WO2001005957A2 - Grapevine leafroll-associated virus proteins - Google Patents

Abstract

The present invention relates to isolated grapevine leafroll virus (GLRaV) proteins or polypeptides. The invention further relates to isolated DNA molecules which encode such proteins or polypeptides, in addition to assays and kits for detecting GLRaV infection in grape plants, and heterologous nucleic acid constructs, vectors, and transformation methods, comprising such GLRaV-encoding nucleic acids, as well as plants and plant parts comprising such constructs.

Description

GRAPEVINE LEAFROLL-ASSOCIATED VIRUS PROTEINS

Field Of The Invention

The present invention relates to novel grapevine leafroll-associated virus proteins, including the GLRaV-5 HSP 70 homologue, GLRaV-5 coat protein, GLRaV-5 duplicate coat protein and the GLRaV-8 HSP 70 homologue protein and GLRaV-8 partial coat protein. In addition, the invention relates to heterologous nucleic acid constructs, vectors, kits, and transformation methods comprising GLRaV-5 and GLRaV-8 protein coding sequences. The invention further relates to methods of detecting infection with GLRaV-5, and methods of making transgenic plants resistant thereto.

References

Adams, D.O., and Yang, S.F., Plant Physiology 70:117-123 (1977).

Agranovsky, A.A., et al, PNAS USA 92:2470-2473, (1995). Ausubel, F.M. , et al. , in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY. John Wiley and Sons,

Inc., Media, PA (1992).

Boscia, et al. , Vitis 3 :\l\-\15, (1995).

Brodeur, et al. , MONOCLONAL ANTIBODY PRODUCTION TECHNIQUES AND APPLICATIONS. Marcel

Dekker, Inc., New York, pp. 51-63 (1987). Ditta, et al, Proc. Nat. Acad. Sci., U.S.A. 77:7347-7351, (1980).

Dolja, V.V., et al. , Annu. Rev. Phytopathol. 32:261-285, (1994).

Dolja, et al. , Virolosv 184:79-86. (1991).

Frazier, et al. , eds.. VIRUS DISEASES OF SMALL FRUITS AND GRAPEVINES. UC, Div. of Ag. Sci.,

Berkeley, CA, pp. 209-212, (1970). Goding, MONOCLONAL ANTIBODIES: PRINCIPLES AND PRACTICE. Academic Press, pp. 59-103

(1986).

Goheen, Am Phytopathol Soc, St. Paul, Minn, 47-54, (1988).

Golino, D.A., Am. J. Enol. Vitic. 43:200-205, (1992).

Harlow and Lane, ANTIBODIES. A LABORATORY MANUAL, Cold Spring Harbor, (1988). Hooykaas, P.J. , and Schilperoot, R.A. , in TRENDS IN BIOCHEMICAL SCIENCES.

International Union of Biochemistry and Elsevier Science Publishers, v.10(8): : 307-309 (1985).

Harlow and Lane, ANTIBODIES, A LABORATORY MANUAL. Cold Spring Harbor, (1988).

Hu, et al. , Phytopathol. 80:920-925, (1990).

Hu, et al., J. Phyopathol. 128:1-14, (1990). Jouanin, et al., Mol. Gen. Genet. 201:370-374, (1985).

Karasev, A.V., et al., J. Gen. Virol., Great Britain, 75:1415-1422, (1994). Kohler and Milstein, Nature 256:495 (1975). Kozbor, /. Immunol. 133:3001 (1984). Lerner, et al , Science 258:1313. (1992). MacKenzie, D.J., et al , Plant Disease 81:222-226, (1996). Marks, et al. , J. Biol. Chem. 267: 16007, (1992a). Marks, et al , Biotechnol. 10:779, (1992b).

Martelli, in Martelli, ed., GRAFT TRANSMISSIBLE DISEASES OF GRAPEVINES. HANDBOOK FOR

DETECTION AND DIAGNOSIS. FAO, Rome Italy, pp. 37-44, (1993).

McBride and Summerfelt, Plant Mol Biol. 14:269-276, (1990). Minafra, A., et al, Vitis 31 :221-227, (1992).

Monis, J. and de Zoeten, G.A. , Phytopathology 80:446-450, (1990).

Monis, J. and Bestwick, R., Am. J. Enol Vine, 47(2) 199-205, (1996).

Monis, J. and Bestwick, R.K., Plant Disease, 81(7) 801-808, (1997).

Monis, J. and Bestwick, R.K., USSN 08/708,591, issued June 23, (1999). Morrison, et al. , Proc. Nat. Acad. Sci. 81:6851- 6855 (1984).

Munson and Pollard, Anal. Biochem. 107:220 (1980).

Murray, E. et al. Nucl Acids Res. .17:477-508, (1989).

Neuberger, et al, Nature 312:604-608 (1984).

Paulos, J.J. and Powell, C.A., Plant Disease 79:246-248, (1995). Parker, J.D., et al , Nucleic Acids Res 19:3055-60, 1991Sambrook, J., et al, in MOLECULAR

CLONING: A LABORATORY MANUAL. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,

NY, Vol. 2 (1989).

Peremyslov, et al, Proc. Natl Acad. Sci. 96: 14771-14776 (1999).

Routh, G., et al, Phytopathology 88: 1238-1243 , (1998). Sambrook, et al, in MOLECULAR CLONING: A LABORATORY MANUAL. (2nd edition), Cold Spring

Harbor Press, Plainview, N.Y (1989).

Takeda, etal , Nature 314:452-454 (1985).

Tian, T., et al, Phytopathol. 86:1167-1173, (1996).

Weber E and Golino D, PWV Grapegrowing, March/April 1993:21-25). Zee, et al. , Phytopathol. 77: 1427-1434, (1987).

Zhu, H.Y., et al, J. Gen. Virol, Great Britian, 79:1289-1298, (1998).

Zimmermann, et al, J. Phytopathol. 130:205-218, (1990).

Background Of The Invention Grapevine leafroll is a viral disease, transmitted and spread through grafting vegetatively propagated plants (Goheen, "Grape Leafroll," in Frazier, et al , 1970). Grapevine leafroll disease effects almost all cultivated and rootstock varieties of grapes, and resulting in poor color development and non-uniform maturation of Vitis vinifera fruit which manifests as reduced yield and reduced sugar content. (See, e.g. , Goheen, 1988.)

Leafroll disease is found everywhere grapevines are grown. In some viticultural regions nearly 100% of the vines are infected. Despite being recognized for more than 150 years, leafroll disease continues to be a problem in all major grapevine growing areas (Weber E and Golino D, 1993).

In recent years, long flexuous closteroviruses have been most consistently associated with leafroll disease. (See, e.g. , Zimmermann, et al , 1990.) These closteroviruses are referred to as grapevine leafroll-associated viruses ("GLRaV", see e.g., Monis, J. and Bestwick, R., 1996). Several serologically distinct types of GLRaV 's have been characterized from diseased grapevines (Boscia, et al , 1995; Martelli, in Martelli, 1993).

Due to the deleterious effects of leafroll disease, it is necessary to screen plants for GLRaV infection prior to vegetative propagation, in order to minimize the spread of the infection.

At present, leafroll disease is detected by biological indexing, Western blot and enzyme- linked immunosorbent assay (ELISA). Biological indexing relies on grafting of "test" varieties onto "indicator" varieties which develop symptoms of leafroll disease in approximately two years, making this an impractical screening technique. Variable distribution of GLRaVs in vegetatively grown and dormant grapevines, and seasonal variation in viral titers render extensive sampling important to insure accurate detection. Serological detection further requires antibodies against each type of closterovirus associated with leafroll disease. Accordingly, at the present time a negative result by Western blot and/or ELISA is not considered definitive.

Relevant GLRaV amino acid sequences available in GenBank/EMBL include; complete nucleotide sequence of GLRaV-2 (AF039204); partial nucleotide sequence of GLRaV-3 (037268) the partial heat shock protein 70 sequence from GLRaV- 1 through GLRaV-5 found at Accession Numbers, CAA75811 (GLRaV-1); AF 039204 (GLRaV-2-USA); CAA74563 (GLRaV-2 Italy); AF037268 (GLRaV-3); AF039553 (GLRaV-4); AF039552 (GLRaV-5); respectively; and a partial coding sequence for the GLRaV-7 heat shock protein 70, found at Accession Number Y15987.

Given the serious risk grapevine leafroll disease poses to vineyards and the absence of an effective treatment for it, there is a need to detect and prevent GLRaV infection.

Summary Of The Invention The present invention is directed to overcoming deficiencies in the prior art by providing new GLRaV sequences and methods for detecting GLRaV infection using such sequences. The invention provides isolated GLRaV-5 and GLRaV-8 polynucleotides which encode GLRaV polypeptides.

The polynucleotides of the invention include sequences which encode: the GLRaV-5 capsid or coat protein, GLRaV-5 HSP 70, the GLRaV-5 partial duplicate capsid protein, and sequences flanking the GLRaV-5 HSP 70 homologue and GLRaV-5 capsid protein (putative HSP 90 ORF), in addition to sequences complementary to such encoding sequences, and novel fragments of such polynucleotides.

The polynucleotides of the invention further include sequences which encode: a GLRaV-8 partial coat protein sequence, the GLRaV-8 HSP 70 homologue protein, sequences complementary to such encoding sequences, and novel fragments of such polynucleotides. In one aspect, the invention provides GLRaV-5 and GLRaV-8 coat proteins or polypeptides, wherein the coat protein or polypeptide amino acid sequence has at least about 80% or 85%, preferably greater than about 90% or 95% sequence identity to an amino acid sequence presented as SEQ ID NO:3 or SEQ ID NO:9, for GLRaV-5 and GLRaV-8, respectively. The invention further provides the nucleotide sequence encoding such GLRaV-5 or

GLRaV-8 coat proteins or polypeptides.

In a related aspect, the invention provides polynucleotide sequences encoding GLRaV-5 and GLRaV-8 coat proteins or polypeptides wherein the polynucleotide sequence preferably has greater than about 90% or 95% sequence identity to a GLRaV-5 or GLRaV-8 coat protein or polypeptide coding sequence presented as SEQ ID NO: 2 and SEQ ID NO: 8.

In one aspect, the invention provides GLRaV-5 and GLRaV-8 HSP70 proteins or polypeptides, wherein the HSP70 protein or polypeptide amino acid sequence has at least about 80% or 85%, preferably greater than about 90% or 95% sequence identity to an amino acid sequence presented in SEQ ID NO:5 or SEQ ID NO: 11, for GLRaV-5 and GLRaV-8, respectively.

The invention further provides the nucleotide sequence encoding such GLRaV-5 or GLRaV-8 HSP 70 proteins or polypeptides.

In a related aspect, the invention provides a polynucleotide sequences encoding GLRaV-5 and GLRaV-8 HSP 70 proteins or polypeptides wherein the polynucleotide sequence preferably has greater than about 90% or 95% sequence identity to a GLRaV-5 or GLRaV-8 HSP 70 protein or polypeptide coding sequence presented in SEQ ID NO:4 and SEQ ID NO: 10.

For GLRaV-5, the invention also provides an approximately 4766 nucleotide sequence (SEQ ID NO:l), which includes the coding sequences for a GLRaV-5 coat protein (SEQ ID NO:2, nucleotides 3285-4094 of SEQ ID NO:l), a GLRaV-5 HSP70 homologue protein (SEQ ID NO:4, nucleotides 1 to 1593 of SEQ ID NO:l), a GLRaV-5 duplicate coat protein (SEQ ID NO:6, nucleotides 4128 to 4751 of SEQ ID NO:l) in addition to a GLRaV-5 HSP 90 homologue sequence.

In another embodiment, the polynucleotides of the invention will hybridize under high stringency conditions to a sequence selected from the group consisting of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and and SEQ ID NO: 10, or the complement thereof.

In another embodiment, the invention provides a vector comprising a nucleic acid sequence encoding a GLRaV polypeptide or protein, operably linked to regulatory elements effective for expression in a plant cell. The present invention also provides a method for the detection of GLRaV infection in a plant. Such detection is carried out using the GLRaV nucleic acid and GLRaV amino acid sequences presented herein, and may take the form of an immunoassay or PCR assay. The invention further contemplates kits for performing such assays.

These and other objects and features of the invention will become more fully apparent when the following detailed description of the invention is read in conjunction with the accompanying drawings.

Brief Description Of The Figures

Figures 1A-G depict the nucleotide sequence for GLRaV-5, which encodes the GLRaV-5 coat protein (SEQ ID NO:2; nucleotides 3285-4094 of SEQ ID NO:l), the GLRaV-5 HSP70 homologue coding sequence (SEQ ID NO:4; nucleotides 1-1593 of SEQ ID NO:l), the flanking ORF between the capsid protein and HSP 70 (nucleotides 1574-2989 of SEQ ID NO:l), and the partial duplicate coat protein (SEQ ID NO:6, nucleotides 4128-4751 of SEQ ID NO:l), with the corresponding amino acid sequence shown below the nucleic acid sequence. Figure 2A depicts the partial nucleotide sequence encoding the GLRaV-8 coat protein

(270 nucleotides; SEQ ID NO:8).

Figure 2B depicts the nucleotide sequence encoding the GLRaV-8, HSP70 protein (1384 nucleotides; SEQ ID NO: 10).

Figure 3A depicts the predicted amino acid sequence for the GLRaV-5 coat protein (269 amino acids; SEQ ID NO:3).

Figure 3B depicts the predicted amino acid sequence for the GLRaV-5 HSP70 protein (530 amino acids; SEQ ID NO:5).

Figure 3C depicts the predicted amino acid sequence for the GLRaV-5 duplicate coat protein (207 amino acids; SEQ ID NO:7). Figure 4A depicts the predicted amino acid sequence for the partial GLRaV-8 coat protein (90 amino acids; SEQ ID NO:9). Figure 4B depicts the predicted amino acid sequence for the GLRaV-8 HSP70 protein (460 amino acids; SEQ ID NO: 11).

Figure 5 is a schematic representation of the partial GLRaV-5 genome and genome cloning strategy. Boxes represent ORFs, with the protein products encoded by the respective ORFs indicated in the boxes. Horizontal lines represent the overlapping clones used to determine the nucleotide sequence, with their respective designations.

Figures 6A and B depict a comparison of the heat shock protein 70 (HSP 70) sequences from GLRaV homologues LR1, USLR2 (US strain), USLR3 (US strain), LR4, LR5 and LR7, showing conserved amino acid residues (highlighted) and the consensus sequence domains conserved among closteroviruses (Domains A-H).

Figures 7A and B depict a comparison of the coat protein sequences from GLRaV homologues LR2 (GLRaV-2 coat protein, US strain), LR2d (GLRaV-2 duplicate CP), LR3 (GLRaV-3 CP), LR3d (GLRaV-3 duplicate CP), LR5 (GLRaV-5 CP), LR5d (GLRaV-5 duplicate CP) and LR-8 (GLRaV-8 CP). Figure 8 demonstrates the relationship of selected closteroviruses heat shock protein homologue proteins. The relationship was determined using the deduced amino acid sequences of beet yellow stunt virus (BYSV), citrus tristeza virus (CTV), GLRaV-1, GLRaV-2, GLRaV-3, GLRaV-5, and little cherry virus (LChV). The length of each pair of branches represents the distance between sequence pairs. The scale beneath the tree measures the distance between sequences.

Figure 9 has the determined phylogenetic relationship of grapevine associated closteroviruses capsid proteins (CP) and their diverged duplicates (dCP). The relationship was determined using the deduced amino acid sequences of CP and dCP from GLRaV- 1, GLRaV-2, GLRaV-3, GLRaV-5, GLRaV-8, as well as two unknown protein sequences from GLRaV-4 (GLRaV-4 UP and GLRaV-4 UP2). To facilitate the alignment, only 250 amino acid residues in the C-terminal portion of the CP and the duplicate CP of GLRaV- 1 and -3 were used. The length of each pair of branches represents the distance between sequence pairs. The scale beneath the tree measures the distance between sequences.

Detailed Description Of The Invention

I. DEFINITIONS

As used herein, the term GLRaV (grapevine leafroll associated virus), refer to a group of viruses that individually or in combination cause leafroll disease, e.g. , GLRaV-1 through GLRaV-8. As used herein the term "GLRaV" is used interchangeably with the term "LR" relative to the different viruses associated with leafroll disease (e.g. , LR-1 through LR-8). The terms "coat protein" and "coat polypeptide", with reference to GLRaV-5 and GLRaV-8, refer to a mature and/or modified GLRaV-5 or GLRaV-8 polypeptide. As used herein, reference to such GLRaV polypeptides or proteins is meant to include the full-length polypeptide, and fragments thereof, unless the context indicates otherwise. As used herein, the terms "coat protein" and "coat polypeptide" are used interchangeably with the term "capsid protein", relative to GLRaV.

Amino acid residues are referred to herein by their standard single letter notations: A, alanine; C, cysteine; D, aspartic acid; E, glutamic acid; F, phenylalanine; G, glycine; H, histidine; I, isoleucine; K, lysine; L, leucine; M, methionine; N, asparagine; P, proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine; W, tryptophan; Y, tyrosine.

The term "polypeptide" as used herein refers to a compound made up of a single chain of amino acid residues linked by peptide bonds. The term "protein" as used herein may be synonymous with the term "polypeptide" or may refer, in addition, to a complex of two or more polypeptides. In the context of the present invention, a "protein complex" refers to multiple copies of the same protein or protein fragment that bind to a single ribonucleotide fragment. Generally, but not always, polypeptides and proteins are formed predominantly of naturally occurring amino acids.

A "variant" polynucleotide sequence may encode a "variant" amino acid sequence which is altered by one or more amino acids from the reference polypeptide sequence. The variant polynucleotide sequence may encode a variant amino acid sequence which contains

"conservative" substitutions, wherein the substituted amino acid has structural or chemical properties similar to the amino acid which it replaces. In addition, or alternatively, tiie variant polynucleotide sequence may encode a variant amino acid sequence which contains "non- conservative" substitutions, wherein the substituted amino acid has dissimilar structural or chemical properties to the amino acid which it replaces.

The terms "substantially purified" and "isolated", refer to molecules, either polypeptides or polynucleotides, that are removed from the components that naturally accompany them. Such polypeptides or polynucleotides have been separated from other components, and are at least 75% free, preferably 85 to 95% free and more preferably 98% or more free from other components with which they are naturally associated.

Variant polynucleotides may also encode variant amino acid sequences which contain amino acid insertions or deletions, or both. Furthermore, a variant polynucleotide may encode the same polypeptide as the reference polynucleotide sequence but, due to the degeneracy of the genetic code, has a polynucleotide sequence which is altered by one or more bases from the reference polynucleotide sequence. As used herein, the term "polynucleotide" refers to a polymeric molecule having a backbone that supports bases capable of hydrogen bonding to typical polynucleotides, where the polymer backbone presents the bases in a manner to permit such hydrogen bonding in a sequence specific fashion between the polymeric molecule and a typical polynucleotide (e.g., single-stranded DNA). Such bases are typically inosine, adenosine, guanosine, cytosine, uracil and thymidine. Polymeric molecules include double and single stranded ribonucleic acids (RNA) and deoxyribonucleic acids (DNA), and may include polymers having backbone modifications such methylphosphonate linkages.

A nucleic acid may be double stranded, single stranded, or contain portions of both double stranded and single stranded sequence. The depiction of a single strand also defines the sequence of the other strand and thus also includes the complement of the sequence which is depicted.

As used herein, the term "recombinant nucleic acid" refers to nucleic acid, originally formed in vitro, in general, by the manipulation of nucleic acid by endonucleases, in a form not normally found in nature. As used herein, the terms "promoter" or "promoter segment" refer to a sequence of DNA that functions to direct transcription of a downstream gene. The promoter will generally be appropriate to the host cell in which the target gene is being expressed. The promoter together with other transcriptional and translational regulatory nucleic acid sequences (also termed "control sequences") are necessary to express a given gene. In general, the transcriptional and translational regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences.

As used herein, the term "regulatable promoter" refers to any promoter whose activity is affected by specific environmental or developmental conditions (e.g., a tomato E4 or E8 promoter). As used herein, the term "constitutive promoter" refers to any promoter that directs RNA production in many or all tissues of a plant transformant at most times.

As used herein, the term "operably linked" relative to a recombinant DNA construct or vector means nucleotide components of the recombinant DNA construct or vector are in a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase.

As used herein, the term "gene" means the segment of RNA, DNA or copy DNA (cDNA) involved in producing a polypeptide chain, which may or may not include regions preceding and following the coding region, e.g. 5' untranslated (5' UTR) or "leader" sequences and 3' UTR or "trailer" sequences

As used herein, the term "sequence identity" means nucleic acid or amino acid sequence identity in two or more aligned sequences, aligned using a sequence alignment program. Sequence searches are preferably carried out using a BLASTN or BLASTP program when evaluating a given nucleic acid or amino acid sequence, respectively, relative to sequences in public databases.

The BLASTX program is preferred for searching nucleic acid sequences that have been translated in all reading frames against amino acid sequences in the GenBank Protein Sequences and other public databases. Both BLASTN and BLASTX are run using default parameters of an open gap penalty of 11.0, and an extended gap penalty of 1.0, and utilize the BLOSUM-62 matrix. (See, Altschul, et al, 1997.)

The term "% homology" is used interchangeably herein with the term " % identity" herein and refers to the level of identity between two amino acid or nucleic acid sequences, i.e. 70% homology means the same thing as 70% sequence identity as deterrnined by a defined algorithm, and accordingly a homologue of a given sequence has at least about 80%, preferably about 90%, more preferably about 95 % sequence identity over a length of the given sequence.

A preferred alignment of selected sequences in order to determine "% identity" between two or more sequences, is performed using the CLUSTAL-W program in the Megaline DNASTAR program, operated with default parameters, including an open gap penalty /gap length penalty of 10.0. In some cases, the Clustal program from the Baylor Medical School: found at http://dot.imgen.bcm. tmc.edu:9331/multi-align/multi-align.html is used with default parameters).

A nucleic acid sequence is considered to be "selectively hybridizable" to a reference nucleic acid sequence if the two sequences specifically hybridize to one another under moderate to high stringency hybridization and wash conditions. Hybridization conditions are based on the melting temperature (Tm) of the nucleic acid binding complex or probe. For example, "maximum stringency" typically occurs at about Tm-5°C (5° below the Tm of the probe); "high stringency" at about 5-10° below the Tm; "intermediate stringency" at about 10-20° below the Tm of the probe; and "low stringency" at about 20-25° below the Tm. Functionally, maximum stringency conditions may be used to identify sequences having strict identity or near-strict identity with the hybridization probe; while high stringency conditions are used to identify sequences having about 80% or more sequence identity with the probe.

High stringency hybridization conditions are well known in the art (see, for example, Sambrook, et al (1989) Chapters 9 and 11, and in Ausubel, F.M., et al, 1993, expressly incorporated by reference herein). An example of high stringency conditions includes hybridization at about 42° C in 50% formamide, 5X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg/ml denatured carrier DNA followed by washing two times in 2X SSC and 0.5% SDS at room temperature and two additional times in 0.1X SSC and 0.5% SDS at 43°C.

A "heterologous" nucleic acid construct or sequence has a portion of the sequence which has been introduced into the plant cell in which it is expressed. Heterologous, with respect to a coding sequence may refer to a coding sequence that has been modified from the form in which it is found in nature. Generally, heterologous nucleic acid are introduced into a cell, by transfection, microinjection, electroporation, or the like. The sequences may contain a control sequence/DNA coding sequence combination that is the same as, or different from a control sequence/DNA coding sequence combination found in the native plant.

As used herein, the terms "chimeric gene construct" and "chimeric nucleic acid construct" are used interchangeably and refer to recombinant nucleic acid sequences which comprise a DNA coding sequence and control sequences required for expression of the coding sequence in a plant cell. As used herein, the term "plant" refers to whole plants, plant organs (for example, leaves, stems, roots, etc.), seeds, and plant cells and progeny of same. The term "plant cell", as used herein includes, without limitation, seeds, fruits, suspension cultures, embryos, meristematic regions, callus tissue, leaves roots shoots, gametophytes, sporophytes, pollen, and microspores. The class of plants which can be used in the methods of the present invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledenous and dicotyledenous plants. Particularly preferred are vining plants, and more particularly preferred are grapevines of the genus Vitis vinifera.

As used herein, "transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. The heterologous polynucleotide may be stably integrated within the host cell genome such that the polynucleotide is passed on to successive generations. Alternatively, the heterologous polynucleotide may be integrated within an extrachromosomal element of the the host plant.

As used herein, the terms "transformed", "stably transformed" or "transgenic" refer to a plant cell that has a non-native (heterologous) nucleic acid sequence integrated into its genome which is maintained through two or more generations. "Transgenic" is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

Thus a plant having within its cells a heterologous polynucleotide is referred to herein as a transgenic plant. The heterologous polynucleotide can be either stably integrated into the genome, or can be extra-chromosomal. Preferably, the polynucleotide of the present invention is stably integrated into the genome such that the polynucleotide is passed on to successive generations. The polynucleotide is integrated into the genome alone or as part of a recombinant expression cassette. "Transgenic" is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acids including those transgenics initially so altered as well as those created by sexual crosses or asexual reproduction of the initial transgenics.

As used herein, "heterologous" in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter may be operably linked to a heterologous structural gene which is from a species different from that from which the structural gene was derived, or, if from the same species, one or both are substantially modified from their original form. A heterologous protein may originate from a foreign species, or, if from the same species, may be substantially modified from its original form by deliberate human intervention. As used herein "recombinant expression cassette" refers to a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements which permit transcription of a particular nucleic acid in a target cell. The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. "Expression" may refer to the transcription of nucleic acid alone, or the further production of protein by translation of the nucleic acid.

Normally, included with the DNA construct will be a structural gene having the necessary regulatory regions for expression in a host and providing for selection of transformant cells. The gene may provide for resistance to a cytotoxic agent, e.g. antibiotic, heavy metal, toxin, etc., complementation providing prototrophy to an auxotrophic host, viral immunity or the like. Depending upon the number of different host species the expression construct or components thereof are introduced, one or more markers may be employed, where different conditions for selection are used for the different hosts. Where Agrobacteήum is used for plant cell transformation, a vector may be used which may be introduced into the Agrobacteήum host for homologous recombination witfi T-DNA or the Ti- or Ri-plasmid present in the Agrobacteήum host. The Ti- or Ri-plasmid containing the T-

DNA for recombination may be armed (capable of causing gall formation) or disarmed (incapable of causing gall formation), the latter being permissible, so long as the vir genes are present in the transformed Agrobacteήum host. The armed plasmid can give a mixture of normal plant cells and gall.

In some instances where Agrobacteήum is used as the vehicle for transforming host plant cells, the expression or transcription construct bordered by the T-DNA border region(s) will be inserted into a broad host range vector capable of replication in E. coli and Agrobacterium, there being broad host range vectors described in the literature. Commonly used is pRK2 or derivatives thereof. See, for example, Ditta, et al. (1980) and EPA 0 120 515, which are incorporated herein by reference. Alternatively, one may insert the sequences to be expressed in plant cells into a vector containing separate replication sequences, one of which stabilizes the vector in E. coli, and the other in Agrobacterium. See, for example, McBride and Summerfelt,

(1990), wherein the pRiHRI (Jouanin, et al, 1985) origin of replication is utilized and provides for added stability of the plant expression vectors in host Agrobacterium cells.

Included with the expression construct and the T-DNA will be one or more markers, which allow for selection of transformed Agrobacterium and transformed plant cells. A number of markers have been developed for use with plant cells, such as resistance to chloramphenicol, kanamycin, the aminoglycoside G418, hygromycin, or the like. The particular marker employed is not essential to this invention, one or another marker being preferred depending on the particular host and the manner of construction.

For transformation of plant cells using Agrobacterium, explants may be combined and incubated with the transformed Agrobacterium for sufficient time for transformation, the bacteria killed, and the plant cells cultured in an appropriate selective medium. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be grown to seed and the seed used to establish repetitive generations and for isolation of vegetable oils.

There are several possible ways to obtain the plant cells of this invention which contain multiple expression constructs. Any means for producing a plant comprising a construct having a nucleic acid sequence of the present invention, and at least one other construct having another

DNA sequence encoding an enzyme are encompassed by the present invention. For example, the expression construct can be used to transform a plant at the same time as the second construct either by inclusion of both expression constructs in a single transformation vector or by using separate vectors, each of which express desired genes. The second construct can be introduced into a plant which has already been transformed with the first expression construct, or alternatively, transformed plants, one having the first construct and one having the second construct, can be crossed to bring the constructs together in the same plant.

The terms "polymerase chain reaction" and "PCR" refer to a process of amplifying one or more specific nucleic acid sequences, as further described below. As used herein, a "means for effecting amplification of GLRaV-specific sequences" refers to component of a PCR reaction wherein annealing, extension and denaturation steps are accomplished by varying the temperature of the reaction mixture in a repeating cyclical manner. A "thermal cycler", such as Perkin Elmer Model 9600, is typically used to regulate the reactions.

As used herein, a "a means for detecting the sequences so amplified" refers to spectrophotometric or electrophoretic means including gel electrophoresis followed by EthBr staining or detection by hybridization with a radiolabeled probe. Fragments may be isolated from a gel following electrophoresis and purified using a QIAEX II or QIAQUICK Gel Extraction kit (Qiagen).

II. CLOSTEROVIRUSES AND GRAPEVINE LEAFROLL-ASSOCIATED VIRUSES

Grapevine leafroll associated viruses (GLRaV) are a group of viruses that collectively or individually are associated with leafroll disease in grapevines. To date, eight different viruses have been found to be associated with the disease. The disease is of economical importance and limits the production of grapes (Vitis species), throughout the world. GLRaVs belong to the closterovirus group, and it has been known for quite some time that the viruses associated with grapevine leafroll disease (except GLRaV-2) have coat proteins that appear to be larger in molecular weight than other types of viruses that belong to the closterovirus group. Based on sodium-dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE), the molecular weights of GLRaV- 1, -3 and -4 coat proteins have been determined to be 38, 43 and 36 kD, respectively (Monis J and Bestwick RK, 1997). In contrast, other closteroviruses, beet yellow virus (BYV), citrus tristeza virus (CTV), and GLRaV-2 have coat proteins with a molecular weight of 22-24 kD.

All closteroviruses characterized so far have a second or duplicate coat protein sequence of unknown function. This duplicate coat protein was reported to be located at the tips of BYV genomic RNA by immunosorbent electron microscopy using a recombinant duplicate coat protein antiserum (Agranovsky, A.A., Leseman, D.E., Maiss, E., Hull, R., and Atabekov. J., 1995).

Such duplicate coat protein sequences generally differ from the main coat protein sequence, but in all cases analyzed to date, have the same signature sequences as the main coat protein sequence. Only partial sequences are currently available for GLRaVs. See, e.g. , U.S. Pat. No.

5,907,085, issued May 25, 1999. Relevant sequences which are available in GenBank include Accession numbers, GLA15890, a GLRaV-1 partial HSP 70 sequence; AF039204, a GLRaV-2 65 kDa chaperone protein; AF037268, a GLRaV-3 59 kDa protein (US); GLAY15891, a GLRaV-3 partial HSP70 sequence (Italian); AF039553, a GLRaV-4 partial HSP 70 sequence 197 amino acid protein (encoded by 601 nucleotides); AF039552, a GLRaV-5 partial HSP 70 sequence 196 amino acid protein (encoded by 588 nucleotides); and Y15987, a GLRaV-7 partial HSP 70 sequence.

A comparison of published nucleotide sequences from GLRaV-3 (GenBank Accession Number AF037268) and GLRaV-2 (GenBank Accession Number AF039204), indicated that although GLRaV-2 is similar to previously characterized closteroviruses, e.g. , BYV, GLRaV-3 is distinct in both genome organization and sequence relatedness.

The sequence and molecular data available on genome organization further indicates that the order of the capsid protein and duplicate protein is in the reverse order in GLRaV-3, and -5, relative to typical closteroviruses (Dolja, 1994).

All closteroviruses characterized so far also have a heat shock protein 70 (HSP 70) homologue. (See, e.g. , Dolja, et al. , 1994). An alignment of the amino acid sequences of the HSP 70 protein sequence from GLRaV-2, GLRV-3, GLRaV-5, and GLRaV-8, is presented in Figure 6A-B. The alignment indicates various portions of the sequence are conserved among most GLRaV HSP 70 amino acid sequences reported to date. HSP 70 has been proposed to play a role in protein-protein interactions such as viral assembly, and cell to cell movement. (Dolja et al , 1994; Peremyslov et al, 1999). The HSP 70 homologue gene and the polypeptide encoded by it is unique to the plus sense RNA closterovirus group, and the N-terminal ATPase domain of HSP 70 is highly conserved among closteroviruses.

The amino acid sequence of Domains A, C and D share sequence homology with other cellular HSP 70 sequences and are characteristic of proteins containing ATPase activity in the N- terminus. The other domains share sequence homology with other grapevine associated closteroviruses characterized thus far.

An alignment of the GLRaV-5 coat protein amino acid sequence (SEQ ID NO: 3), the GLRaV-5 duplicate coat protein amino acid sequence (SEQ ID NO: 7), and the GLRaV-8 coat protein amino acid sequence (SEQ ID NO: 9), and other known GLRaV coat protein sequences is presented in Figs. 7A-B, with the SNRDG signature sequence, characteristic of GLRaV coat protein sequences shown as highlighted. The comparison indicates that the GLRaV-5 coat protein sequence is more related to GLRaV-3 than to other grapevine associated closteroviruses. A comparison of HSP 70, capsid and duplicate capsid protein sequences from GLRaV-3, GLRaV-2 and other closteroviruses is provided by Ling et al. , 1998 and Zhu et al. , 1998. Coat proteins of BYV (Beet yellows virus), CTV (citrus tristeza virus), LIYV (Lettuce infectious yellows virus) as well as their duplicate coat proteins have also been shown to have a SNRDG signature sequences.

III. GLRaV POLYNUCLEOTIDES AND POLYPEPTIDES The GLRaV coat protein coding sequences of the invention were isolated by performing the steps of (1) infecting plants with GLRaV, (2) isolating RNA from such infected plants, (3) carrying out a cDNA synthesis reaction using random primers, (4) preparing double stranded

DNA (dsDNA), (5) ligating adaptors to the ds DNA, (6) generating a library of adaptor-ligated dsDNA, (6) performing 3'RACE PCR to obtain a GLRaV fragment, (7) extending the 3' RACE PCR product by performing PCR using a gene-specific primer together with an adaptor-specific primer to obtain a longer fragment, (8) ligating the fragment into a cloning vector , sequencing it and repeating step (7) with a different gene-specific primer until a full length sequence is obtained.

The Vitis cultivars used in developing the present invention were the LR 100 isolate which is infected with GLRaV-5 and the LR 102 isolate which is infected with LR-1, LR-2, LR-

5, and LR-8. Such grape cultivars are publicly available, e.g. , from the "U.C. Grapevine Virus

Collection" Foundation Plant Material Service at the University of California, Davis (Golino,

D.A., 1992).

In some cases, virus was purified according to standard methods for closterovirus purification, such as those described by Hu, et al. , 1990 and Zee, et al. , 1987, both of which are expressly incorporated by reference herein. In other cases, viral RNA is isolated essentially as described in the RNeasy kit (Qiagen). cDNA libraries were generated using RNA isolated from infected grape cultivars, e.g. ,

LR100 for GLRaV-5 and LR102 for GLRaV-8, using random hexamers as described by Monis and de Zoeten, 1990.

PCR accessible cDNA libraries were made with Clontech's Marathon cDNA

Amplification Kit using random primers [Clontech Laboratories, Inc., Palo Alto, CA], following the manufacturer's protocol. Briefly, after first and second-strand cDNA synthesis, adaptors were ligated to the polished ends of the double-stranded cDNA. After the libraries were constructed, modified adaptors were ligated to the digested DNA fragments, such that the adaptor defined one end of a PCR template, yielding a library of adaptor ligated double stranded DNA (ds DNA).

Rapid amplification of 3' ends (3' RACE) PCR was carried out using this library according to the Marathon cDNA Amplification kit instruction manual. Degenerate primers designed from the conserved HSP 70 closterovirus region (Karasev et al , 1991, Tian et al, 1996) were used to produce viral specific primers for RACE PCR. Approximately 600 bp fragments corresponding to the HSP 70 gene of GLRaV-5 and -8 were cloned and sequenced.

HSP 70 sequence specific primers were designed based on the cloned sequences and used to "walk" in a PCR-accessible library (using MARATHON cDNA Amplification kit, Clontech), 5 towards the 3' end of the genome. Each PCR fragment so generated was cloned and sequenced and used for the design of the next "walking primer". This process was repeated several times until enough sequence information was obtained to identify specific closterovirus coat protein amino acid signature sequences.

For GLRaV-5, the HSP 70 sequence was extended by use of GSP8 (SEQ ID NO: 15), 0 GSP12 (SEQ ID NO:16), GSP15 (SEQ ID NO:17) and GSP23 (SEQ ID NO:18) primers yielding 5 clones for a total of approximately 4.8 kb. A complete GLRaV-5 coding sequence amplified from viral cDNA is presented in Figure 1 (SEQ ID NO: l).

For GLRaV-8, the HSP 70 sequence was extended by use of GSP4 (SEQ ID NO:23), GSP27 (SEQ ID NO:24), GSP28 (SEQ ID NO:26) and GSP29 (SEQ ID NO:27) primers yielding 5 5 clones for a total of approximately 4.6 kb. A partial GLRaV-8 coat protein coding sequence amplified from viral cDNA is presented in Figure 2 A (SEQ ID NO: 8).

Once the sequence was identified, primers were designed to clone the isolated coat protein coding sequences. For GLRaV-5, the complete coat protein was cloned using the LR-5 CP start codon primer (SEQ ID NO: 19) (for in vitro CP expression only), the LR5-3F (SEQ ID o NO:20), and LR5-2R primers (SEQ ID NO:21).

GLRaV-5 SEQUENCES

Approximately 4700 nucleotides of the GLRaV-5 genome were sequenced, indicating four open reading frames, designated herein as ORF1-ORF4. ORF1 includes the coding sequence for a 530 amino acid polypeptide with an estimated molecular weight of 58 kD which has sequence homology to the cellular heat shock protein HSP 70. The HSP 70 homologue gene and the polypeptide encoded by it is unique to the (+) sense RNA closterovirus group, and the N-terminal ATPase domain of HSP 70 is highly conserved among closteroviruses. HSP 70 has been proposed to play a role in protein-protein interactions such as in assembly of multiunit complexes for genome replication, viral assembly, or cell to cell movement. (See, e.g. , Dolja et al , 1994.)

Alignment of the HSP 70 coding region from GLRaV-5 with a similar region from other grapevine-associated closteroviruses indicates conserved motifs (Figs. 6A-B). The use of degenerate primers (Tian et al. , 1996) to clone the 5' portion of the HSP 70 homologue gene, yielded clones lacking the first 4 amino acids. A pairwise comparison of the amino acid sequence of the GLRaV-5 HSP 70 protein with the non redundant GenBank CDS translations + PDB + Swiss Prot + PIR + PRF database on June 23, 1999, revealed 98% sequence identity between the partial amino acid sequence of the GLRaV-5 HSP 70 homologue (Routh et al , 1998); 93% identity with the partial amino acid sequence of the GLRaV-4 HSP 70 (Routh, et al. , 1998); 32 % identity with the GLRaV-3 HSP 70 amino acid sequence (Ling et al. , 1998); and 29% sequence identity with the GLRaV-2 HSP 70 amino acid sequence (Zhu, et al , 1998).

ORF2 includes the coding sequence for a 475 amino acid polypeptide with an estimated molecular weight of 51 kD. A pairwise comparison of ORF2 with sequences found in the non redundant database, performed on July 8, 1999, revealed 51 % sequence homology with GLRaV- 3 ORF 5 (55 kD polypeptide, amino acids 324-384). The comparison suggests that ORF2 is a positional homologue of the HSP 90 gene reported in typical closteroviruses (Ling, et al, 1998). The function of the polypeptide encoded by ORF2 has yet to be identified.

ORF 3 includes the coding sequence for a 269 amino acid polypeptide with an estimated molecular weight of 29 kD. This ORF was identified as the viral capsid protein based on the presence of a five amino acid signature sequence, SNRGD, found in other filamentous viruses (Dolja et al , 1991).

In addition, ORF 3 was subcloned into a bacterial expression vector an MBP-CP fusion protein and overproduced (Example 2). This fusion protein was found to be specifically immunoreactive with anti-GLRaV-5 capsid protein antibodies.

A pairwise comparison of the GLRaV-5 capsid protein amino acid sequence with sequences found in the non redundant database conducted on June 23, 1999, revealed sequence identity to other previously characterized closteroviruses: 37% identity with GLRaV-3 capsid protein amino acid sequence (Ling, et al , 1998) and 21 % identity with the beet yellows stunt virus (BYSV).

ORF 4 includes the coding sequence for a 207 amino acid polypeptide with an estimated molecular weight of 23 kd. Sequence analysis indicates that OFR4 encodes a partial sequence of the GLRaV-5 duplicate coat protein based on the presence of 3 out of 5 amino acids (SNG), of the signature sequence found in closterovirus capsid and duplicate capsid proteins. A pairwise comparison of the amino acid sequence encoding the GLRaV-5 putative duplicate capsid protein with sequences found in the non redundant database, conducted on June 23, 1999, revealed sequence identity to a partial sequence encoded by an unknown gene isolated from GLRaV-4 (70% identity 77/110) (GenBank Accession Number AF030168).

The sequence of the GLRaV-5 gene indicates that the capsid protein coding sequence is located upstream from the duplicate capsid protein coding sequence, similar to that reported for GLRaV-3. This is in contrast to in BYV, CTV, and GLRaV-2, wherein the duplicate coat protein coding sequence is located upstream from the capsid protein coding sequence.

The GLRaV-5 coat protein coding sequence contains a start codon at nucleotides 3285 to 3287, a stop codon at nucleotides 4092 to 4094 and the SNRDG signature sequences (shown in Figs. 6A-B as highlighted). A Basic BLASTN search (http://www.ncbi.nlm.nih.gov/BLAST) of non-redundant nucleic acid sequence databases, conducted on June 23, 1999, through NCBI (http://www.ncbi.nlm.nih.gov/index.html) with the GLRaV-5 coat protein coding sequence presented in Figure 1 (SEQ ID NO:l), revealed no significant sequence identity between sequences available in GenBank and nucleic acids 3285-4094 of the GLRaV-5 coat protein coding sequence.

The predicted amino acid sequence for the GLRaV-5 coat protein was determined using Mac Vector, and is presented in Figure 3 (SEQ ID NO:3). A Basic BLASTP search (http://www.ncbi.nlm.nih.gov/BLAST) of the Swiss-Prot database, conducted on June 23, 1999, through NCBI (http://www.ncbi.nlm.nih.gov/ index.html) with the GLRaV-5 coat protein amino acid sequence indicated 37% sequence identity to GenBank Accession Number AF037268 (GLRaV-3 capsid protein gene and 21 % sequence identity to GenBank Accession Number U51931 (Beet yellow stunt virus capsid protein).

A GLRaV-5 coat protein duplicate coding sequence was identified and shown to exhibit a start codon at nucleotides 4128 to 4130, a stop codon at nucleotides 4751 to 4753, and an SNGD signature sequence (shown in Figs. 7A-B as highlighted). A Basic BLASTN search

(http://www.ncbi.nlm.nih.gov/BLAST) of non-redundant nucleic acid sequence databases, conducted on June 23, 1999, through NCBI (http://www.ncbi.nlm.nih.gov/index.html), with the GLRaV-5 coat protein coding sequence presented in Figure 7A-B (SEQ ID NO:6), revealed 89% sequence identity between GenBank Accession Number AF03168 (GLRaV-4 unknown gene) and nucleotides 148-250 of the GLRaV-5 duplicate coat protein coding sequence.

The predicted amino acid sequence for the GLRaV-5 duplicate coat protein was determined using MacVector, and is presented in Figure 3C (207 amino acids; SEQ ID NO:7). A Basic BLASTP search (http://www.ncbi.nlm.nih.gov/BLAST) of the non redundant database (conducted on June 23, 1999, through NCBI (http://www.ncbi. nlm.nih.gov/index.html) with the GLRaV-5 coat protein duplicate amino acid sequence revealed 70% sequence identity between

GenBank Accession Number AF03168 (amino acids 16-150) (GLRaV-4 unknown gene) and amino acids 41-124 of the GLRaV-5 duplicate coat protein amino acid sequence.

A GLRaV-5 HSP 70 homologue protein coding sequence was identified and is presented in Fig. 1 (SEQ ID NO:4). The GLRaV-5 HSP 70 homologue protein coding sequence exhibits a stop codon at nucleotides 1591 to 1593. A basic BLASTN search

(http://www.ncbi.nlm.nih.gov/BLAST) of non-redundant nucleic acid sequence databases, conducted on June 23, 1999, through NCBI (http://www.ncbi.nlm.nih.gov/index.html) indicates that nucleotides 4-578 of the GLRaV-5 HSP 70 homologue coding region share 99% sequence identity with nucleotides 3-577 of GenBank Accession Number AF039552 (partial GLRaV-5 HSP 70 homologue) and 77% sequence identity with nucleotides 1-578 of GenBank Accession Number AF039553 (partial GLRaV-4 HSP 70 homologue), respectively.

The predicted amino acid sequence for the GLRaV-5 HSP 70 homologue protein was determined using MacVector, and is presented in Figure 3B (amino acids 1-530 of SEQ ID NO:5). A Basic BLASTP search (http://www.ncbi.nlm.nih.gov/BLAST) of the non-redundant database, conducted on June 23, 1999, through NCBI (http://www.ncbi.nlm.nih.gov/ index.html) with the GLRaV-5 HSP 70 homologue amino acid sequence indicates that amino acids 2-197 and amino acids 1-197 of the GLRaV-5 HSP 70 homologue sequence share 98% sequence identity with GenBank Accession Number AF039552 (GLRaV-5) and 90% sequence identity with GenBank accession Number AF 039553 (GLRaV-4).

A BLASTP search further revealed that amino acids 1-530 of the GLRaV-5 HSP 70 homologue sequence share 59% identity with GenBank Accession Number AF039204 (GLRaV-2 USA) and 28% identity with GenBank Accession Number Y 14131 (GLRaV-2 Italian), respectively, and that amino acids 1-433 of the GLRaV-5 HSP 70 homologue sequence shares 30% identity with GenBank Accession Number U51931 (BYSV).

Putative GLRaV-8 Sequences

Approximately 4600 nucleotides of the putative GLRaV-8 genome were sequenced, indicating at least two open reading frames, designated herein as ORF1-ORF2.

ORF1 includes the coding sequence for a 456 amino acid polypeptide with an estimated molecular weight of 49 kD which is homologous to the cellular heat shock protein HSP 70. An alignment of the amino acid sequence for HSP 70 with the amino acid sequence from other grapevine-associated closteroviruses revealed the presence of conserved motifs (Figs. 6A-B).

A pairwise comparison of GLRaV- 1 HSP 70 protein conducted on July 8, 1999, through the non redundant database 97% identity with the partial sequence of the Italian strain of GLRaV- 3 HSP 70 (Y15891); 46% identity with the sequence of GLRaV-3 HSP 70 (Ling, et al , 1998); 32% sequence identity with GLRaV-2 HSP 70 (Zhu, et al , 1998); 30% sequence identity with beet yellows virus (BYV), sugar beet yellows virus (SBYV) HSP 70 homologue genes.

ORF 2 includes the coding sequence for a 90 amino acid polypeptide with an estimated molecular weight of 10 kD. The polypeptide was identified as the partial GLRaV-8 capsid or duplicate capsid polypeptide based on the presence of 3 out of the 5 amino acid signature sequence (SNR), found in other closteroviruses (Zhu, et al. , 1998). An alignment of the deduced amino acid of this ORF and the amino acid sequence of the capsid and duplicate capsid proteins from other characterized grapevine associated closteroviruses is shown in Figs. 7A-B.

A pairwise comparison of the putative GLRaV-8 capsid protein amino acid sequence, conducted on June 23, 1999, through the non redundant database revealed no significant sequence similarity to the sequence of proteins available in GenBank except for the invariant amino acid sequences, described above.

The GLRaV-8 coat protein coding sequence contains a putative start codon at nucleotides 1 to 3, a stop codon at nucleotides 271 to 273, and the NRD signature sequence. A nucleotide sequence encoding the partial GLRaV-8 coat protein is presented in Figure 2 A (nucleotides 1-270 of SEQ ID NO:8). A Basic BLASTN search (http://www.ncbi.nlm.nih.gov/BLAST) of non- redundant nucleic acid sequence databases through NCBI (http://www.ncbi.nlm. nih.gov/ index.html), conducted on June 23, 1999, with the partial GLRaV-8 coat protein coding sequence revealed no significant sequence identity between GenBank sequences and 273 bp of the nucleic acid sequence which encodes a partial GLRaV-8 coat protein. The predicted amino acid sequence based on the partial coding sequence for the GLRaV-

8 coat protein was determined using MacVector, and is presented in Figure 4A (90 amino acids; SEQ ID NO:9). A Basic BLASTP search (http://www.ncbi.nlm.nih.gov/ BLAST) of the Swiss- Prot database, conducted on June 23, 1999, through NCBI (http://www. ncbi.nlm. nih.gov/index.html) with the predicted amino acid sequence for the partial GLRaV-8 coat protein revealed no significant sequence identity to sequences available in GenBank.

A CLUSTAL W alignment of the coat protein amino acid sequences from other grapevine associated closteroviruses including GLRaV-2, GLRaV-3, GLRaV-5, and the GLRaV- 5 duplicate coat protein was carried out using the DNASTAR Megaline program or Clustal through the Baylor Medical School (see Figs. 7A-B). A putative GLRaV-8 HSP 70 homologue protein coding sequence was identified and is presented in Fig. 2B (1384 nucleotides; SEQ ID NO: 10). The GLRaV-8 HSP 70 homologue protein coding sequence exhibits a stop codon at nucleotides 1382 to 1384. A basic BLASTN search (http://www.ncbi. nlm.nih.gov/ BLAST) of non-redundant nucleic acid sequence databases, conducted on July 8, 1999, through NCBI (http://www. ncbi.nlm.nih.gov/index.html) with the putative GLRaV-8 HSP 70 homologue protein coding sequence indicates that nucleotides

40-588 of the GLRaV-8 HSP 70 homologue coding region shares 85 % sequence identity with

GenBank Accession Number GLAY15891.

The predicted amino acid sequence for the GLRaV-8 HSP 70 homologue protein was determined using MacVector, and is presented in Fig. 4B (amino acids 1-460 of SEQ ID NO: 11). A Basic BLASTP search (http://www.ncbi.nlm.nih.gov/BLAST) of the non-redundant database, conducted on June 23, 1999, through NCBI (http://www.ncbi.nlm.nih.gov/ index.html) with the GLRaV-8 HSP 70 homologue amino acid sequence indicates that amino acids 1-440 of the GLRaV-1 HSP 70 homologue amino acid sequence share 46% sequence identity with GenBank Accession Number AF037268 (GLRaV-3 HSP 70), amino acids 6-196 share 89% sequence identity with GenBank Accession Number Y15891 (Italian GLRaV-3 HSP), and amino acids 1- 436 share 33 % identity with GenBank Accession Number AF05675 (beet yellows virus).

Variant GLRaV Polynucleotides. Polypeptides And Proteins In one aspect, the invention provides a GLRaV-5 or GLRaV-8 coat protein or polypeptide. A polypeptide is a "GLRaV-5 coat or capsid polypeptide" or "GLRaV-5 coat or capsid protein" if the amino acid sequence has at least about 80% or 85 % , preferably greater than about 90% or 95% sequence identity to the amino acid for the GLRaV-5 or GLRaV-8 coat protein, as presented in SEQ ID NO:3 or SEQ ID NO:9. In some cases, the identity will be as high as about 98 % . The invention further provides the nucleotide sequence encoding such GLRaV-5 or GLRaV-8 coat proteins or polypeptides. In a related aspect, the invention provides a polynucleotide sequence encoding a GLRaV-

5 or GLRaV-8 coat protein or polypeptide wherein the polynucleotide sequence has at least about 80% or 85%, preferably greater than about 90% or 95% sequence identity to the coding sequence for a GLRaV-5 or GLRaV-8 coat protein, as presented in SEQ ID NO:2 or SEQ ID NO:8. In some cases, the identity will be as high as about 98%. In another aspect, the invention provides a GLRaV-5 or GLRaV-8 HSP70 protein or polypeptide. A polypeptide is a "GLRaV-8 HSP 70 polypeptide" or a "GLRaV-5 HSP 70 protein" if the amino acid sequence has at least about 80% or 85 %, preferably greater than about 90% or 95% sequence identity to the amino acid for the GLRaV-5 or GLRaV-8 HSP70 protein or polypeptide, as presented in SEQ ID NO: 5 or SEQ ID NO:l l . In some cases, the identity will be as high as about 98%. The invention further provides the nucleotide sequence encoding such GLRaV-5 or GLRaV-8 HSP 70 proteins or polypeptides.

The invention further provides a polynucleotide sequence encoding a GLRaV-5 or GLRaV-8 HSP70 protein or polypeptide wherein the polynucleotide sequence has at least about 80% or 85%, preferably greater than about 90% or 95% sequence identity to the coding sequence for a GLRaV-5 or GLRaV-8 HSP70 protein or polypeptide, as presented in SEQ ID NO:4 or SEQ ID NO: 10. In some cases, the identity will be as high as about 98% .

For GLRaV-5, the invention also provides an approximately 4766 nucleotide sequence (SEQ ID NO:l), which includes the coding sequences for a GLRaV-5 coat protein (SEQ ID NO:2, nucleotides 3285-4094 of SEQ ID NO:l), a GLRaV-5 HSP70 homologue protein (SEQ ID NO:4, nucleotides 1 to 1593 of SEQ ID NO: 1), a GLRaV-5 duplicate coat protein (SEQ ID NO:6, nucleotides 4128 to 4751 of SEQ ID NO:l) in addition to a GLRaV-5 HSP 90 homologue sequence.

In one embodiment, the polynucleotide coding sequences of the invention will hybridize under high stringency conditions to a sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:8, and SEQ ID NO: 10, or the complement thereof.

The polynucleotides may include the coding sequence of GLRaV (i) in isolation, (ii) in combination with additional coding sequences, such as fusion protein or signal peptide, in which the GLRaV coding sequence is the dominant coding sequence, (iii) in combination with non- coding sequences, such as control elements, such as promoter and terminator elements or 5' and/or 3' untranslated regions, effective for expression of the coding sequence in a suitable host, and/or (iv) in a vector or host environment in which the GLRaV coding sequence is a heterologous gene.

The polynucleotide may encode a fragment of GLRaV, corresponding to, e.g., HSP 70. Also contemplated are novel uses of polynucleotide fragments ("oligonucleotides"), typically having at least 15 bases, preferably at least 20-30 bases, corresponding to a region of the coding- sequence polynucleotide. The fragments may be used as probes, primers, antisense agents, and the like, according to known methods.

The polynucleotides may be extended to obtain upstream and downstream sequences such as promoters, regulatory elements, and 5' and 3' untranslated regions (UTRs). Extension of the available transcript sequence may be performed by numerous methods known to those of skill in the art, such as PCR or primer extension (Sambrook, et al. , supra), or by the RACE method using, for example, the Marathon RACE kit (Clontech, Palo Alto, CA).

Another method which has been used to retrieve flanking sequences is that of Parker, J.D., et al , 1991. GLRaV is a ssRNA virus, hence, there is no genomic DNA, and the viral RNA is first converted into cDNA. Preferred libraries for screening for full length cDNAs are ones that have been size-selected to include larger cDNAs. Random primed libraries are preferred in that they will contain more sequences which contain the 5' and upstream regions of GLRaV genes. The polynucleotides and oligonucleotides of the invention can also be prepared by solid- phase methods, according to known synthetic methods. Typically, fragments of up to about 100 bases are individually synthesized, then joined to form continuous sequences up to several hundred bases.

The polynucleotide coding sequences and novel oligonucleotides of the invention have a variety of uses in (1) the synthesis of GLRaV, (2) diagnostics and use as probes, (3) viral gene mapping, and (4) induced plant disease resistance. In accordance with the present invention, polynucleotide sequences which encode GLRaV coat proteins, fragments of the protein, fusion proteins, or functional equivalents thereof, collectively referred to herein as "GLRaV", may be used in recombinant nucleic acid molecules that direct the expression of GLRaV proteins in appropriate host cells. Due to the inherent degeneracy of the genetic code, other nucleic acid sequences which encode substantially the same or a functionally equivalent amino acid sequence may be used to clone and express GLRaV proteins.

As will be understood by those of skill in the art, it may be advantageous to produce GLRaV-encoding nucleotide sequences possessing non-naturally occurring codons. Codons preferred by a particular prokaryotic or eukaryotic host (Murray, E., et al , 1989), can be selected, for example, to increase the rate of GLRaV polypeptide expression or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, than transcripts produced from naturally occurring sequence.

The polynucleotide sequences of the present invention can be engineered in order to alter a GLRaV coding sequence for a variety of reasons, including but not limited to, alterations which modify the cloning, processing and/or expression of the gene product. For example, alterations may be introduced using techniques which are well known in the art, e.g., site-directed mutagenesis, to insert new restriction sites, to alter glycosylation patterns, to change codon preference, and to produce sequence variants having altered biological activity, etc.. The present invention also includes recombinant constructs comprising one or more of the sequences, as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Procedures for making any of a number of suitable vectors and promoters are known to those of skill in the art are described in, for example, Sambrook, et al. (1989): Ausubel, et al. (1989).

A GLRaV coat or HSP 70 polypeptide may be a derivative or variant GLRaV coat or HSP 70 polypeptide. That is, the derivative GLRaV coat or HSP 70 polypeptide will contain at least one amino acid substitution, deletion or insertion, with amino acid substitutions being particularly preferred. The amino acid substitution, insertion or deletion may occur at any residue within the GLRaV polypeptide. As outlined below, particularly preferred substitutions are made within the GLRaV coat polypeptide sequences, presented herein as SEQ ID NO: 3 for GLRaV-5 and SEQ ID NO:9 for GLRaV-8 or within the GLRaV HSP 70 polypeptide sequences, presented herein as SEQ ID NO:5 for GLRaV-5 and SEQ ID NO:l 1 for GLRaV-8. The amino acid sequence of a GLRaV polypeptide or protein of the present invention may be shorter or longer than the amino acid sequences shown in Figures 3A-C and 4A-B, for GLRaV-5 and GLRaV-8 (1), respectively. Thus, in a preferred embodiment, included within the definition of GLRaV polypeptides are portions or fragments of the sequences depicted in Figures 3A-C and 4A-B (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 and SEQ ID NO:l l, respectively).

Preferably, fragments of a GLRaV polypeptide, are at least about 20-100 amino acids in length, more preferably about 100-200 amino acids in length.

The invention also provides an isolated GLRaV-5 duplicate coat polypeptide or protein. In particular, the invention provides an isolated native sequence GLRaV-5 duplicate coat polypeptide or protein, which in one embodiment, includes a 207 amino acid sequence presented in Figure 3C (SEQ ID NO:7).

For sequences which contain either more or fewer amino acids than the GLRaV polypeptides exemplified herein, it is understood that the percentage of similarity or identity will be determined based on the number of similar or identical amino acids in relation to the total number of amino acids. Thus, for example, similarity or identity of sequences shorter than the GLRaV polypeptide exemplified herein will be determined using the number of amino acids in the shorter sequence.

A GLRaV polypeptide of the invention may be (i) a protein in which one or more of the amino acid residues in a sequence listed above are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue), or (ii) a protein in which one or more of the amino acid residues includes a substituent group, or (iii) a protein in which additional amino acids are fused to GLRaV, or (iv) an isolated fragment of the protein which maintains the activity of the full length GLRaV polypeptide. Such fragments, variants and derivatives are deemed to be within the scope of those skilled in the art from the teachings herein.

The amino acid sequence of the GLRaV-5 capsid protein, presented herein as SEQ ID NO:3, has been shown to include the invariant amino acids (S, N, R, G, D) identified in all closteroviruses sequenced thus far. In the GLRaV-8 capsid protein sequence, 3 out of the 5 invariant amino acids have been identified. An alignment of the coat protein amino acid sequences for GLRaV-3 (LR-3), GLRaV-5

(LR-5), GLRaV-2 (LR-2), and their respective duplicate CP, and GLRaV-8 (LR-8) is presented in Figs. 7A-B, with the invariant closterovirus amino acids (S, N, R, G, D), presented as underlined.

The S, R and D residues have been reported as conserved for filamentous viruses in general (Dolja, et al , 1991). The isolated GLRaV-5 polynucleotide has been confirmed to encode a GLRaV capsid protein by Western blot analyses of a recombinant maltose binding fusion protein, and the cleaved recombinant product.

IV. EXPRESSION OF GLRaV COAT PROTEINS

The GLRaV-5 coding sequence was expressed in vitro in a bacterial expression vector, as further described in Example 2. The complete sequence of GLRaV-5 was cloned into a bacterial expression vector as a maltose binding fusion protein pMALc (New England Biolabs, MA). The fusion protein was purified using an amylose column, digested with protease Factor Xa, and analyzed by Western blot using GLRaV-1 polyclonal, GLRaV-2 polyclonal, GLRaV-4 polyclonal, GLRaV-5 monoclonal and polyclonal, GLRaV-8 monoclonal (19A12 mAB), and 15F1 (broad spectrum) monoclonal antibodies. Western blot results indicate that the recombinant protein reacted with GLRaV5 specific antibodies.

V. ANTI-GLRaV ANTIBODIES

The present invention further includes antibodies specifically imrnunoreactive with a GLRaV coat protein. As used herein, the term "antibodies" refers to both polyclonal and monoclonal antibodies, as well as both entire immunoglobulin molecules or any functional fragment thereof. Exemplary antibody fragments include Fab, F(ab')₂, complementarity determining regions (CDRs), V_L (variable light chain region), V_H (variable heavy chain region), and combinations thereof.

Several groups have purified closterovirus-like particles from diseased grape vines and prepared monoclonal antibodies and polyclonal antisera. (Monis J and Bestwick RK, 1997).

In one aspect, the present invention provides an anti-GLRaV coat protein antibody that is specifically imrnunoreactive with GLRaV-5. The antibody has diagnostic applications, particularly for use together with antibodies against other GLRaVs in diagnosing GLRaV infection of Vitis sp.

Polyclonal Antibodies The anti-GLRaV coat protein antibodies of the present invention may be polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Such polyclonal antibodies can be produced in a mammal, for example, following one or more injections of a substantially purified GLRaV coat protein, and preferably, an adjuvant.

Typically, the a purified GLRaV coat protein and an adjuvant are injected into the mammal by a series of subcutaneous or intraperitoneal injections. The immunizing agent may include a purified GLRaV coat protein or a fusion protein thereof. It may be useful to conjugate the antigen to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Adjuvants include, for example, Freund's complete adjuvant and MPL-TDM adjuvant (mono-phosphoryl Lipid A, synthetic trehalose dicorynomycolate). A particular immunization protocol may be determined by one skilled in the art based on standard protocols or by routine experimentation.

Monoclonal Antibodies

Alternatively, the anti-GLRaV coat protein antibodies may be monoclonal antibodies. Monoclonal antibodies may be produced by hybridomas, wherein a mouse, hamster, or other appropriate host animal, is immunized with a GLRaV coat protein to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent

(Kohler and Milstein, 1975)]. Alternatively, the lymphocytes may be immunized in vitro.

The immunizing agent will typically include a substantially purified GLRaV coat protein or polypeptide or a fusion protein thereof. Generally, spleen cells or lymph node cells are used for non-human mammalian sources of monoclonal antibodies. The lymphocytes are fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to produce a hybridoma cell (Goding, 1986). In general, immortalized cell lines are transformed mammalian cells, for example, myeloma cells of rat, mouse, bovine or human origin. The hybridoma cells are cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase

(HGPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT), substances which prevent the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, support stable high level production of antibody, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine or human myeloma lines, which can be obtained, for example, from the American Type Culture Collection (ATCC), Rockville, Maryland. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, 1984; Brodeur, et al, 1987).

The culture medium (supernatant) in which the hybridoma cells are cultured is assayed for the presence of monoclonal antibodies directed against a GLRaV coat protein or polypeptide.

Preferably, the binding specificity of monoclonal antibodies present in the hybridoma supernatant is determined by immunoprecipitation or by an in vitro binding assay, such as radio- immunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Appropriate techniques and assays are known in the art. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, 1980. Preferably an anti-GLRaV coat protein antibody will have a binding affinity of at least 1 x 10^'7 M.

After the desired antibody-producing hybridoma cells are identified, the cells are cloned by limiting dilution procedures and grown by standard methods. Techniques for antibody production are well known in the literature, e.g., as described in Harlow and Lane, 1988 and U.S. Pat Nos. 4,381,292; 4, 451,570 and 4,618,577. In some cases, hybridoma cells are grown in vivo as ascites in a mammal.

The monoclonal antibodies secreted by selected clones are isolated or purified from the culture medium or ascites fluid by immunoglobulin purification procedures routinely used by those of skill in the art such as, for example, protein A-Sepharose, hydroxyl-apatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

Such monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567; Marks, et al , 1992a; Marks, et al, 1992b and Lerner, et al. , 1992, each of which is incorporated by reference, herein. DNA encoding the monoclonal antibodies of the invention can be isolated from the GLRaV coat protein-specific hybridoma cells and sequenced, e.g. , by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies.

Once isolated, the DNA may be inserted into an expression vector, which is then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for the human heavy and light chain constant domains in place of the homologous murine sequences (Morrison, et al. 1984; Neuberger, et al, 1984; Takeda, et al. , 1985), or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. The non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody. The antibodies may also be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, in vitro methods are suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments, particularly, Fab fragments, F(ab')₂ fragments, CDRs, V_L fragments, V_H fragments and combinations thereof, can be accomplished using routine techniques known in the art. VI. METHODS OF DETECTING GLRAV INFECTION

Diagnostic methods for detecting GLRaV infection in specific plant samples, and for detecting levels of expression of GLRaV in plant tissues, also form part of the invention. In one embodiment, a method of detecting RNA which encodes GLRaV in a plant sample, involves the steps of: (a) obtaining a plant nucleic acid extract, (b) hybridizing the complement of a polynucleotide which encodes GLRaV to RNA obtained from a plant sample, thereby forming a hybridization complex, and (c) detecting the hybridization complex, wherein the presence of the complex correlates with the presence of GLRaV RNA in the plant sample. Methods for detecting mutations in the coding region of GLRaV are also contemplated.

A. Immunoassav

Immunological tests, such as ELISA, have been developed for the detection of GLRaVs. (See, e.g., Hu, et al , 1990; Monis and Bestwick, 1996; Monis and Bestwick 1997.) However, the reliability of such tests requires both identification of all closterovirues that contribute to leafroll disease and the development of antibodies capable of detecting such viruses with sufficient sensitivity to ensure the viruses is not passed on during vegetative propagation. The unequal distribution throughout the plant and seasonal variation in expression contribute to the difficulty in developing reliable immunoassays.

An exemplary immunoassay is an ELISA or Western blot assay which includes the steps of (1) grinding infected tissue in extraction buffer as described in Monis and Bestwick, 1996 (for ELISA), or concentrating virus from the grapevine cultivars to be tested, as described in Monis and Bestwick, 1997 (for Western blot), (2) denaturing the virus preparation (Western blot), (3) providing a solid support to which has been bound an antibody which is specifically imrnunoreactive with a GLRaV polypeptide or protein, (4) adding the virus preparation to the solid support, (5) washing the solid support to remove unbound protein, (6) adding a second labeled antibody to the solid support, and (7) detecting the bound GLRaV polypeptide or protein. Such assays may be qualitative or quantitative and include antibodies for detection of one or more GLRaV coat proteins in a single assay, e.g. , by using one or more anti-GLRaV coat protein antibodies having different specificities. It will be understood that given an antibody that is specifically imrnunoreactive with a

GLRaV protein or polypeptide, any of a number of different types of immunoassays may be employed by those of skill in the art to detect the presence of GLRaV in tissue of Vitis sp. Techniques for carrying out such immunoassays are generally known, and include ELISA, Immunogold labeling, Western Blot and i munodotblot, and IC-PCR, as generally described in Harlow and Lane, 1988 and Hu, et al. , 1990. B. PCR

Reverse transcriptase PCR (RT-PCR) and immunocaprure RT-PCR (IC-RT-PCR) may also be used for detection of GLRaV infection in grape plants. (See, e.g. , Routh, G. , et al. , 1998). As is known to those of skill in the art, PCR refers to a process of amplifying one or more specific nucleic acid sequences, by (i) annealing oligonucleotide primers to a single- stranded nucleic acid template in a test sample, (ii) combining the product of (i) with a nucleic acid polymerase to extend the 3' ends of the annealed primers and thereby form a double- stranded nucleic acid product, (iii) denaturing the double-stranded nucleic acid product to yield two single-stranded nucleic acids, and (iv) repeating the steps of primer annealing, primer extension, and product denaturation enough times to generate detectable amounts of amplified sequences defined by the primers. The sequential annealing, extension and denaturation steps are controlled by varying the temperature of the reaction container, normally in a repeating cyclical manner. Annealing and extension are typically carried out between 40-80°C, whereas denaturation requires temperatures between about 80 and 100°C

A polymerase chain reaction (PCR) reaction mixture generally includes the components necessary for amplification of specific nucleic acid sequences. Kits and reagents for carrying out PCR reactions are commercially available and generally include nucleotides, (some or all of dCTP, dATP, dGTP and dTTp or dUTP), one or more of which may be labeled in any known or suitable manner, e.g., radio labeled, the polymerase, and one or more of buffers, salts, stabilizing agents and reagents for nucleic acid extraction and detection. (See, e.g. products available from Perkin-Elmer.)

A plant extract sample for use in a PCR assay for GLRaV sequences is prepared using Quiagen's RNAeasy plant RNA extraction kit protocol, with modifications (MacKenzie, et al, 1997; Example 1). Viral RNA was isolated and converted into cDNA as further described in Example 1.

A set of PCR primers, LR5-1F (SEQ ID NO: 31) and LR5-1R (SEQ ID NO: 32) were used to amplify a 690 nucleotide fragment from the GLRaV-5 coat protein coding sequence. PCR reactions were carried out using standard conditions, as described by Minafra, A., et al, 1992, and in Example 3. Primers for PCR amplification of a GLRaV-5 specific sequence are presented in Table 3.

A second set of primers, GSP3 (SEQ ID NO: 33) and GSP4 (SEQ ID NO: 34), were designed for the specific detection of GLRaV-8 HSP70 homologue protein gene sequences. The PCR reactions were run as described above, and in Example 3. This primer set detected a PCR product of 154 nucleotides in GLRaV-8 infected material. Primers for PCR amplification of a

GLRaV-8 specific sequence are presented in Table 3. It will understood by those of skill that a Taqman™ (PE Applied Biosystems) probe and primers set may be designed and for the detection of GLRaV nucleic acids.

C. Others An assay for GLRaV infection in Vitis plants may also involve obtaining total mRNA from the tissue and detecting and/or quantitating the mRNA in the sample by methods known to those of skill in the art, such as Northern blot and RT-PCR assay.

Either cloned GLRaV polynucleotides or sequence information from the GLRaV-5 coding sequence (SEQ ID NO:l) or GLRaV-8 sequences (SEQ ID NO:8 and SEQ ID NO: 10), may be used to detect sequences having a high degree of sequence similarity or identity to a particular target sequence. Such sequences can be isolated, e.g., from a selected cDNA library by hybridization under high stringency conditions, as defined above. As is known in the art, hybridization is typically performed by designing a polynucleotide probe derived from the target sequence, labeling the probe with reporter moieties, and using the reporter-labeled probe to visualize the presence of similar sequences immobilized on a solid support. The probe can be labeled using any of a variety of reporter molecules known in the art and detected accordingly: for example, radioactive isotopic labeling and chemiluminescent detection reporter systems (Tropix; Bedford, MA).

The labeled probes may be hybridized to samples being tested using standard hybridization procedures. Typically, the polynucleotide sample (e.g., mRNA) is immobilized or "blotted" onto a nylon or nitrocellulose membrane (available, e.g., from Schleicher & Schuell, Keene, NH). Variations of such blots include filters lifted from media (e.g., agar) plates containing a library, Northern blots, dot blots and slot blots. The membranes containing the immobilized polynucleotides are washed in a pre-hybridization solution and incubated at a controlled temperature in a hybridization solution containing the probe. Following hybridization, the membranes are washed under conditions effective to result in the desired degree of hybridization specificity following standard methods (e.g., Ausubel, et al, 1992; Sambrook, et al, 1989).

The presence of GLRaV proteins or polypeptides can also be evaluated by Western blot or ELISA using antibodies specific for the particular strain of GLRaV, as detailed above.

VII. UTILITY OF GLRAV-1. GLRAV-5 AND GLRAV-8 SEQUENCES

The polynucleotides of the present invention may be used for a variety of diagnostic purposes. The polynucleotides may be used to detect and quantitate expression of GLRaV in plant tissue prior to use in vegetative propagation, by detecting the presence of GLRaV RNA. In addition, GLRaV coat protein coding sequences may be modified to be defective, for example, by eliminating the start codon or incorporating multiple stop codons to produce an untranslated capsid protein. Such defective GLRaV coding sequences could interfere with the normal production of viral capsid protein and produce plants that are resistant to GLRaV-5 and - 8, and other related and unrelated grapevine associated closteroviruses. In a related approach, the expression of sense or antisense HSP 70 homologue sequences in Vitis sp. may be used to interfere with normal viral functions such as, movement, encapsidation, or replication of viral RNA.

The following examples illustrate, but are in no way intended to limit the scope of the present invention.

MATERIALS AND METHODS DNA PLASMIDS AND AGROBACTERIUM BINARY VECTOR CONSTRUCTION

Biological reagents were typically obtained from the following vendors: 5' to 3' Prime, Boulder, CO; New England Biolabs, Beverly, MA; Gibco/BRL, Gaithersburg, MD; Promega, Madison, WI; Clontech, Palo Alto, CA; and Operon, Alameda, CA

Standard recombinant DNA techniques were employed in all constructions (Adams and Yang, 1977; Ausubel, et al, 1992; Hooykaas and Schilperoot, 1985; Sambrook, et al, 1989), each of which is expressly incorporated by reference herein.

EXAMPLE 1 LIBRARY CONSTRUCTION FOR ISOLATION OF GLRaV-5 AND GLRaV-8 CODING SEQUENCES

Double-stranded (ds) RNA was isolated from mature stem and leaf petioles of infected grapevine material following the procedure described by Paulos and Powell, 1994. For additional cDNA synthesis and cloning, viral RNA was isolated essentially as described in the RNeasy kit protocol (Qiagen) as modified by MacKenzie, et al. , 1996.

Briefly, grape stem and petioles tissues from infected grapevines were pulverized and concentrated as described in Monis and Bestwick, 1997. Either freshly ground homogenized tissue or 300 μl of concentrated virus preparation (Monis and Bestwick, 1997) were disrupted in Quiagen lysis buffer and processed as described by MacKenzie, D.J., et al, 1996. cDNA libraries were generated using RNA isolated from the grape cultivar LR 100, for GLRaV-5 specific libraries. For GLRaV-8, cDNA from RNA isolated from LR 102 was used, though this will include other sequences than those of GLRaV-8 (possibly GLRaV- 1, GLRaV-2 and GLRaV- 5 sequences, due to the mixed infection of LR 102). The RNA was precipitated by the addition of 0.1 vol. 3M sodium acetate (pH 5.2) and 2.5 vol. ethanol, pelleted by centrifugation (14,000xg, 10 min), drained, and resuspended in a small volume of nuclease-free water.

GLRaV-5 and putative GLRaV-8 cDNA libraries were made using Clontech's Marathon 5 cDNA Amplification Kit [Clontech, Palo Alto, CA] following the manufacturer's protocol.

Briefly, after first and second-strand cDNA synthesis, the Marathon adaptors, were ligated to the polished ends of the double-stranded cDNA. This cDNA library served as a PCR-accessible library for rapid amplification of 5' and 3' ends (RACE).

PCR with degenerate oligonucleotide primers designed from a closterovirus consensus 0 sequence was used to obtain specific GLRaV-5 and putative -8 HSP 70 homologue sequences. (See Tian T et al. , 1996.)

The PCR-derived GLRaV-5 and putative -8 HSP 70 homologue sequences (each approximately 600 bp), were used to design primers for downstream sequence extension in PCR- accessible libraries constructed and amplified according to the supplier's protocol. See Table 1 5 for LR-5-specific primers and Table 2 for putative LR 8- specific primers.

GLRaV-5

In the first round of amplification, PCR products were amplified from the GLRaV-5 library using GSP8 (SEQ ID NO: 15) and MAP (SEQ ID NO:29). The PCR products obtained 0 by Marathon cDNA RACE were cloned into a vector, colonies were screened and positive clones sequenced. The largest PCR amplification product was chosen and primers designed based on the sequence of the selected PCR amplification product for a subsequent downstream walk.

Marathon cDNA RACE was repeated sequentially with the sequence specific primers, GSP12

(SEQ ID NO:16), GSP15 (SEQ ID NO: 17) and GSP23 (SEQ ID NO:18), together with an 5 adaptor primer.

A 600 bp PCR amplification product and 1115 bp, 1580 bp, 1520 bp, and 600 bp overlapping Genome Walker products were assembled as a contiguous sequence, for a total of

4766 bp, presented as SEQ ID NO. l. This assembled sequence was used to design primers for amplification of the various GLRaV-5 sequences, described herein. See Figure 5 for a schematic o description of the cloning strategy used.

For example, the complete GLRaV-5 sequence was used to design PCR primers for cloning the GLRaV-5 coat protein coding region (SEQ ID NO:2; nucleotides 3285-4094 of SEQ

ID NO:l).

The GLRaV-5 HSP70 coding sequence was obtained by sequencing 3 overlapping Genome Walker products, each of which contained a portion of the LR5 HSP70 gene, assembled as a contiguous sequence, presented herein as SEQ ID NO:4 (1-1593 of SEQ ID NO:l). The GLRaV-5 duplicate coat protein coding region (SEQ ID NO:6; nucleotides 4128- 4751 of SEQ ID NO:l), was obtained by sequencing the two 5' most overlapping genome walker products (GSP15- and GSP23-amplified clones), each of which have a portion of the duplicate CP.

Table 1. Primers for isolation/cloning of GLRaV-5 coat protein coding sequence

GSP 8 5 'GGCCGTGTCAATTACTGGTAGTGCTGTG 3 ' SEQ ID NO: 15

GSP 12 5' GCCAGAGAGACCCTTGGACGAGGAATAC 3' SEQ ID NO: 16

GSP 15 5' GCAGGTGGATTTCTCTGGTGTGGATGA 3' SEQ ID NO: 17 GSP 23 5' GCTGGCGTTTATGCGACTGTTATG 3' SEQ ID NO: 18

LR-5 CP start 5' ATGTCTGGAGCGTCGCAGAAC 3' SEQ ID NO: 19

LR5-3F 5' ACCCGAAGTTGCTGTCTGACC 3' SEQ ID NO:20

LR5-2R 5' CTCGGGCGGCATAACAGTC 3' SEQ ID NO:21

GLRaV-8

In the first round of amplification, PCR products were amplified from the GLRaV-8 library using GSP4 (SEQ ID NO:23) and MAP (SEQ ID NO:29). The PCR products obtained by Marathon cDNA RACE were cloned into a vector, colonies were screened and positive clones sequenced. The largest PCR amplification product was chosen and primers designed based on the sequence of the selected PCR amplification product for a subsequent upstream walk. Marathon cDNA RACE was repeated sequentially with the sequence specific primers, GSP27 (SEQ ID NO:24), GSP28 (SEQ ID NO:26) and GSP29 (SEQ ID NO:27), together with an adaptor primer. A 600 bp PCR amplification product and, 1178 bp, 745 bp, 1200 bp, and 1500 bp overlapping Genome Walker products were assembled as two contiguous sequences.

The putative GLRaV-8 partial coat protein coding sequence was obtained by sequencing the GSP29-amplified Genome Walker products, each of which contained a portion of the LR8 HSP70 coat protein gene, assembled as a contiguous sequence, presented herein as SEQ ID NO:8.

Coding sequence to HSP70 was obtained by sequencing 3 overlapping Genome Walker products, each of which contained a portion of the putative LR8 HSP70 gene, assembled as a contiguous sequence, presented herein as SEQ ID NO: 10. Table 2. Primers for isolation of putative GLRaV-8 coding sequences

GSP 4 5' GCTGGCAAACCTGGTGGACTTTACATC 3' SEQ ID NO:24 GSP 27 5' GGGCGAGTCCAATCGTACCTGGTTA 3' SEQ ID NO:25

GSP 28 5' CGCCTGCTCTTTGGGGGACCCGACCG 3' SEQ ID NO:26

GSP 29 5' AATGCCGAATCCAAGACCTGGTTCAC 3' SEQ ID NO:27

EXAMPLE 2 IN VITRO EXPRESSION OF THE GLRAV-5 COAT PROTEIN AND PRODUCTION OF ANTISERUM An open reading frame (ORF) that contained the coding sequence for the SNRGD amino acid signature sequence was identified as a putative GLRaV-5 coat protein gene. This ORF was subcloned into a bacterial expression vector as a maltose binding fusion protein (MBP) pMALc (New England Biolabs, MA). The specific primers LR-5 CP start (SEQ ID NO: 19) and LR5-2R (SEQ ID NO:21), described in Table 1, were used for PCR amplification. The PCR product was digested with Hind III and cloned into the Hind III site of the plasmid.

The CP was expressed in E. coli under the control of the Tac promoter and suppressed by the Lac repressor. The MBP-CP fusion protein was induced with 0.3 mM IPTG and purified from 1 liter cultures using an amylose column as described by the manufacturer. After protease Factor Xa digestion, protein samples were tested in Western blot against a GLRaV- 1 polyclonal antibody, a GLRaV-2 polyclonal antibody, a GLRaV-4 polyclonal antibody, a GLRaV-5 monoclonal and polyclonal antibody, a GLRaV-8 monoclonal antibody (19A12), and a broad spectrum monoclonal antibody , 15F1 monoclonal. The Western blot result indicated that the recombinant protein only reacted with GLRaV5 specific antibodies.

The affinity purified GLRaV-5 CP was used to immunize rabbits for the production of antiserum. The polyclonal antiserum was used in immunoblots for the specific detection of the GLRaV-5 coat protein.

EXAMPLE 3 SPECIFIC DETECTION OF GLRAV-5 AND -8 NUCLEIC ACIDS A set of PCR primers, LR5-1F (SEQ ID NO:31) and LR5-1R (SEQ ID NO:32) were designed for the amplification of a 690 nucleotide fragment from the GLRaV-5 coat protein. The viral RNA was isolated and converted into cDNA as described in Example 1. Standard PCR reactions were carried out as described by Minafra, A., 1992, except the plant tissues were extracted as described above, and the annealing step of the PCR reaction was carried out at 62° C. This primer set detected a DNA fragment of the expected size, 690 nucleotides, in plant material infected with GLRaV-5 while no PCR products were detected when extracts of plants known to be uninfected, or infected with GLRaV- 1, -2, -3, -4, or -8 were tested. For this reason the identity of this sequence was assigned to the GLRaV-5 coat protein.

A second set of PCR primers, GSP3 (SEQ ID NO:33) and GSP4 (SEQ ID NO:34), designed based on the putative GLRaV-8 HSP70 homologue protein gene sequence were used in PCR reactions, carried out as described above at 66° C. This primer set detected a PCR product of 154 nucleotides in GLRaV-8 infected material, while no PCR products were detected when extracts of plants known to be uninfected, or infected with GLRaV-4, or -5 were tested. A PCR product was also detected in plants infected with GLRaV-1. From the similarities of these viruses in the genomic region where the primers were designed, and the presence GLRaV-1 in the infected material, the assignment of identity of this sequence to the HSP70 homologue protein may be made to GLRaV- 1.

A third set of PCR primers, LR8-1F (SEQ ID NO:35) and LR8-1R (SEQ ID NO:36), and a fourth set of PCR primers, LR8-2F (SEQ ID NO:37) and LR8-2R (SEQ ID NO:38), designed based on the GLRaV-8 putative helicase domain gene sequence were used in PCR reactions, carried out as described above at 54° C. The third primer set detected a PCR product of 614 nucleotides in GLRaV-5 and -8 infected material, the fourth primer set detected a PCR product of 632 nucleotides in GLRaV-5 and -8 infected material, while no PCR products were detected when extracts of plants known to be uninfected, or infected with GLRaV- 1, or GLRaV- 4, were tested.

Table 3. Primers for detection of the GLRaV-5 and GLRaV-8 sequences

LR5-1F: 5' CCCGTGATACAAGGTAGGACA 3' SEQ ID NO:31

LR5-1R: 5' CAGACTTCACCTCCTGTTAC 3' SEQ ID NO:32

GSP3: 5' CGTTCGCGTTACCCACGCTGCCTA 3' SEQ ID NO:33

GSP4: 5' GCTGGCAAACCTGGTGGACTTTACATC 3' SEQ ID NO:34

LR8-1F 5' TTTGGTGAGAATGGGAGTATG 3' SEQ ID NO:35

LR8-1R 5' CTTTCGTCGGCTGACATAGAG 3' SEQ ID NO:36

LR8-2F 5' ATGGGACTTGTCTTCTATCAC 3' SEQ ID NO:37

LR8-2R 5' GTTGGGAAGAGGCGTGAAGTG 3' SEQ ID NO:38 SEQUENCE LISTING TABLE

Claims

What is claimed is:

1. An isolated polynucleotide selected from the group consisting of: a) an isolated polynucleotide comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 3; b) an isolated polynucleotide comprising SEQ ID NO: 2; c) an isolated polynucleotide comprising a nucleotide sequence which has at least 70% identity to that of SEQ ID NO: 2 over the entire length of SEQ ID NO: 2; d) an isolated polynucleotide comprising a nucleotide sequence which has at least 80% identity to that of SEQ ID NO: 2 over the entire length of SEQ ID NO: 2; e) an isolated polynucleotide comprising a nucleotide sequence which has at least 90% identity to that of SEQ ID NO: 2 over the entire length of SEQ ID NO: 2; f) an isolated polynucleotide comprising a nucleotide sequence which has at least 95 % identity to that of SEQ ID NO: 2 over the entire length of SEQ ID NO: 2; g) an isolated polynucleotide that hybridizes, under stringent conditions, to SEQ ID NO: 2 or a fragment thereof; and h) an isolated polynucleotide complementary to the polynucleotide sequence of (a), (b), (c), (d), (e), (f) or (g).

2. An isolated polynucleotide selected from the group consisting of : a) an isolated polynucleotide comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 5; b) an isolated polynucleotide comprising SEQ ID NO: 4; c) an isolated polynucleotide comprising a nucleotide sequence which has at least 70% identity to that of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4; d) an isolated polynucleotide comprising a nucleotide sequence which has at least 80% identity to that of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4; e) an isolated polynucleotide comprising a nucleotide sequence which has at least 90% identity to that of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4; f) an isolated polynucleotide comprising a nucleotide sequence which has at least 95% identity to that of SEQ ID NO: 4 over the entire length of SEQ ID NO: 4; g) an isolated polynucleotide that hybridizes, under stringent conditions, to SEQ ID NO: 4 or a fragment thereof; and h) an isolated polynucleotide complementary to the polynucleotide sequence of (a), (b), (c), (d), (e), (f) or (g).

3. An isolated polynucleotide selected from the group consisting of: a) an isolated polynucleotide comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 9; b) an isolated polynucleotide comprising SEQ ID NO: 8; c) an isolated polynucleotide comprising a nucleotide sequence which has at least 70% identity to that of SEQ ID NO: 8 over the entire length of SEQ ID NO: 8; d) an isolated polynucleotide comprising a nucleotide sequence which has at least 80% identity to that of SEQ ID NO: 8 over the entire length of SEQ ID NO: 8; e) an isolated polynucleotide comprising a nucleotide sequence which has at least 90% identity to that of SEQ ID NO: 8 over the entire length of SEQ ID NO: 8; f) an isolated polynucleotide comprising a nucleotide sequence which has at least 95 % identity to that of SEQ ID NO: 8 over the entire length of SEQ ID NO: 8; g) an isolated polynucleotide that hybridizes, under stringent conditions, to SEQ ID NO: 8 or a fragment thereof; and h) an isolated polynucleotide complementary to the polynucleotide sequence of (a), (b), (c),

(d), (e), (f) or (g).

4. An isolated polynucleotide selected from the group consisting of: a) an isolated polynucleotide comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 11; b) an isolated polynucleotide comprising SEQ ID NO: 10; c) an isolated polynucleotide comprising a nucleotide sequence which has at least 70% identity to that of SEQ ID NO: 10 over the entire length of SEQ ID NO: 10; d) an isolated polynucleotide comprising a nucleotide sequence which has at least 80% identity to that of SEQ ID NO: 10 over the entire length of SEQ ID NO: 10; e) an isolated polynucleotide comprising a nucleotide sequence which has at least 90% identity to that of SEQ ID NO: 10 over the entire length of SEQ ID NO: 10; f) an isolated polynucleotide comprising a nucleotide sequence which has at least 95 % identity to that of SEQ ID NO: 10 over the entire length of SEQ ID NO: 10; g) an isolated polynucleotide that hybridizes, under stringent conditions, to SEQ ID NO: 10 or a fragment thereof; and h) an isolated polynucleotide complementary to the polynucleotide sequence of (a), (b), (c), (d), (e), (f) or (g).

5. A nucleic acid construct comprising as operably linked components in the 5' to 3' direction of transcription: a transcriptional initiation region; and a polynucleotide sequence selected from the group consisting of the isolated polynucleotides of Claims 1-4.

6. An expression cassette comprising a nucleic acid construct according to Claim 5.

7. The expression cassette according to Claim 6, wherein said transcriptional initiation region comprises a promoter.

8. The expression cassette according to Claim 6, wherein said promoter is a regulatable promoter.

9. The expression cassette according to Claim 6, wherein said promoter is a constitutive promoter.

10. A host cell comprising a nucleic acid construct according to Claim 5.

11. The host cell according to Claim 10, wherein said host cell is selected from the group consisting of bacterial, insect, fungal, mammalian, and plant.

12. The host cell according to Claim 11, wherein said host cell is a plant cell.

13. A plant comprising a cell of Claim 12.

14. A method of detecting GLRaV infection in a species of Vitis, comprising:

(a) providing a first antibody specifically immunoreactive with a GLRaV coat protein;

(b) providing a second antibody specifically immunoreactive with a GLRaV coat protein, wherein said second antibody is labeled in a manner effective for detection;

(c) contacting said second antibody with plant extract sample to form a mixture; (d) adding the mixture to the first antibody, allowing the mixture and the first antibody to react; and

(e) detecting any immune complexes formed, thereby detecting the presence of GLRaV coat protein in the plant extract sample.

15. The method according to claim 14, wherein said first and second antibodies are provided in solution.

16. The method according to claim 14, wherein said first antibody is immobilized on a solid phase.

17. The method according to claim 14, wherein said label is selected from the group consisting of an enzyme, a radioisotope, biotin, a spin label, a fluorophore, a chemiluminescent label, an antigen label and an antibody label.

18. A method of detecting GLRaV infection in a species of Vitis, comprising: (a) purifying RNA from a plant suspected of GLRaV infection;

(b) synthesizing first strand cDNA;

(c) adding the cDNA obtained from step (b) to a polymerase chain reaction (PCR) reaction mixture containing a primer pair for amplifying a cDNA sequence specific to a GLRaV coat protein; (d) amplifying by polymerase chain reaction;

(e) testing aliquots of the PCR amplification product from step (d) for the presence or absence of a GLRaV-specific PCR amplification product products using spectrophotometric or electrophoretic means, wherein a positive detection of said GLRaV-specific PCR amplification product indicates the presence of GLRaV in said plant.

19. The method according to claim 18, wherein said GLRaV is GLRaV-5 and said primer pair corresponds to the sequences presented as SEQ ID NO:31 and SEQ ID NO: 32.

20. The method according to claim 18, wherein said GLRaV is GLRaV-8 and said primer pair corresponds to the sequences presented as SEQ ID NO:33 and SEQ ID NO:34.

21. The method according to claim 18, wherein said testing includes subjecting said PCR amplification product to gel electrophoresis and hybridization with a labeled probe specific to the amplified fragment, and detecting the presence of a sequence complementary to said radiolabeled probe.

22. A kit comprising a solid phase coated with an anti-GLRaV coat protein antibody that will immunologically bind at least one GLRaV polypeptide or protein having an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO: 9 and SEQ ID NO: 11, a container comprising said polypeptide or protein and a means for detecting the amount of said bound GLRaV polypeptide or protein.

23. A method for providing resistance to GLRaV infection in a recombinant plant cell, said method comprising: transforming a plant cell with an expression cassette according to Claim 6, wherein transcription of said polynucleotide sequence interferes with a normal viral function.

24. The method according to Claim 23 wherein said normal viral function is selected from the group consisting of movement, encapsidation, or replication of viral RNA.

25. The method according to Claim 23 wherein said polynucleotide sequence encodes

GLRaV coat protein.

26. The method according to Claim 23 wherein said polynucleotide sequence encodes a defective GLRaV coat protein.

27. The method according to Claim 23 wherein said polynucleotide sequence is expressed as an antisense sequence.

28. The method according to Claim 23 wherein said polynucleotide sequence encodes GLRaV HSP70 homologue protein.