeptide can be obtained by standard chemical synthesis of peptides, by proteolytic cleavage of the polypeptide and by synthesis from nucleic acid encoding the portion of interest.
  • fragments of the human p53 polypeptide can comprise the amino acid sequence comprising residues 117 to 127 comprising the mutation VI 22 A.
  • other fragments of mutant human p53 polypeptides can be obtained that contain a desired mutation.
  • the polypeptide may include conservative substitutions where a naturally occurring amino acid is replaced by one having similar properties.
  • amino acids may be substituted for other amino acids in a mutant human p53 polypeptide without appreciable loss of functional activity. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a mutant human p53 amino acid sequence (or, of course, the underlying nucleic acid sequence) and nevertheless obtain a mutant human p53 polypeptide with like properties. It is thus contemplated that various changes may be made in the amino acid sequence of the mutant human p53 polypeptide (or underlying nucleic acid sequence) without appreciable loss of biological utility or activity and possibly with an increase in such utility or activity.
  • antibodies that selectively or specifically bind to the polypeptides provided and contemplated herein
  • the antibody can be raised to any of the polypeptides provided and contemplated herein, both naturally occurring and recombinant polypeptides, and immunogenic fragments, thereof.
  • the antibody can be used in techniques or procedures such as diagnostics, treatment, or vaccination.
  • nucleic acid refers to single-or multiple stranded molecules which may be DNA or RNA, or any combination thereof, including modifications to those nucleic acids.
  • the nucleic acid may represent a coding strand or its complement, or any combination thereof.
  • Nucleic acids may be identical in sequence to the sequences which are naturally occurring (except for the presently mutated codons) for any of the novel genes discussed herein or may include alternative codons which encode the same amino acid (for the non-mutated amino acids) as that which is found in the naturally occurring sequence.
  • nucleic acids can also be modified from their typical stmcture. Such modifications include, but are not limited to, methylated nucleic acids, the substitution of a non-bridging oxygen on the phosphate residue with either a sulfur (yielding phosphorothioate deoxynucleotides), selenium (yielding phosphorselenoate deoxynucleotides), or methyl groups (yielding methylphosphonate deoxynucleotides) .
  • a compound comprising a nucleic acid can be a derivative of a typical nucleic acid such as nucleic acids which are modified to contam a terminal or internal reporter molecule and/or those nucleic acids containing non-typical bases or sugars.
  • reporter molecules include, but are not limited to, isotopic and non-isotopic reporters. Therefore any molecule which may aid in detection, amplification, replication, expression, purification, uptake, etc. may be added to the nucleic acid constmct.
  • nucleic acid encoding a particular protein of interest or a region of that nucleic acid, is constmcted, modified, or isolated, that nucleic acid can then be cloned into an appropriate vector, which can direct the in vivo or in vitro synthesis of that wild- type and/or modified protein.
  • the vector is contemplated to have the necessary functional elements that direct and regulate transcription of the inserted gene, or nucleic acid.
  • These functional elements include, but are not limited to, a promoter, regions upstream or downstream of the promoter, such as enhancers that may regulate the transcriptional activity of the promoter, an origin of replication, appropriate restriction sites to facilitate cloning of inserts adjacent to the promoter, antibiotic resistance genes or other markers which can serve to select for cells containing the vector or the vector containing the insert, RNA splice junctions, a transcription termination region, or any other region which may serve to facilitate the expression of the inserted gene or hybrid gene. (See generally, Sambrook et al).
  • E. coli Esscherichia coli
  • Other microbial hosts suitable for use include bacilli, such as Bacillus subtilis, and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species.
  • bacilli such as Bacillus subtilis
  • enterobacteriaceae such as Salmonella, Serratia, and various Pseudomonas species.
  • prokaryotic hosts one can also make expression vectors, which will typically contain expression control sequences compatible with the host cell (e.g., an origin of replication).
  • any number of a variety of well-known promoters will be present, such as the lactose promoter system, a tryptophan (T ⁇ ) promoter system, a beta-lactamase promoter system, or a promoter system from phage lambda.
  • the promoters will typically control expression, optionally with an operator sequence, and have ribosome binding site sequences for example, for initiating and completing transcription and translation.
  • an amino terminal methionine can be provided by insertion of a Met codon 5' and in-frame with the downstream nucleic acid insert.
  • the carboxy-terminal extension of the nucleic acid insert can be removed using standard oligonucleotide mutagenesis procedures.
  • yeast expression can be used. There are several advantages to yeast expression systems. First, evidence exists that proteins produced in a yeast secretion systems exhibit correct disulfide pairing. Second, post-translational glycosylation is efficiently carried out by yeast secretory systems. The Saccharomyces cerevisiae pre-pro-alpha-factor leader region (encoded by the MF"-1 gene) is routinely used to direct protein secretion from yeast. (Brake, et al. " «-Factor-Directed Synthesis and Secretion of Mature Foreign Proteins in Saccharomyces cerevisiae.” Proc. Nat. Acad. Sci., 81 :4642-4646 (1984)).
  • the leader region of pre-pro-alpha-factor contains a signal peptide and a pro-segment which includes a recognition sequence for a yeast protease encoded by the KEX2 gene: this enzyme cleaves the precursor protein on the carboxyl side of a Lys- Arg dipeptide cleavage signal sequence.
  • the nucleic acid coding sequence can be fused in-frame to the pre-pro-alpha-factor leader region. This constmct is then put under the control of a strong transcription promoter, such as the alcohol dehydrogenase I promoter or a glycolytic promoter.
  • the nucleic acid coding sequence is followed by a translation termination codon which is followed by transcription termination signals.
  • nucleic acid coding sequences can be fused to a second protein coding sequence, such as Sj26 or ⁇ -galactosidase, used to facilitate purification of the fusion protein by affinity chromatography.
  • a second protein coding sequence such as Sj26 or ⁇ -galactosidase
  • the insertion of protease cleavage sites to separate the components of the fusion protein is applicable to constmcts used for expression in yeast. Efficient post translational glycosylation and expression of recombinant proteins can also be achieved in Baculovims systems.
  • Mammalian cells permit the expression of proteins in an environment that favors important post-translational modifications such as folding and cysteine pairing, addition of complex carbohydrate stmctures, and secretion of active protein.
  • Vectors useful for the expression of active proteins in mammalian cells are characterized by insertion of the protein coding sequence between a strong viral promoter and a polyadenylation signal.
  • the vectors can contain genes conferring hygromycin resistance, gentamicin resistance, or other genes or phenotypes suitable for use as selectable markers, or methotrexate resistance for gene amplification.
  • the chimeric protein coding sequence can be introduced into a Chinese hamster ovary (CHO) cell line using a methotrexate resistance-encoding vector, or other cell lines using suitable selection markers. Presence of the vector DNA in transformed cells can be confirmed by Southern blot analysis. Production of RNA corresponding to the insert coding sequence can be confirmed by Northern blot analysis.
  • suitable host cell lines capable of secreting intact human proteins have been developed in the art, and include the CHO cell lines, HeLa cells, myeloma cell lines, Jurkat cells, etc.
  • Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer, and necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
  • Preferred expression control sequences are promoters derived from immunoglobulin genes, SV40, Adenovims, Bovine Papilloma Vims, etc.
  • the vectors containing the nucleic acid segments of interest can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transformation is commonly utilized for prokaryotic cells, whereas calcium phosphate, DEAE dextran, or lipofectin mediated transfection or electroporation may be used for other cellular hosts.
  • vectors for the expression of genes or nucleic acids in mammalian cells those similar to those developed for the expression of human gamma-interferon, tissue plasminogen activator, clotting Factor VIII, hepatitis B vims surface antigen, protease Nexinl, and eosinophil major basic protein, can be employed.
  • the vector can include CMV promoter sequences and a polyadenylation signal available for expression of inserted nucleic acids in mammalian cells (such as COS-7).
  • Insect cells also permit the expression of mammalian proteins. Recombinant proteins produced in insect cells with baculovims vectors undergo post-translational modifications similar to that of wild-type proteins.
  • baculovims vectors useful for the expression of active proteins in insect cells are characterized by insertion of the protein coding sequence downstream of the Autographica californica nuclear polyhedrosis vims (AcNPV) promoter for the gene encoding polyhedrin, the major occlusion protein.
  • Cultured insect cells such as Spodoptera frugiperda cell lines are transfected with a mixture of viral and plasmid DNAs and the viral progeny are plated.
  • the genes or nucleic acids of the present invention can be operatively linked to one or more of the functional elements that direct and regulate transcription of the inserted gene as discussed above and the gene or nucleic acid can be expressed.
  • a gene or nucleic acid can be operatively linked to a bacterial or phage promoter and used to direct the transcription of the gene or nucleic acid in vitro.
  • a further example includes using a gene or nucleic acid provided herein in a coupled transcription-translation system where the gene directs transcription and the RNA thereby produced is used as a template for translation to produce a polypeptide.
  • a gene or nucleic acid provided herein in a coupled transcription-translation system where the gene directs transcription and the RNA thereby produced is used as a template for translation to produce a polypeptide.
  • the products of these reactions can be used in many applications such as using labeled RNAs as probes and using polypeptides to generate antibodies or in a procedure where the polypeptides are being administered to a cell or a subject.
  • Expression of the gene or nucleic acid can be by either in vivo or in vitro.
  • In vivo synthesis comprises transforming prokaryotic or eukaryotic cells that can serve as host cells for the vector.
  • expression of the gene or nucleic acid can occur in an in vitro expression system.
  • in vitro transcription systems are commercially available which are routinely used to synthesize relatively large amounts of mRNA.
  • the nucleic acid encoding the desired gene would be cloned into an expression vector adjacent to a transcription promoter.
  • the Bluescript II cloning and expression vectors contain multiple cloning sites which are flanked by strong prokaryotic transcription promoters.
  • Kits are available which contain all the necessary reagents for in vitro synthesis of an RNA from a DNA template such as the Bluescript vectors.
  • RNA produced in vitro by a system such as this can then be translated in vitro to produce the desired protein.
  • cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art.
  • the nucleic acids of this invention can be introduced into the cells via any gene transfer mechanism, such as, for example, vims-mediated gene delivery, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes.
  • the transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into a subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.
  • nucleic acids of this invention can also be utilized for in vivo gene therapy techniques (US Patent No. 5,399,346).
  • the nucleic acid can comprise a nucleotide sequence which encodes a gene product which is meant to function in the place of a defective gene product and restore normal function to a cell which functioned abnormally due to the defective gene product.
  • the nucleic acid may encode a gene product which was not previously present in a cell or was not previously present in the cell at a therapeutic concentration, whereby the presence of the exogenous gene product or increased concentration of the exogenous gene product imparts a therapeutic benefit to the cell and/or to a subject.
  • the cells can be in a subject and the nucleic acid can be administered in a pharmaceutically acceptable carrier.
  • the subject can be any animal in which it is desirable to selectively express a nucleic acid in a cell.
  • the animal of the present invention is a human.
  • non-human animals which can be treated by the method of this invention can include, but are not limited to, cats, dogs, birds, horses, cows, goats, sheep, guinea pigs, hamsters, gerbils and rabbits, as well as any other animal in which selective expression of a nucleic acid in a cell can be carried out according to the methods described herein.
  • the nucleic acids of the present invention can be in the form of naked DNA or the nucleic acids can be in a vector for delivering the nucleic acids to the cells for expression of the nucleic acid inside the cell.
  • the vector can be a commercially available preparation, such as an adenovims vector (Quantum Biotechnologies, Inc. (Laval, Quebec, Canada). Delivery of the nucleic acid or vector to cells can be via a variety of mechanisms.
  • delivery can be via a liposome, using commercially available liposome preparations such as Lipofectin ® , Lipofectamine ® (GIBCO-BRL, Inc., Gaithersburg, MD), Superfect ® (Qiagen, Inc. Hilden, Germany) and Transfectam ® (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art.
  • the nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a Sonoporation machine (ImaRx Pharmaceutical Co ⁇ ., Arlington, AZ).
  • vector delivery can be via a viral system, such as a retroviral vector system which can package a recombinant retroviral genome.
  • the recombinant retrovirus can then be used to infect and thereby deliver nucleic acid to the infected cells.
  • the exact method of introducing the nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors.
  • Other techniques are widely available for this procedure including the use of adenoviral vectors, adeno-associated viral (AAV) vectors, lentiviral vectors, pseudotyped retroviral vectors, and pox vims vectors, such as vaccinia vims vectors.
  • Physical transduction techniques can also be used, such as liposome delivery and receptor-mediated and other endocytosis mechanism. This invention can be used in conjunction with any of these or other commonly used gene transfer methods.
  • nucleic acid and the nucleic acid delivery vehicles of this invention can be in a pharmaceutically acceptable earner for in vivo administration to a subject.
  • pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vehicle, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
  • the carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
  • the nucleic acid or vehicle may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extraco ⁇ oreally, topically or the like.
  • parenterally e.g., intravenously
  • intramuscular injection by intraperitoneal injection, transdermally, extraco ⁇ oreally, topically or the like.
  • the exact amount of the nucleic acid or vector required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity or mechanism of any disorder being treated, the particular nucleic acid or vehicle used, its mode of administration and the like.
  • the present invention further provides screening methods for identifying toxic, supertransactivating, and tox-suppressor mutations in human p53.
  • this invention provides a method of detecting a supertransactivating mutation in the human p53 gene comprising: a) obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; b) introducing into the yeast cell a nucleic acid which expresses a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to the human p53 coding sequence; c) plating the yeast cell of step b) on raffinose as the carbon source; and identifying colonies on plates, wherein colonies expressing wild type p53 yield red colonies and colonies expressing a supertransactivating mutation in p53 yield white or pink colonies.
  • the GAL 1 promoter can be GAL 1 or any other fragment or unit of the GALl -10 promoter.
  • plaque can also include replica plating.
  • the yeast strains of this invention can be incubated on plates containing a carbon source as well as in liquid culture containing a carbon source.
  • raffinose as a carbon source is meant that raffinose is the main carbon source, but the media, either in plates or in liquid culture could contain trace amounts of other carbon sources without significantly affecting the results obtained.
  • variable expression of p53 is achieved using the GALl promoter and by changing the carbon source in the medium.
  • the GALl promoter allows a basal level of expression when raffinose is used as a unique carbon source, because the glucose repression system is removed, but the promoter is not induced.
  • p53 levels are so low that the wildtype cannot activate transcription of the reporter gene (in this case ADE2) efficiently and the color of the colonies remains red.
  • p53 supertransactivating mutants that, either because of increased stability or stronger binding to the ribosomal gene cluster (RGC) sequence, perform transactivation more efficiently than wildtype , and can produce white yeast colonies and be easily identified on raffinose.
  • inducible promoter systems such as PHO5 and the glucocorticoid resposive element system in the methods of the invention
  • vectors for Expression of cloned genes in yeast regulation, ove ⁇ roduction and unde ⁇ roduction.
  • the methods of the present invention can be adapted to utilize any inducible promoter system in the presence of the appropriate inducer.
  • reporter genes that can be utilized include HIS3, LEU2, URA3 in yeast strains that are deficient for HIS3, LEU2 and URA3, respectively.
  • the screening can be performed by selecting colonies expressing p53 variants at very low levels of induction (under control of GALl and on raffinose medium) and looking for growth on plates lacking histidine, leucine, and uracil, respectively. The following methods are provided for detecting a supertransactivating mutation by utilizing different reporters.
  • a method of detecting a supertransactivating mutation in the human p53 gene comprising, obtaining a yeast cell comprising a HIS3 reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; introducing into the yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human 53 coding sequence; plating the yeast cell on raffinose as a carbon source; and raffinose plus a small amount of galactose in synthetic medium lacking histidine; identifying colonies on plates, wherein normal size colonies expressing a transactivating mutation in p53 grow on raffinose or on raffinose plus a small amount of galactose medium without histidine and wherein cells expressing wild type p53 do not grow or grow poorly.
  • Also provided is a method of detecting a supertransactivating mutation in the human p53 gene comprising: obtaining a yeast cell comprising a URA3 reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; introducing into the yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human 53 coding sequence; plating the yeast cell on raffinose as a carbon source; and raffinose plus a small amount of galactose in synthetic medium lacking uracil; identifying colonies on plates, wherein normal size colonies expressing a transactivating mutation in p53 grow on raffinose or on raffinose plus a small amount of galactose medium without uracil and wherein cells expressing wild type p53 do not grow or grow poorly.
  • a method of detecting a supertransactivating mutation in the human p53 gene comprising: obtaining a yeast cell comprising a LEU2 reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; introducing into the yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human 53 coding sequence; plating the yeast cell on raffinose as a carbon source; and raffinose plus a small amount of galactose in synthetic medium lacking leucine; identifying colonies on plates, wherein normal size colonies expressing a transactivating mutation in p53 grow on raffinose or on raffinose plus a small amount of galactose medium without leucine and wherein cells expressing wild type p53 do not grow or grow poorly.
  • mutants exhibiting altered sequence specificity can be isolated and analyzed. These mutants might possess a supertransactivating activity toward some p53 responsive elements and a defect in DNA recognition of other slightly different p53 responsive elements. Those alleles may be useful in functionally dissecting the p53 downstream pathway to understand the components that are most relevant in tumor suppression or for specific activation of genes such as apoptosis genes. These supertransactivating mutants could also be used in therapies that combine restoration of wildtype- like p53 activity and apoptosis to tumor cells along with chemotherapy. The ability to supertransactivate specific genes is particularly useful, since some genes are much more relevant to cell inactivation, such as apoptosis genes. The supertransactivating dominance can be used to counteract the dominant negative impact of various tumor mutations.
  • Determination of transactivation by supertransactivating p53 mutants at different expression levels and with different p53 responsive elements can be achieved by: obtaining a first yeast cell comprising a reporter gene, wherein the reporter gene is linked to a first DNA sequence to which human p53 binds; introducing into the first yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human p53 coding sequence; obtaining a second yeast cell comprising a reporter gene, wherein the reporter gene is linked to a second DNA sequence to which human p53 binds; introducing into the second yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human p53 coding sequence; plating the first and second yeast cell on each of glucose, raffinose, raffinose and galactose, and raffinose
  • the assay can be set up with more than two responsive elements.
  • an assay that compares the effects of a p53 mutant on 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more responsive elements can be performed utilizing the above method.
  • any p53 responsive element can be used in the present screening method.
  • the DNA sequences to which p53 binds can be the 3xRGC responsive element, the PIG3 responsive element, the p21 responsive element, the box responsive element or any other DNA sequence which p53 binds.
  • the yeast cells are plated on glucose, raffinose, raffinose and galactose, and raffinose and more galactose in order to measure transactivation under conditions of varying expression levels.
  • Expression levels are lowest in glucose, higher in raffinose and much higher in raffinose plus galactose.
  • raffinose and more galactose is meant a concentration of galactose that is higher than the concentration of raffinose and galactose.
  • the amount of galactose added to raffinose containing plates can be varied from trace amounts to 2.0% galactose in order to obtain variable amounts of p53 expression.
  • the yeast cells can be plated on glucose, glucose and raffinose, glucose and 0.003% galactose, and glucose and 0.015% galactose. In this example, 0.015% galactose is more than 0.003% galactose.
  • the yeast cells can be plated on glucose, glucose and raffinose, glucose and 0.005% galactose and glucose and 0.016% galactose.
  • a responsive element such as 3xRGC, PIG3, p21 or box.
  • This assay will allow one skilled in the art to determine if a particular p53 mutant is supertransactivating for one responsive element at lower expression levels and supertransactivating for another responsive element at higher expression levels. Also, this assay allows for the identification of mutants that are selective for a particular responsive element or subset of responsive elements. This screening assay can also be performed with other inducible promoter systems in order to determine selectivity of supertransactivators for p53 responsive elements.
  • the S 12 IF mutant is supertransactivating for the 3XRGC element, the PIG3 element and the box element at lower levels of expression as compared to wildtype, but not for the p21 responsive element.
  • one skilled in the art can select particular mutant p53s to target specific pathways based on their ability to transactivate a particular responsive element. For example, a mutant exhibiting increased or supertransactivation activity for the PIG3 pathway can be used to modulate that pathway and one exhibiting supertransactivation activity for the p21 pathway can be utilized to modulate the p21 pathway. Since the same supertransactivating mutation can transactivate one responsive element at low levels of expression and another responsive element at higher levels, one skilled in the art could target more than one responsive element with the same mutation by varying the amount of supertransactivator.
  • this screening method can also be accomplished by utilizing a yeast strain containing a regl-501 mutation. Therefore, this invention provides a method of determining transactivation by supertransactivating p53 mutants at different expression levels and with different p53 responsive elements by: obtaining a first regl-501 mutant yeast cell comprising a reporter gene, wherein the reporter gene is linked to a first DNA sequence to which human p53 binds; introducing into the first regl-501 mutant yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human p53 coding sequence; obtaining a second regl- 501 mutant yeast cell comprising a reporter gene, wherein the reporter gene is linked to a second DNA sequence to which human p53 binds; introducing into the second gr- 501 mutant yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible
  • a control can also be included wherein the reporter is linked to the 3XRGC element.
  • the yeast cells are plated on glucose and increasing concentrations of galactose in order to measure transactivation under conditions of varying expression levels.
  • This assay can be performed by plating the cells on glucose, glucose and a first concentration of galactose, glucose and a second selected concentration of galactose of galactose higher than the first concentration; glucose and a third selected concentration of galactose higher than the second concentration; glucose and a fourth selected concentration of galactose higher than the third concentration; glucose and a fifth selected concentration of galactose higher than the fourth concentration; glucose and a sixth selected concentration of galactose higher than the fifth concentration etc. such that the cells are plated on glucose and plates containing increasing concentrations of galactose.
  • the supertransactivators can be subdivided into those that affect growth when moderately expressed or alternatively have no apparent effect on growth (e.g. using ADH1 promoter) .
  • the present invention also provides evidence that the supertransactivators can act in a dominant fashion over previously identified dominant transactivation defective mutants. Therefore, the supertransactivator can lead to induction of a reporter gene even when it is in the presence of an induction defective p53 where the induction defective p53 would normally prevent induction by wildtype p53.
  • the following table illustrates the effects that a supertransactivating mutation under ADH 1 control, i.e. moderate expression can have:
  • the invention further provides a method of detecting a toxic mutation in the human p53 gene comprising: a) obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which a human p53 binds; b) introducing into the yeast cell a nucleic acid which expresses a human p53, the nucleic acid comprising an inducible GAL 1 promoter linked to a human p53 coding sequence; c) plating the yeast cell of step b) on each of glucose, raffinose or galactose and; d) identifying colonies on plates wherein colonies expressing wildtype p53 yield red colonies on glucose plates, red colonies on raffinose plates and white colonies on galactose plates, and wherein colonies expressing a toxic p53 yield red colonies on glucose plates, red colonies or white colonies or no colonies on raffinose plates and no colonies on galactose plates.
  • the toxic mutants may produce white or red colonies
  • toxic mutants can produce red colonies or white colonies or no colonies on raffinose plates.
  • the toxic mutations may produce white colonies on raffinose that are smaller than the white colonies produced by the wildtype p53 on raffinose.
  • the method for detecting a toxic mutation can be performed by plating the yeast cell of step b) described above on each of glucose or galactose. If a toxic mutation is present, no colonies will appear on the galactose plates.
  • the toxic p53 mutations can also be detected by utilizing other promoter systems such as an on-off promoter.
  • the present invention provides a method of detecting a toxic mutation in the human p53 gene comprising: introducing into the yeast cell a nucleic acid which encodes an unidentified human p53 in the cell, the nucleic acid comprising an on-off promoter linked to the human p53 coding sequence; b) incubating the yeast cell in synthetic yeast medium in the presence and absence of an inducer for the promoter; and c) identifying a toxic mutant, wherein yeast expressing wildtype p53 yield growth in the presence or absence of an inducer for the promoter, and wherein yeast expressing a toxic mutation in p53 yields growth in the presence of an inducer for the promoter.
  • an on-off promoter than can be used to detect the toxic mutation include the CUPl on-off promoter where the induction level is 50-100 fold and the promoter is induced by addition of copper in the medium. If the CUPl promoter is used, copper acts as the inducer of the promoter linked to the human p53 coding sequence. Similary, any inducible promoter and inducer of the promoter can be utilized in the methods of the present invention.
  • the present invention further provides a method of detecting a toxic suppressor mutation in the human p53 gene wherein a toxic mutation is detected by the method described above and further comprising introducing into a yeast a second nucleic acid, wherein the second nucleic acid expresses a mutant p53, the second nucleic acid comprising a promoter operably linked to a human p53 coding sequence. If the mutation in the second nucleic acid reverses the toxic phenotype, the second nucleic acid contains a toxic suppressor mutation.
  • a second mutation can be introduced into the nucleic acid containing the toxic mutation detected. This nucleic acid containing both mutations can then be introduced into the yeast cell. If the second mutation in the nucleic acid containing the toxic mutation reverses the toxic phenotype, the second mutation is a toxic suppressor mutation.
  • the present invention further provides a method of detecting a dominant mutation in the human p53 gene wherein a mutation in p53 is detected and further comprising introducing into the yeast cell a second nucleic acid, the second nucleic acid comprising a promoter operably linked to a wildtype human p53 coding sequence, wherein the second nucleic acid expresses wild-type human p53 in the cell, whereby the mutation is determined to be dominant or recessive. If the phenotype observed is that of the mutation, the mutation is determined to be a dominant mutation.
  • the present approach provides for direct isolation of p53 variants that can overcome the dominant negative effect on transactivation of the main p53 tumor hotspots. This could be achieved by transforming a strain already expressing a p53 dominant mutant with randomly generated p53 variants and selecting for a wild type phenotype at low level of p53 expression. This would be very useful in the development of p53 alleles to counteract dominant p53 mutations.
  • the screening methods of the present invention can also be accomplished by utilizing a yeast strain containing a regl-501 mutation (Hovland et al).
  • This mutation is defective in glucose repression of the GAL promoter so that strains can be grown in standard amounts of glucose and approximately linear increases in the levels of induction are accomplished by adding increasing amounts of galactose.
  • This mutation has been used to control expression levels in yeast of a variety of genes including a heterologous EcoRI endonuclease (Lewis et al.).
  • the Lewis et al. reference is inco ⁇ orated herein in its entirety.
  • the invention provides a method of detecting a supertransactivating mutation in the human p53 gene comprising: obtaining a regl-501 mutant yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; introducing into the yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human p53 coding sequence; plating the yeast cell on glucose and glucose and increasing concentrations of galactose; identifying colonies on plates, wherein colonies expressing supertransactivating mutation in p53 yield white or pink colonies.
  • This assay can be performed by separately plating the cells on glucose, glucose and a first selected concentration of galactose, glucose and a second selected concentration of galactose of galactose higher than the first concentration; glucose and a third selected concentration of galactose higher than the second concentration; glucose and a fourth selected concentration of galactose higher than the third concentration; glucose and a fifth selected concentration of galactose higher than the fourth concentration; glucose and a sixth selected concentration of galactose higher than the fifth concentration etc. such that the cells are plated on glucose and plates containing glucose plus increasing concentrations of galactose.
  • Also provided by this invention is a method of detecting a toxic mutation in the human p53 gene comprising: obtaining a regl-501 mutant yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds; introducing into the yeast cell a nucleic acid which encodes an unidentified human p53 in the cell, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human p53 coding sequence; plating the yeast cell on each of glucose, or glucose and selected concentrations of galactose; identifying colonies on plates, wherein colonies expressing wild type p53 yield red colonies on glucose, red colonies on glucose and selected concentrations of galactose and white colonies on glucose and higher concentrations of galactose, and wherein colonies expressing a toxic mutation in p53 yield red colonies on glucose, red colonies or white colonies or no colonies on glucose and selected concentrations of galactose, and no colonies on glucose and higher concentrations of galactose.
  • increases in levels of p53 induction can be controlled by adding increasing concentrations of galactose.
  • One skilled in the art can perform the above-mentioned screening assay by plating the cells on glucose and glucose and selected concentrations of galactose.
  • the selected concentrations can be increasing concentrations of galactose.
  • the skilled artisan can vary the concentration of galactose, as necessary, to observe the toxic mutation.
  • the cells can be plated on glucose, glucose and a selected concentration of galactose, and glucose and higher concentrations of galactose.
  • the skilled artisan can observe the gradual progression of the toxic phenotype, by observing red colonies on glucose, red or white colonies glucose and galactose, and no colonies on glucose and higher concentrations of galactose.
  • the selected concentration can be varied until the skilled artisan discerns which concentration of galactose is sufficient to produce enough p53 such that cell growth can be observed without killing the cells.
  • This assay can be performed by plating the cells on glucose, glucose and a first concentration of galactose, glucose and a second selected concentration of galactose of galactose higher than the first concentration; glucose and a third selected concentration of galactose higher than the second concentration; glucose and a fourth selected concentration of galactose higher than the third concentration; glucose and a fifth selected concentration of galactose higher than the fourth concentration; glucose and a sixth selected concentration of galactose higher than the fifth concentration etc. such that the cells are plated on glucose and glucose plates plus increasing concentrations of galactose.
  • the invention also provides for the recognition of p53 mutants with reduced transactivation capability, which are referred to as weak p53 mutants, as opposed to normal, suprtransactiviating mutants or nonfunctional mutants.
  • p53 mutants with reduced transactivation capability which are referred to as weak p53 mutants, as opposed to normal, suprtransactiviating mutants or nonfunctional mutants.
  • a mutation P250L exhibits low transactivation for promoter 3xRGC and very little transactivation for a B AX promoter when this mutant is expressed at high constitutive levels from an ADHI promoter.
  • this mutant can be screened for weak transactivating activity by obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds, introducing into the yeast cell a nucleic acid which encodes a human p53, the nucleic acid comprising an constitutive promoter, such as ADHI linked to a human p53 coding sequence, plating the yeast cell on glucose, and identifying colonies on plates, wherein colonies expressing weak transactivating mutations result in pink colonies when compared to wildtype p53 which produces white colonies under ADHI constitutive expression.
  • the weak mutations may result in white colonies if expression is higher.
  • the higher level of p53 expression can also be accomplished using the GALl promoter and high levels of galactose induction.
  • the GALl promoter can be used such that when induced in the presence of increasing concentrations of galactose, a weak transactivator can be identified because it is unable to transactivate even at high concentrations of galactose, i.e. on glucose plates containing a high concentration of galactose which induce high levels of expression.
  • the DNA sequence to which p53 binds can be 3xRGC, p21, bax or any other sequence to which p53 binds.
  • constitutive promoters that can be utilized in the methods of the present invention are also contemplated. These include PGK and the high level GPD system (Vectors for constitutive and inducible gene expression in yeast. Mark Schena, Didier Picard and Keith R. Yamamoto in Guide to Yeast Genetics and Molecular Biology; Methods in Enzymology Edited by Christine Guthrie and Gerald R. Fink; Volume 194 pp 378 -398). Any constitutive promoter can be adapted for use in the methods of the present invention.
  • the present invention further provides a method of screening for compounds that can mimic a toxic p53 by: obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds, introducing into the yeast cell a nucleic acid which encodes a non-toxic mutant or wildtype human p53, the nucleic acid comprising an inducible promoter comprising GAL 1 linked to a human p53 coding sequence, introducing the compound to the yeast cell, plating the yeast cell on each of glucose, raffinose, or galactose, and identifying a compound that mimics a toxic mutation, preventing growth of colonies expressing wildtype or non-toxic mutant p53 to yield red colonies on glucose, red colonies or white colonies or no colonies on raffinose, and no colonies on galactose.
  • a compound that mimics a toxic mutation can be identified by plating the yeast cell on each of glucose and galactose, wherein a compound that mimics a toxic mutation will result in no growth of colonies in galactose and cells without p53 can grow on galactose.
  • the detection of compounds that mimic a toxic mutation can also be accomplished through the use of on-off promoter.
  • An example of this would be a method of screening for compounds that can mimic a toxic p53 mutation comprising: a) introducing into the yeast cell a nucleic acid which encodes a non-toxic mutant or wildtype human p53 in the cell, the nucleic acid comprising an on-off promoter linked to a non-toxic mutant or wildtype human p53 coding sequence; b) introducing the compound to the yeast cell; c) incubating the yeast cell in artificial yeast medium iii the presence and absence of an inducer for the promoter; and d) identifying a compound that mimics a toxic mutation, thereby preventing growth of yeast in the presence of an inducer for the promoter.
  • a suitable on-off promoter would be the CUPl promoter which is inducible in the presence of copper. Any inducible promoter can be utilized with the methods of the present invention.
  • the present invention also provides a method for screening a compound that can mimic a supertransactivating mutation in the human p53 gene comprising: obtaining a yeast cell comprising a reporter gene, wherein the reporter gene is linked to a DNA sequence to which human p53 binds, introducing into the yeast cell a nucleic acid which encodes a wildtype or mutant human p53, the nucleic acid comprising an inducible GAL 1 promoter linked to a human non-supertransactivating mutant or wildtype p53 coding sequence, plating the yeast cell and compound on raffinose, and identifying a compound that mimics a supertransactivating mutation in p53 to yield white or pink colonies, wherein the compound has no effect in the absence of p53.
  • the yeast cells of this invention can be obtained by generating the yeast strain, purchasing the yeast strain or receiving the yeast strain form any other source.
  • the nucleic acid which encodes human p53 can be introduced by targeted integration into a yeast chromosome or alternatively via methods such as plasmid transformation that results in expression of nucleic acids.
  • the reporter gene of this invention can be stably integrated into the genome of the cell or alternatively, the reporter gene can be introduced via a plasmid that does not contain sequences for stable integration of the reporter gene and results in expression of the reporter gene.
  • yeast two hybrid assays can be utilized. These procedures employ commercially available kits (e.g., Matchmaker* from Clontech, Palo Alto, CA) and involve fusing the "bait” (in this example, all or part of a mutant p53 nucleic acid ) to a DNA binding protein, such as GAL4, and fusing the "target” (e.g. a cDNA library) to an activating protein, such as the activation element domain of VP-16. Both constmcts are then transformed into yeast cells containing a selectable marker gene under the control of, in this example, a GAL4 binding element.
  • a DNA binding protein such as GAL4
  • target e.g. a cDNA library
  • the cDNA of the target constmct is isolated from positive clones and conventional methods used to isolate the cDNA encoding the protein or protein fragment that interacts with the GAL4-bait constmct.
  • the invention also provides a method of inducing toxicity in a cell by administering to the cell a human p53 that contains a toxic mutation or a supertransactivating mutation to the cell.
  • the human p53 that contains a toxic mutation to the cell can be selected from the group consisting of VI 22 A, V274I, C277W, C277R, F338L, V157I, or G279R.
  • the human p53 that contains a toxic mutation to the cell can also be a mutant p53 that contains the mutation V122A and the mutation A76T or a mutant p53 that contains the mutation W91C, the mutation C124R, the mutation Q136K, the mutation T150A and the mutation T150A or a mutant p53 that contains the mutation C124R, the mutation Q136K and the mutation T150A.
  • the human p53 that contains a supertransactivating mutation can be selected from the goup consisting of S96P, H115R, S121C, S121F, T123A, C124Y, C124F, Q167R, E171K, H178Y, S183L, D184Y, T231I, P191L, S240N, SI 16T, N288K, F338L, S215T, T123S, N345S, D184G, E198V, T230I, V274A, W91R, H115R, S96P, S116T, N228K, T118A, T123P, L137R, A159T, M160T, II 62V, D184G, N210S, S215T, T230I, I232V, N239Y, N268S, E285A, C124R, Q136K, T150A, A76T.
  • the invention also provides a method of inducing toxicity in a cell by introducing into the cell a nucleic acid that encodes the toxic mutant p53 linked to a promoter, whereby the toxic mutant p53 is expressed in the cell and causes growth inhibition or cell death.
  • the invention further provides a method of inhibiting growth or inducing toxicity in a cell by introducing into the cell a nucleic acid that encodes the supertransactivating mutant p53 linked to a promoter, whereby the supertransactivating mutant p53 is expressed in the cell and causes cell death or prevent growth.
  • the nucleic acids encoding the toxic mutants or supertransactivating mutants that prevent growth at high expression can comprise a nucleic acid that encodes a mutation selected from the group consisting of: V122A, V274I, C277W, C277R, F338L, V157I, W91C, C124R, Q136K, T150A, or G279R.
  • the nucleic acid that encodes the toxic mutants can comprise a nucleic acid that encodes the mutation VI 22 A and the mutation A76T or a nucleic acid that encodes the mutation W191C, the mutation C124R, the mutation Q136K and the mutation T150A or a nucleic acid that encodes the mutation C124R, the mutation Q136K and the mutation T150A.
  • the nucleic acids encoding the supertransactivating mutants can comprise a nucleic acid that encodes a mutation selected from the group consisting of: S96P, H115R, S121C, S121F, T123A, C124Y, C124F, Q167R, E171K, H178Y, S183L, D184Y, T231I, P191L, S240N, S116T, N288K, F338L, S215T, T123S, N345S, D184G, E198V, T230I, V274A, W91R, H115R, S96P, S116T, N228K, T118A, T123P, L137R, A159T, M160T, I162V, D184G, N210S, S215T, T230I, I232V, N239Y, N268S, E285A, C124R, Q136K, T150A, A76T.
  • the toxic or the supertransactivating mutations can be used to overcome known tumor mutations or known dominant negative mutations.
  • the toxic or supertransactivating mutations can be used to overcome a mutation present in a cancer patient or a mutation that causes cancer and thereby lead to growth inhibition or lethality of the cancer cells.
  • the nucleic acids of this invention can be utilized in in vivo gene therapy techniques.
  • the nucleic acids encoding the toxic mutants can be delivered to cells via viral delivery systems, non- viral delivery systems, as naked DNA or liposomes.
  • viral delivery include retroviral delivery in which viral vectors integrate stably into the genome of the infected cells and require cell division for transduction. Retroviral vectors are used in the majority of approved gene transfer clinical protocols (Roth and Cristiano, 1997 J. Natl. Cancer Inst, 89:21-39).
  • adenoviral delivery method (Roth and Cristiano), based on adenovims type 5.
  • adenovims type 5 adenovims type 5
  • other adeno vimses can be utilized such as AAV1, AAV2, AAV3, AAV4, and AAV6.
  • Adenovimses are capable of high efficiency transduction of a wide range of cells types and are not limited to actively proliferating cells. Since adenovimses do not integrate into the genome of the host cell, they are transient expression vectors and therefore do not carry the same risk to causing insertional mutagenesis as in retroviral transduction.
  • HSV he ⁇ es simplex vims
  • Non- viral delivery methods include direct DNA injection and cationic lipid mediated gene transfer.
  • Phase I clinical trials have employed direct percutaneous intratumour injection of DNA, more specifically, naked (i.e. without viral or synthetic vector) wildtype p53 into patients having either primary or secondary liver tumors (Habib et al. 1996 Cancer Detection and Prevention 20:103-107; Flicker J. 1996 Molec. Med. Today 2: 361; Habib NA. 1997 4: 329-330).
  • Cationic lipid mediated delivery involves the use of cationic liposomes complexed with plasmid DNA carrying the transgene of interest which can be efficiently endocytosed by mammalian cells.
  • Cationic delivery is relatively non-toxic and perhaps non-immunogenic which would allow multiple administrations of the mutant p53s, which may be necessary in the treatment of metastatic tumours.
  • Studies in which liposome-p53 complexes were directly injected into human breast tumors grown on nude mice caused not only regression of the primary tumour but also prevention of tumour relapse and metastasis (Nu et al. 1997 Human Gene Therapy 8: 177-185).
  • the present invention further provides a method of inducing toxicity in a cell by administering a toxic human p53, or a nucleic acid encoding a toxic p53 further comprising administering an anticancer therapy.
  • Anti-cancer therapy can include surgery, chemotherapy, radiotherapy, immunotherapy or any combination thereof.
  • chemotherapeutic agents include cisplatin, 5- fluorouracil and S-l.
  • Immunotherapeutics methods include administration of interleukin-2 and interferon- .
  • ura3-l URA3 3xRGC::CYCl ::ADE2 was originally constmcted to assess p53 transactivation by Richard Iggo (Flaman et al).
  • the strain contains an integrated copy 0 ADE2 under control of a minimal CYC1 promoter. 3 copies of the human p53 responsive DNA element found at the ribosomal gene cluster (RGC) are inserted in the upstream region of the promoter.
  • RRC ribosomal gene cluster
  • Colonies expressing wild type p53 grow like adenine prototrophs yielding white colonies on plates containing a limiting amount of adenine while small red colonies appear when a nonfunctional p53 is expressed.
  • Strains T334 (Sclafani) and SI (Tran et al.,) were used in some experiments to test the effect of p53 on growth and to obtained diploids by crossing them with yIG397 derivatives.
  • YPH-p21 MATaura3-52 lys 2-801 ade2-101 trpl- ⁇ 63 his3- A 200 leu2- A 1 URA3 p21::pCYCl::ADE2
  • p21 p53 binding site is a 20mer sequence found 2.4 kb upstream of the p21 promoter
  • YPH-bax MAT a ura3-52 lys2-801 ade2-101 trpl-A 63 his3- ⁇ 200 Ieu2-A 1 URA3 bax::pCYCl::ADE2
  • bax p53 binding site is a 39mer sequence found 486-448 bp upstream of the bax promoter
  • Plasmid pLS76 encodes the complete human p53 cDNA under the control of the constitutive ADHI promoter.
  • the plasmid is based on pRS315 (LEU2).
  • pLS89 is a yeast expression vector coding for the p53 cDNA under control of the strong inducible GALl promoter.
  • Plasmid pRDI22- identical to pLS76 except for the BsmI::StuI deletion at p53- and pLS89 (after BsmI::StuI digestion and gel purification) were used for gap repair cloning, as previously described (Flaman et al). Briefly, PCR amplifications of a p53 cDNA fragment between positions 124 and 1122 were co- transformed in yIG397 together with the linear gapped plasmid. Since both ends of the PCR product and of the linear plasmid overlaps (75 and 80bp, respectively at the 5' and the 3') in vivo homologous recombination can reconstitute the complete p53 cDNA and a circular expression vector.
  • Plasmids pCMV-Neo-Bam and pC53-SN3 (Baker et al., (1990) "Suppression of human colorectal carcinoma cell growth by wild type p53". Science 249: 912-915) coding for the human p53 cDNA under CMV promoter were used for expression studies in mammalian cells. Specific mutant p53s were constmcted replacing the Sgral- Stul p53 portion with the same fragment of pLS89 derivatives.
  • the plasmid PG13 contains 13 copies of a p53 responsive element that allow the p53 transcriptional control of the luciferase gene.
  • the plasmid MG15 is a control vector with mutated copies of the p53 binding site (Kem et al.,). PG13 and MG15 were used to test p53 transactivation in mammalian cells. Plasmids pGL1012 and 1138 contain respectively the bax responsive element and a 2.4kb region from the p21 promoter and the luciferase gene.
  • Yeast strains were cultured in (1% yeast extract, 2% peptone, 2% dextrose (YPD) or with the addition of 200mg/l adenine (YPD A) or on selective medium when appropriate.
  • p53 transactivation was generally determined in synthetic medium containing 5mg/l of adenine. Growth inhibition was analyzed in plates containing galactose at 2% as a carbon source (YPGAL). To determine the transcriptional potential of the p53 toxic allele, plates containing raffinose at 2% (Sigma) as a carbon source and variable low amount of galactose were used. In the presence of raffinose the GALl promoter is derepressed and can be induced by galactose addition. Random mutagenesis experiments, PCR integration in yeast, DNA recovery and analysis
  • Plasmid pLS89 was used as a template for PCR reactions using the TAQ Long Plus polymerase mix (Stratagene) under optimal reaction conditions. Universal primers pRSa and pRSc were used to generate a 5 kb fragment that included the sequence for the p53 cDNA, its GALl promoter and the yeast selection marker TRP1. The primers also had 50 bp tails conesponding to LYS2 sequence to allow specific chromosomal integration of the fragment. PCR reactions were purified by precipitation and used to transform yIG397 competent cells by the LiAc protocol. Transformants were selected on synthetic medium lacking tryptophan and tested for lysine auxotrophy. Purified TRPl-lys2 clones were then tested on galactose plates with low adenine to test p53 dependent growth inhibition and transactivation.
  • Genomic DNA was prepared by standard methods and the p53 fragment between 124 and 1122 was PCR amplified, cloned using gap repair in pLS89 to confirm the phenotype in yeast, and sequenced using an ABI373 automated sequencer.
  • Precast SDS-PAGE gels (PAGE-ONE, Owl Separation Systems) were used for electrophoresis. Proteins were transfened to PVDF membrane (Immobilon-P, Millipore) using a semi-dry electroblotter (Owl Separation Systems) according to instmctions. p53 was detected by using both pAbl801 and DO-1 monoclonal antibodies (Santa Cmz) at 1 :2000 dilution. Immunodetection was performed using the ECL kit (Amersham) according to protocol. Transfections in Saos-2 cells, luciferase assays and western blots
  • the osteosarcoma derived p53 null cell line SAOS-2 was used for p53 expression experiments.
  • Cells were cultured in McCoy's 5A medium with 15% FBS semm (GIBCO).
  • T25 cm 2 cell cultures flasks were seeded and transfected at 60% confluence by lipofectin reagent (GIBCO).
  • GIBCO lipofectin reagent
  • 1.5 g of purified plasmid DNA was used.
  • Selection by G418 (GIBCO) at 0.5 mg/ml was applied after one day of recovery in complete medium following removal of lipofectin. Colonies were stained after 2-3 weeks.
  • V p53 transactivation assays in transient transfections were done using 50 to 100 ng of p53 expression plasmid and 1.5 g of PG13 or MG15. Cells were recovered, lysed and protein extracts were quantified. Luciferase activity was measured by scintillation counting using the single photon monitor program using the Luciferase Assay System (Promega). The same or similarly obtained protein extracts were used for Western blot analysis. p21 was detected using c-19 monoclonal antibody (Santa Cmz). -tubulin was used as an internal loading and transfer control and detected by a monoclonal antibody (Sigma)
  • p53 in yeast can result in reduced growth when highly expressed.
  • This invention sought to identify p53 mutants that could enhance this phenotype, even under conditions of reduced expression. To do this, p53 mutants were generated using mutagenic PCR methods.
  • the complete human p53 cDNA was amplified along with a GALl promoter and yeast DNA regions that would allow for targeted integration into a yeast chromosome.
  • the p53 fragment was integrated into a chromosome (at the LYS2 locus) rather than being recovered on a plasmid because overexpression of p53 leads to plasmid loss. Conditions in which approximately 15% of the recovered p53 genes would exhibit reduced transactivation (i.e. less than an average of one detectable mutation per gene) were used.
  • Gap repair into yIG397 cells was then used to reconstitute GALl p53 expression plasmids containing the PCR sequence. Transformants were selected on glucose. No growth was observed on galactose plates after 5 days, whereas cells with wild type p53 on a plasmid did exhibit growth. Thus it was concluded that the p53 fragment amplified by PCR was responsible for the no- growth phenotype. However, when examined under the microscope cells underwent a small number of divisions on galactose compared to the original isolate and gave rise to hregular microcolonies containing approximately 50-100 cells. This phenotype was likely due to plasmid instability and possibly cross-feeding.
  • the toxic mutation p53-19 lacks transactivation
  • expression of p53 was greatly reduced in order to prevent lethality.
  • Cells were grown on plates containing 2% raffinose as a carbon source and a small amount of galactose (0.006%) and 0.015%) and limiting adenine. This would allow for growth and provide the opportunity to detect possible transactivation function, based on the color of the colonies that would arise.
  • the wild type p53 of yIRp53-5 clone led to transcription of the ADE2 reporter gene as evidenced by the appearance of white colonies. Only red colonies were observed with yIRp53-19.
  • p53- 19 alters the transactivation ability of p53 at a promoter containing a ribosomal gene cluster (RGC) responsive element.
  • RRC ribosomal gene cluster
  • DNA sequencing of the region from nucleotide 124 to 1122 of p53-19 revealed two base pair substitutions, a T to C at position 365 and an A to G at position 887 resulting in the following amino acid changes: VI 22 A and H296R.
  • the conesponding regions were PCR amplified and cloned by gap repair into a GALl expression plasmid (see above). When cells were incubated on galactose, expression of the H296R mutant resulted in reduced growth as found for expressed wild type p53.
  • the p53-V122A mutant totally prevented growth, similar to the phenotype of the original isolate.
  • the effect of p53-V122A expression was tested in three different strain backgrounds (one was protease deficient) and comparable results were obtained.
  • Transformation by this plasmid resulted in only microcolonies containing less than 50 cells, many of which were enlarged, after 4-5 days. The ability to undergo transformation was not affected since the frequency of these microcolonies was comparable to the frequency of normal colonies obtained with a control plasmid. Thus,-fhe p53-V122A mutant is toxic in yeast even under moderate expression.
  • the p53 VI 22 A toxic mutation is dominant over wild type p53.
  • Second site DNA binding mutations can relieve VI 22 A toxicity
  • Second site mutations were introduced into the p53 V122A allele in order to examine the importance of DNA binding and transactivation on its toxic impact.
  • the double mutants were cloned into the high expression GALl plasmid or the moderate expression ADHI plasmid.
  • a double mutation formed with the Q331Stop mutation resulted in alleviation of much of the growth defect when expression was from the GALl promoter.
  • All the double mutants formed between VI 22 A and P177H, M246L, E258K, G279E, R282Q reduced the toxic effect of V122A when expressed from the GALl promoter (Table 2). There was no inhibition with the reduced expression from the ADHI promoter.
  • the search for toxic p53 mutants was expanded by cloning PCR products conesponding to the p53 cDNA region between nucleotides 124 and 1122 (amino acid 42 to 374) into a centromere plasmid using gap repair.
  • 5 isolates were identified that exhibited a "no-growth" phenotype when highly expressed from the GALl promoter and these are presented in Table 3.
  • Clones 2 and 3 contamed the VI 22 A mutation.
  • the mutant clone 4 contained two mutations, one at codon 274 and the other at 277. Even though p53 missense mutations have been found in vivo at both codons, the V274I amino acid change appears only twice in the p53 tumor database and C277W is novel.
  • Mutant clone 5 also contained two base pair substitutions resulting in amino acid changes at codon 277 in the DNA binding domain (C277R) and codon 338 in the tetramerization domain (F338L).
  • transformants with GALl expression plasmids were plated on selective media containing low adenine and raffinose as unique carbon source or raffinose and variable amount of galactose (Fig. 4).
  • Glucose plates with low adenine and raffinose plates without adenine were used to check that transactivation actually reflected protein expression and that white/pink colonies were phenotypically adenine prototrophs.
  • mutants were considered supertrans for p21, since there was no activation by wild type p53 at the same low expression.
  • p53-G279R can also activate transcription but at higher level of protein expression (raffinose + 0.003%) galactose) and is not distinguishable from wild-type p53. At much higher levels of expression (> 0.5% galactose) growth was completely suppressed by all the toxic mutants.
  • the toxic mutants were also examined for their ability to transactivate the bax::ADE2 reporter . Unlike ⁇ or p21, none of the mutants exhibited activation O ADE2 under conditions of low expression (on raffinose only). However, in the presence of a small amount of galactose (0.003%) the p53-V122A mutant gave rise to light pink colonies, while the wild type as well as the other mutants only gave rise to red colonies. At a much higher level of expression the wild type p53 yielded white colonies.
  • the present invention shows that subtle differences in transactivation capabilities between the various toxic mutants can be characterized using three different p53 responsive elements (RGC,p21 and bax) and variable expression of p53. While toxic at high levels of expression, the p53 alleles exhibit promoter selectivity and enhanced transactivation for some p53 responsive elements. It also appears that the difference in relative DNA binding affinity of wild type p53 for the bax andp21 responsive elements observed in vitro (Wieczorek et al.) and with human cells (Ludwig et al.; Thombonow et al.) is recapitulated in this yeast system using conditions of low protein expression. Intragenic suppression of p53 tumor mutants for p21 and bax transactivation by p53-V122A
  • the wild type p53 led to considerable induction of p21.
  • the p53-V122A mutant exhibited much less induction.
  • the G279E mutant alone resulted in almost no induction of p21 and a similar result was obtained with the V122A::G279E mutant. It should be pointed out that this double mutant led to high growth suppression as noted above (see Fig. 5 and Table 5).
  • the p53-V122A mutant differs considerably from the wild type protein in ability to induce the p21 target gene.
  • V122A is at least partially defective in transcriptional activation in Saos-2 cells and that it suppresses cellular growth on its own, or in double mutants, in a p21 independent fashion.
  • the transactivation potential of p53-V122A was also tested using plasmid-based luciferase reporter assays. Saos-2 cells were co-transfected with both the luciferase reporters and the p53 expression plasmids and protein extracts were prepared 24 hours after transfection.
  • p53-V122A When tested with the p21 promoter, p53-V122A exhibited a wild type activity and the double mutant p53-V122A::G279E was not re-activated (Fig. 7, panel A). However, p53-V122A induced luciferase at a higher level compared to wild type p53 with the bax responsive element (Fig. 7, panel B). This effect is not due to a difference in p53 expression, as the western blots showed similar or somewhat reduced p53 protein for the V122A allele. Su ⁇ risingly, p53-V122A was as effective as wild type p53 in inducing luciferase activity with PG13 (13xRGC-RE::luc) (Fig. 7, panel C).
  • p53-G279E was inactive in this assay
  • p53-V122A::G279E was active.
  • p53-V122A and the double mutant with G279E were as active as wild type when tested with a MDM2:: luciferase reporter system.
  • Yeast has proven to be a useful system for the functional evaluation of wild type p53 and various p53 mutants from tumor cells.
  • the use of reporter systems in yeast that utilize promoter elements from human genes recognized by p53 has enabled the dissection of functional domains of p53 (i.e., transactivation and DNA binding).
  • this level of expression would likely prevent growth of a toxic p53 mutant.
  • Even the modest level of expression with the constitutive ADHI promoter prevented cell growth, which explains why this p53 class of mutants had not been isolated previously.
  • the GALl promoter has proven ideal since its level of expression can be varied by the sugar supplement used for growth. This feature is also used herein to characterize novel p53 mutants that are super inducers of transcription:
  • the expressed protein is normally stable in yeast and human cells based on Western blot analysis.
  • the consequences of co-expression of the VI 22 A mutant protein together with various p53 functional mutations in yeast indicates that it can interact with wild type and mutant p53's.
  • the VI 22 A mutant has a strong dominant effect on growth when co-expressed with wild type p53, but much less of an effect in the presence of DNA binding mutations.
  • a double mutant that isV122A and lacks the tetramerization domain is not toxic. Double mutants that have altered amino acids at sites involved in DNA contacts or conect folding also reduced the lethal impact of VI 22 A.
  • the p53-V122A mutant is completely defective in transcription in the RGC yeast reporter system that was used. This was shown under conditions of low levels of transcription and with double-mutants where growth was not completely abolished. Since the reporter system utilized an RGC binding site, which has a lower binding affinity than promoter elements such as p21, it is possible that the VI 22 A mutation leads to altered specificity. If there was simply reduced binding ability, then it is unlikely that the mutant would have a greater than wild type p53 impact on growth. A mutant, S121F, had been described near this position; however, it exhibited only a subtle change in sequence specificity (Freeman et al.).
  • p53-V122A activated transcription o ⁇ bax::ADE2 andp21::ADE2 at very low level of expression unlike wild type p53.
  • p53-G279R did not show enhanced transactivation with any of the promoter elements tested, but showed normal transactivation withp21::ADE2 and it clearly caused toxicity at moderate or high expression.
  • This mutant may possess high DNA binding affinity for a different p53 responsive element.
  • a p53 variant with enhanced transactivation may be able to intragenically suppress non- functional mutations elsewhere in the DNA binding domain.
  • the extent of suppression is also likely to be affected by the relative affinity of p53 for a given responsive element and the degree of perturbation introduced by the non-functional mutation.
  • p53-V122A was indeed able to re-activate a number of non functional tumor mutants ⁇ orp21::ADE2 (see Table 6). Only two mutations were partially or completely re-activated for b ⁇ x::ADE2 transactivation, and as expected no double mutant was active with RGC::ADE2 (see Tablel).
  • the present invention shows that the selection for toxic variants of p53 in yeast allows easy isolation of p53 mutants that exhibit relevant altered functional properties.
  • the p53 functional assay in yeast has repeatedly been demonstrated reliable and sensitive at characterizing inactivating mutations isolated from human tumors.
  • the predictability of the yeast assays on the impact of subtle or enhanced function mutations in human cells needed to be evaluated.
  • the V122A single mutant was not distinguishable from wild type p53 in terms of ability to prevent colony formation of the human Saos-2 cells. It is interesting that, similar to results in yeast, this mutation when combined with G279E as a double mutation resulted in decreased colony forming ability compared to G279E alone.
  • the p53-V122A protein retained some ability to induce synthesis of p21 as compared to wild type p53, while the V122A::G279E double mutant exhibited almost no p21 induction.
  • the double mutant V122A::R282Q also had decreased synthesis of p21, whereas there was a near normal level when R282Q was expressed.
  • Table 5 The effect of p53- VI 22 A expression both in yeast and in human cells is summarized in Table 5.
  • p53-V122A did not show higher induction of endogenous p21 compared to wild type p53 in the Saos-2 cells and did not completely re-activate p53-G279E. However, the double mutant showed some induction of p21at 48 hours after transfection. Luciferase assays with ap21 responsive element confirmed the western blot results in that no enhanced activity for p53-V122A was observed.
  • the p21 reporter system in yeast and mammalian cells differed in that mammalian cells contained a large fragment of the p21 promoter that includes two different p53 responsive elements and can also be regulated in a p53 independent way. The yeast system instead utilizes only the 5' p21 responsive element. The affinity of p53 for these two responsive elements is different (Thornbonow et al.) and the relative contribution of each to p21 expression is not well characterized.
  • p53-V122A retained full transactivation activity with the 13xRGC::luc and re-activated the G279E mutation. No such effect was seen in yeast with a 3xRGC::ADE2. This difference may be explained by the different copy number of p53 responsive element and by the high copy number of the mammalian reporter plasmid. The reporter system in yeast is integrated as a single copy in the genome. p53- V122A showed about 4 fold higher luciferase activity than wild type p53 for the b ⁇ xr.luc reporter system. The level of p53 proteins in the same extract was similar. p53-V122A did not reactivate the G279E mutation for baxr. luc.
  • Position VI 22 is invariant among p53 protein sequences analyzed from 20 different species (Soussi and May). Based on the crystal stmcture of the p53 DNA binding domain from (Cho et al), it is contained within the large LI loop. Residue 120 in this loop provides an essential contact with DNA. While residues in this region of the protein are highly conserved, few human tumor-associated p53 mutants are found in this region. This is su ⁇ rising, since there is generally a strong conelation between sequence conservation and the incidence of p53 alterations in tumors(Walker et al.).
  • V122A tumor mutations have been identified (based on a search of the p53 database, containing more than 10.000 entries, Hainaut at al.,), although a single V122L mutant has been reported. However, it has been possible to generate p53 variants in the LI loop that are functionally altered.
  • G279 are invariant among p53 protein sequences. Cysteine 277 directly contacts the DNA sequence in the major groove based on p53/DNA crystal stmcture (Cho et al.), and amino acid changes at this codon exhibit altered DNA binding specificity (Gagnebin et al.; Thukral et al.; and Sailer et al.). Neither C277R nor C277W changes have been identified in tumors. A p53 mutant with a C277R alteration was shown recently to activate transcription o ⁇ p21 and MDM2 when expressed transiently in mammalian cells; however, its impact on growth was not reported.
  • the mutant exhibited a defect in transactivation from specific synthetic p53 responsive elements and had a defect in apoptosis induction in Saos-2 cells (Sailer et al.).
  • the in vitro DNA binding activity of p53-C277W mutant protein has been evaluated in bandshift assays using only the distal p21 responsive element; no defect was observed (Chene et al.).
  • the G279R was isolated as a toxic p53 variant in these studies since this mutation appears several times in the p53 tumor database.
  • p53-G279R lethality in yeast results from altered sequence recognition that in mammalian cells activates a partially defective p53 response that is compatible with tumor progression.
  • V122A mutation is not the only p53 mutation that is toxic. Additional single amino acid changes have been found that result in p53 lethality (see Table 3). Some mutations affect residues in the LI loop, while others affect the DNA binding domain and also the tetramerization domain. The mutants could be functionally distinguished, since some of the toxic mutants also retained transcriptional capability.
  • a toxic allele such as p53-V122A can have the added benefit of being more potent and more specific. For example, cells would be directed more to an apoptotic mode of elimination if p21 induction were less efficient compare to bax inactivation. In addition, reduced p21 induction would suggest that combined treatments with commonly used chemotherapeutic agents might be more effective since there would not be a checkpoint control response.
  • p53 plays a key role in preventing the development of cancer and most tumors associated with mutant p53 contain highly overexpressed missense mutant p53, reactivation or restoration of p53 function to tumor cells is a promising cancer therapy approach (Gallagher).
  • Different strategies have been attempted aimed at specifically targeting mutant p53 tumor cells. For example, a defective adenovims able to replicate only in the absence of p53 checkpoint function is under clinical trial (Bischoff et al). The idea of exploiting the high level of mutated protein to drive selective induction of a toxic gene has also been examined (Costa et al) .
  • tumor mutants with altered base pair recognition could be used to specifically induce a toxin (Gagnebin et al).
  • This invention exploits variable expression of human p53 in yeast to develop screens for mutants exhibiting novel phenotypes that would conespond to altered promoter selectivity and affinity.
  • the p53 cDNA regions coding for the DNA binding and tetramerization domains were subjected to random PCR mutagenesis and were cloned directly by recombination in yeast into a vector with a GALl promoter whose level of expression could be easily varied.
  • a novel simple screen was developed that directly identifies p53 variants exhibiting greater than wild type levels of transactivation (supertrans) for the RGC responsive element. All the p53 mutants obtained with this screen were located in the DNA binding domain. Six were in the LI loop region between amino acids 115 and 124. These supertrans mutants have not been observed in human tumors. The transactivation potential of a panel of supertrans p53 mutants on different promoters was evaluated using the p53 responsive elements, RGC, PIG3,p21 and bax.
  • the sequence for the RGC response element is 5' GACCTTGCCTGGACTTGCCTGGCCTTGCCT (SEQ ID NO: 1); the sequence for the p21 response element is 5'GAACATGTCCCAACATGTTG (SEQ NO: 2); the sequence for the bax element is 5' TCACAAGTTAGAGACAAGCCTGGGCGTGGGCTATATT (SEQ ID NO: 3) and the sequence for the Pig3 response element is 5'
  • AGCTTGCCCACCCATGCTCCAGCTTGCCCACCCATGCTC (SEQ ID NO: 4)
  • the yeast strains, plasmids, media and reagents were obtained as previously described above for the toxic mutants.
  • the human p53 cDNA between nucleotide 124 and 1122 was PCR amplified using a TAQ DNA polymerase without proofreading activity under optimal reaction conditions.
  • Unpurified amplification products were used to perform GAP repair cloning in the yeast strain yIG397. An aliquot of the PCR amplification was used for GAP repair in pRDI-22 plasmid. Homologous recombination in yeast reconstitutes a constitutive p53 expression plasmid that utilizes the moderate ADHI promoter to transcribe the p53 cDNA. Transformants are selected for the plasmid marker and p53trasactivation function is tested on plates containing limiting adenine. This is possible since the yIG397strains contains a p53-dependent reporter gene, ADE2, whose transcription can be monitored by a color assay.
  • Transcription O ⁇ ADE2 requires p53 because the upstream activating sequences of its yeast promoter have been deleted and replaced with three copies of a p53 binding sequence originally found in the human Ribosomal Gene Cluster (RGC). Since wild type p53 has been shown to act as a transcription factor also in S. cerevisiae, yeast transformant colonies expressing wild type p53 have a ade-i- phenotype and produce normal size white colonies, while transformants expressing a non functional p53 will be ade- and produce smaller red colonies. The color is due to the accumulation of an intermediate in the adenine biosythesis. This color discrimination also allows the identification of intermediate phenotypes (i.e.
  • GAP repair cloning was performed using a pGALl expression plasmid, pLS89, and exploiting variable expression of p53 by plating transformants on plates containing different carbon sources.
  • yIG397 cells transformed with pLS89 produce dark red colonies on glucose plates, where the GALl promoter is repressed.
  • the same clones produce lighter red colonies on raffinose plates where the GALl promoter is not repressed by glucose, but not induced.
  • galactose plates colonies are instead white, but growth is limited as the result of the inhibitory effect due to wild type p53 over-expression.
  • p53 protein levels were checked by Western blot recovering cells after growth in different sugars.
  • pGALl and pADHl driven expression were also compared. Immunodetection confirmed that pGALl p53 expression on galactose is about tenfold higher than pADHl expression on glucose. In glucose and raffinose cultures, pGALl driven p53 expression was respectively not detectable or barely detected. It was reasoned that GAP repair cloning in pGALl expression plasmid and plating on raffinose might allow the discrimination between wild type p53 and "super" wild type p53 for transactivation. Since wild type p53 produces light red colonies in this condition, the possibility to identify pink or white colonies might lead to the isolation of the "super" wild type p53's.
  • panel B white (and pink) colonies can be scored on raffinose plates. Their frequency is about 5% of the frequency of nonfunctional p53 mutants (i.e. red colonies in Fig. 8, panel A) or about 0.7-1%) of the total number of transformants. Given the estimated number of base pairs where a substitution can affect the transcriptional activation function in the p53 cDNA (542bp, Flaman) and assuming random polymerase enors, it was estimated that approximately 30 "super trans" p53 alleles could be generated with this approach among 3000 to 10,000 colonies examined. In four independent experiments 18 white colonies and 7 pink colonies were isolated and analyzed.
  • the nature of the mutation(s) in the p53 cDNA of 18 white and 7 pink supertrans clones was determined by DNA sequencing. Presented in Table 6 are the amino acid change(s), and the number of identical mutations that have been reported at the same codon in tumors. Among 25 independent clones there were 26 different amino acid changes and 17 mutants contained a single amino acid change, suggesting that the number of supertrans mutations have not been saturated. This invention therefore contemplates any supertransactivating mutations identifed in the future by the screening methods of this invention.
  • the LI loop is a hotspot region for supertrans p53 mutants: 7 different changes at four positions.
  • Both the ADE2 and ⁇ -Gal reporters confirmed that single amino acid changes in p53 DNA binding domain can greatly enhance the transactivation activity of human p53 in yeast. It is possible that these mutations increase the affinity of the DNA binding domain for the p53 responsive element used in the screen (3xRGC). Alternatively, the mutations may have a stabilizing effect on p53 conformation or affect protein: :protein interactions.
  • the amount of wild type p53 and four supertrans mutants in raffinose cultures was evaluated by western blot. All mutants showed a comparable and slightly reduced protein level compared to wild type p53 ( Figure 12). The slight reduction might be due to a minor effect of supertrans alleles on yeast growth even at low expression.
  • p53tumor mutations and in particular mutation hotspots in tumors are considered to be the dominant negative phenotype over wild type in heterozygosis. This effect is generally explained by the ability of these mutants to form hetero-tetramers with wild type and reduce or compromise their function. Having generated p53 alleles that show increased transactivation compared to wild type we tested whether "supertrans" alleles might be resistant to the dominant negative phenotype of p53tumor mutations.
  • Plasmids were constmcted that express p53 alleles under the constitutive ADHI promoter. These vectors were transformed in yeast together with differently marked but otherwise identical vectors expressing p53 mutations.
  • Double transformants were selected and tested for transactivation with the ADE2 based color assay.
  • An example of this phenotypic analysis is shown in Figure 13 while results are summarized in Table 8.
  • Five supertrans alleles were tested against six p53 dominant-negative tumor mutants.
  • Yeast transformants containing both tumor and either wild type or supertrans expression plasmids were obtained on double selective plates.
  • Five of the six tumor mutants inhibited wild type activity (pink colonies) (Table 8).
  • the S121F, T123A and V274A supertrans mutants were resistant to the dominant negative phenotype (white colonies).
  • the S240N mutant prevented growth when expressed under ADHI promoter and the presence of wild type p53 did not alleviate this phenotype.
  • the invention also provides p53 allelic variants that discriminate between different p53 regulated pathways. For example, p53 mutants are identified that preferentially enhance transactivation of defined p53 -regulated genes while retaining normal or even reduced activity for others.
  • the system provides the opportunity to "tailor" p53 functional control for the various promoters recognized by p53 in terms of strength of induction by 53 (from none to supertrans) and for combinations of p53 responsive genes (i.e., some turned on, some turned off). This provides opportunities to change the p53 responsive pathways and therefore the biological outcomes in response to environmental challenges.
  • New promoter response elements are identified that can be recognized by new (mutant) forms of p53.
  • the system also provides the opportunity to identify or tailor mutant p53s that are dominant when expressed with other (i.e., common tumor p53) mutants.
  • pattern summarizes the promoter elements that are turned on and turned off by the mutant p53, the level of response for each promoter element, and potential toxicity of a p53 mutant. Some mutants exhibit strong specificity for a given responsive element, while others appear more active than wild type for all the elements tested. These latter mutations may increase folding stability or introduce additional DNA contacts but without affecting specificity. Different amino acid changes at the same position in the LI loop (121, 123 and 124) showed different patterns of transactivation specificity and affinity.
  • The, S121F mutant was unable to activate the luciferase reporter despite very strong suppression of growth. While the levels differed, the other three super supertrans mutants T123A, C124Y and S240N, were all able to induce luciferase regardless of the responsive elements tested. The strongest response, which was somewhat greater than for wild type p53, was found with the MDM2 promoter. The levels of p53 protein expression in the transient transfections were comparable based on Western blot analysis ( Figure 17). As expected, the V274A mutant was better tolerated and the protein amount was higher. Using an antibody to p21, examined the ability of the various p53 alleles to induce the endogenous p21 from its own promoter was also examined.
  • the S121F mutant showed a partial defect in p21 induction.
  • T123A, C124Y and S240N all induced p21, as did the wild type p53 while V274A appeared completely defective.
  • the results in yeast with the partial p21 responsive element (Tables 7 and 12) and the endogenous p21 promoter in Saos-2 cells were comparable .
  • a prediction with the finding of p53 alleles exhibiting increased transcriptional activation is that they might be more resistant than wild type p53 to the dominant negative effect of common tumor mutants. This dominant negative effect can be seen in heterozygosity and may explain the strong in vivo selection for missense p53 mutations. It is possible that in mixed tetramers, subunits possessing higher DNA binding affinities than wild type can still mediate enough interaction with p53 responsive elements to allow transactivation. Alternatively, at physiological level of expression the minimal amount of "supertrans' nomotetramers, but not of wild type ones (statistically 1/16 of total proteins in the case of heterozygosity and equal stability) required to achieve transcriptional activation could be reached.
  • the approach of this invention to select for increased transcriptional potential in p53 allelic variants has utilized three p53 responsive elements of which only two conespond to promoters of p53 regulated genes (bax and p21). Some of the mutations exhibited enhanced activity with at least two responsive elements (see Tables 6, 10, 11, 12) while other appeared more specific for one element. Most of the mutants have not been detected in tumors, suggesting that these proteins retain wild type like tumor suppressor activity and might possess distinct functional features. Additional p53 response elements can be utilized in the assays taught.
  • the assay provided herein can be used as a screening tool for subtle p53 mutants in tumor samples since they may go undetected with the common p53 functional assay.
  • Novel or rare mutations have been recently identified by direct sequencing in tumor samples and shown to possess wild type like transactivation function in human cells (Smith et al.).
  • p53 mutations that exhibit weak transactivation defects were recently identified with the yeast screen of this invention in bladder cancer tissues.
  • the assay is useful for the generation and characterization of novel p53 alleles that exhibit an altered pattern of regulation of downstream genes and is useful for in vivo functional dissection of p53 responsive pathways and identification of additional p53 regulated genes.
  • the transactivation analysis at low expression with the complete human p53 protein and various tetrameric responsive elements provide a better understanding of p53-DNA binding specificity/affinity and stability. This approach can complement recent in vitro studies that addressed p53 folding stability and DNA binding affinity (Bullock et al.; Nikolova et al.).
  • the sensitivity of the yeast assay to various levels of p53 expression could be used to identify compounds (i.e. chemicals, small molecules or peptides) or interacting factors that either enhance or reduce p53 function. Such agents might also be able to functionally reactivate p53 tumor mutants (Foster et al; Selivanova et al.). Alternatively, temporary inactivation of p53 function may also have therapeutic value ( Komarov et al.).
  • supertrans p53 alleles provided herein or identified according to the present methods that exhibit selectivity for the induction of the apoptotic pathway may have a higher therapeutic effect compared to wild type p53 for cancer gene therapy under conditions where functional p53 is delivered directly to the tumor tissues (Sailer et al.; Vinyals et al; Swisher et al.).
  • Methods developed to examine human supertrans and toxic p53 mutants can also be used to examine nonhuman p53 genes. Examples are shown for mouse p53 wild type and R270C and T122L mutants (conesponding to human amino acid positions 273 and 125) in Table 13. T122L has been found in mouse skin cancer and is toxic in yeast and super trans for bax and p21 but reduced for RGC.
  • This system provides a specific, broadly applicable approach for modification of genes (master genes) that regulate multiple down stream genes through consensus promoter elements. Therefore, it may be possible to regulate specific pathways.
  • the regulatable promoters can be included in reporters similar to that described for p53.
  • An example of pathway specificity resulting from a change in a master gene is found for lexA of E. col. J Mol Biol 1987 Jan 5;193(l):27-40.
  • Differential repression of SOS genes by unstable lexA41 (tsl-1) protein causes a "split-phenotype" in Escherichia coli K-12. Peterson KR, Mount DW
  • p53 can have a variety of effects. Whereas wild type has a set number of p53 promoters that it turns on and each promoter is turned on to a given degree, the present invention shows that through the use of yeast as a screening tool, combined with mutations of the p53 gene and characterization of p53 mutants at different expression levels the pattern of p53 response is changed.
  • CTS1 a p53-derived chimeric tumor suppressor gene with enhanced in vitro apoptotic properties. J. Clin. Invest., 101, 120-127.
  • Nikolova, P.V. wong, K.B., DeDecker, B., Henckel, J., and Fersht, A.R. (2000) Mechanism of rescue of common p53 cancer mutations by second-site suppressor mutations, EMBO J. 19: 370-378.
  • Mammalian p53 can function as a transcription factor in yeast, Nucleic Acids Res. 20, 1539-1545.
  • V122A::Q331 Stop ++++ red
  • Mutant Codon Amino acid Structural p53 tumor database c change change location b Del. - miss. / identical change* 1
  • a Growth is prevented by expression of the mutant p53 from a GALl inducibl e promoter under conditions of galactose-induced high level expression or the lower level ADHI constitutive expression. Microcolonies appeared after 4-5 days when the p53 mutant was under the ADHI promoter, similar to what was observed with p53-V122A.
  • Identical change same amino acid substitution as found by the yeast assay.
  • Table 10 p53 alleles showing enhanced transcriptional activation compared to wild type p53 selected using the RGC or p21 or bax responsive elements.
  • Mutant phenotype phenotype amino acid change Location 3 p53 database in pADHl in pGALl Del.-miss. / identical glucose raffinose galactose change
  • AAC AGC N268S S10 1-8 / 5 ACT > ATA T284I H2 3-9 / 0 w27 no growth white no growth GAG > GCG E285A H2 11-88 /
  • Mutant phenotype phenotype amino acid change Location 11 p53 database in pADHl in pGALl Del.-miss. / identical glucose raffinose galactose change w30 no growth white no growth ACT > CCT T123P LI 0-0 / w31 no growth white no growth ATG > ACG M160T S4 0-21 / 0
  • Transactivation in yeast used the ADE2 reporter, in mammalian it was luciferase on a reporter plasmid or using antibody to p21 expressed from the endogenous reporter.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne des polypeptides isolés du gène p53 humain renfermant des mutations. Ces mutations peuvent être des mutations toxiques, des mutations supertransactivatrices ou des mutations de suppression du phénotype toxique. L'invention concerne également des méthodes d'identification de ces mutations toxiques, supertransactivatrices, faiblement transactivatrices et de suppression du phénotype toxique, ainsi que des méthodes d'identification de composés imitant les mutations toxiques, supertransactivatrices et de suppression du phénotype toxique du gène p53 humain. L'invention concerne enfin des méthodes permettant d'induire une toxicité dans une cellule par administration d'un polypeptide comprenant une mutation supertransactivatrice ou toxique.
PCT/US2000/020538 1999-07-30 2000-07-28 Mutations du gene p53 humain, et systeme genetique de levures utilise pour l'identification fonctionnelle des mutations du gene p53 humain WO2001009325A2 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU62395/00A AU784293B2 (en) 1999-07-30 2000-07-28 Human P53 mutations and a genetic system in yeast for functional indentification of human P53 mutations
JP2001514117A JP2003506041A (ja) 1999-07-30 2000-07-28 ヒトｐ５３変異およびヒトｐ５３変異の機能的同定のための酵母遺伝子系
US10/048,502 US7256260B1 (en) 1999-07-30 2000-07-28 Human p53 mutations and a genetic system in yeast for functional identification of human p53 mutations
CA002380631A CA2380631A1 (fr) 1999-07-30 2000-07-28 Mutations du gene p53 humain, et systeme genetique de levures utilise pour l'identification fonctionnelle des mutations du gene p53 humain
EP00948979A EP1204745A2 (fr) 1999-07-30 2000-07-28 Mutations du gene p53 humain, et systeme genetique de levures utilise pour l'identification fonctionnelle des mutations du gene p53 humain
AU2006202361A AU2006202361A1 (en) 1999-07-30 2006-06-02 Human P53 mutations and a genetic system in yeast for functional identification of human P53 mutations

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14663499P 1999-07-30 1999-07-30
US60/146,634 1999-07-30

Publications (3)

Publication Number Publication Date
WO2001009325A2 true WO2001009325A2 (fr) 2001-02-08
WO2001009325A3 WO2001009325A3 (fr) 2001-08-30
WO2001009325A9 WO2001009325A9 (fr) 2002-08-08

Family

ID=22518261

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/020538 WO2001009325A2 (fr) 1999-07-30 2000-07-28 Mutations du gene p53 humain, et systeme genetique de levures utilise pour l'identification fonctionnelle des mutations du gene p53 humain

Country Status (5)

Country Link
EP (1) EP1204745A2 (fr)
JP (1) JP2003506041A (fr)
AU (1) AU784293B2 (fr)
CA (1) CA2380631A1 (fr)
WO (1) WO2001009325A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7256260B1 (en) 1999-07-30 2007-08-14 The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services, Nih Human p53 mutations and a genetic system in yeast for functional identification of human p53 mutations
WO2008147186A1 (fr) * 2007-05-31 2008-12-04 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Vaccin obtenu à partir d'un peptide de p53
CN110257467A (zh) * 2019-07-22 2019-09-20 福州市皮肤病防治院 一种检测肿瘤抑制因子p53显性抑制突变的试剂盒及其应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996016989A1 (fr) * 1994-11-28 1996-06-06 The Wistar Institute Of Anatomy And Biology PROTEINES p53 A DOMAINES DE TETRAMERISATION MODIFIES
WO1997041136A1 (fr) * 1996-05-01 1997-11-06 The Johns Hopkins University Mutation de suppresseurs des mutations cancereuses p53 courantes
WO2000022115A2 (fr) * 1998-10-13 2000-04-20 Board Of Regents, The University Of Texas System Dosages permettant d'identifier des alterations fonctionnelles dans le gene suppresseur de tumeur p53
WO2000068384A2 (fr) * 1999-05-12 2000-11-16 Xencor, Inc. Nouveaux acides nucleiques et proteines ayant une activite p53 et comportant des domaines de tetramerisation modifies

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2144768A1 (fr) * 1992-10-01 1994-04-14 Stephen H. Friend Epreuve fonctionnelle pour les genes suppresseurs de tumeurs
ATE262586T1 (de) * 1994-11-28 2004-04-15 Univ Jefferson Fusion junction typ iii mutant egf rezeptor peptid-tumorvakzin

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996016989A1 (fr) * 1994-11-28 1996-06-06 The Wistar Institute Of Anatomy And Biology PROTEINES p53 A DOMAINES DE TETRAMERISATION MODIFIES
WO1997041136A1 (fr) * 1996-05-01 1997-11-06 The Johns Hopkins University Mutation de suppresseurs des mutations cancereuses p53 courantes
WO2000022115A2 (fr) * 1998-10-13 2000-04-20 Board Of Regents, The University Of Texas System Dosages permettant d'identifier des alterations fonctionnelles dans le gene suppresseur de tumeur p53
WO2000068384A2 (fr) * 1999-05-12 2000-11-16 Xencor, Inc. Nouveaux acides nucleiques et proteines ayant une activite p53 et comportant des domaines de tetramerisation modifies

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
FLAMAN J -M ET AL: "A simple p53 functional assay for screening cell lines, blood, and tumors." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 92, no. 9, 1995, pages 3963-3967, XP002153428 1995 ISSN: 0027-8424 cited in the application *
FREEMAN J ET AL: "Mutation of conserved domain II alters the sequence specificity of DNA binding by the p53 protein." EMBO (EUROPEAN MOLECULAR BIOLOGY ORGANIZATION) JOURNAL, vol. 13, no. 22, 1994, pages 5393-5400, XP002153425 ISSN: 0261-4189 cited in the application *
GAGNEBIN J ET AL: "Use of transcription reporters with novel p53 binding sites to target tumour cells expressing endogenous or virally transduced p53 mutants with altered sequence-specificity." ONCOGENE, vol. 16, no. 5, 5 February 1998 (1998-02-05), pages 685-690, XP000961074 ISSN: 0950-9232 *
INGA ALBERTO ET AL: "N-(2-chloroethyl)-N-nitrosourea tethered to lexitropsin induces minor groove lesions at the p53 cDNA that are more cytotoxic than mutagenic." CANCER RESEARCH, vol. 59, no. 3, 1 February 1999 (1999-02-01), pages 689-695, XP002153427 ISSN: 0008-5472 *
KELLY JACK D ET AL: "Relationship between DNA methylation and mutational patterns induced by a sequence selective minor groove methylating agent." JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 274, no. 26, 25 June 1999 (1999-06-25), pages 18327-18334, XP002153426 ISSN: 0021-9258 *
MATSUMURA I ET AL: "IN VITRO EVOLUTION OF THERMOSTABLE P53 VARIANTS" PROTEIN SCIENCE,GB,CAMBRIDGE UNIVERSITY PRESS, CAMBRIDGE, vol. 8, no. 4, April 1999 (1999-04), pages 731-740, XP000891282 ISSN: 0961-8368 *
SALLER ELISABETH ET AL: "Increased apoptosis induction by 121F mutant p53." EMBO (EUROPEAN MOLECULAR BIOLOGY ORGANIZATION) JOURNAL, vol. 18, no. 16, 16 August 1999 (1999-08-16), pages 4424-4437, XP002160228 ISSN: 0261-4189 *
SOUSSI THIERRY ET AL: "Structural aspects of the p53 protein in relation to gene evolution: A second look." JOURNAL OF MOLECULAR BIOLOGY, vol. 260, no. 5, 1996, pages 623-637, XP002153429 ISSN: 0022-2836 cited in the application *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7256260B1 (en) 1999-07-30 2007-08-14 The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services, Nih Human p53 mutations and a genetic system in yeast for functional identification of human p53 mutations
WO2008147186A1 (fr) * 2007-05-31 2008-12-04 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Vaccin obtenu à partir d'un peptide de p53
US8663646B2 (en) 2007-05-31 2014-03-04 Academisch Ziekenhuis Leiden H.O.D.N. Lumc P53 peptide vaccine
CN110257467A (zh) * 2019-07-22 2019-09-20 福州市皮肤病防治院 一种检测肿瘤抑制因子p53显性抑制突变的试剂盒及其应用

Also Published As

Publication number Publication date
EP1204745A2 (fr) 2002-05-15
AU784293B2 (en) 2006-03-02
WO2001009325A3 (fr) 2001-08-30
WO2001009325A9 (fr) 2002-08-08
AU6239500A (en) 2001-02-19
JP2003506041A (ja) 2003-02-18
CA2380631A1 (fr) 2001-02-08

Similar Documents

Publication Publication Date Title
Ziv et al. Recombinant ATM protein complements the cellular AT phenotype
Nakano et al. The small GTP‐binding protein Rho1 is a multifunctional protein that regulates actin localization, cell polarity, and septum formation in the fission yeast Schizosaccharomyces pombe
Unger et al. p53: a transdominant regulator of transcription whose function is ablated by mutations occurring in human cancer.
Philips et al. Identification of Kel1p, a kelch domain-containing protein involved in cell fusion and morphology in Saccharomyces cerevisiae
EP1343884A2 (fr) Proteine jfy induisant l'apoptose rapide
US6323331B1 (en) Beclin-related nucleic acid molecules, and uses thereof
Yin et al. Stu1p is physically associated with β-tubulin and is required for structural integrity of the mitotic spindle
Inga et al. Novel human p53 mutations that are toxic to yeast can enhance transactivation of specific promoters and reactivate tumor p53 mutants
US5840579A (en) Nucleic acids encoding p53 mutations which suppress p53 cancer mutations
Epstein et al. p53 mutations isolated in yeast based on loss of transcription factor activity: similarities and differences from p53 mutations detected in human tumors
US6218515B1 (en) Cyclin E variants and use thereof
AU784293B2 (en) Human P53 mutations and a genetic system in yeast for functional indentification of human P53 mutations
Sekiya-Kawasaki et al. Identification of functional connections between calmodulin and the yeast actin cytoskeleton
US6255074B1 (en) Abl-interactor protein
US7256260B1 (en) Human p53 mutations and a genetic system in yeast for functional identification of human p53 mutations
AU2006202361A1 (en) Human P53 mutations and a genetic system in yeast for functional identification of human P53 mutations
US5876972A (en) Nucleic acid molecules coding for tumor suppressor proteins and methods for their isolation
US6911538B2 (en) Engineered open reading frame for p53
US5770720A (en) Ubiquitin conjugating enzymes having transcriptional repressor activity
US6297019B1 (en) Recombinant polynucleotides encoding CYP7 promoter-binding factors
US7144711B2 (en) AGS proteins and nucleic acid molecules and uses therefor
AU720755B2 (en) Ubiquitin conjugating enzymes having transcriptional repressor activity
RU2252256C2 (ru) ГОМОЛОГИ (ATR) ПОЛИПЕПТИДА rad3, ПОЛИНУКЛЕОТИДЫ И СВЯЗАННЫЕ С НИМИ СПОСОБЫ И МАТЕРИАЛЫ
Zhang et al. The DNA-binding and Transcription-Activation Abilities of p53 Are Necessary but not Sufficient for Its Antiproliferation Function’
WO1997049828A1 (fr) Nouveaux facteurs associes a la proteine de liaison de la boite tata essentielles a la viabilite de la levure

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 2380631

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 62395/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2000948979

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000948979

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 10048502

Country of ref document: US

AK Designated states

Kind code of ref document: C2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 98-102, 105 AND 106, DESCRIPTION, REPLACED BY NEW PAGES 98-102, 105 AND 106; PAGES 1/18-18/18, DRAWINGS, REPLACED BY NEW PAGES 1/18-18/18; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE