AU727208C - Grapevine leafroll virus proteins and their uses - Google Patents

Description

GRAPEVINE LEAFROLL VIRUS PROTEINS AND THEIR USES

This work was supported by United States-Israel

Binational Agricultural Research and Development Fund Grant No. US-1737-89 and by the United States Department of

Agriculture Cooperative Agreement No. 58-2349-9-01. The Federal Government may have certain rights in the invention.

FIELD OF THE INVENTION

The present invention relates to grapevine leafroll virus proteins, DNA molecules encoding these proteins, and their uses. BACKGROUND OF THE INVENTION

The world's most widely grown fruit crop, the grape

(Vitis sp.), is cultivated on all continents except

Antarctica. Major grape production centers are in European countries (including Italy, Spain, and France), which

constitute about 70% of the world grape production (Mullins et al., Biology of the Grapeyine, Cambridge, U.K., University Press (1992)). The United States is the eighth largest grape grower in the world. Although grapes have many uses, a major portion of grape production (~80%) is used for wine

production. Unlike cereal crops, most of the world's

vineyards are planted with traditional grapevine cultivars, which have been perpetuated for centuries by vegetative propagation. Several important grapevine virus and virus-like diseases, such as grapevine leafroll, corky bark, and

Rupestris stem pitting, are transmitted and spread through the use of infected vegetatively propagated materials. Thus, propagation of certified, virus-free materials is one of the most important disease control measures. Traditional breeding for disease resistance is difficult due to the highly

heterozygous nature and outcrossing behavior of grapevines, and due to polygenic patterns of inheritance. Moreover, introduction of a new cultivar may be prohibited by custom or law. Recent biotechnology developments have made possible the introduction of special traits, such as disease resistance, into an established cultivar without altering its

horticultural characteristics.

Many plant pathogens, such as fungi, bacteria,

phytoplasmas, viruses, and nematodes can infect grapes, and the resultant diseases can cause substantial losses in

production (Pearson et al., Compendium of Grapp Diseases,

American Phytopathological Society Press (1988)). Among these, viral diseases constitute a major hindrance to

profitable growing of grapevines. About 34 viruses have been isolated and characterized from grapevines. The major virus diseases are grouped into: (1) the grapevine degeneration caused by the fanleaf nepovirus, other European nepoviruses, and American nepoviruses, (2) the leafroll complex, and (3) the rugose wood complex (Martelli, ed., Graft Transmissible Diseases of Grapeyines, Handbook for Detection and Diagnosis, FAO, UN, Rome, Italy (1993)).

Grapevine leafroll complex is the most widely distributed of the major diseases of grapes. According to Goheen (Goheen, "Grape Leafroll," in Frazier et al., eds., Virus Diseases of

Small Fruits and Grapeyines (A Handbook), University of

California, Division of Agricultural Sciences, Berkeley,

Calif, USA, pp. 209-212 (1970), grapevine leafroll-like disease was described as early as the 1850s in German and

French literature. The viral nature of the disease and graft transmission were first demonstrated by Scheu (Scheu, D, D, Weinbau 14:222-358 (1935). In 1946, Harmon and Snyder (Harmon et al., Proc, Am, Soc, Hort, Sci, 74:190-194 (1946))

determined the virus nature of White Emperor disease in

California. It was later proven by Goheen et al. (Goheen et al., Phytopathology, 48:51-54 (1958)) that both leafroll and "White Emperor" diseases were the same, and only the name

"leafroll" was retained. Leafroll is a serious virus disease of grapes and occurs wherever grapes are grown. This wide distribution of the disease has come about through the propagation of diseased vines. It affects almost all cultivated and rootstock

varieties of Vi tis . Although the disease is not lethal, it causes yield losses and reduced sugar content. Scheu

estimated in 1936 that 80 per cent of all grapevines planted in Germany were infected (Scheu, Mein Winzerbuch, Berlin, Reichsnahrstand-Verlags (1936)). In many California wine grape vineyards, the incidence of leafroll (based on a 1959 survey of field symptoms) agrees with Scheu's initial

observation in German vineyards (Goheen et al., Amer, J, Enol, Vitic,, 10:78-84 (1959)). The current situation on leafroll disease appears similar (Goheen, The American

Phytopathological Society, St. Paul, Minnesota:APS Press,

1:47-54 (1988). Goheen estimated that the disease causes an annual loss of about 5-20 per cent of the total grape

production (Goheen (1970); Goheen (1988)). The amount of sugar in individual berries of infected vines is only about 1/2 to 2/3 that of berries from noninfected vines (Goheen

(1958)).

Symptoms of leafroll disease vary considerably depending upon the cultivar, environment, and time of the year. On red or dark-colored fruit varieties, the typical downward rolling and interveinal reddening of basal, mature leaves is prevalent in autumn and is less apparent in spring or early summer. On light-colored fruit varieties, symptoms are less conspicuous, usually downward rolling accompanied by interveinal chlorosis. Moreover, many infected rootstock cultivars do not develop symptoms. In these cases, the disease is usually diagnosed with a woody indicator indexing assay using Vitis vivifera cv. Carbemet Franc (Goheen (1988)).

Ever since Scheu demonstrated that leafroll was graft transmissible, a virus etiology has been suspected (Scheu

(1935)). Several virus particle types have been isolated from leafrcll diseased vines. These include potyvirus-like (Tanne et al., Phytopathology, 67:442-447 (1977)), isometric virus- like (Castellano et al., Vitis, 22:23-39 (1983)) and Namba et al., Ann, Phytopathol, soc, Japan, 45:70-73 (1979)), and closterovirus-like (Namba, Ann, Phytopathol, Soc, japan,

45:497-502 (1979)) particles. In recent years, however, long flexuous closteroviruses ranging from 1,400 to 2,200 nm in length have been most consistently associated with leafroll disease (Castellano (1983), Faoro et al., Riy, Patol, Veg., Ser IV, 17:183-189 (1981); Gugerli et al., Rev. Suisse

Viticult, Arboricult, Hort., 16:299-304 (1984); Hu et al., J, Phytopathol., 128:1-14 (1990); Milne et al., Phytopathol, Z., 110:360-368 (1984); Zee et al., Phytopathology, 77:1427-1434 (1987); Zimmermann et al., J. Phytopathol., 130:205-218

(1990). These closteroviruses are referred to as grapevine leafroll associated viruses (GLRaV). At least six

serologically distinct types of GLRaV's (GLRaV-1 to -6) have been detected from leafroll diseased vines (Table 1) (Boscia et al., Vitis, 34:171-175 (1995); (Martelli, "Leafroll," pp. 37-44 in Martelli, ed., Graft Transmissible Diseases of

Grapeyines, Handbook for Detection and Diagnosis, FAO, Rome Italy, (1993)). The first five of these were confirmed in the 10th Meeting of the International Council for the Study of Virus and Virus Diseases of the Grapevine (ICVG) (Volos,

Greece, 1990). Through the use of monoclonal antibodies, however, the original GLRaV II described in Gugerli (1984) has been shown to be an apparent mixture of at least two

components, IIa and IIb (Gugerli et al., "Grapevine Leafroll Associated Virus II Analyzed by Monoclonal Antibodies," 11th Meeting of the International Council for the Study of Viruses and Virus Diseases of the Grapeyine, Montreux, Switzerland, pp. 23-24 (1993)). Recent investigation with comparative serological assays (Boscia (1995)) demonstrated that the IIb component of cv. Chasselas 8/22 is the same as the GLRaV-2 isolate from France (Zimmermann (1990)) which also include the isolates of grapevine corky bark associated closteroviruses from Italy (GCBaV-BA) (Boscia (1995)) and from the United

States (GCBaV-NY) (Namba et al., Phytopathology, 81:964-970 (1991)). The IIa component of cv. Chasselas 6/22 was given the provisional name of grapevine leafroll associated virus 6 (GLRaV-6). Furthermore, the antiserum to the CA-5 isolate of GLRaV-2 produced by Boscia et al. (Boscia et al.,

Phytopathology, 80:117 (1990)) was shown to contain antibodies to both GLRaV-2 and GLRaV-1, with a prevalence of the latter (Boscia (1995)).

Several shorter closteroviruses (particle length 800 nm long) have also been isolated from grapevines. One of these, called grapevine virus A (GVA) has also been found associated, though inconsistently, with the leafroll disease (Agran et al., Vitis, 29:43-48 (1990); Conti, et al., Phytopathol,

Mediterr., 24:110-113 (1985); Conti et al., Phytopathology, 70:394-399 (1980)). The etiology of GVA is not really known; however, it appears to be more consistently associated with rugose wood sensu lato (Rosciglione at al., Rev, Suisse Vitic Arboric, Hortic., 18:207-211 (1986); and Zimmermann (1990)). Another short closterovirus (800 nm long) named grapevine virus B (GVB) has been isolated and characterized from corky bark-affected vines (Boscia et al., Arch, Virol., 130:109-120 (1993); Namba (1991)).

As suggested by Martelli, leafroll symptoms may be induced by more than one virus or they may be simply a general plant physiological response to invasion by an array of phloem-inhabiting viruses. Grapevine leafroll is induced by one (or a complex) of long closteroviruses (particle length 1,400 to 2,200 nm).

Grapevine leafroll is transmitted primarily by

contaminated scions and rootstocks. However, under field conditions, several species of mealybugs have been shown vectors of leafroll (Engelbrecht et al., Phytophylactica, 22:341-346 (1990); Engelbrecht et al., Phytophylactica,

22:347-354 (1990); Rosciglione, et al., (Abstract),

Phytophylactica, 17:63-63 (1989); and Tanne, Phytpparasitica, 16:288 (1988)). Natural spread of leafroll by insect vectors is rapid in various parts of the world. In New Zealand, observations of three vineyards showed that the number of infected vines nearly doubled in a single year (Jordan et al., 11th Meeting of the International Council for the Study of Viruses and Virus Diseases of the Grapeyine, Montreux,

Switzerland, pp. 113-114 (1993)). One vineyard became 90% infected 5 years after GLRaV-3 was first observed. Prevalence of leafroll worldwide may increase as chemical control of mealybugs becomes more difficult due to the unavailability of effective insecticides.

In view of the serious risk grapevine leafroll virus poses to vineyards and the absence of an effective treatment, there is a need to prevent this disease and the resulting economic losses. The present invention overcomes this

deficiency in the art.

SUMMARY OF INVENTION

The present invention relates to an isolated protein or polypeptide corresponding to a protein or polypeptide of a grapevine leafroll virus. The encoding RNA and DNA molecules, in either isolated form or incorporated in an expression system, vectors, host cells, and transgenic Vi tis or citrus scions or rootstock cultivars, are also disclosed.

Another aspect of the present invention relates to a method of imparting grapevine leafroll virus resistance to Vitis scion or rootstock cultivars by transforming them with a DNA molecule encoding a protein or polypeptide of a grapevine leafroll virus. These DNA molecules can also be used in transformation of citrus scion or rootstock cultivar to impart tristeza virus resistance to such cultivars.

The present invention also relates to an antibody or binding portion thereof or probe which recognizes the protein or polypeptide or the nucleic acid encoding same.

Grapevine leafroll virus resistant transgenic variants of the current commercial grape cultivars and rootstocks allows for improved control of the virus while retaining the varietal characteristics of specific cultivars. Furthermore, these variants permit control of GLRaV transmitted by contaminated scions or rootstocks or by GLRaV-carrying mealybugs or other insect pests. With respect to the latter mode of

transmission, the present invention circumvents increasingly restricted pesticide use, which has made chemical control of mealybug infestations increasingly difficult. Thus, the interests of the environment and the economics of grape cultivation and wine making are benefited by the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1A-1B, illustrates the results of Northern blot hybridization. Figure 1B shows that probe made from a clone insert gave positive reaction with itself (lane 3) and to dsRNA from leafroll infected tissues (lane 1), but not with nucleic acids extracted from healthy grapevines (lane 2).

Lane M contains molecular weight markers (HindIII digested lambda DNA). Figure 1A depicts an ethidium bromide stained agarose gel before transfer to a membrane.

Figure 2 presents an analysis of GLRaV-3 dsRNA by

electrophoresis on an ethidium bromide stained agarose gel. A dsRNA of ca. 16 kb was readily isolated from diseased

grapevine (lane 6), but not from the healthy control (lane 5). Other samples that were used for control were tobacco mosaic virus dsRNA (lane 1); cucumber mosaic virus dsRNA (lane 2); pBluescript vector (lane 3) and an insert of clone pC4. λ HindIII digested lambda DNA was used as molecular weight markers (lane M) .

Figure 3 is a Western blot of antibodies to GLRaV-3 that reacted to proteins produced by cDNA clones after IPTG

induction in E. coli . Similar banding patterns were observed whether a polyclonal (panel A) or a monoclonal antibody

(panel B) was used. Lane 1 shows clone pCP10-1; lane 2, pCP5; lane 3, pCP8-4; and lane 4, the native coat protein from

GLRaV-3 infected tissue. Lane M is a prestained protein molecular weight marker.

Figure 6 shows the cDNA clones containing the coding region for the coat protein of the NY1 isolate of GLRaV-3.

Three clones (pCP8-4, pCP5, pCP10-1) were identified by immunoscreening a cDNA library prepared in lambda ZAP II. Two other clones were aligned after plaque hybridization and nucleotide sequencing. The coat protein ORF is shown by an arrow in an open rectangle.

Figure 5 is the phylogenetic tree generated using results obtained using the Clustal Method of MegAlign program in

DNASTAR for the coat protein of GLRaV-3. The coat protein of GLRaV-3 was incorporated into a previously described alignment (Dolja et al., Ann, Rev, Phytopathol., 32:261-285 (1994)) for comparison. The other virus sequences were obtained from current databases: apple chlorotic leafspot virus (ACLSV); apple stem grooving virus (ASGV); apple stem pitting virus (ASPV); barley yellow mosaic virus (BaMV); beet yellows closterovirus (BYV); diverged copies of BYV and CTV coat proteins (BYV p24 and CTV p27, respectively); citrus tristeza virus (CTV); grapevine virus A (GVA); grapevine virus B (GVB); lily symptomless virus (LSV); lily virus X (LVX); narcissus mosaic virus (NMV); pepper mottle virus (PeMV); papaya mosaic virus (PMV); potato virus T (PVT); potato virus S (PVS);

potato virus M (PVM); potato virus X (PVX); tobacco etch virus (TEV); tobacco vein mottle virus (TVMV); and white clover mosaic virus (WcMV).

Figure 6 depicts an analysis of reverse transcription polymerase chain reaction (RT-PCR) to detect GLRaV-3 in a partially purified virus preparation. The original sample concentration is equivalent to 50 mg/μl of phloem tissue (lane 1) which was diluted by 10-fold series as 10^-1 (lane 2), 10^-2 (lane 3), 10^-3 (lane 4), 10^-4 (lane 5), and 10^-5 (lane 6), respectively. The expected 219 bp PCR product was clearly observed up to lane 4, which is equivalent to a detection limit of 10 μg of phloem tissue. Lane 7 was a healthy

control. Lane 8 was dsRNA for positive control. Lanes 9-11 were also used for positive controls of purified viral RNA (lane 9), dsRNA (lane 10), and piasmid DNA (pC4) (lane 11) as templates, respectively. Lane M contains molecular weight markers (HaeIII digested fX 174 DNA). Figures 7A-7B depicts comparative analysis of Nested PCR with immuno-capture preparations on field collected samples. Using a polyclonal antibody to GLRaV-3 for immune-capture, th expected 648 bp PCR product was not consistently observed in the first round of PCR amplification with external primers over a range of samples (lanes 1-7, Figure 7A). However, the expected 219 bp PCR product amplified by internal primers was consistently observed over all seven samples (lanes 1-7, Figure 7B). A similar inconsistency is also shown in a sample prepared by proteinase K-treated crude extract (compare panels A to B on lane 8). With dsRNA as template, the expected PCR products were readily observed in both reactions (compare lane 10 in Figure 7A and 7B). No such products were observed on a healthy sample (lane 9). Lane M contained molecular weight markers (HaeIII digested fX 174 DNA).

Figures 8A-8B depict comparative studies on the

sensitivity of Nested PCR with samples prepared using

proteinase K-treated crude extract (Figure 8A, PK Nested PCR) and by immuno-capture preparation (Figure 8B, IC Nested PCR). Nested PCR was performed on samples with serial 10-fold dilutions of up to 10^-6 in a proteinase K-treated and 10^-8 in an immuno-capture preparation. The expected 219 bp PCR product was observed up to 10^-5 in PK Nested PCR and over 10^-8 (the highest dilution used in this test) in IC Nested PCR. A similar PCR product was also observed with dsRNA template but not healthy grape tissues (H. CK). Lane M contained molecular weight markers (HaeIII digested fX 174 DNA).

Figure 9 shows partial genome organization for GLRaV-3 and the cDNA clones used to determine nucleotide sequence.

Numbered lines represent nucleotide coordinates in kilobases

(kb).

Figure 10 depicts the proposed genome organization of the GLRaV-3 in comparison with three other closterovirus genomes, BYV, CTV, and LIYV (Dolja (1994)). Homologous proteins are shown by identical patterns. Papain-like proteinase (P-PRO); methyltransferase of type 1 (MTR1); RNA helicase of

superfamily 1 (HEL1); RNA polymerase of supergroup 3 (PLO3); HSP70-related protein (HSP70r); and capsid protein forming filamentous virus particle (CPf).

Figure 11 is the phylogenetic tree showing the amino acid sequence relationship of the helicase of alphaviruses. The helicase domain of GLRaV-3 (291 aa) from the present study is used. The other virus sequences were obtained from current databases (Swiss-Prot and GenBank, release 84.0). Apple chlorotic leafspot virus (ACLSV); broad bean mottle virus (BbMV); brome mosaic virus (BMV); beet yellow closterovirus (BYV); cowpea chlorotic mottle virus (CcMV); cucumber mosaic virus (CMV); fox mosaic virus (FxMV); lily symptomless virus (LSV); lily virus X (LXV); narcissus mosaic virus (NMV) ; pea early browning virus (PeBV); papaya mosaic virus (PMV); poplar mosaic virus (PopMV); peanut stunt virus (PSV); potato virus S (PVS); potato virus M (PVM); potato virus X (PVX); strawberry mild yellow edge-associated virus (Sm Yea V); tomato aspermy virus (TAV); tobacco mosaic virus (TMV); tobacco rattle virus (TRV); and white clover mosaic virus (WcMV).

Figure 12 shows the phylogenetic tree for the RNA

dependent RNA polymerases (RdRp) of the alpha-like supergroup of positive strand RNA viruses. The deduced amino acid sequence of the RdRp of GLRaV-3 was incorporated into a previously described alignment (Dolja (1994)) for comparison. The other virus sequences were obtained from current

databases: Apple chlorotic leafspot virus (ACLSV); alfalfa mosaic virus (AlMV); apple stem grooving virus (ASGV) ; brome mosaic virus (BMV) ; beet necrotic yellow vein virus (BNYW); beet yellow virus (BYV); barley stripe mosaic virus (BSMV) ; beet yellow stunt virus (BYSV); cucumber mosaic virus (CMV) ; citrus tristeza virus (CTV); hepatitis E virus (HEV) ; potato virus M (PVM); potato virus X (PVX); raspberry bushy dwarf virus (RBDV); shallot virus X (SHVX); Sinbis virus (SNBV) ;

tobacco mosaic virus (TMV); tobacco rattle virus (TRV); and turnip yellow mosaic virus (TYMV) .

Figure 13 is the predicted phylogenetic relationship for viral and cellular HSP70 proteins. HSP70-related protein of GLRaV-3 (p59) was incorporated into a previously described alignment (Dolja (1994)) for comparison. The sequences of BYV, CTV, and LIYV proteins were from Agranovsky et al., J. Gen, Virol., 217:603-610 (1991), Pappu et al., Virology.

199:35-46 (1994), and Klaassen et al., Virology. 208:99-110 (1995), respectively. Only the N-terminal half of beet yellow stunt virus HSP70-related protein (Karasev et al., J. Gen. Virol,, 75:1415-1422 (1994)) is used. Other sequences were obtained from the Swiss-Prot database; their accession numbers are as follows: DNA1_BACSU, Bacillus subtilis (P13343);

DNAK_ECOLI, Escherichia coli (P04475); HS70_CHICK (P08106); HS70_ONCMY, Oncorhynchus mykiss (P08108); HS70_PLACB,

Plasmodium cynomolgi (Q05746); HS70_SCHMA, Schiεtosoma mansoni (P08418); HS70_XENLA, Xenopus laevis (P02827);

HS71_DROME, Drosophila melanogaster (P02825); HS71_HUMAN

(P08107); HS71_MOUSE (P17879); HS71_PIG (P34930); HS74_PARLI, Paracentrotus lividus (Q06248); HS74_TRYBB, Trypanosoma brucei (P11145); and ZMHSP702, maize gene for heat shock protein 70 exon 2 (X03697).

Figure 14 summarizes the strategies employed in the construction of the plant transformation vector pBinl9GLRaV- 3hsp90-12-3. A plant expression cassette, in the HindIII-EcoRI fragment containing CaMV 35S-35S promoters-AMV 5' untranslated sequence-43K ORF-Nos 3' untranslated region, was excised from pBI525GLRaV-3hsp90 and cloned into the similarly (restriction enzyme) treated plant transformation vector pBinl9. The resulting clone, pBinl9GLRaV-3hsp90-12-3, is shown. Locations of important genetic elements within the binary piasmid are indicated: BR, right border; BL, left border; Nos-NPT II, plant expressible neomycin

phosphotransferase gene; Lac-LAC Z, plant expressible Lac Z gene; and Bacterial Kan, bacterial kanamycin resistance gene.

Figure 15 shows the Agro-bacterium-binary vector

pGA482G/cpGLRaV-3, which was constructed by cloning the

HindIII fragment of pEPT8cpGLRaV-3 into a derivative of pGA482 and used for transformation via Agrobacterium or Biolistic approach. DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to isolated DNA molecules encoding the proteins or polypeptides of a grapevine leafroll virus. A substantial portion of the grapevine leafroll virus genome, within which are a plurality of open reading frames, has been sequenced by the present inventors. One such DNA molecule contains an open reading frame encoding grapevine leafroll virus helicase and comprising the nucleotide sequence corresponding to SEQ ID NO:1. The helicase has an amino acid sequence corresponding to SEQ ID NO:2 and a molecular weight from about 146 to about 151 kDa, preferably about 148.5 kDa.

Another such DNA molecule comprises an open reading frame which codes for a grapevine leafroll virus RNA-dependent RNA polymerase and comprises the nucleotide sequence corresponding to SEQ ID NO: 3. The RNA-dependent RNA polymerase has an amino acid sequence as given in SEQ ID NO: 4 and a molecular weight from about 59 to about 63 kDa, preferably about 61 kDa.

Another such DNA molecule comprises an open reading frame which codes for a grapevine leafroll virus hsp70-related protein or polypeptide and comprises the nucleotide sequence corresponding to SEQ ID NO: 5. The hsp70-related protein has an amino acid sequence corresponding to SEQ ID NO: 6 and a molecular weight from about 57 to about 61 kDa, preferably about 59 kDa.

Another such DNA molecule comprises an open reading frame which codes for a grapevine leafroll virus hsp90-related protein and comprises the nucleotide sequence corresponding to SEQ ID NO:7. The hsp90-related protein has an amino acid sequence corresponding to SEQ ID NO: 8 and a molecular weight from about 53 to about 57 kDa, preferably about 55 kDa.

Another such DNA molecule comprises an open reading frame which codes for a grapevine leafroll virus coat protein or polypeptide. The DNA molecule comprises the nucleotide

sequence corresponding to SEQ ID NO: 9. The coat protein has an amino acid sequence as given in SEQ ID NO: 10 and a molecular weight from about 33 to about 43 kDa, preferably about 35 kDa.

Alternatively, the DNA molecule of the present invention can constitute an open reading frame which codes for a first undefined protein or polypeptide. This DNA molecule comprises the nucleotide sequence corresponding to SEQ ID NO: 11. The first undefined protein or polypeptide has an amino acid sequence corresponding to that in SEQ ID NO: 12 and a molecular weight from about 5 to about 7 kDa, preferably about 6 kDa.

Another such DNA molecule constitutes an open reading frame which codes for a second undefined grapevine leafroll virus protein or polypeptide and comprises the nucleotide sequence corresponding to SEQ ID NO: 13. The second undefined protein or polypeptide has an amino acid sequence as given in SEQ ID NO: 14 and a molecular weight from about 4 to about 6 kDa, preferably about 5 kDa.

Another such DNA molecule constitutes an open reading frame which codes for a grapevine leafroll virus coat protein repeat and comprises the nucleotide sequence corresponding to SEQ ID NO: 15. The coat protein repeat has an amino acid sequence as given in SEQ ID NO: 16 and a molecular weight from about 51 to about 55 kDa, preferably about 53 kDa.

Yet another such DNA molecule constitutes an open reading frame which codes for a third undefined grapevine leafroll virus protein or polypeptide and comprises the nucleotide sequence corresponding to SEQ ID NO: 17. The third undefined protein or polypeptide has an amino acid sequence as given in SEQ ID NO: 18 and a molecular weight from about 33 to about 39 kDa, preferably about 36 kDa.

Yet another DNA molecule which constitutes an open reading frame for a fourth undefined grapevine leafroll virus protein or polypeptide comprises the nucleotide seuqence corresponding to SEQ ID NO: 19. The fourth undefined protein or polypeptide has an amino acid sequence as given in SEQ ID NO: 20 and a molecular weight from about 17 to about 23 kDa, preferably about 20 kDa. Yet another DNA molecule constitutes an open reading frame for a fifth undefined grapevine leafroll virus protein or polypeptide and comprises the nucleotide sequence

corresponding to SEQ ID NO:21. The fifth undefine protein or polypeptide has an amino acid sequence as given in SEQ ID

NO:22 and a molecular weight from about 17 to about 23 kDa, preferably about 20 kDa.

Yet another DNA molecule of the present invention

consitutes an open reading frame for a sixth undefined protein or polypeptide and comprises the nucleotide sequence

corresponding to SEQ ID NO:23. The sixth undefined protein or polypeptide has an amino acid sequence as given in SEQ ID NO:24 and a molecular weight from about 5 to about 9 kDa, preferably about 7 kDa.

Also encompassed by the present invention are fragments of the DNA molecules of the present invention. Suitable fragments capable of imparting grapevine leafroll resistance to grape plants are constructed by using appropriate

restriction sites, revealed by inspection of the DNA

molecule's sequence, to: (i) insert an interposon (Felley et al., Gene, 52:147-15 (1987), which is hereby incorporated by reference) such that truncated forms of the grapevine leafroll virus coat polypeptide or protein, that lack various amounts of the C-terminus, can be produced or (ii) delete various internal portions of the protein. Alternatively, the sequence can be used to amplify any portion of the coding region, such that it can be cloned into a vector supplying both

transcription and translation start signals suitable for the desired host cell.

Variants may also (or alternatively) be modified by, for example, the deletion or addition of nucleotides that have minimal influence on the properties, secondary structure and hydropathic nature of the encoded polypeptide. For example, the nucleotides encoding a polypeptide may be conjugated to a signal (or leader) sequence at the N-terminal end of the protein which co-translationally or post-translationally directs transfer of the protein. The nucleotide sequence may also be altered so that the encoded polypeptide is conjugated to a linker or other sequence for ease of synthesis,

purification, or identification of the polypeptide.

The protein or polypeptide of the present invention is preferably produced in purified form (preferably, at least about 80%, more preferably 90%, pure) by conventional

techniques. Typically, the protein or polypeptide of the present invention is isolated after lysing or sonication.

After washing, the lysate pellet is resuspended in buffer containing Tris-HCl. During dialysis, a precipitate forms from this protein solution. The solution is centrifuged, and the pellet is washed and resuspended in the buffer containing Tris-HCl. Proteins are resolved by electrophoresis through an SDS 12% polyacrylamide gel.

The DNA molecule encoding the grapevine leafroll virus protein or polypeptide of the present invention can be

incorporated in cells using conventional recombinant DNA technology. Generally, this involves inserting the coding sequence into an expression system to which the DNA molecule is heterologous (i.e. not normally present). The heterologous DNA molecule is inserted into the expression system or vector in proper sense orientation and correct reading frame. The vector contains the necessary elements for the transcription and translation of the inserted protein-coding sequences as well known in the art.

U.S. Patent No. 4,237,224 (Cohen and Boyer), hereby incorporated by reference, describes the production of

expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase.

These recombinant plasmids are then introduced, e.g., by transformation, and replicated in unicellular cultures

including procaryotes and eucaryotic cells grown in culture.

Recombinant genes may also be introduced into virus vectors, such as vaccinia virus. Recombinant viruses can be generated by transfection of plasmids into cells infected with virus. Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gt11, gt WES.tB, Charon 4, and piasmid vectors such as P3R322, pBR325, PACYC177, pACYC184, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKC101, SV 40, pBluescript II SK +/- or KS +/- (see

Stratagene Cloning Systems Catalog (1993) from Stratagene, La Joila, CA, hereby incorporated by reference), pQE, p1H821, pGEX, pET series (see Studier et. al., Gene Expression

Technology, vol. 185 (1990), hereby incorporated by

reference), and any derivatives thereof. Recombinant

molecules can be introduced into cells via transformation, transduction, conjugation, mobilization, or electroporation. The DNA sequences are cloned into the vector using standard cloning procedures in the art, as described by Maniatis et al., Molecular Cloning: A Laboratory Manual. Cold Springs Laboratory, Cold Springs Harbor, New York (1982), which is hereby incorporated by reference.

A variety of host-vector systems may be utilized to express the protein-encoding sequence(s). Primarily, the vector system must be compatible with the host cell used.

Host-vector systems include but are not limited to the following: bacteria transformed with bacteriophage DNA, piasmid DNA, or cosmid DNA; microorganisms such as yeast containing yeast vectors; mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); and plant cells infected by bacteria or transformed via particle

bombardment (i.e. biolistics). The expression elements of these vectors vary in their strength and specificities.

Depending upon the host-vector system utilized, any one of a number of suitable and well known transcription and

translation elements can be used.

Different genetic signals and processing events control many levels of gene expression (e.g., transcription and messenger RNA (mRNA) translation). Transcription of DNA is dependent upon the presence of a promotor, a DNA sequence that directs the binding of RNA polymerase and thereby promotes mRNA synthesis. The DNA sequences of eucaryotic promotors differ from those of procaryotic promotors. Furthermore, eucaryotic promotors and accompanying genetic signals, including enhancer-like sequences and inducible regulatory sequences, may not be recognized in or may not function in a procaryotic system, and, further, procaryotic promotors are usually not recognized and do not function in eucaryotic cells.

Similarly, translation of mRNA in procaryotes depends upon the presence of the proper procaryotic signals, which differ from those of eucaryotes. Efficient translation of mRNA in procaryotes requires a ribosome binding site (Shine-Dalgarno (SD) sequence) on the mRNA. This sequence is a short nucleotide sequence that is located before the start codon, usually AUG, which encodes the N-terminal methionine of the protein. The SD sequences are complementary to the 3'-end of the 16S rRNA (ribosomal RNA) and promote binding of mRNA to ribosomes by duplexing with rRNA to allow correct positioning of the ribosome. For a review on maximizing gene expression, see Roberts and Lauer, Methods in Enzymology, 68:473 (1979), which is hereby incorporated by reference.

Promotors vary in their "strength" (i.e. their ability to promote transcription). It is generally desirable to use strong promotors in order to obtain a high level of

transcription and, hence, expression of the cloned gene of interest. Depending upon the host cell system utilized, any one of a number of suitable promotors may be used. For instance, when cloning in E. coli , its bacteriophages, or plasmids, promotors such as the T7 phage promoter, lac

promotor, trp promotor, recA promotor, ribosomal RNA promotor, the P_R and P_L promotors of coliphage lambda and others,

including but not limited, to lacUV5, ompF, bla, Ipp, and the like, may be used to direct high levels of transcription of adjacent DNA segments. Additionally, a hybrid trp-lacUV5 (tac) promotor or other E. coli promotors produced by

recombinant DNA or other synthetic DNA techniques may be used to provide for transcription of the inserted coding sequence or other inserted nucleic acid.

Bacterial host cell strains and expression vectors may be chosen which inhibit the action of the promotor unless

specifically induced. In certain operons, the addition of specific inducers is necessary for efficient transcription of the inserted DNA. For example, the lac operon is induced by the addition of lactose or IPTG (isopropylthio-beta-D- galactoside). A variety of other operons, such as trp, pro, etc., have different under regulatory mechanisms.

Specific initiation signals are also required for

efficient gene transcription and translation in procaryotic cells. These transcription and translation initiation signals may vary in "strength" as measured by the quantity of gene specific messenger RNA and protein synthesized, respectively. The DNA expression vector, which contains a promotor, may also contain any combination of various "strong" transcription and/or translation initiation signals. For instance,

efficient translation in E. coli requires a SD sequence about 7-9 bases 5' to the initiation codon (ATG) to provide a ribosome binding site. Thus, any SD-ATG combination that can be utilized by host cell ribosomes may be employed. Such combinations include, but are not limited to, the SD-ATG combination from the cro gene or the N gene of coliphage lambda, or from the E. coli trp E, D, C, B or A genes.

Additionally, any SD-ATG combination produced by recombinant DNA or other techniques involving incorporation of synthetic nucleotides may be used.

Once the isolated DNA molecules encoding the various grapevine leafroll virus proteins or polypeptides, as

described above, have been cloned into an expression system, they are ready to be incorporated in a host cell. Such

incorporation can be carried out by the various forms of transformation noted above, depending upon the vector/host cell system. Suitable host cells include, but are not limited to, bacteria, yeast, mammalian cells, insect, plant, and the like. The present invention also relates to RNA molecules which encode the various grapevine leafroll virus proteins or polypeptides described above. The transcripts can be

synthesized using the host cells of the present invention by any of the conventional techniques. The mRNA can be

translated either in vi tro or in vivo . Cell-free systems typically include wheat-germ or reticulocyte extracts.

One aspect of the present invention involves using one or more of the above DNA molecules encoding the various proteins or polypeptides of a grapevine leafroll virus to transform grape plants in order to impart grapevine leafroll resistance to the plants. The mechanism by which resistance is imparted is not known. As hypothesized, the transformed plant can express the coat protein or polypeptide, and, when the

transformed plant is inoculated by a grapevine leafroll virus, such as GLRaV-1, GLRaV-2, GLRav-3, GLRaV-4, GLRaV-5, or

GLRaV-6, or combinations of these, the recombinantly expressed coat protein or polypeptide surrounds the virus, thereby preventing translation of the viral DNA.

In this aspect of the present invention the subject coding sequence incorporated in the plant can be

constitutively expressed. Alternatively, expression can be regulated by a promoter which is activated by the presence of grapevine leafroll virus. Suitable promoters for these purposes include those from genes expressed in response to grapevine leafroll virus infiltration. Additional suitable plant promoters include those which induce downstream gene expression in response to wounding, in response to elicitors and in response to virus infection. In the alternative, a constitutive plant-expressible promoter can be used; it is preferred that the level of gene expression is sufficiently high to provide virus resistance but not so high as to be detrimental to the normal functioning of the cell and tissues in which it is expressed. Immediately upstream of the start of a coding sequence for a GLRaV-3 protein or polypeptide in an expression system (expression vector, for use in plants) it is desired that there be a Kozak consensus for translation intiation (AAXXATGG, where X is any of the four nucleotides) Downstream of the end of the coding sequence for the virus protein or polypeptide, it is preferred that there be a polyadenylation signal functional in plants, such as that from the nopaiine synthase gene, the octopine synthase gene or from the CaMV 35S gene. These sequences are well known in the plant biotechnology art.

The DNA coding sequences and/or molecules of the present invention can be utilized to impart grapevine leafroll

resistance for a wide variety of grapevine plants. The DNA molecules are particularly well suited to imparting resistance to Vitis scion or rootstock cultivars. Scion cultivars which can be protected include those commonly referred to as Table or Raisin Grapes, such as Alden, Almeria, Anab-E-Shahi, Autumn Black, Beauty Seedless, Black Corinth, Black Damascus, Elack Malvoisie, Black Prince, Blackrose, Bronx Seedless, Burgrave, Calmeria, Campbell Early, Canner, Cardinal, Catawba,

Christmas, Concord, Dattier, Delight, Diamond, Dizmar,

Duchess, Early Muscat, Emerald Seedless, Emperor, Exotic, Ferdinand de Lesseps, Fiesta, Flame seedless, Flame Tokay,

Gasconade, Gold, Himrod, Hunisa, Hussiene, Isabella, Italia, July Muscat, Khandahar, Katta, Kourgane, Kishmishi, Loose Perlette, Malaga, Monukka, Muscat of Alexandria, Muscat Flame, Muscat Hamburg, New York Muscat, Niabell, Niagara, Olivette blanche, Ontario, Pierce, Queen, Red Malaga, Ribier, Rish Baba, Romulus, Ruby Seedless, Schuyler, Seneca, Suavis (IP 365), Thompson seedless,, and Thomuscat. They also include those used in wine production, such as Aleatico, Alicante Bouschet, Aligote, Alvarelhao, Aramon, Baco blanc (22A),

Burger, Cabernet franc, Cabernet, Sauvignon, Calzin,

Carignane, Charbono, Chardonnay, Chasselas dore, Chenin blanc, Clairette blanche, Early Burgundy, Emerald Riesling, Feher Szagos, Fernao Pires, Flora, French Colombard, Fresia,

Furmint, Gamay, Gewurztraminer, Grand noir, Gray Riesling, Green Hungarian, Green Veltliner, Grenache, Grillo, Helena, Inzolia, Lagrein, Lambrusco de Salamino, Malbec, Malvasia bianca, Mataro, Melon, Merlot, Meunier, Mission, Montua de Pilas, Muscadelle du Bordelais, Muscat blanc, Muscat Ottonel, Muscat Saint-Vallier, Nebbiolo, Nebbiolo fino, Nebbiolo

Lampia, Orange Muscat, Palomino, Pedro Ximenes, Petit

Bouschet, Petite Sirah, Peverella, Pinot noir, Pinot Saint-George, Primitivo di Gioa, Red Veltliner, Refosco, Rkatsiteli, Royalty, Rubired, Ruby Cabernet, Saint-Emilion, Saint Macaire, Salvador, Sangiovese, Sauvignon blanc, Sauvignon gris,

Sauvignon vert, Scarlet, Seibel 5279, Seibel 9110, Seibel 13053, Semillon, Servant, Shiraz, Souzao, Sultana Crimson, Sylvaner, Tannat, Teroldico, Tinta Madeira, Tinto cao,

Touriga, Traminer, Trebbiano Toscano, Trousseau, Valdepenas, Viognier, Walschriesling, White Riesling, and Zinfandel.

Rootstock cultivars which can be protected include Couderc 1202, Couderc 1613, Couderc 1616, Couderc 3309, Dog Ridge, Foex 33 EM, Freedom, Ganzin 1 (A × R #1), Harmony, Kober 5BB, LN33, Millardet & de Grasset 41B, Millardet & de Grasset 420A, Millardet & de Grasset 101-14, Oppenheim 4 (SO4), Paulsen 775, Paulsen 1045, Paulsen 1103, Richter 99, Richter 110, Riparia Gloire, Ruggeri 225, Saint-George, Salt Creek, Teleki 5A, Vitis rupestris Constantia, Vi tis California, and Vitis girdiana.

There is extensive similarity in the hsp70-related sequence regions of GLRaV-3 and other closteroviruses, such as tristeza virus. Consequently, the GLRaV-3 hsp70-related gene can also be used to produce transgenic cultivars other than grape, such as. citrus, which are resistant to closteroviruses other than grapevine leafroll, including tristeza virus.

These include cultivars of lemon, lime, orange, grapefruit, pineapple, tangerine, and the like, such as Joppa, Maltaise Ovale, Parson (Parson Brown), Pera, Pineapple, Queen,

Shamouti, Valencia, Tenerife, Imperial Doblefina, Washington Sanguine, Moro, Sanguinello Moscato, Spanish Sanguinelli, Tarocco, Atwood, Australian, Bahia, Baiana, Cram, Dalmau, Eddy, Fisher, Frost Washington, Gillette, LengNavelina,

Washington, Satsuma Mandarin, Dancy, Robinson, Ponkan, Duncan, Marsh, Pink Marsh, Ruby Red, Red Seedless, Smooth Seville, Orlando Tangeic, Eureka, Lisbon, Meyer Lemon', Rough Lemon, Sour Orange, Persian Lime, West Indian Lime, Bearss, Sweet Lime, Troyer Citrange, and Citrus trifoliata.

Plant tissue suitable for transformation include leaf tissue, root tissue, meristems, zygotic and somatic embryos, and anthers. It is particularly preferred to utilize embryos obtained from anther cultures.

The expression systems of the present invention can be used to transform virtually any plant tissue under suitable conditions. Tissue transformed in accordance with the present invention can be grown in vi tro in a suitable medium to impart grapevine leafroll virus resistance. Transformed cells can be regenerated into whole plants such that the protein or

polypeptide imparts resistance to grapevine leafroll virus in the intact transgenic plants. In either case, the plant cells transformed with the recombinant DNA expression system of the present invention are grown and express one of the above-described grapevine leafroll virus proteins or polypeptides and, thus, grapevine leafroll resistance.

One technique of transforming plants with the DNA

molecules of the present invention is by contacting the tissue of such plants with an inoculum of a bacterium transformed with a vector comprising a gene of the present invention which imparts grapevine leafroll resistance. Generally, this procedure involves inoculating the plant tissue with a

suspension of bacteria and incubating the tissue for 48 to 72 hours on regeneration medium without antibiotics at 25-28°C. Cells of the genus Agrobacteriuiπ can be used to

transform plant cells and/or plant tissue. Suitable species include Agrobacterium tumefaciens and Agrobacterium

rhizogenes . A. tumefaciens (e.g., strains C58, LBA4404, or EHA105) is particularly useful due to its well-known ability to transform plants, plant tissue and plant cells.

Another approach to transforming plant cells with a gene which imparts resistance to pathogens is particle bombardment (also known as biolistic transformation) of the host cell.

This can be accomplished in one of several ways. This

technique is disclosed in U.S. Patent Nos. 4,945,050, 5,036,006, and 5,100,792, all to Sanford et al., and in

Emerschad et al., Plant Cell Reports, 14:6-12 (1995)), all hereby incorporated by reference. Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and to be incorporated within the interior thereof. When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the heterologous DNA. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle.

Biologically active particles (e.g., dried bacterial cells containing the vector and heterologous DNA) can also be propelled into plant cells.

Once grape plant tissue is transformed in accordance with the present invention, it is regenerated to form a transgenic grape plant. Generally, regeneration is accomplished by culturing transformed tissue on medium containing the

appropriate growth regulators and nutrients to allow for the initiation of shoot meristems. Appropriate antibiotics are added to the regeneration medium to inhibit the growth of Agrobacterium and to select for the development of transformed cells. Following shoot initiation, shoots are allowed to develop in tissue culture and are screened for marker gene activity.

The DNA molecules of the present invention can be

transcribed into mRNA, which, although encoding a grapevine leafroll virus protein or polypeptide, is not translated to the corresponding protein. This is known as RNA-mediated resistance. When a Vitis scion or rootstock cultivar is transformed with such a DNA molecule, the DNA molecule can be transcribed under conditions effective to maintain the mRNA in the plant cell at low level density readings. Density

readings of between 15 and 50 using a Hewlet ScanJet and Image Analysis Program are preferred. The grapevine leafroll virus protein or polypeptide can also be used to raise antibodies or binding portions thereof or probes. The antibodies can be monoclonal or polyclonal.

Monoclonal antibody production may be effected by

techniques which are well-known in the art. Basically, the process involves first obtaining immune cells (lymphocytes) from the spleen of a mammal (e.g., mouse) which has been previously immunized with the antigen of interest either in vivo or in vitro. The antibody-secreting lymphocytes are then fused with (mouse) myeloma cells or transformed cells, which are capable of replicating indefinitely in cell culture, thereby producing an immortal, immunoglobulin-secreting cell line. The resulting fused cells, or hybridomas, are cultured, and the resulting colonies screened for the production of the desired monoclonal antibodies. Colonies producing such antibodies are cloned, and grown either in vivo or in vi tro to produce large quantities of antibody. A description of the theoretical basis and practical methodology of fusing such cells is set forth in Kohler and Milstein, Nature. 256:495 (1975), incorporated by reference.

Mammalian lymphocytes are immunized by in vivo

immunization of the animal (e.g., a mouse) with the protein or polypeptide of the present invention. Such immunizations are repeated as necessary at intervals of up to several weeks to obtain a sufficient titer of antibodies. Following the last antigen boost, the animals are sacrificed and spleen cells removed.

Fusion with mammalian myeloma cells or other fusion partners capable of replicating indefinitely in cell culture is effected by standard and well-known techniques, for

example, by using polyethylene glycol (PEG) or other fusing agents. (See Milstein and Kohler, Eur. J. Immunol., 6:511 (1976), incorporated by reference.) This immortal cell line, preferably murine, but may also be derived from cells of other mammalian species, including but not limited to rats and humans, is selected to be deficient in enzymes necessary for the utilization of certain nutrients, capable of rapid growth, and having good fusion capability. Many such cell lines are known to those skilled in the art, and others are regularly described.

Procedures for raising polyclonal antibodies are also well known. Typically, such antibodies can be raised by administering the protein or polypeptide of the present invention subcutaneously to New Zealand white rabbits which have first been bled to obtain pre-immune serum. The antigens can be injected at a total volume of 100 μl per site at six different sites. Each injected material will contain

synthetic surfactant adjuvant pluronic polyols, or pulverized acrylamide gel containing the protein or polypeptide after SDS-polyacrylamide gel electrophoresis. The rabbits are then bled two weeks after the first injection and periodically boosted with the same antigen three times every six weeks . A sample of serum is then collected 10 days after each boost. Polyclonal antibodies are then recovered from the serum by affinity chromatography using the corresponding antigen to capture the antibody. Ultimately, the rabbits are euthanized with pentobarbital 150 mg/Kg IV. This and other procedures for raising polyclonal antibodies are disclosed in Harlow et. al., editors, Antibodies: A Laboratory Manual (1988), which is hereby incorporated by reference.

In addition to utilizing whole antibodies, binding portions of such antibodies can be used. Such binding

portions include Fab fragments, F(ab')₂ fragments, and Fv fragments. These antibody fragments can be made by

conventional procedures, such as proteolytic_^ fragmentation procedures, as described in Goding, Monoclonal Antibodies: Principles and Practice, New York:Academic Press, pp. 98-118 (1983), hereby incorporated by reference.

The present invention also relates to probes found either in nature or prepared synthetically by recombinant DNA

procedures or other biological procedures. Nucleic acid probes can also be synthesized by manual chemical synthesis (see, e.g., Beaucage and Caruthers (1981) Tetra, Lett,

22:1859-1862; MAtteuci et al. (1981) J, Am, chem, Soc, 103:3185) or by automated chemical synthesis using

commercially available equipment (e.g., Applied Biosystems, Foster City, CA). Suitable probes are molecules which bind to grapevine leafroll viral antigens identified by the monoclonal antibodies of the present invention. Such probes can be, for example, proteins, peptides, lectins, or nucleic acid probes.

The antibodies or binding portions thereof or probes can be administered to grapevine leafroll virus infected scion cultivars or rootstock cultivars. Alternatively, at least the binding portions of these antibodies can be sequenced, and the encoding DNA synthesized. The encoding DNA molecule can be used to transform plants together with a promoter which causes expression of the encoded antibody or binding portion thereof when the plant is infected by grapevine leafroll virus. In either case, the antibody or binding portion thereof or probe will bind to the virus and help prevent the usual leafroll response.

Antibodies raised against the proteins or polypeptides of the present invention or binding portions of these antibodies can be utilized in a method for detection of grapevine

leafroll virus in a sample of tissue, such as tissue from a grape scion or rootstock. Antibodies or binding portions thereof suitable for use in the detection method include those raised against a helicase, an RNA-dependent RNA polymerase, an hsp70-related, an hsp90-related, or a coat protein or

polypeptide in accordance with the present invention. Any reaction of the sample with the antibody is detected using a reporter or other assay system which indicates the presence of grapevine leafroll virus in the sample. A variety of assay systems can be employed, such as enzyme-linked immunosorbent assays, radioimmunoassays, gel diffusion precipitin reaction assays, immunodiffusion assays, agglutination assays,

fluorescent immunoassays, protein A immunoassays, or

immunoelectrophoresis assays.

Alternatively, grapevine leafroll virus can be detected in such a sample using a nucleotide sequence of the DNA molecule, or a fragment thereof, encoding for a protein or polypeptide (or a portion thereof) of the present invention. The nucleotide sequence is provided as a probe in a nucleic acid hybridization assay or a specific gene amplification detection procedure (e.g., using a polymerase chain reaction procedure). Any reaction with the probe is detected so that the presence of grapevine leafroll virus in the sample is indicated.

The following examples are provided to illustrate embodiments of the present invention but are by no means intended to limit its scope. References cited in the Examples are incorporated by reference herein.

EXAMPLES

Example 1 - Materials and Methods

Virus purification and dsRNA isolation. The NY1 isolate, also referred to as isolate GLRaV 109 by Golino, Amer, J, Enol, Vitic, 43:200-205 (1992), a member of GLRaV-3 (Hu et al., J. Phytopathol. (Berl.). 128:1-14 (1990)); Zee et al., Phytopathology, 77:1427-1434 (1987)) was used throughout this work. Leafroll-diseased canes and mature leaves were

collected from a vineyard in central New York State, and kept at -20°C until used. GLRaV-3 virus particles were purified according to the method described by Zee (1987), and modified later by Hu (1990). After two cycles of Cs₂SO₄ gradient purification, virus particles were observed from virus-enriched fractions by negative staining on an electron

microscope.

The dsRNA was extracted from scraped bark/phloem tissue of canes as described in Hu (1990). Briefly, total nucleic acid was extracted with phenol/chloroform; dsRNA was absorbed on a CF-11 cellulose column under 17% ethanol and eluted without ethanol. After two cycles of ethanol precipitation, dsRNA was analyzed by electrophoresis on a 6% polyacrylamide or 1% agarose gel. A high Mr dsRNA (~16 kb) along with several smaller Mr dsRNAs was consistently identified in leafroll diseased but not in healthy samples (Hu (1990). The 16 kb dsRNA, which was presumably a replicative form of the virus, was purified further following separation on a low melting temperature-agarose gel (Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Ed . , Cold Spring Harbor Laboratory Press (1989). The double-stranded nature of the dsRNA was confirmed by its resistance to DNase and RNase in high salt and sensitivity to RNase in water (Hu (1990).

cDNA synthesis and molecular cloning. Complementary DNA (cDNA) was prepared by the procedure of Gubler et al., Gene, 25:263 (1983), and modified for dsRNA by Jelkmann et al.,

Phytopathology, 79:1250-1253 (1989). Briefly, following denaturation of about 2 μg of dsRNA in 20 mM methylmercuric hydroxide (MeHg) for 10 min, the first-strand cDNA was synthesized by avian myeloblastosis virus (AMV)-reverse transcriptase using random primers (Boehringer Mannheim,

Indianapolis, IN). The second-strand cDNA was synthesized with DNA polymerase I while RNA templates were treated with RNase H. The cDNA was size-fractionated on a CL-4B Sepharose column and peak fractions, which contained larger molecular weight cDNA, were pooled and used for cloning. Complementary DNA ends were blunted with T4 DNA polymerase, and EcoRI adapters were ligated onto a portion of the blunt-ended cDNA. After treatment with T4 polynucleotide kinase and removal of unligated adapters by spin column chromatography, the cDNA was ligated with lambda ZAPII/EcoRI prepared arms (Stratagene, La Jolla, CA). These recombinant DNAs were packaged in vi tro with GIGAPACK II GOLD™ packaging extract according to the manufacturer's instruction (Stratagene). The packaged phage particles were used to infect bacteria, E. coli XL1-blue cells.

Screening the cDNA library. To select GLRaV-3 dsRNA specific cDNA clones, probes were prepared from UNI -AMP™

(Clontech, Palo Alto, CA) PCR-amplified cDNA. PCR-amplified GLRaV-3 cDNA was labeled with ³²P [a-dATP] by Klenow fragment of E. coli DNA polymerase I with random primers and used as a probe for screening the library (Feinberg et al., Analytic Biochem., 132:6-13 (1983)). Library screening was carried out by transferring plaques grown overnight onto GENESCREEN PLUS™ filters, following the manufacturer's instructions for

denaturation, prehybridization, and hybridization (Dupont, Boston, MA). After washing, an autoradiograph was developed after exposing Kodak X-OMAT film to the washed filters

overnight at -80°C. Bacteriophage recombinants were converted into plasmids (in vivo excision) following the manufacturer's instruction, (Stratagene).

Identification of the coat protein gene was done by immunoscreening the cDNA library with GLRaV-3 specific

polyclonal (Zee (1987)) and monoclonal (Hu (1990)),

antibodies. Degenerate primer (5'GGNGGNGGNACNTTYGAYGTNTCN (SEQ. ID. No. 19), I=inosine, Y=T or C) generated from a conserved amino acid sequence in Motif C of the BYV HSP70 gene (p65) was used to select HSP70 positive clones. Further sequence extension was made possible by the clone walking strategy, which used sequences that flanked the sequence to probe the library for a clone that contained an insert

extending farther in either 5' or 3' direction.

Northern blot hybridization. Inserts from selected clones were labeled with ³²P[a-dATP] by Klenow fragment of E. coli DNA polymerase I (Feinberg (1983)), and used as probes to test their specific reactions to dsRNAs isolated from leafroll infected tissues. Double-stranded RNA isolated from GLRaV-3 infected vines was separated by electrophoresis on a 1% agarose gel (nondenatured condition), denatured with 50 mM NaOH, 0.6 M NaCl for 30 min at room temperature, and

neutralized with 1.5 M NaCl, 0.5 M Tris-HCl, pH 7.5 for another 30 min. Denatured dsRNA was sandwich-blotted onto a GENESCREEN PLUS™ membrane. Prehybridization and hybridization were carried out in a manner similar to that described above. The membrane was washed and exposed to Kodak X-OMAT film, and an autoradiograph was developed.

Identification of immunopositive clones. For

immunoscreening, plates with plaques appearing after 8-12 h incubation at 37°C were overlaid with a 10 mM isopropyl-β-D-thio-galactopyranoside (IPTG) impregnated Nylon filters (GENESCREEN PLUS™) and incubated for an additional 3-4 h. After blocking with 3% bovine serum albumin (BSA), the blotted filter was incubated in a 1:1000 dilution of alkaline phosphatase-conjugated GLRaV-3 polyclonal antibody for 3 h at 37°C. Positive signals (purple dots) were developed by incubation of washed filters in a freshly

prepared nitroblue tetrazolium (NET) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) solution. To further confirm whether or not a true GLRaV-3 coat protein expression plaque was selected, a secondary immunoscreening was carried out by reinfection of bacterial XL1 Blue cells with an earlier selected plaque.

Western blot analysis. After secondary immunoscreening, GLRaV-3 antibody positive plaques were converted into piasmid, the pBluescript, by in vivo excision. Single colonies were picked up and cultured in LB medium with 100 μg/ml of

ampicillin until mid-log growth. Fusion protein expression was induced by addition of 10 mM IPTG with an additional 3 h of incubation at 37°C. Bacteria was pelleted and denatured by boiling in protein denaturation buffer (Sambrook (1989)). An aliquot of 5 μl denatured sample was loaded and separated by electrophoresis on a 12% SDS-polyacrylamide gel along with a prestained protein molecular weight marker (Bio-Rad, Hercules, CA). The separated proteins were transferred onto an

Immobulon membrane (Millipore) with an electroblotting

apparatus (Bio-Rad). After blocking with 3% BSA, the

transferred membrane was incubated with 1:1,000 dilution of either GLRaV-3 polyclonal or monoclonal antibody/alkaline phosphatase conjugate. A positive signal was developed after incubation of the washed membrane in NBT and BCIP.

PCR analysis. To analyze a cloned insert, an aliquot of a bacterial culture was used directly in PCR amplification with common vector primers (SK and KS). PCR-amplified product was analyzed by electrophoresis on an agarose gel.

Nucleotide sequencing and computer sequence analysis.

Piasmid DNA, purified by either a CsCl method (Sambrook

(1989)) or a modified mini alkaline-lysis/PEG precipitation procedure (Applied Biosystems' Instruction), was sequenced either with Sequenase version 2 kit following the

manufacturer's instruction (US Biochemical, Cleveland, Ohio) or with Taq DYEDEOXY™ terminator cycle sequencing kit (Applied Biosystems, Inc.). Automated sequencing was conducted on an ABI373 automated sequencer.

Nucleotide sequences were analyzed using a Genetics

Computer Group (GCG) sequence analysis software package

(Madison, WI). Sequence fragments were assembled using

Newgelstart to initiate the GCG fragment assembly system and to support automated fragment assembly in GCG Version 7.2.

Computer-assisted analysis of phylogenetic relationships. Amino acid sequences were either obtained from database SwissProt or translated from nucleotide sequences obtained from GenBank. A phylogenetic tree depicting a predicted

relationship in the evolution of the GLRaV-3 coat protein sequence with those of other filamentous plant viruses was generated using the Clustal Method of the DNASTAR's MegAlign program (Madison, WI). With the Clustal method, a preliminary phylogeny is derived from the distances between pairs of input sequences and the application of the UPGMA algorithm (Sneath et al., Numerical Taxonomy - The Principles and Practice of Numerical Taxonomy, Freeman Press (1973)), which guides the alignment of ancestral sequences. The final phylogeny is produced by applying the neighborhood joining method of Saitou et al., Mol, Biol, Eyol., 4:406-425 (1987), to the distance and alignment data.

Nucleotide sequence and primer selection. The sequence fragment (Table 16) selected for PCR has now been identified to be from nucleotides 9364 to 10,011 of the incomplete GLRaV-3 genome (Table 4). This sequence region encodes a short peptide which shares sequence similarity to HSP90 homologues of other closteroviruses (Figure 1). Selected primers and their designations are shown in Table 16, which shows the nucleotide and amino acid sequences of a PCR amplified

fragment of the GLRaV-3 genome. The external and internal primers used for PCR are underlined and their orientations are indicated by arrows.

Sample preparation. These include 1) dsRNA, 2) purified virus, 3) partially purified virus, 4) proteinase K treated crude extract, and 5) immuno-capture preparation.

Isolation of dsRNA from leafroll infected grapevine tissues followed the procedure developed by Hu (1990).

Virus purification was effected by the following

procedure. An aliquot of 500 μl GLRaV-3-enriched fractions after two cycles of Cs₂SO₄ gradient was diluted with two volumes of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) and incubated on ice for 5 min. The reaction was then adjusted to a final concentration of 200 mM NaAc, pH 5.0, C.5% SDS, and 200 μg/ml proteinase K and incubated at 37°C for 3 h. Viral RNA was extracted with phenol and chloroform, ethanolprecipitated, and resuspended in 50 μl of diethyl

pyrocarbonate (DEPC)-treated H₂O . For each 100 μl PCR reaction mixture, 1 μl of purified viral RNA was used as template.

Partially purified virus was prepared according to the virus purification procedure described in Hu (1990), but only to the high speed centrifugation (27,000 rpm, 2 h) step

without further Cs₂SO₄ gradient centrifugation. The pellet was resuspended in TE buffer and subjected to proteinase K

treatment as described above. Viral RNA was extracted with phenol/chloroform and precipitated using ethanol. From 10 g of starting material, the pellet was resuspended in 200 μl of DEPC treated H₂O. A 1 μl aliquot of extracted RNA or its 10-fold dilution series (up to 10^-5) was used for reverse

transcription-PCR (RT-PCR).

Crude extract was treated with Proteinase K as follows.

Liquid nitrogen powdered grapevine bark/phloem tissue (100 mg) was macerated in 1 ml of virus extraction buffer (0.5 M Tris-HCl, pH 9.0, 0.01 M MgSO₄, 4% water insoluble polyvinyl

pyrrolidone (PVP40), 0.5% bentonite, 0.2% 2-mercaptoethanol, and 5% Triton X-100) (Zee (1987)). After a brief

centrifugation (5,000 rpm, 2 min), 500 μl of supernatant was transferred into a new tube, adjusted to 100 μg/ml proteinase K, and incubated for 1 h at 55°C (Kawasaki, "Sample

Preparation from Blood, Cells, and Other Fluids," in Innis et al., eds, PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc. (1990)). Following incubation, the preparation was boiled for 10 min to inactivate proteinase K and to denature the viral RNA. The upper clear phase was transferred into a new tube after a brief centrifugation. The viral RNA was precipitated with ethanol and resuspended in 100 μl of DEPC-treated H₂O. An aliquot of 1 μl proteinase K- treated crude extract or its 10-fold dilution series (up to 10^-6) was used.

The immuno-capture procedure was adapted from the method described by Wetzel at al., J. Virol. Meth, 39:27-37 (1992)). A 0.5 ml thin wall PCR tube was coated directly with 100 μl of 10 μg/ml purified gamma-globulin from GLRaV-3 antiserum (Zee

(1987)) in ELISA coating buffer (15 mM Na₂CO₃, 35 mM NaHCO₃, pH 9 . 6 , and 0.02% NaN₃) and incubated for 4 h at 30°C. After washing 3 times with PBS-Tween-20, the antibody coated tube was loaded with 100 μl of crude extract (1:10 or its 10-fold dilution series, up to 10^-8) prepared in ELISA extraction buffer (50 mM sodium citrate, pH 8.3, 20 mM sodium

diethyldithiocarbonate (DIECA), 2% PVP 40K) and incubated at 30°C for 4 h. After washing, a 25 μl aliquot of transfer buffer (10 mM Tris, pH 8.0, 1% Triton X-100) was added to the tube and vortexed thoroughly to release viral RNA.

RT-PCR. Initially, reverse transcription (RT) and

polymerase chain reaction (PCR) were performed in two separate reactions. An aliquot of 20 μl of reverse transcription reaction mixture was prepared to contain 2 μl of 10X PCR buffer (Promega, Madison, WI) (10 mM Tris-HCl, pH 8.3, 500 mM KCl, and 0.01% gelatin), 50 mM MgCl₂, 2 μl of 10 mM dNTP, 150 ng of 5' and 3' primers, 16 units of RNasin, 25 units of avian myeloblastosis virus (AMV) reverse transcriptase, and 1 μl of a denatured sample preparation. The reverse transcription reaction was carried out at 37°C for 30 min. After

denaturation by heating at 95°C for 5 min, an aliquot of PCR reaction mixture was added. This PCR reaction mixture (80 μl) contained 8 μl of 10X PCR buffer (Promega), 150 mM MgCl₂, 250 ng of each 5' and 3' primer, 1 μl of 10 mM dNTP, and 2.5 units of Taq DNA polymerase. The thermal cycling program was set as follows: a precycle at 92 °C for 3 min; followed by 35 cycles of denaturation at 92°C, 1 min; annealing at 50°C, 1 min; and extension at 72°C, 2.5 min. The final extension cycle was set at 72°C for 5 min.

Because reverse transcriptase functions in the PCR buffer system, RT and PCR can be combined (RT-PCR) in a single reaction (Ali et al., Biotechniques, 15:40-42 (1993); Goblet et al., Nucleic Acids Research, 17:2144 (1989)). The RT-PCR reaction mixture of 100 μl contains 10 μl of 10X PCR

amplification buffer (Promega), 200 mM MgCl₂, 250 ng each of primers, 3 μl of 10 mM dNTPs, 40 units of RNasin, 25 units of AMV or moloney-murine leukemia virus (M-MLV) reverse

transcriptase, 2.5 units of Taq DNA polymerase, and 1 μl of denatured sample preparation. The thermal cycling program was set as follows: one cycle of cDNA synthesis step at 37°C for 30 min, immediately followed by PCR cycling as described above.

Nested PCR. Inconsistent results obtained from a single round of PCR amplification prompted an investigation into the feasibility of Nested PCR. Initial PCR amplification was performed with an external primer set (93-110 & 92-98) (Table 15). A PCR product of 648 bp was consistently observed from dsRNA as template, but the expected PCR product was not

consistently observed in samples prepared from proteinase K-treated crude extract or immuno-capture sample preparation. Consequently, additional PCR amplification with an internal primer set (93-25 &. 93-40) was carried out by adding 5 μl of the first external primer-amplified PCR product into a freshly prepared 100 μl PCR reaction mixture. The PCR cycling

parameters were as described above. Example 2 - Virus Purification and dsRNA Isolation.

GLRaV-3 virus particles were purified directly from field collected samples of infected grapevines. Attempts to use genomic RNA for cDNA cloning failed due to low yield of virus particles with only partial purity. However, virus particles were shown to be decorated by GLRaV-3 antibody using electron microscopy. The estimated coat protein molecular weight of 41K agreed with an earlier study (Hu (1990). Because of low yield in virus purification, dsRNA isolation was further pursued. Based on the assumption that high Mr dsRNA (16 kb) is the replicative form of the GLRaV-3 genomic RNA, this high Mr dsRNA was separated from other smaller ones by

electrophoresis (Figure 2), purified from a low melting temperature agarose gel, and used for cDNA synthesis.

Example 3 - cDNA Synthesis, Molecular Cloning, and Analysis of cDNA Clones,

First-strand cDNA was synthesized with AMV reverse transcriptase using purified 16 kb dsRNA which had been denatured with 10 mM MeHg as template. Only random primers were used to prime the denatured dsRNA because several other closteroviruses (BYV, CTV, and LIYV) have been shown to have no polyadenylated tail on the 3' end (Agranovsky et al., J, Gen, Virol., 72:15-24 (1991)); Agranovsky et al., Virology, 198:311-324 (1994); Karasev et al., Virology. 208:511-520 (1995); Klaassen et al., Virology. 208:99-110 (1995); Pappu et al., Virology, 199:35-46 (1994)). After second-strand cDNA synthesis, the cDNA was size-fractionated on a CL-4B Sepharose column, and peak fractions which contained larger molecular weight cDNA were pooled and used for cloning. An

autoradiograph of this pooled cDNA revealed cDNA molecules up to 4 kb in size.

A lambda ZAPII library was prepared from cDNA that was synthesized with random primed, reverse transcription of

GLRaV-3 specific dsRNA. Initially, white/blue color selection in IPTG/X-gal containing plates was used to estimate the ratio of recombination. There were 15.7% white plaques, and an estimated 7 × 10⁴ GLRaV-3 specific recombinants in this cDNA library. The library was screened with probes prepared from UNI-AMP™ PCR-amplified GLRaV-3 cDNA. More than 300 clones with inserts of up to 3 kb were selected after screening the cDNA library with probe prepared from UNI-AMP™ PCR-amplified GLRaV-3 cDNA. In Northern blot hybridization, a probe

prepared from a clone insert, pC4, reacted strongly to the 16 kb dsRNA as well as to several other smaller Mr dsRNAs. Such a reaction was not observed with nucleic acids from healthy grape or with dsRNA of CTV (Figure 1).

Example 4 - Selection and Characterization of Immunopositiyet Clones

A total of 6 X 10⁴ plaques were immunoscreened with GLRaV- 3 specific polyclonal antibody. Three cDNA clones, designated pCP5, pCP8-4, and pCP10-1, produced proteins that reacted to the polyclonal antibody to GLRaV-3. GLRaV-3 antibody

specificity of the clones was further confirmed by their reaction to GLRaV-3 monoclonal antibody. PCR analysis of cloned inserts showed that a similar size of PCR product (1.0-1.1 kb) was cloned in each immunopositive clone using primers corresponding to flanking vector seuqences (SK and KS).

However, various sizes of antibody-reacting protein were produced from these clones, which suggested that individual clones were independent and contained different segments of the coat protein gene. The Mr of immunopositive fusion

protein from clone pCP10-1 2as estimated to be 50K in SDS-PAGE, which was greater than the native coat protein of 41K (compare lanes 1 to 4 in Figure 3). Immunopositive proteins produced in clone pCP5 (Figure 3, lane 2) and pCP8 (Figure 3, lane 3) were different in size and smaller than the native coat protein. Clone pCP5 produced a GLRaV-3 antibody-reacting protein of 29K. Clone pCP8-4, however, produced an antibody-reacted protein of 27K. Similar banding patterns were

observed when either polyclonal (Figure 3A) or monoclonal

(Figure 3B) antibodies were used in Western blots. These results indicated that these cDNA clones contained coding sequences for the GLRaV-3 coat protein gene. Example 5 - Nucleotide Sequencing and Identification of the Coat Protein Gene

Both strands of the three immunopositive clones were sequenced at least twice. A multiple sequence alignment of these three clones overlapped and contained an incomplete ORF lacking the 3' terminal sequence region. The complete

sequence of this ORF was obtained by sequencing an additional clone, pA6-8, which was selected using the clone walking strategy. The complete ORF potentially encoded a protein of 313 amino acids with a calculated Mr of 34,866 (p35) (Figure 4 and Tables 2-3). Table 2 shows the nucleotide and amino acid sequences of the coat protein gene of grapevine leafroll associated closterovirus-3, isolate NY1. Nucleotide

sequencing was conducted by the procedure described in

Example 1. The translated amino acid sequence is shown below the nucleotide sequence. Table 3 compares the alignment of the coat protein of GLRaV-3 with respect to BYV, CTV, and LIYV. Consensus amino acid residues are shown. Uppercase letters indicate identical amino acids, and lowercase letters indicate at least three identical or functionally similar amino acids. The three conserved amino acid residues (S, R, and D) identified in all filamentous plant virus coat proteins are in bold (Dolja et al., Virology, 184:79-86 (1991)).

Because this ORF was derived from three independent clones after screening with GLRaV-3 coat protein specific antibody, it was identified as the coat protein gene of GLRaV-3. A multiple amino acid sequence alignment of p35 with the coat proteins of other closteroviruses, including BYV, CTV, and LIYV, is presented in Table 3. The typical consensus amino acid residues (S, R, and D) of the coat proteins of the filamentous plant viruses (Dolja et al., Virology. 184:79-86 (1991)), which may be involved in salt bridge formation and the proper folding of the most conserved core region (Boyko et al., Proc. Natl. Αcad, Sci, USA, 89:9156-9160 (1992)), were also preserved in the p35. Phylogenetic analysis of the

GLRaV-3 coat protein amino acid sequence with respect to the other filamentous plant viruses placed GLRaV-3 into a separate but closely related branch of the closterovirus (Figure 5). Direct sequence comparison of GLRaV-3 coat protein with respect to other closterovirus coat proteins or their diverged copies by the GCG Pileup program demonstrated that at the nucleotide level, GLRaV-3 had its highest homology to BYV (41.5%) and CTV (40.3%). At the amino acid level, however, the highest percentage similarity were to the diverged copies of coat protein, with 23.5% identity (46.5% similarity) to CTV p26 and 22.6% (44.3% similarity) to BYV p24.

Example 6 - Identification of a Coat Protein Translation

Initiation Site

Various sizes of GLRaV-3 specific antibody-reactive proteins were produced by three immunopositive clones in E. coli (Figure 3). Sequences of these clones overlapped and represented a common ORF that was identified as the coat protein gene (Figure 4). In searching for possible

translation regulatory elements, sequence analysis beyond the coat protein coding region revealed a purine rich sequence, - uGAGuGAAcgcgAUG- (SEQ ID NO:26), which was similar to the

Shine-Dalgarno sequence (uppercase letters) (Shine et al.,

Proc. Natl. Acad. Sci. US,, 71:1342-1346 (1974),), upstream from the coat protein initiation site (AUG). This purine rich sequence can serve as an alternative ribosome entry site for the translation of the GLRaV-3 coat protein gene in E.

coli . If this first AUG in the ORF serves for coat protein translation, the ribosomal entry site must be located in this purine rich region because an in-frame translation stop codon (UGA) was only nine nucleotides upstream from the coat protein gene translation initiation site (AUG). Analysis of

nucleotide sequence beyond the cloned insert into the vector sequence of clone pCP8-4 and pCP10-1 provided direct evidence that the fusion protein was made from the N-terminal portion of coat protein and C-terminal portion of β-galactosidase

(16.5K). Further analysis of sequence around the selected AUG initiation codon of the coat protein gene revealed a consensus sequence (-GnnAUGG-) that favored the expression of eucaryotic mRNAs (Kozak, Microbiological Reviews, 47:1-45 (1983); Kozak, Cell. 44:283-292 (1986)).

Nucleotide sequence analysis of three immunopositive clones revealed overlapping sequences and an ORF that covers about 96% of the estimated coat protein gene (Figure 4). The complete ORF was obtained after sequencing of an additional clone (pA6-8) that was selected by the clone walking strategy. Identification of this ORF as the coat protein gene was based upon its immunoreactivity to GLRaV-3 polyclonal and monoclonal antibodies, the presence of filamentous virus coat protein consensus amino acid residues (S, R, and D), and the

identification of a potential translation initiation site.

The calculated coat protein molecular weight (35K) is smaller than what was estimated on SDS-PAGE (41K). This discrepancy in molecular weight between computer-calculated and SDS-PAGE estimated falls in the expected range.

The estimated coat protein Mr of GLRaV-3 and another grape closterovirus-like designated GLRaV-1 are larger than the 22-28K coat protein range reported for other well

characterized closteroviruses such as BYV, CTV, and LIYV

(Agranovsky (1991); Bar-Joseph et al., "Closteroviruses,"

CMI/AAB, No. 260 (1982), Klaassen et al., J. Gen. Virol.,

75:1525-1533 (1994); (Martelli et al., "Closterovirus,

Classification and Nomenclature of Viruses, Fifth Report of the International Committee on Taxonomy of Viruses," in

Archives of Virology Supplementum 2, Martelli et al., eds., New York: Springer-Verlag Wein, pp. 345-347 (1991); Sekiya et al., J, Gen, Virol., 72:1013-1020 (1991)). Hu (1990)

suggested a possible coat protein dimer. The present sequence data, however, do not support this suggestion. First, the size of the coat protein is 35K, which is smaller than what would be expected of a coat protein dimer. Second, a multiple sequence alignment of N-terminal half and C-terminal half of GLRaV-3 coat protein with the coat proteins of other

closteroviruses showed that the filamentous virus coat protein consensus amino acid residues (S, R, and D) are only present in the C-terminal portion, but not in the N-terminal portion of the coat protein.

Example 7 - Primer Selection,

Primers were selected based on the nucleotide sequence of clone pC4 which had been shown to hybridize to GLRaV-3 dsRNAs on a Northern hybridization (Figure 1). The 648 bp sequence amplified by PCR was identified as nucleotides 9,364 to 10,011 of the incomplete GLRaV-3 genome (Table 4). This sequence fragment encodes a short peptide which shows some degree of amino acid sequence similarity to heat shock protein 90

(HSP90) homologues of other closteroviruses, BYV, CTV, and LIYV (Table 5). Two sets of primer sequences and their designations (external, 93-110 & 92-98, and internal, 93-25 & 93-40) are shown in Table 15. Effectiveness of synthesized primers to amplify the expected PCR product was first

evaluated on its respective cDNA clone, pC4 (Figure 6, lane 11). Example 8 - Development of a Simple and Effective PCR Sample

Preparation.

Initially purified dsRNA was used in a RT-PCR reaction. The expected 219 bp PCR product was consistently observed with the internal set of primers (Figure 6, lane 10). To test whether or not these primers derived from GLRaV-3 specific dsRNA sequence is in fact the GLRaV-3 genome sequence, RNA extracted from a highly purified virus preparation was

included in an assay. As expected, PCR products with similar size (219 bp) were observed in cloned piasmid DNA (pC4)

(Figure 6, lane 11), dsRNA (Figure 6, lane 10) as well as purified viral RNA (Figure 6, lane 9). This PCR result was the first evidence that dsRNA isolated from leafroll-infected tissue was derived from the GLRaV-3 genome. However, PCR sample preparations from the purified virus procedure are too complicated to be used for leafroll diagnosis. Simplification sample preparations used viral RNA extracted from a partially purified virus preparation. This partially purified virus preparation was again shown to be effective in RT-PCR (Figure 6). Sensitivity of RT-PCR was further evaluated with 10-fold serial dilution (up to 10^-5) of a sample. The expected PCR product of 219 bp in a partially purified virus preparation was observable up to the 10^-3 dilution (Figure 6, lane 4).

Although RT-PCR was shown again to work with partially

purified virus preparations, this method of sample preparation was still too complicated to be used in a routine disease diagnosis. Over 10 attempts to directly use crude extract for RT-PCR were unsuccessful. Proteinase K-treated crude extract was by far the most simple and still effective pretreatment for RT-PCR. Therefore, the proteinase K-treated crude extract was used to evaluate RT-PCR for its ability to detect GLRaV-3. Example 9 - RT-PCR

With proteinase K-treated crude extract prepared from scraped phloem tissue collected from a typical leafroll infected vine (Doolittle's vineyard, New York), a PCR product of 219 bp was readily observed. However, application of this sample preparation method to other field collected samples (USDA, PGRU, Geneva, NY) was disappointing. With different batches of sample preparations, a range of 3 to 10 out of 12 ELISA positive samples were shown to have the expected PCR products. To determine whether these inconsistent results were due to some kind of enzyme (reverse transcriptase or Taq DNA polymerase) inhibition present in the proteinase K-treated crude extract, increasing amounts of a sample were added into an aliquot of 100 μl PCR reaction mixture. PCR products of 219 bp were readily observed from samples of 0.1 μl (lane 1) and 1 μl (lane 2) but not from 10 μl. Presumably, sufficient amount of enzyme inhibitors was present in the .10 μl of this sample.

Example 10 - Immuno-capture RT-PCR

The immuno-capture method further simplified sample preparation by directly using crude extracts that were

prepared in the standard ELISA extraction buffer. Immuno- capture RT-PCR (IC RT-PCR) tests were initially performed with the internal primer set, and the expected PCR product of 219 bp was observed from a typical leafroll infected sample.

However, this PCR method to test a range of field collected ELISA positive samples gave inconsistent results. In a PCR test performed with the external primer set, only five out of seven field collected ELISA positive samples were shown to amplify the expected PCR product (648 bp) (Figure 7A).

Meanwhile, the expected PCR product was consistently observed in dsRNA (Figure 7A, lane 10), but such product was never observed in the healthy control (Figure 7A, lane 9). In this case, however, the expected PCR product was not observed in a sample prepared using proteinase K-treated crude extract

(Figure 7A, lane 8).

Example 11 - Nested PCR

As described above, inconsistency of RT-PCR was

experienced with samples prepared either by the proteinase K-treated or by the immuno-capture methods. If this PCR

technique is to be used in disease diagnosis, a consistent and reproducible result is needed. Thus, the Nested PCR method was introduced. Although an expected PCR product of 648 bp from the first PCR amplification with the external primer set was not always observable (Figure 7A), in a Nested PCR

amplification with the internal primer set, the expected 219 bp PCR product was consistently observed from all seven ELISA positive samples (Figure 7B). These products were observed in dsRNA (Figure 7B, lane 10) and in the proteinase K-treated crude extract (Figure 7B, lane 8) but not in a healthy control (Figure 7B, lane 9). To determine the sensitivity of Nested

PCR with samples prepared either by proteinase K-treated or by immuno-capture methods, Nested PCR and ELISA were performed simultaneously with samples prepared from a 10-fold dilution series. The sensitivity of Nested PCR was shown to be 10^-5 in proteinase K-treated crude extract (Figure 8A), and was more than 10^-8 (the highest dilution point in this test) in an immuno-capture preparation (Figure 8B). With similar sample preparations, sensitivity for ELISA was only 10^-2.

Example 13 - Validation of PCR with ELISA and indexing

To determine whether the PCR-based GLRaV-3 detection method described in this study has a practical application in grapevine leafroll disease diagnosis, a validation experiment with plants characterized thoroughly by ELISA and indexing is necessary. Several grapevines collected at USDA-PGRU at

Geneva, New York, which have been well characterized by 3-year biological indexing and by ELISA were selected for validation tests. A perfect correlation was observed between ELISA positive and PCR positive samples, although there was some discrepancy over indexing which suggested that other types of closteroviruses may also be involved in the grapevine leafroll disease (Table 7).

PCR technology has been applied to detect viruses, viroids and phytoplasmas in the field of plant pathology (Levy et al., Journal of Virological Methods, 49:295-304 (1994)). Because of the presence of enzyme inhibitors (reverse

transcriptase and/or Taq DNA polymerase) in many plant

tissues, a lengthy and complicated procedure is usually required to prepare a sample for PCR. In studies of PCR detection of grapevine fanleaf virus, Rowhani et al.,

Phytopathology, 83:749-753 (1993), have already observed an enzyme inhibitory phenomenon. Substances including phenolic compounds and polysaccharides in grapevine tissues were

suggested to be involved in enzyme inhibition.

One of the objectives in the present study was to develop a sound practical procedure for sample preparation to

eliminate this inhibitory problem for PCR detection of GLRaV-3 in grapevine tissues. Although the expected PCR product was consistently observed from samples of dsRNA, purified virus and partial purified virus, proteinase K-treated crude extract and immuno-capture methods were the simplest and were still effective. Samples prepared with proteinase K-treated crude extract have an advantage over others in that hazardous organic solvents, such as phenol and chloroform, are avoided. However, care must be taken in the sample concentration because the reaction can be inhibited by adding too much grapevine tissue. Minafra et al., J. Virol. Methods, 47:175- 188 (1994), reported the successful PCR detection of grapevine virus A, grapevine virus B, and GLRaV-3 with crude saps prepared from infected grapevine tissues, this method of sample preparation was, however, not effective in the present study. The similar primers used by Minafra (1994), were, however, able to amplify the expected size of PCR products from dsRNA of the NY1 isolate of GLRaV-3.

Immuno-capture is another simple and efficient method of sample preparation (Wetzel (1992), which is hereby

incorporated by reference). First, crude ELISA extracts can be used directly for RT-PCR. Second, it provides not only a definitive answer, but may also be an indication to a virus serotype. Third, with an immuno-capture step, virus particles are trapped by an antibody, and inhibitory substances may be washed away. Nested PCR with samples prepared by the immuno-capture method is 10³ times more sensitive than with samples prepared by proteinase K-treated crude extract. However, this approach requires a virus specific antibody. For some newly discovered or hard to purify viruses, a virus specific

antibody might not be available. There are at least six serologically distinctive closteroviruses associated with grapevine leafroll disease (Boscia (1995)).

Example 13 - Nucleotide Sequence and Open Reading Frames

A lambda ZAPII library was prepared from cDNA that was synthesized with random primed, reverse transcription of

GLRaV-3 specific dsRNA. Initially, white/blue color selection in IPTG/X-gal containing plates was used to estimate the ratio of recombination. There were 15.7% white plaques, or an estimated 7 X 10⁴ GLRaV-3 specific recombinants in this cDNA library. The library was screened with probes prepared from UNI-AMP™ PCR-amplified GLRaV-3 cDNA. More than 300 clones with inserts of up to 3 kb were selected after screening the cDNA library with probe prepared from UNI-AMP™ PCR-amplified GLRaV-3 cDNA. In Northern blot hybridization, a probe

prepared from the cloned insert of pC4, reacted strongly to the 16 kb dsRNA as well as to several other smaller Mr dsRNAs. No hybridization with nucleic acids from healthy grape or to dsRNA of CTV was observed (Figure 1).

Clone pB3-1 was selected and sequenced after screening the library with HSP70 degenerate primer

(5'GGIGGIGGIACITTYGAYGTITCI (SEQ ID NO:25)). Other clones that were chosen for nucleotide sequencing were selected by the clone walking strategy. The nucleotide sequencing

strategy employed was based on terminal sequencing of random selected clones assisted with GCG fragment assembly program to assemble and extend the sequence. The step-by-step primer extension method was used to sequence the internal region of a selected clone. A total of 54 clones were selected for

sequencing. Among them, 16 clones were completely sequenced on both DNA strands (Figure 9).

A total of 15,227 nucleotides were sequenced; nine open reading frames (ORFs) were identified designated as ORFs 1a, 1b, and 2 to 8. The sequenced region was estimated to cover about 80% of the complete GLRaV-3 genome. Major genetic components, such as helicase (ORF 1a), RdRp (ORF 1b), HSP70 homologue (ORF 4), HSP90 homologue (ORF 5) and coat protein (ORF 6) were identified.

ORF 1a was an incomplete ORF from which the 5' terminal portion has yet to be cloned and sequenced. The sequenced region presented in Figure 10 and Table 4 represents

approximately two-thirds of the expected ORF 1a , as compared to the ORF 1a from BYV, CTV, and LIYV. The partial ORF la was terminated by the UGA stop codon at positions 4165-4167; the respective product consisted of 1388 amino acid residues and had a deduced Mr of 148,603. Database searching indicated that the C-terminal portion of this protein shared significant similarity with the Superfamily 1 helicase of positive-strand RNA viruses. Comparison of the conserved domain region (291 amino acids) showed a 38.4% identity with an additional 19.7% similarity between GLRaV-3 and BYV and a 32.4% identity with an additional 21.1% similarity between GLRaV-3 and LIYV (Table 6). Six helicase conserved motifs of Superfamily 1 helicase of positive-strand RNA viruses (Hodgman, Nature, 333:22-23 (Erratum 578) (1988); Koonin et al., Crit, Rev, Biochem,

Molec, Biol., 28:375-430 (1993)) were also retained in GLRaV-3. Analysis of the predicted phylogenetic relationship in helicase domains between GLRaV-3 and the other positive-strand RNA viruses placed GLRaV-3 along with the other

closteroviruses, including BYV, CTV, and LIYV, into the

"tobamo" branch of the alphavirus-like supergroup (Figure 11, Table 5). Table 5 compares the amino acid sequence alignment of the helicase of GLRaV-3 with respect to BYV, CTV, and LIYV. Consensus amino acid residues are shown. Uppercase letters indicate identical amino acids, lowercase letters indicate at least three identical or functionally similar amino acids.

Six conserved motifs (I to VI) that are conserved among the Superfamily 1 helicase (Koonin et al., Crit, Rev, in Biochem, Molec. Biol., 28:375-430 (1993)) of the positive-strand RNA viruses are overlined.

ORF lb overlapped the last 113 nucleotides of ORF la and terminated at the UAG codon at positions 5780 to 5782. This ORF encodes a protein of 536 amino acid residues with a calculated Mr of 61,050 (Figures 10, Table 4). Database screening of this protein revealed significant similarity to the Supergroup 3 RdRp of the positive-strand RNA viruses.

Sequence comparison of GLRaV-3 with BYV, LIYV, and CTV over a 313-amino acid sequence fragment revealed a striking amino acid sequence similarity among eight conserved motifs (Table 8). Consensus amino acid residues are shown. Uppercase letters indicate identical amino acids, and lowercase letters indicate at least three identical or functionally similar amino acids. The motifs (I to VIII) that are conserved among the Supergroup 3 RNA polymerase of positive-strand RNA viruses are overlined. The best alignment was with BYV, while the least alignment was with LIYV (Table 6). Analysis of

predicted phylogenetic relationships of the RdRp domains of the alphavirus-like supergroup viruses again placed GLRaV-3 into the tobamo branch along with other closteroviruses, BYV, CTV, BYSV, and LIYV (Figure 12).

Publications on BYV, CTV, and LIYV have proposed that ORF 1b is expressed via a +1 ribosomal frameshift (Agranovsky (1994); Dolja et al., Ann, Rev, Phytopathol., 32:261-285

(1994); Karasev (1995), and Klaassen (1995)). Direct

nucleotide sequence comparison was performed within the

ORF1a/1b overlap of GLRaV-3 with respect to BYV, CTV, or LIYV. An apparently significant similarity was observed only to LIYV (Table 9), and not to BYV or CTV. The so-called "slippery" GGGUUU sequence and the stem-and-loop structure that were proposed to be involved in the BYV frameshift was absent from the GLRaV-3 ORF1a/1b overlap. The predicted frameshift within the GLRaV-3 ORF 1a/1b overlap was selected based on an

inspection of the C-terminal portion of the helicase alignment and the N-terminal portion of the RdRp alignment between

GLRaV-3 and LIYV.

Table 9 compares the aligned GLRaV-3 and LIYV nucleotide sequences (presented as DNA) in the vicinity of the proposed frameshift, nt 4099-4165 in GLRaV-3 and nt 5649-5715 in LIYV. Identical nucleotides are uppercase. LIYV predicted +1

frameshift region (aAAG) and the corresponding GLRaV-3 (cACA) are bold and italic. The encoded C-terminus of HEL and N-terminus of RdRp are presented above (GLRaV-3) and below

(LIYV) the nucleotide alignment. Repeat sequences are

underlined.

The GLRaV-3 ORF la/lb frameshift was predicted to occur in the homologous region of the LIYV genome, and was also

preceded by a repeat sequence (GCTT) (Figure 24). Unlike

LIYV, this repeat sequence was not a tandem repeat and was separated by one nucleotide (T) in GLRaV-3.

The frameshift was predicted to occur at CACA (from His to Thr) in GLRaV-3 rather than slippery sequence AAAG in LIYV. However, additional experiments on in vi tro expression of

GLRaV-3 genomic RNA are needed in order to determine whether or not a large fusion protein is actually produced. ORF 2 is predicted to encode a small peptide of 51 amino acids and a calculated Mr of 5,927. Database searching did not reveal any obvious protein matches within the existing Genbank (Release 84.0).

Intergenic regions of 220 bp between ORF lb and ORF 2 and

1065 bp between ORF 2 and ORF 3 were identified. There is no counterpart in the BYV or LIYV genomes; instead, an ORF of 33K in CTV (Karasev et al., J. Gen. Virol., 75:1415-1422 (1994)) or 32K in LIYV (Klaassen (1995)) is observed over this similar region.

ORF 3 encodes a small peptide of 45 amino acids and a calculated Mr of 5,090 (p5K). Database searching revealed that it was most closely related to the small hydrophobic, transmembrane proteins of BYV (6.4K), CTV (6K), and LIYV (5K) Individual comparison (Table 3) showed that LIYV was its closest relative (45.8%) at the nucleotide level and BYV was the most homologous (30.4%) at the amino acid level.

Table 10 compares the aligned amino acid sequences the small hydrophobic transmembrane protein of GLRaV-3 p5K with those of BYV (p6K), CTV (p6K), and LIYV (p5K). Consensus amino acid residues are shown. Lowercase letters indicate at least three identical or functionally similar amino acids.

The transmembrane domain that has been identified in several other closteroviruses, BYV, CTV, and LIYV (Karasev et al.,

Virology, 208:511-520 (1995)), is overlined.

ORF 4 encodes a protein of 549 amino acids and a

calculated Mr of 59,113 (p59) (Figure 10, Table 4). Database screening revealed significant similarity to the HSP70 family, the p65 protein of BYV, the p65 protein of CTV, and the p62 protein of LIYV. A multiple amino acid sequence alignment of GLRaV-3 p59 with HSP70 analogs of other closteroviruses showed striking sequence similarity among eight conserved motifs (A-H). Functionally important motifs (A-C) that are

characteristic of all proteins containing the ATPase domain of the HSP70 type (Bork et al., Proc, Natl, Acad, Sci. USA,

89:7290-7294 (1992)) were also preserved in GLRaV-3 p59, which suggested that this HSP70 chaperonin-like protein may also possess ATPase activity on its N-terminal domain and protein- protein interaction on its C-terminal domain (Dolja (1994).

Table 11 presents the amino acid sequence alignment of the HSP70-related protein of GLRaV-3 (p59K) with those of BYV (p65K), CTV (p65K), and LIYV (p62K). The eight conserved motifs (A to H) of cellular HSP70 are overlined. Consensus amino acid residues are shown. Uppercase letters indicate identical amino acids, and lowercase letters indicate at least three identical or functionally similar amino acids.

Analysis of the predicted phylogenetic relationship of p59 of GLRaV-3 with HSP70-related proteins of other

closteroviruses (BYV, CTV, and BYSV) and cellular HSP70s again placed the four closteroviruses together and the rest of the cellular HSP70s on the other branches (Figure 13). Although several closterovirus HSP70-related proteins are closely related to each other and distant from other cellular members of this family, inspection of the phylogenetic tree indicates that GLRaV-3 may be an ancestral closterovirus relatively early in evolution as predicted by Dolja (1994), because

GLRaV-3 was placed in between closteroviruses and the other cellular HSP70 members.

ORF 5 encodes a protein of 483 amino acids with a

calculated Mr of 54,852 (p55) (Figure 10, Table 4). Table 12 compares the alignment of the amino acid sequence deduced from the PCR fragment of GLRaV-3 with respective regions of HSP90 homologues of beet yellow virus (BYV) (p64), citrus tristeza virus (CTV) (p61), and lettuce infectious yellow virus (LIYV) (p59). Consensus amino acid residues are shown. Uppercase letters indicate identical amino acids, lowercase letters indicate at least three identical or functionally similar amino acids.

No significant sequence homology with other proteins was observed in the current database (GenBank, release 84.0).

Direct comparison with other counterparts (p61 of CTV, p64 of BYV, and p59 of LIYV) of closteroviruses revealed some degree of amino acid sequence similarity, with 21.7% to BYV, 17.5% to CTV, and 16.7% to LIYV, respectively (Tables 6, 11, 12). Two conserved regions of HSP90 previously described in BYV and CTV (Pappu (1994)) were identified in the p55 of GLRaV-3 (Table 13).

ORF 6 encodes a protein of 313 amino acids with a

calculated Mr of 34,866 (p35) (Figure 10 and Table 4). The fact that this ORF was encoded by three overlapping GLRaV-3 immunpositive clones indicates that it contains the coat protein gene of GLRaV-3. Alignment of the product of ORF 6 (p35) with the coat protein sequences of BYV, CTV, and LIYV, is presented in Table 3. The typical consensus amino acid residues (S, R, and D) of the coat protein of the filamentous plant viruses (Dolja (1991)), which may be involved in salt bridge formation and the proper folding of the most conserved core region (Boyko (1992)), were also retained in the p35 (Table 3). Individual sequence comparison showed the highest similarity to CTV (20.5%) and BYV (20.3%), and the lowest similarity to LIYV (17.8%). Analysis of predicted

phylogenetic relationships with other filamentous plant viruses tentatively placed GLRaV-3 into a separate, but a closely related branch of closteroviruses (Figure 5).

ORF 7 encodes a protein of 477 amino acids with a

calculated Mr of 53,104 (p53) (Figure 10 and Table 4). Based on the presence of conserved seuqences, this protein is designated as grapevine leafroll virus coat protein repeat (p53).

ORF 8 encodes an undefined polypeptide of a calculated Mr of 21,248 (p21).

ORF 9 encodes an undefined protein of calculated Mr of 19,588 (p20).

ORF 10 encodes an undefined polypeptide with a calculated Mr of 19,653 (p20).

ORF 11 encodes an undefined protein of calculated Mr of 6963 (p7).

In the present study, many GLRaV-3 dsRNA specific cDNA clones were identified using a probe generated from UNI-AMP™ PCR-amplified cDNA. Using UNI-AMP™ adapters and primers

(Clontech) in PCR has several advantages. First, it is not necessary to know the nucleotide sequence of an amplified fragment. Second, cDNA can be amplified in sufficient amounts for specific probe preparation. In general, cDNA amplified by PCR using UNI-AMP™ primers and adapters could be used for cloning as well as a probe for screening of cDNA libraries. However, low abundance of the starting material and many cycles of PCR amplification often incorporate errors into the nucleotide sequence (Keohavong et al., Proc. Natl. Acad. Sci. USA, 86:9253-9257 (1989); Saiki et al., Science, 239:487-491 (1988)). In the present study, only UNI-AMP™ PCR amplified cDNA was used as a probe for screening. The cDNA library was generated by direct cloning of the cDNA that was synthesized by AMV reverse transcriptase. Therefore, the cDNA cloned inserts are believed to more accurately reflect the actual sequence of the dsRNA and the genomic RNA of GLRaV-3.

A total of 15,227 nucleotides or about 80% of the

estimated 16 kb GLRaV-3 dsRNA was cloned and sequenced.

Identification of this sequence fragment as the GLRaV-3 genome was based on its sequence alignment with the coat protein gene of GLRaV-3. This is the first direct evidence showing that high molecular weight dsRNA (~16 kb) isolated from GLRaV-3 infected vines is derived from GLRaV-3 genomic RNA. Based upon the nine ORFs identified, the genome organization of GLRaV-3 bears significant similarity to the other

closteroviruses sequenced (BYV, CTV, and LIYV) (Figure 10).

Dolja (1994) tentatively divided the closterovirus genome into four modules. For GLRaV-3, the 5' accessory module including protease and vector transmission factor is yet to be identified. The core module, including key domains in RNA replication machinery (MET-HEL-RdRp) that is conserved

throughout the alphavirus supergroup, has been revealed in parts of the HEL and RdRp domains. The MET domain has not yet been identified for GLRaV-3. The chaperon module, including three ORFs coding for the small transmembrane protein, the HSP70 homologue, and the distantly related HSP90 homologue, has been fully sequenced. The last module includes coat protein and its possible diverged copy and is also preserved in GLRaV-3. Overall similarity of the genome organization of GLRaV-3 with other closteroviruses further support the

inclusion of GLRaV-3 as a member of closteroviruses (Hu (1990) and Martelli (1991), which are hereby incorporated by

reference). However, observation of a predicted ambisense gene on its 3' terminal region may separate GLRaV-3 from other closteroviruses. Further comparative sequence analysis (Table 3) as well as phylogenetic observation of GLRaV-3 with respect to other closteroviruses over the entire genome sequence region suggested that GLRaV-3 is most closely related to BYV, followed by CTV, and LIYV.

As suggested by others (Agranovsky (1994), Dolja (1994), Karasev (1995), and Klaassen (1995)), expression of ORF 1b in closteroviruses may be via a +1 ribosomal frameshift

mechanism. In GLRaV-3, a potential translation frameshift of ORF lb could make a fusion HEL-RdRp protein of over 1,926 amino acid residues with a capacity to encode a protein of more than 210K Comparative study of GLRaV-3 with respect to other closteroviruses over the ORF la/lb overlap revealed a significant sequence similarity to LIYV, but not to BYV or to CTV. The so-called slippery sequence (GGGUUU) and stem-loop and pseudoknot structures identified in BYV (Agranovsky

(1994), which is hereby incorporated by reference) is not present in GLRaV-3. Thus, a frameshift mechanism that is similar to LIYV may be employed for GLRaV-3. However, protein analysis is necessary in order to determine the protein

encoding capacities of these ORFs.

Differing from BYV, both CTV and LIYV have an extra ORF (ORF 2) in between RdRp (ORF 1b) and the small membrane

protein (ORF 3) and potentially encoding a protein of 33K or 32K, respectively. However, in GLRaV-3, there is a much smaller ORF 2 (7K) followed by a long intergenic region of 1065 bp.

So far, among all plant viruses described, the HSP70 related gene is present only in the closteroviruses (Dolja

(1994)). Identification of the GLRaV-3 HSP70 gene was based on an assumption that this gene should also be present in the closterovirus associated with grapevine leafroll disease, specifically GLRaV-3. Thus, cDNA clones that reacted with HSP70-degenerated primers were identified for sequence analysis. The identification of subsequent clones for sequencing was based on the gene-walking methodology.

However, identification of immunopositive clones enabled identification of the coat protein gene of GLRaV-3 and proved that the HSP70 -containing sequence fragment is present in the GLRaV-3 RNA genome.

The 16 kb dsRNA used for cDNA synthesis was assumed to be a virus replicative form (Hu (1990). Selected clones have been shown by Northern hybridization to hybridize to the 16 kb dsRNA and several smaller RNAs (presumably subgenomic RNAs) (Figure 1). Second, three GLRaV-3 antibody-reacting clones were identified after immuno-screening of the protein

expression library with both GLRaV-3 polyclonal (Zee (1987)) and monoclonal (Hu (1990)) antibodies. After nucleotide sequencing, these three antibody-reacting clones were shown to overlap one another and contain a common ORF which potentially encodes a protein with calculated Mr of 35K. This is

consistent with the Mr estimated on SDS-PAGE (41K). Third, analysis of the partial genome sequence of GLRaV-3 suggested a close similarity in genome organization and gene sequences to the other closteroviruses (Dolja (1994)).

Information regarding the genome of GLRaV-3 provides a better understanding of this and related viruses and adds to the fundamental knowledge of closteroviruses. Present work on the nucleotide sequence and genome organization (about 80% of the estimated genome sequence) has provided direct evidence for a close relationship between GLRaV-3 and other

closteroviruses. It has also enabled, for the first time, the evaluation of phylogenetic relationships of GLRaV-3 based on a wide range of genes and gene products (helicase, polymerase, HSP70 homologue, HSP90 homologue, and coat protein). Based upon major differences in genome format and organization between BYV, CTV, and LIYV, along with phylogenetic analysis, Dolja (1994)) proposed the establishment of the new family Closteroviridae with three new genera of Closterovirus (BYV), Ci trivirus (CTV), and Biclovirus (LIYV). This work on genome organization and phylogenetic analysis, along with evidence that this virus is transmitted by mealybugs (see hereinabove) indicates that a new genus under Closteroviridae family should be established. Thus, GLRaV-3 (the NY1 isolate) is proposed as the type representative of the new genus, Graclovirus (grapevine clo-sterovirus). Further sequencing of other grapevine leafroll associated closteroviruses may add more members to this genus.

Another cDNA library of GLRaV-3 has been established recently from dsRNA of an Italian isolate of GLRaV-3

(Saldarelli et al., Plant Pathology (Oxford). 43:91-96 (1994), which is hereby incorporated by rsference). Selected clones react specifically to GLRaV-3 dsRNA on a Northern blot;

however, no direct evidence was provided to suggest that those clones were indeed from GLRaV-3 genomic RNA. Meanwhile, a small piece of sequence information from one of those cDNA clones was used to synthesize primers for the development of a PCR detection method (Minafra (1994), which is hereby

incorporated by reference). Direct sequence comparison of these primer sequences to GLRaV-3 genome sequence obtained in the present study, showed that one of the primers (H229,

5'ATAAGCATTCGGGATGGACC (SEQ ID NO: 27)) is located at

nucleotides 5562-5581 and the other (C547,

5'ATTAACtTgACGGATGGCACGC (SEQ ID NO: 28)) is in reverse

direction and is the complement of nucleotides 5880-5901.

Mismatching nucleotides between the primers and GLRaV-3

sequence are shown in lowercase letters. Sequence comparison over these short primer regions to GLRaV-3 (isolate NY1) genome sequence showed a 90-95% identity, which suggested that these two isolates belong to the same virus (GLRaV-3).

Moreover, the primers prepared by Minafra (1994), which is hereby incorporated by reference, from the Italian isolate of GLRaV-3 produced an expected size of PCR product with

templates prepared from the NY1 isolate of GLRaV-3. The remainder of the GLRaV-3 genome can be readily sequenced using the methods described herein and/or techniques well known to the art. Example 14 - Identification and Characterization of the 43 K ORF

The complete nucleotide sequence of the GLRaV-3 HSP90related gene is given in Table 4. Initial sequencing work indicated that an open reading frame (ORF) encoding for a protein with a calculated Mr of 43K (Table 14) was downstream of the HSP70-related gene. This gene was selected for

engineering because the size of its encoded product is similar to the GLRaV-3 coat protein gene. However, after sequence analysis, this incomplete ORF was located in the 3' terminal region of the HSP90-related gene. It is referred to herein as the incomplete GLRaV-3 HSP90 gene or as the 43K ORF.

Example 15 - Custom-PCR Engineering the Incomplete GLRaV-3 HSP90 Gene for Expression in Plant Tissues

Two custom synthesized oligonucleotide primers, 5' primer (93-224, tacttatctagaaccATGGAAGCGAGTCGACGACTA (SEQ ID NO: 29)) and 3' complementary primer (93-225,

tcttgaggatccatggAGAAACATCGTCGCATACTA (SEQ ID NO: 30)) that flank the 43K ORF were designed to amplify the incomplete

HSP90 gene fragment by polymerase chain reaction. Addition of a restriction enzyme NcoI site in the primer facilitates cloning and protein expression (Table 15) (Slightom, Gene, 100:251-255 (1991)). Using these primers, a product of the proper size (1.2 kb) was amplified by RT-PCR using GLRaV-3 double-stranded RNA (dsRNA) as template.

Table 14 shows the nucleotide sequence fragment

containing the 43 kDa open reading frame that used to engineer the plant expression cassette, pBI525GLRaV-3hsp90. This fragment (nucleotides 9404 to 10,503 of the partial GLRaV-3 genome sequence, Table 4) is located in the 3' portion of

GLRaV-3 HSP90-related gene. Nucleotides shown in lower case facilitate cloning by adding NcoI restriction sites. The PCR amplified product was treated with NcoI, isola_ted from a low-melting temperature agarose gel, and cloned into the same restriction enzyme treated binary vector pBI525

(obtained from William Crosby, Plant Biotechnology Institute, Saskatoon, Sask., Canada), resulting in a clone pBI525GLRaV- 3hsp90 (Figure 31). A plant expression cassette, the EcoRI and HindIII fragment of clone pBI525GLRaV-3hsp90, which contains properly engineered CaMV 35S promoters and a Nos 3' untranslated region, was excised and cloned into a similar restriction enzyme digested plant transformation vector, pBin19 (Figure 14) (Clontech Laboratories, Inc.). Two clones, pBin19GLRaV-3hsp90-12-3 and pBin19GLRaV-3hsp90-12-4 that were shown by PCR to contain the proper size of the incomplete HSP90 gene were used to transform the avirulent A .

tumefaciens, strain LBA4404 via electroporation (Bio-Rad).

The potentially transformed Agrobacterium was plated on selective media with 75 μg/ml of kanamycin. Agrobacterium lines which contain the HSP90 gene sequence were used to transform tobacco (Nicotiana tobacum cv. Havana 423) using standard procedures (Horsch et al., Science, 227:1229-1231

(1985)). Kanamycin resistant tobacco plants were analyzed by PCR for the presence of the transgene. Transgenic tobacco plants with the transgene were self pollinated and seed was harvested.

Example 16 - Custom-PCR Engineering of the 43K ORF

The complete sequence of the GLRaV-3 hsp90 gene was reported in Table 4. However, in the present study, using two custom synthesized oligo primers (93-224,

tacttatctagaaccATGGAAGCGAGTCGACGACTA (SEQ ID NO:29) and 93- 225, tcttgaggatccatggAGAAACATCGTCGCATACTA (SEQ ID NO: 30)) and GLRaV-3 dsRNA as template, the incomplete HSP90 related gene sequence was amplified by RT-PCR which added an NcoI

restriction enzyme recognition sequence (CCATGG) around the potential translation initiation codon (ATG) and another NcoI site, 29 nt downstream from the translation termination codon (TAA) (Table 14). The PCR amplified fragment was digested with NcoI, and cloned into the same restriction enzyme treated plant expression vector, pBI525. Under ampicillin selective conditions, hundreds of antibiotic resistant transformants of E. coli strain DH5a were generated. Clones derived from five colonies were selected for further analysis. Restriction enzyme mapping (NcoI or BamHI and EcoRV) showed that three out of five clones contained the proper size of the incomplete GLRaV-3 HSP90 sequence. Among them, two clones were

engineered in the correct 5'-3' orientation with respect to the CaMV-AMV gene regulatory elements in the plant expression vector, pBI525. A graphical structure in the region of the plant expression cassette of clone pBI525GLRaV-3hsp90-12 is presented in Figure 14.

The GLRaV-3 HSP90 expression cassette was removed from clone pBI525GLRaV-3hsp90-12 by a complete digestion with

HindIII and EcoRI and cloned into the similar restriction enzyme treated plant transformation vector pBinl9. A clone designated as pBin19GLRaV-3hsp90-12 was then obtained (Figure 14) and was subsequently mobilized into the avirulent

Agrobacterium strain LBA4404 using a standard electroporation protocol (Bio-Rad). Potentially transformed Agrobacterium cells were then plated on a selective medium (75 μg/ml

kanamycin), and antibiotic resistant colonies were analyzed further by PCR with specific synthesized primers (93-224 and 93-225) to see whether or not the incomplete HSP90 gene was still present. After analysis, clone LBA4404/pBin19GLRaV-3hsp90-12 was selected and used to transform tobacco tissues.

Example 17 - Transformation and Characterization of Transgenic Plants

The genetically engineered A. tumefaciens strain,

LBA4404/pBin19GLRaV-3hsp90-12, was co-cultivated with tobacco leaf discs as described (Horsch (1985)), Potentially

transformed tobacco tissues were selected on MS regeneration medium (Murashige et al., Physiologia Plantarum, 15:473-497 (1962)) containing 300 μg/ml of kanamycin. Numerous shoots developed from kanamycin resistant calli in about 6 weeks. Rooted tobacco plants were obtained following growth of developed shoots on a rooting medium (MS without hormones) containing 300 μg/ml of kanamycin. Eighteen independent, regenerated kanamycin resistant plants were transplanted in a greenhouse and tested for the presence of the HSP90-related gene by PCR. Fourteen out of eighteen selected kanamycin resistant putative transgenic lines were shown to contain a PCR product with the expected size of 1.2 kb.

The genetically engineered Agrobacterium tumefaciens strain LBA4404/pBin19GLRaV-3hsp90-12 was also used to

transfrom the grapevine rootstock C. 3309 (Vitis riparia x Vi tis rupestris) . Embryogenic calli of C. 3309 were obtained by culturing anthers on MSE medium (Murashige and Skoog salts plus 0.2% sucrose, 1.1 mg/L 2,-4-D, and 0.2 mg/L BA. The medium was adjust to pH 6.5 and 0.8% Noble agar was added. After autoclaving 100 ml M-0654, 100 ml M-0529 and 1 ml vitamin M-3900 were added to the medium. Ater 60 days primary calli were indcued and transferred to hormone-free HMG medium (1/2 Murashige salts with 10 g/L sucrose, 4.6 g/L glycerol and 0.8% Noble agar) for embryogenesis. Calli with globular or heart-shaped embryos were immersed for 15 min. in A.

tumefaciens LBA4404/pBin19GLRaV-3hsp90-12 suspended in MS liquid medium. The embryos were blotted on filter paper to remove excess liquid and transferred to HMG medium with acetosyringone (100 μM) and kept for 48 hrs. in the dark at 28°C. The calli were then washed 2-3 times in MS liquid medium plus cefotaxime (300 μg/ml) and carbenicillin (200 μg/ml) and transferred to HMG medium with the same antibiotics for 1-2 weeks. Subsequently, the embryogenic calli were transferred to HMG medium containing 20 or 20 μg/ml kanmamycin and 300 μg/ml cefotaxime plus 200 μg/ml carbenicillin to select for transgenic embryos. After being on selective medium for 3-4 months, growing embryos were transferred to HMG, MGC (full-strength MS salts amended with 20 g/L sucrose, 4.6 g/L glycerol, 1 g/L casein hydrolysate and 0.8% Noble agar), or MSE medium with kanamycin. After 4 months

germinated embryos were transferred to baby food jars containing rooting medium (Woody plant medium described by Lloyd and McCown (1981) "Commercially feasible

micropropagation of mountain laurel, Kalmia la tifola , by use of shoot tip culture," Proc . Intl . Plant Prop. Soc .30:421-427, supplemented with 0.1 mg/L BA, 3 g/L activated charcoal and 1.5% sucrose. The pH was adjusted to 5.8 and Noble agar was added to 0.7%) . Plantlets with roots were transplatned to pots with artificial soil mix and grown in greenhouses. 88 grapevine plants have cultivated, and several have been shown to contain the 43 kDa protein gene (by PCR).

Using the methods described above, engineering of the incomplete HSP90 gene of GLRaV-3 into plant expression and transformation vectors has been effected. The targeted gene sequence was shown to be integrated into the plant genome by PCR analysis of the putative transgenic tobacco plants. The engineered A . tumefaciens strain LBA4404/pBin19GLRaV-3hsp90-12 has been used to transform grapes and tobacco. Furthermore, this plant transformation vector can serve as a model for construction of other GLRaV-3 vectors, such as coat protein, RdRp, and HSP70, for which nucleotide sequences are disclosed herein.

Since the first demonstration of transgenic tobacco plants expressing the coat protein gene of TMV resulted in resistance against TMV infection (Powell-Abel et al., Science, 232:738-743 (1986), which is hereby incorporated by

reference), the phenomenon of the coat protein-mediated

protection has been observed for over 20 viruses in at least 10 different taxonomic groups in a wide variety of

dicotyledonous plant species (Beachy et al., Annu . Rev.

Phytopathol., 28:451-74 (1990); Wilson, Proc. Natl. Acad.

Sci., USA, 90:3134-3141 (1993)). If gene silencing (or co-suppression) (Finnegan et al., Bio/Technology, 12:883-888

(1994); Flavell, Proc. Natl. Acad. Sci. USA, 91:3490-3496

(1994)) is one of the resistance mechanisms (Lindbo et al.,

The Plant Cell, 5:1749-1759 (1993); Pang et al.,

Bio/Technology, 11:819-824 (1993); Smith et al., The Plant Cell. 6:1441-1453 (1994)), then one would expect to generate transgenic plants expressing any part of a viral genome sequence to protect plants from that virus infection. Thus, in the present study, transgenic plants expressing the 43K ORF (or the incomplete hsp90 gene) are protected from GLRaV-3 infection.

Since tobacco (Nicotiana tobaccum cv . Havana 423) is not the host of GLRaV-3, direct evaluation of virus resistance was not possible in tobacco. However, after mechanical

inoculation of N. benthamiana with grapevine leafroll infected tissue, Boscia (1995) have recovered a long closterovirus from N. benthamiana which is probably GLRaV-2. Thus, it is believed that other types of grapevine leafroll associated closteroviruses can also be mechanically transmitted to N.

benthamiana . With transfer of an engineered 43K ORF from GLRaV-3 to N. benthamiana and to the grapevine rootstock

Couderc 3309, it is possible to evaluate the resistance of those plants against GLRaV-2 infection.

Example 18 - Coat Protein-mediated Protection and Other Forms of Pathogen-derived Resistance

The successful engineering technique used in the above work can be utilized to engineer other gene sequences of

GLRaV-3 which have since been identified. Among these, the coat protein gene of GLRaV-3 is the primary candidate since coat protein-mediated protection (Beachy (1990); Hull et al., Crit, Rev, Plant Sci., 11:17-33 (1992); Wilson (1993)) has been the most successful example in the application of the concept of pathogen-derived resistance (Sanford et al., J.

Theor, Biol., 113:395-405 (1985)). Construction of plant expression vector (pEPT8/cpGLRaV-3) and Agrobacterium binary vector (pGA482pEPT8/cpGLRaV-3) was done following a strategy similar to the above. The GLRaV-3 coat protein gene was PCR amplified with primers (KSL95-5,

actatttctagaaccATGGCATTTGAACTGAAATT (SEQ ID NO:31), and KSL95-6, ttctgaggatccatggTATAAGCTCCCATGAATTAT (SEQ ID NO: 32)) and cloned into pEPT8 after NcoI treatment. The expression

cassette from pEPT8/cpGLRaV-3 (including double CaMV 35S enhancers, 35S promotor, alfalfa mosaic virus leader sequence, GLRaV-3 coat protein gene, and 35S terminator) was digested with HindIII and cloned into pGA482G (Figure 15). The

resulting Agrobacterium binary vector (pGA482GpEPT8/cpGLRaV-3) was mobilized into A. tumefaciens strain C58Z707 and used for transformation of grapevines.

Other gene sequences (e.g., ORF 1b, the RNA dependent RNA polymerase) can also be used, as replicase-mediated protection has been effectively used to protect plants from virus

infection (Carr et al., Seminars in Virology, 4:339-347

(1993); Golemboski et al., Proc. Natl. Acad. Sci, USA,

87:6311-6315 (1990)). The HSP70 homologue can also be used to generate transgenic plants that are resistant to all types of grapevine leafroll associated closteroviruses because

significant sequence similarity is observed over HSP70

conserved domains. Moreover, the phenomenon of RNA-mediated protection has also been observed (de Haan et al.,

Bio/Technology, 10:1133-1137 (1992); Farinelli et al., Mol, Plant Microbe Interact., 6:284-292 (1993); Kawchuk et al.,

Mol, Plant Microbe Interact, 4:247-253 (1991); Lindbo et al., Virology, 189:725-733 (1992); Lindbo et al., Mol, Plant

Microbe Interact, 5:144-153 (1992); Lindbo et al., Seminars in Virology, 4:369-379 (1993); Pang (1993); Van Der Wilk et al., Plant Mol. Biol., 17:431-440 (1991)). Thus, untranslatable transcript versions of the above mentioned GLRaV-3 genes also produce leafroll resistant transgenic plants.

Another form of pathogen-derived resistance effective in the control of plant viral disease is the use of antisense RNA. Transgenic tobacco plants expressing the antisense sequence of the coat protein gene of cucumber mosaic virus (CMV) showed a delay in symptom expression by CMV infection (Cuozzo et al., Bio/Technology, 6:549-554 (1988)). Transgenic plants expressing either potato virus X (PVX) coat protein or its antisense transcript were protected from infection by PVX. However, plants expressing antisense RNA were protected only at low inoculum concentration. The extent of this protection mediated by antisense transcript is usually lower than transgenic plants expressing the coat protein (Hemenway et al., EMBO J., 7:1273-1280 (1988)). This type of resistance has also been observed in bean yellow mosaic virus (Hammond et al., Phytopathology, 81:1174 (1991), tobacco etch virus

(Lindbo et al., Virology, 189:725-733 (1992)) potato, virus Y (Farinelli (1993)), and zucchini yellow mosaic virus (Fang et al., Mol. Plant Microbe Interact., 6:358-367 (1993)).

However, high level of resistance mediated by antisense sequence was observed to be similar to potato plants (Russet Burbank) expressing potato leafroll virus coat protein

(Kawchuk (1991)). Besides using antisense transcript of the virus coat protein gene, other virus genome sequences have also been demonstrated to be effective. These included the 51-nucleotide sequences near the 5' end of TMV RNA (Nelson et al., Gene (Abst), 127:227-232 (1993)) and noncoding region of turnip yellow mosaic virus genome (Zaccomer et al., Gene, 87- 94 (1993)).

GLRaV-3 has been shown to be transmitted by mealybugs and in some cases it has been shown to spread rapidly in vineyards (see hereinabove). This disease will become more of a problem if mealybugs become resistant to insecticides or if

insecticide use is restricted. Thus, the development of leafroll resistant grapevines is environmentally sound and good for the economics of grape growing.

Although grapevine is a natural host of Agrobacterium (A. vi tis is the causal agent of the grapevine crown gall

disease), transformation of grapevine has proven difficult (Baribault et al., J. Exp, Bot., 41:1045-1049 (1990);

Baribault et al., Plant Cell Reports, 8:137-140 (1989); Colby et al., J. Am, Soc, Hort. Sci., 116:356-361 (1991); Guellec et al., Plant Cell Tissue Organ Cult., 20:211-216 (1990); Hebert et al., Plant Cell Reports, 12:585-589 (1993); Le Gall et al., Plant Science, 102:161-170 (1994); Martinelli et al.,

Theor, Appl, Genetics, 88:621-628 (1994); Mullins et al.,

Bio/Technology, 8:1041-1045 (1990)). Recently, an efficient regeneration system using proliferative somatic embryogenesis and subsequent plant development has been developed from zygotic embryos of stenospermic seedless grapes (Mozsar, J. et al., Vitis, 33:245-246 (1994); Emerschad (1995)). Using this regeneration system, Scorza et al., Plant Cell Reports, 14:589-592 (1995) succeeded in obtaining transgenic grapevines through zygotic-derived somatic embryos after particlewounding/A. tumefaciens treatment. Using a Biolistic device, tiny embryos were shot with gold particles (1.0 μm in

diameter). The wounded embryos were then co-cultivated with A . tumefaciens containing engineered plasmids carrying the selection marker of kanamycin resistance and β-glucuronidase (GUS) genes. Selection of transgenic grapevines was carried out with 20 μg/ml kanamycin in the initial stage and then 40 μg/ml for later proliferation. Small rooted seedlings were obtained from embryogenic culture within 5 months of

bombardment/A. tumefaciens (Scorza (1995)). Transgenic grapevines were analyzed by PCR and Southern hybridization, and shown to carry the transgenes. The above-mentioned grapevine transformation approach has been carried out in the current investigation to generate transgenic grapevines expressing GLRaV-3 genes. Evaluation of any potential

leafroll resistance on transgenic grapevines is carried out using insect vectors or by grafting.

Example 19 - Production of Antibodies Recognizing GLRaV3

E. coli harboring the clone pCP10-1, which contains the major portion of the coat protein gene of GLRaV3 (Figure 4), was used to express the coat protein and the β-galactosidase fusion protein. About 500 ml of LB medium containing 50 μg/ml of ampicillin was inoculated with a single colony and

incubated with rigorous shaking for overnight until log-phase growth. Expression of the fusion protein was induced by the addition of 1 mM IPTG. Bacteria were harvested by

centrifugation at 5,000 rpm for 10 min. The bacterial

envelope was broken by sonication. After low speed

centrifugation to remove cell debris, the fusion protein was precipitated by the addition of saturated ammonium sulfate, then resuspended in PBS buffer and electrophoresed in a SDS- polyacrylamide gel (SDS-PAGE). The fusion protein band was excised after soaking the SDS-PAGE gel in 0.25M KCl to locate the protein band. The protein was eluted with buffer (0.05M Tris-HCl, pH 7.9, 0.1% SDS, 0.1 mM EDT and 0.15 M NaCl) and precipitated by the addition of trichloroacetic acid to a final concentration of 20%.

An antiserum was prepared by immunization of a rabbit with 0.5-1 mg of the purified protein emulsified with Freund's completed adjuvant followed by two more weekly injections of 0.5-1 mg protein emulsified with Freund's incomplete adjuvant. After the last injection, antiserum was prepared from blood collected from the rabbit every week for a period of 4 months .

On Western blot analysis, the antibody gave a specific reaction to the 41K protein in GLRaV3 infected tissue as well as to the fusion protein itself (50K) and generated a pattern similar to the pattern seen in Figure 3. This antibody was also successfully used as a coating antibody and as an

antibody-conjugate in an enzyme linked immunosorbent assay (ELISA).

The above method of producing antibody to GLRaV3 can also be applied to other GLRaV-3 gene sequences of the present invention. The method affords a large amount of highly purified protein from E. coli from which antibodies can be readily obtained. It is particularly useful in the common case where it is rather difficult to obtain sufficient amount of purified virus from GLRaV3 infected grapevine tissues.

Although the invention has been described in detail for the purpose of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.

Claims (55)

CLAIMS :

1. An isolated DNA molecule encoding a protein or polypeptide of a grapevine leafroll virus.

2. An isolated DNA molecule according to claim 1, wherein the protein or polypeptide is selected from a group consisting of a helicase, an RNA-dependent RNA polymerase, an hsp70-related, an hsp90-related, a coat protein or

polypeptide, coat protein repeat, ORF8 (p21), ORF9 (P20), ORF10 (P20) and ORF11 (p7).

3. An isolated DNA molecule according to claim 2, wherein the protein or polypeptide is a helicase having a molecular weight of from about 146 to about 151 kDa.

4. An isolated DNA molecule according to claim 3, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO: 2.

5. An isolated DNA molecule according to claim 4, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO:1.

6. An isolated DNA molecule according to claim 2, wherein the protein or polypeptide is an RNA-dependent RNA polymerase having a molecular weight of from about 59 to about 63 kDa.

7. An isolated DNA molecule according to claim 6, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO:4.

8. An isolated DNA molecule according to claim 7, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO : 3.

9. An isolated DNA molecule according to claim 2, wherein the protein or polypeptide is an hsp70-related protein or polypeptide having a molecular weight of from about 57 to about 61 kDa.

10. An isolated DNA molecule according to claim 9, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO: 6.

11. An isolated DNA molecule according to claim 10, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO: 5.

12. An isolated DNA molecule according to claim 2, wherein the protein or polypeptide is an hsp90-related protein or polypeptide having a molecular weight of from about 53 to about 57 kDa.

13. An isolated DNA molecule according to claim 12, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO: 8.

14. An isolated DNA molecule according to claim 13, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO: 7.

15. An isolated DNA molecule according to claim 2, wherein the protein or polypeptide is a coat protein or polypeptide having a molecular weight of from about 33 to about 43 kDa.

16. An isolated DNA molecule according to claim 15, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO: 10.

17. An isolated DNA molecule according to claim 16, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO: 9.

18. An isolated DNA molecule according to claim 1, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO: 12.

19. An isolated DNA molecule according to claim 18, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO: 11.

20. An isolated DNA molecule according to claim 1, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO: 14.

21. An isolated DNA molecule according to claim 20, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO: 13.

22. An isolated DNA molecule according to claim 1, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO: 16.

23. An isolated DNA molecule according to claim 22, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO: 15.

24. An isolated DNA molecule according to claim 1, wherein the protein or polypeptide comprises an amino acid sequence corresponding to SEQ ID NO: 18.

25. An isolated DNA molecule according to claim 24, wherein the DNA molecule comprises a nucleotide sequence corresponding to SEQ ID NO:17.

26. An expression system comprising a DNA segment corresponding to a DNA molecule according to any of claims 1 to 25 in a vector heterologous to the DNA molecule and wherein a nucleotide sequence encoding a protein or polypeptide of a grapevine leafroll virus is operatively linked to nucleotide sequences which direct the expression of said protein or polypeptide.

27. A host cell transformed with a heterologous

expression system according to claim 26.

28. A host cell according to claim 27, wherein the host cell is selected from the group consisting of Agrobacterium vitis and Agrobacterium tumefaciens .

29. A host cell according to claim 28, wherein the host cell is a grape cell or a citrus cell.

30. A transgenic Vi tis scion cultivar or rootstock cultivar comprising a DNA sequence encoding a protein or a polypeptide of a grapevine leafroll virus according to any of claims 1-25.

31. A transgenic Vi tis scion cultivar or rootstock cultivar according to claim 30, wherein the Vi tis scion or rootstock cultivar is a scion cultivar selected from the group consisting of Vi tis vinifra, Alden, Almeria, Anab-E-Shahi, Autumn Black, Beauty Seedless, Black Corinth, Black Damascus, Black Malvoisie, Black Prince, Blackrose, Bronx Seedless,

Burgrave, Calmeria, Campbell Early, Canner, Cardinal, Catawba, Christmas, Concord, Dattier, Delight, Diamond, Dizmar,

Duchess, Early Muscat, Emerald Seedless, Emperor, Exotic, Ferdinand de Lesseps, Fiesta, Flame seedless, Flame Tokay, Gasconade, Gold, Himrod, Hunisa, Hussiene, Isabella, Italia, July Muscat, Khandahar, Katta, Kourgane, Kishmishi, Loose Perlette, Malaga, Monukka, Muscat of Alexandria, Muscat Flame, Muscat Hamburg, New York Muscat, Niabell, Niagara, Olivette blanche, Ontario, Pierce, Queen, Red Malaga, Ribier, Rish Baba, Romulus, Ruby Seedless, Schuyler, Seneca, Suavis (IP 365), Thompson seedless, Aleatico, Alicante Bouschet, Aligote, Alvarelhao, Aramon, Baco blanc (22A), Burger, Cabernet franc, Cabernet, Sauvignon, Calzin, Carignane, Charbono, Chardonnay, Chasselas dore, Chenin blanc, Clairette blanche, Early

Burgundy, Emerald Riesling, Feher Szagos, Fernao Pires, Flora, French Colombard, Fresia, Furmint, Gamay, Gewurztraminer, Grand noir, Gray Riesling, Green Hungarian, Green Veltliner, Grenache, Grillo, Helena, Inzolia, Lagrein, Lambrusco de

Salamino, Malbec, Malvasia bianca, Mataro, Melon, Merlot, Meunier, Mission, Montua de Pilas, Muscadelle du Bordelais, Muscat blanc, Muscat Ottonel, Muscat Saint-Vallier, Nebbiolo, Nebbiolo fino, Nebbiolo Lampia, Orange Muscat, Palomino, Pedro Ximenes, Petit Bouschet, Petite Sirah, Peverella, Pinot noir, Pinot Saint-George, Primitivo di Gioa, Red Veltliner, Refosco, Rkatsiteli, Royalty, Rubired, Ruby Cabernet, Saint-Emilion, Saint Macaire, Salvador, Sangiovese, Sauvignon blanc,

Sauvignon gris, Sauvignon vert, Scarlet, Seibel 5279, Seibel

9110, Seibel 13053, Semillon, Servant, Shiraz, Souzao, Sultana Crimson, Sylvaner, Tannat, Teroldico, Tinta Madeira, Tinto cao, Touriga, Traminer, Trebbiano Toscano, Trousseau,

Valdepenas, Viognier, Walschriesling, White Riesling, and Zinfandel.

32. A transgenic Vitis scion cultivar or rootstock cultivar according to claim 30, wherein the Vitis scion or rootstock cultivar is a rootstock cultivar selected from the group consisting of Couderc 1202, Couderc 1613, Couderc 1616, Couderc 3309, Dog Ridge, Foex 33 EM, Freedom, Ganzin 1 (A × R #1), Harmony, Kober 5BB, LN33, Millardet & de Grasset 41B, Millardet & de Grasset 420A, Millardet & de Grasset 101-14, Oppenheim 4 (SO4), Paulsen 775, Paulsen 1045, Paulsen 1103, Richter 99, Richter 110, Riparia Gloire, Ruggeri 225, Saint-George, Salt Creek, Teleki 5A, Vitis rupestris Constantia, Vitis California , and Vitis girdiana .

33. A method of imparting grapevine leafroll virus resistance to a Vitis scion cultivar or rootstock cultivar comprising:

transforming a Vitis scion cultivar or rootstock cultivar with a an expression system according to claim 26 wherein said vector is a plant transformation vector.

34. A method according to claim 33, wherein the Vi tis scion cultivar or rootstock cultivar is a scion cultivar selected from the group consisting of Vitis vinifra, Alden, Almeria, Anab-E-Shahi, Autumn Black, Beauty Seedless, Black Corinth, Black Damascus, Black Malvoisie, Black Prince,

Blackrose, Bronx Seedless, Burgrave, Calmeria, Campbell Early, Canner, Cardinal, Catawba, Christmas, Concord, Dattier,

Delight, Diamond, Dizmar, Duchess, Early Muscat, Emerald

Seedless, Emperor, Exotic, Ferdinand de Lesseps, Fiesta, Flame seedless, Flame Tokay, Gasconade, Gold, Himrod, Hunisa,

Hussiene, Isabella, Italia, July Muscat, Khandahar, Katta, Kourgane, Kishmishi, Loose Perlette, Malaga, Monukka, Muscat of Alexandria, Muscat Flame, Muscat Hamburg, New York Muscat, Niabell, Niagara, Olivette blanche, Ontario, Pierce, Queen, Red Malaga, Ribier, Rish Baba, Romulus, Ruby Seedless,

Schuyler, Seneca, Suavis (IP 365), Thompson seedless,

Aleatico, Alicante Bouschet, Aligote, Alvarelhao, Aramon, Baco blanc (22A), Burger, Cabernet franc, Cabernet, Sauvignon, Calzin, Carignane, Charbono, Chardonnay, Chasselas dore,

Chenin blanc, Clairette blanche, Early Burgundy, Emerald

Riesling, Feher Szagos, Fernao Pires, Flora, French Colombard, Fresia, Furmint, Gamay, Gewurztraminer, Grand noir, Gray

Riesling, Green Hungarian, Green Veltliner, Grenache, Grillo, Helena, Inzolia, Lagrein, Lambrusco de Salamino, Malbec,

Malvasia bianca, Mataro, Melon, Merlot, Meunier, Mission, Montua de Pilas, Muscadelle du Bordelais, Muscat blanc, Muscat Ottonel, Muscat Saint-Vallier, Nebbiolo, Nebbiolo fino,

Nebbiolo Lampia, Orange Muscat, Palomino, Pedro Ximenes, Petit Bouschet, Petite Sirah, Peverella, Pinot noir, Pinot Saint- George, Primitivo di Gioa, Red Veltliner, Refosco, Rkatsiteli, Royalty, Rubired, Ruby Cabernet, Saint-Emilion, Saint Macaire, Salvador, Sangiovese, Sauvignon blanc, Sauvignon gris,

Sauvignon vert, Scarlet, Seibel 5279, Seibel 9110, Seibel 13053, Semillon, Servant, Shiraz, Souzao, Sultana Crimson, Sylvaner, Tannat, Teroldico, Tinta Madeira, Tinto cao,

Touriga, Traminer, Trebbiano Toscano, Trousseau, Valdepenas, Viognier, Walschriesling, White Riesling, and Zinfandel.

35. A method according to claim 33, wherein the Vitis scion cultivar or rootstock cultivar is a rootstock cultivar selected from the group consisting of Couderc 1202, Couderc 1613, Couderc 1616, Couderc 3309, Dog Ridge, Foex 33 EM,

Freedom, Ganzin 1 (A × R #1), Harmony, Kober 5BB, LN33,

Millardet & de Grasset 41B, Millardet & de Grasset 420A,

Millardet & de Grasset 101-14, Oppenheim 4 (SO4), Paulsen 775, Paulsen 1045, Paulsen 1103, Richter 99, Richter 110, Riparia Gloire, Ruggeri 225, Saint-George, Salt Creek, Teleki 5A, Vitis rupestris Constantia, Vitis California, and Vitis girdiana.

36. A method according to claim 33, wherein the

grapevine leafroll virus is selected from the group consisting of GLRaV-1, GLRaV-2, GLRaV-3, GLRaV-4, GLRaV-5, and GLRaV-6.

37. A method according to claim 33, wherein said

transforming is Agrobacterium-mediated.

38. A method according to claim 37, wherein said

transforming comprises:

contacting tissue of the Vitis scion cultivar or

rootstock cultivar with an inoculum of bacterium of the genus Agrobacterium transformed with an expression construct

according to claims 26 and regenerating a transformed plant.

39. A method according to claim 38, wherein the tissue is selected from the group consisting of leaf tissue, root tissue, meristems, zygotic and somatic embryos, and anthers.

40. A method according to claim 33, wherein said transforming comprises:

propelling particles at grape plant cells under

conditions effective for the particles to penetrate into the cell interior and

introducing an expression vector comprising the DNA molecule into the cell interior.

41. A method according to claim 40, wherein the vector is associated with the particles, whereby the vector is carried into the cell interior together with the particles.

42. A method according to claim 41, wherein the vector surrounds the cell and is drawn into the cell by the

particle's wake.

43. A transgenic citrus scion cultivar or rootstock cultivar transformed with an expression system according to claim 26, wherein said vector is a plant transformation vector.

44. A transgenic citrus scion cultivar or rootstock cultivar according to claim 43, wherein the citrus scion cultivar or rootstock cultivar is selected from the group consisting of lemon, lime, orange, grapefruit, pineapple, and tangerine.

45. A transgenic citrus scion cultivar or rootstock cultivar according to claim 43, wherein the citrus scion cultivar or rootstock cultivar is selected from the group consisting of Joppa, Maltaise Ovale, Parson (Parson Brown),

Pera, Pineapple, Queen, Shamouti, Valencia, Tenerife, Imperial Doblefina, Washington Sanguine, Moro, Sanguinello Moscato, Spanish Sanguinelli, Tarocco, Atwood, Australian, Bahia, Baiana, Cram, Dalmau, Eddy, Fisher, Frost Washington,

Gillette, LengNavelina, Washington, Satsuma Mandarin, Dancy, Robinson, Ponkan, Duncan, Marsh, Pink Marsh, Ruby Red, Red Seedless, Smooth Seville, Orlando Tangelo, Eureka, Lisbon, Meyer Lemon', Rough Lemon, Sour Orange, Persian Lime, West Indian Lime, Bearss, Sweet Lime, Troyer Citrange, and Citrus trifoliata.

46. A method for producing a virus-resistant citrus scion cultivar or rootstock cultivar comprising:

transforming citrus tissue with an expression vector according to claim 26.

47. A method according to claim 46, wherein said

transforming is Agrobacterium-mediated.

48. A method according to claim 46, wherein the tissue is selected from the group consisting of leaf tissue, root tissue, meristems, zygotic and somatic embryos, and anthers.

49. The method of claim 46 wherein said expression vector is introduced into plant cells by a biolistic method.

50. An antibody or binding portion thereof or probe recognizing the protein or polypeptide encoded by the DNA molecule according to any of claims 1 to 25.

51. An isolated protein or polypeptide corresponding to a protein or polypeptide of a grapevine leafroll virus encoded by a DNA molecule according to any of claims 1-25.

52. A method for detection of grapevine leafroll virus in a sample, said method comprising:

providing an antibody or binding portion thereof

recognizing the encoded protein or polypeptide according to any of claims 1 to 25; contacting the sample with the antibody or binding portion thereof; and

detecting any reaction which indicates that grapevine leafroll virus is present in the sample using an assay system.

53. A method according to claim 55, wherein the assay system is selected from the group consisting of an enzymelinked immunosorbent assay, a radioimmunoassay, a gel

diffusion precipitin reaction assay, an immunodiffusion assay, an agglutination assay, a fluorescent immunoassay, a protein A immunoassay, and an immunoelectrophoresis assay.

54. A method for detection of grapevine leafroll virus in a sample, said method comprising:

providing a nucleotide sequence of the DNA molecule according to any of claims 1 to 25 as a probe in a nucleic acid hybridization assay;

contacting the sample with the probe; and

detecting any reaction which indicates that grapevine leafroll virus is present in the sample.

55. A method for detection of grapevine leafroll virus in a sample:

providing a nucleotide sequence of the DNA molecule according to any of claims 1 to 25 as a probe in a gene amplification detection procedure;

contacting the sample with the probe; and

detecting any reaction which indicates that grapevine leafroll virus is present in the sample.