WO2000078800A2

WO2000078800A2 - Combined decorin binding protein and outer surface protein compositions and methods of use

Info

Publication number: WO2000078800A2
Application number: PCT/US2000/016763
Authority: WO
Inventors: Mark S. Hanson; Nita K. Patel; David R. Cassatt
Original assignee: Medimmune, Inc.
Priority date: 1999-06-18
Filing date: 2000-06-16
Publication date: 2000-12-28
Also published as: AU5622800A; WO2000078800A3

Abstract

Disclosed are surprisingly effective compositions, therapeutic kits and vaccines comprising one or more Borrelia decorin binding protein components and one or more Borrelia outer surface protein components. Methods and medical uses are also disclosed in which the compositions, kits and vaccines are administered to prevent and/or treat Borrelial infections, notably the Borrelial infections that cause Lyme disease.

Description

COMBINED DECORIN BINDING PROTEIN AND OUTER SURFACE PROTEIN COMPOSITIONS AND METHODS OF USE

BACKGROUND OF THE INVENTION

The present application claims priority to co-pending U.S. provisional patent application Serial No. 60/140,258, filed June 18, 1999, the entire text and references of which application are specifically incorporated by reference herein without disclaimer. The U.S. Government owns certain rights in the present invention pursuant to grant number Al 39865 from the

National Institutes of Health.

1. Field of the Invention

The present invention relates generally to the fields of immunology, molecular biology and medicine, more particularly, to the areas of Borrelial infections and Lyme disease. The invention provides surprisingly effective compositions, kits and vaccines that comprise one or more Borrelia decorin binding protein components and one or more Borrelia outer surface protein components. Narious methods and medical uses are also provided in which the compositions, kits and vaccines are employed to prevent and/or treat Borrelial infections, particularly the Borrelial infections that cause Lyme disease.

2. Description of Related Art Lyme disease (Steere, 1989), or Lyme borreliosis, is transmitted by ticks, particularly of the genus Ixodes, and caused by spirochetes of the genus Borrelia. Lyme disease agents, that is borreliae isolated from humans or animals with clinical Lyme disease, are currently classified into at least three phylogenetic groups: B. b rgdorferi sensu stricto, B. garinii, and B. af∑elii. Strains potentially representing other phylogenetic groups of Lyme disease agents as well, such as group 25015 (B. bissettii sp. nov.), have been also isolated from ixodid ticks. Collectively these spirochetes are referred to as B. burgdorferi sensu lato, or simply B. burgdorferi. The genotypic and phenotypic variation among Lyme disease agents supporting the designation of these phylogenetic subgroupings is a complicating factor for the design of effective vaccines or immunotherapeutic strategies for Lyme disease. Lyme disease is transmitted through the bite of a tick that attaches itself to the host and, upon feeding, deposits the spirochetes into the dermis of the skin. In the skin, B. burgdorferi replicates before endovascular dissemination to organs. Typically, an annular spreading skin 5 lesion, erythema migrans, forms from the site of the tick bite. Early symptoms of Lyme disease are flu-like and may include fatigue and lethargy. Left untreated, Lyme disease can develop into a chronic, multisystemic disorder involving the skin, joints, heart, and central nervous system.

Once deposited in the dermis, the spirochetes become associated with and appear to 10 colonize the collagen fibers. Skin is the most consistent site of spirochete-positive culture. In persistent infection, the skin may provide a protective niche for replication, thereby acting as a reservoir of spirochetes for subsequent distribution to other tissues.

As B. burgdorferi disseminates to other organs, the organisms appear to localize to the 1.5 extracellular spaces of these tissues as well. In several organs, including tendon (Barthold et al, 1993; 1991), ligament (Haupl et al, 1993), heart (Zimmer et al, 1990), and muscle (Barthold et al, 1992; Duray, 1992), B. burgdorferi spirochetes are found primarily in close association with collagen fibers, suggesting that this association is an important mechanism of tissue adherence in different stages of infection. Although the association of B. burgdorferi with 0 collagen fibers has been reported by several investigators, the underlying molecular mechanism remains unknown. Lyme disease is typically treated with antibiotics, which are generally effective in the early stages of the disease. Later stages involving cardiac, arthritic, and nervous system disorders are often non-responsive.

5 Several proteins present on the outer surface of B. burgdorferi have been identified, including OspA (31 kDa; Barbour et al, 1983), OspB (34 kDa), OspC (22 kDa), OspD, OspE, and OspF. Laboratory studies have shown that passively-administered antibodies (Schaible et al. , 1990) reactive with the B. burgdorferi outer surface protein A (OspA), or immunization with recombinant OspA (Fikrig et al. , 1990), protect mice from challenge with in vitro-grown or 0 tick-borne B. burgdorferi. Recombinant subunit vaccines composed of B. burgdorferi OspA have also shown protective efficacy against tick challenge in mouse, hamster, dog, and monkey models of Lyme borreliosis (Fikrig et al, 1992; Johnson et al, 1995; Chang et al, 1995; Philipp et al, 1997; Edelman, 1997). Based largely on the protective efficacy of experimental OspA vaccines in rodent models of Lyme borreliosis, three monovalent OspA-based vaccines progressed to clinical trials.

Clinical trials in the United States evaluating the performance of monovalent OspA vaccines through two Lyme disease transmission seasons have shown that OspA vaccines are efficacious in humans as well (Sigal et al, 1998; Steere et al. 1 98). Following approval by the Food and Drug Administration (FDA), OspA now provides an option for immunoprophylaxis against Lyme disease in the United States. However, broad, sustained protection of humans may be difficult to achieve with vaccines based solely on OspA.

While several approaches to the treatment of Borrelial diseases, such as Lyme disease, have experienced some success, many problems remain, including antibiotic resistance, variability of antigens between species and species variation through mutation of antigens, as well as the need to protect susceptible groups such as young children, the elderly and other immunocompromised patients. Thus, there exists an immediate need in the art for an effective treatment for B. burgdorferi, and vaccines against the causative agent of Lyme disease. The development of agents that achieve sustained protection and provide significant cross-protection against serologically diverse species would be particularly advantageous.

SUMMARY OF THE INVENTION

The present invention overcomes one or more of these and other shortcomings in the art by providing improved immunogenic compositions and methods comprising combinations of Borrelia components, particularly, combinations of Borrelia decorin binding protein (Dbp) components and outer surface protein (Osp) components. The immunogenic combinations, compositions, kits and methods of the invention have improved efficacy, particularly relative to OspA alone. Certain advantages of the invention include the ability to protect against challenge by OspA minus strains, to protect against challenge with higher numbers of OspA positive organisms and to protect against emergence of particular antigen minus strains. The combinations, compositions, kits and methods of the invention can also be used at lower doses than available vaccines, particularly those vaccines consisting of OspA alone, and can provide protection against Borrelial infections even when the immunizing compositions are derived from a species of Borrelia that is heterologous to the species of infection.

The present invention therefore provides combinations of compositions, pharmaceutical compositions, vaccines and kits comprising a biologically effective amount of at least a first and second Borrelia protein, or at least a first and second polypeptide or peptide from the Borrelia protein; or at least a first and second nucleic acid that encodes such a Borrelia protein, polypeptide or peptide; or at least a first and second antibody, or antigen binding fragment thereof, that binds to such a Borrelia protein, polypeptide or peptide.

In preferred embodiments, the first and second Borrelia proteins, polypeptides, peptides, nucleic acids or antibodies will be Borrelia decorin binding protein (Dbp) proteins, polypeptides, peptides, nucleic acids or antibodies and Borrelia outer surface protein (Osp) proteins, polypeptides, peptides, nucleic acids or antibodies. Accordingly, the invention provides combinations of compositions, pharmaceutical compositions, vaccines and kits comprising a biologically effective amount of at least a first and second Borrelia component or immunogenic Borrelia component wherein:

(a) the at least a first Borrelia component is at least a first Borrelia decorin binding protein or at least a first polypeptide or peptide from such a Borrelia decorin binding protein; or at least a first nucleic acid that encodes such a Borrelia decorin binding protein, polypeptide or peptide; or at least a first antibody, or antigen binding fragment thereof, that binds to such a Borrelia decorin binding protein, polypeptide or peptide; and (b) the at least a second Borrelia component at least one Borrelia outer surface protein or at least a first polypeptide or peptide from such a Borrelia outer surface protein; or at least one nucleic acid that encodes such a Borrelia outer surface protein, polypeptide or peptide; or at least one antibody, or antigen binding fragment thereof, that binds to such a Borrelia outer surface protein, polypeptide or peptide.

It will be understood that the term "proteins, polypeptides, peptides, nucleic acids or antibodies", as stated herein, is used in a scientifically acceptable shorthand notation to refer to the respective Borrelia decorin binding protein or outer surface protein biological components described above. Thus, the term "a decorin binding protein or peptide" means a decorin binding protein or a peptide from such a decorin binding protein. It will be understood that the use of the alternative recitation "or" does not remove the peptide component from the definition of being derived or obtained from a decorin binding protein. Thus, terms such as "decorin binding protein or peptide" and "outer surface protein or peptide" do not mean a decorin binding protein or outer surface protein or a peptide of any origin or random sequence, but mean a decorin binding protein or an outer surface protein or a peptide derived from a decorin binding protein or outer surface protein.

The terms "Borrelia decorin binding protein" and "Borrelia outer surface protein" may thus be used to qualify the functional origin of any one of a protein, polypeptide, peptide, nucleic acid or antibody. As "decorin binding protein" and "outer surface protein" refer to all such biological components , the terms "Dbp" and "Osp" are preferred for simplicity. Using Dbp and Osp thus avoids any potential confusion in referring to proteins, rather than polypeptides, peptides, nucleic acids or antibodies, i.e . the terms "Dbp protein" and "Osp protein" are more easily used than "decorin binding protein protein" and "outer surface protein protein". The terms "Dbp" and "Osp" are also preferred for simplicity in referring to polypeptides, peptides, nucleic acids and antibodies. For example, the terms "Dbp nucleic acid" and "Osp nucleic acid" are more easily used than "decorin binding protein nucleic acid" and "outer surface protein nucleic acid" and should avoid any potential confusion between proteins and nucleic acids. Further, although it is known that decorin binding proteins are surface accessible proteins, there are structural and functional distinctions between decorin binding proteins and outer surface proteins that do not bind decorin. The "Osp" and "outer surface" proteins for use in the compositions and methods of the invention may thus be defined as "an outer surface protein other than a decorin binding protein"; "an outer surface protein that does not share significant sequence homology with a known decorin binding protein"; "an outer surface protein wherein the nucleic acid encoding the protein does not hybridize, under relatively stringent hybridization conditions, to a nucleic acid encoding a known decorin binding protein"; and/or as "an outer surface protein that does not bind decorin in a decorin binding assay".

Techniques for determining protein and nucleic acid sequence homology with, and nucleic acid hybridization to, known decorin binding proteins, such as DbpA and DbpB (U.S. Patent No. 5,853,987; WO 96/34106; WO 97/27301 ; each specifically incorporated herein by reference), and techniques for conducting decorin binding assays, are well known in the art (U.S. Patent No. 5,853,987; WO 96/34106; WO 97/27301 ; each specifically incorporated herein by reference). Therefore, those of ordinary skill in the art will readily be able to determine whether a given Borrelia so-called outer surface protein shares significant sequence homology with Dbp proteins, whether their respective nucleic acids hybridize under relatively stringent hybridization conditions and/or whether the protein binds decorin in a functional assay. It will thus be routine to determine whether a given Borrelia "so-called outer surface protein" is a protein that does or does not exhibit sufficient structural and functional properties to make it a decorin binding protein.

Outer surface-accessible proteins that are encoded by nucleic acids that hybridize, under relatively stringent hybridization conditions, to nucleic acids encoding known decorin binding proteins, such as DbpA and DbpB; that share significant sequence homology to known decorin binding proteins, such as DbpA and DbpB; and that bind decorin in a functional assay (U.S. Patent No. 5,853,987; WO 96/34106; WO 97/27301 ; each specifically incorporated herein by reference) will thus be "decorin binding proteins" in the context of the present application. Outer surface-accessible proteins that are not encoded by nucleic acids that hybridize, under relatively stringent hybridization conditions, to nucleic acids encoding known decorin binding proteins, such as DbpA and DbpB; that do not share significant sequence homology to known decorin binding proteins, such as DbpA and DbpB, and that do not bind decorin in a functional assay (U.S. Patent No. 5,853,987; WO 96/34106; WO 97/27301 ; each specifically incorporated herein by reference) will thus be "outer surface proteins other than decorin binding proteins" and will be termed "Osp" proteins in the context of the present application.

Proteins, polypeptides and peptides that share or exhibit "significant sequence identity or homology", as used herein, are proteins, polypeptides and peptides that have between about 70% and about 80%; or more preferably, between about 81% and about 90%; or even more preferably, between about 91% and about 99%; of amino acids that are identical to (sequence identity), or conserved or functionally equivalent to (sequence homology), the amino acids of known decorin binding proteins, such as DbpA and DbpB (U.S. Patent No. 5,853,987; WO 96/34106: WO 97/27301; each specifically incorporated herein by reference), provided the biological activity of the protein, polypeptide and/or peptide, in binding decorin, is maintained.

Nucleic acids, coding regions and genes that share or exhibit "significant sequence identity", as used herein, are nucleic acids, coding regions and genes that have between about 70% and about 80%; or more preferably, between about 81% and about 90%; or even more preferably, between about 91% and about 99%; of nucleotides that are identical to the nucleotides of known decorin binding proteins, such as DbpA and DbpB (U.S. Patent No. 5,853,987; WO 96/34106; WO 97/27301 ; each specifically incorporated herein by reference), provided the biological activity of the encoded protein, polypeptide and/or peptide, in binding decorin, is maintained.

Most succinctly, the present invention provides combinations of compositions, pharmaceutical compositions, vaccines and kits comprising at least a first Borrelia Dbp protein, polypeptide, peptide, nucleic acid or anti-Dbp antibody and at least a first Borrelia Osp protein, polypeptide, peptide, nucleic acid or anti-Osp antibody. These compositions may be defined as comprising "a Dbp component" and "an Osp component", respectively.

The currently preferred Dbp-Osp combinations of the invention are formulated within a single composition, for ease of administration. Nonetheless, the Dbp- and Osp-containing combinations of the invention may be formulated as two separate compositions, e.g., in the form of a kit or "kit of parts" for subsequent combination, or simultaneous or close sequential administration.

The kits of the invention thus comprise at least a first Borrelia Dbp protein, polypeptide, peptide, nucleic acid or anti-Dbp antibody and at least a first Borrelia Osp protein, polypeptide, peptide, nucleic acid or anti-Osp antibody in at least a first suitable container. Therefore, Dbp and Osp components in two separate compositions, formulations and containers are encompassed within the scope of the invention. The kits will preferably comprise pharmaceutically acceptable excipients and may also comprise instructions for use.

The compositions, pharmaceutical compositions, vaccines and kits of the invention may thus comprise a biologically effective combined amount of at least a first and second Borrelia component, or at least a first and second immunogenic Borrelia component, wherein the at least a first Borrelia component or immunogenic component is at least a first Dbp protein, polypeptide, peptide, nucleic acid or anti-Dbp antibody, and the at least a second Borrelia component or immunogenic Borrelia component is at least a first Borrelia Osp protein, polypeptide, peptide. nucleic acid or anti-Osp antibody.

The compositions, pharmaceutical compositions, vaccines and kits preferably comprise biologically effective amounts, combined biologically effective amounts, biologically effective combined amounts, immunologically effective combined amounts, prophylactically effective combined amounts, therapeutically effective combined amounts, and such like, of the Dbp and Osp immunogenic Borrelia components. Exemplary combined effective amounts are amounts effective to generate an anti- Borrelia immune response upon administration to an animal or human subject. The animal may have or be at risk of developing a Borrelia infection or Lyme disease. The animal may also be employed for the generation of Borrelia-reactive immunological components.

In terms of the preventative and/or treatment aspects of the invention, the compositions, pharmaceutical compositions, vaccines and kits will generally comprise "immunologically effective combined amounts", which are amounts effective to generate a meaningful anti- Borrelia immune response upon administration to an animal having or at risk of developing a Borrelia infection or Lyme disease. The "meaningful anti-Borrelia immune responses" are those that provide a discernable benefit to the animal, preferably, a notable benefit, and most preferably, a statistically significant benefit in a controlled study. "Therapeutically effective combined amounts" are preferably combined amounts effective to treat or prevent Lyme disease upon administration to an animal having or at risk of developing Lyme disease.

"Prophylactically effective combined amounts" are amounts of the combined Dbp and Osp Borrelia components effective to "protect against" or "immunize" an animal, thereby reducing the risk of, and preferably, significantly reducing the risk of, Borrelia infections or Lyme disease. In certain preferred embodiments, prophylactically effective combined amounts protect against challenge by various strains of Borrelia, including OspA minus strains; and/or protect against challenge with higher numbers of potentially infective Borrelia organisms; and/or protect against emergence of particular antigen minus strains.

According to the effectiveness of the present invention, combinations, compositions, pharmaceutical compositions, vaccines and kits of the invention are provided that comprise low doses of Dbp and Osp components in a combined amount effective to generate a significant anti- Borrelia immune response upon administration to an animal having or at risk of developing a Borrelia infection or Lyme disease. The Dbp and Osp components are preferably provided at lower doses than current vaccines and achieve the same, or preferably improved effects; and more preferably, significantly improved or even synergistic effects. The combinations, compositions, pharmaceutical compositions, vaccines and kits of the invention may also be defined as comprising a biologically effective minimum amount of at least a first Borrelia decorin binding protein, polypeptide, peptide, nucleic acid or antibody and at least a first Borrelia outer surface protein, polypeptide, peptide, nucleic acid or antibody.

Although the vaccines of the invention may be used to provide active or passive immunity, vaccines for generating active immunity will often be preferred. Accordingly, the preferred vaccines are those comprising at least a first Borrelia Dbp protein, polypeptide, peptide or nucleic acid and at least a first Borrelia Osp protein, polypeptide, peptide or nucleic acid.

In terms of passive immunization, the compositions of the invention may comprise at least a first antibody, or antigen binding fragment thereof, that specifically binds to a Borrelia decorin binding protein, polypeptide or peptide and a second antibody, or antigen binding fragment thereof, that specifically binds to a Borrelia outer surface protein, polypeptide or peptide. These are the meanings of "anti-Dbp antibodies" and "anti-Osp antibodies", as used herein. For simplicity, the term "antibody", as used throughout, encompasses antibodies and antigen binding fragments thereof.

The combinations, compositions, pharmaceutical compositions, vaccines and kits of the invention may be those wherein at least one of the first and second immunogenic Borrelia components, i.e., at least one of the Dbp or Osp proteins, polypeptides, peptides, nucleic acids or antibodies, are derived from a Borrelia species that is heterologous to the Borrelia infection of the animal or human. Each of the first and second immunogenic Borrelia components may be derived from a Borrelia species that is heterologous to the species of said Borrelia infection. Mixed combinations of heterologous and homologous first and second immunogenic Borrelia components are also provided.

The combinations, compositions, pharmaceutical compositions, vaccines and kits may comprise biologically effective amounts of Borrelia decorin binding protein and outer surface protein biological components where the type of biological component is matched. Thus, matched pairs of at least two proteins, at least two peptides, at least two nucleic acids, and at least two antibodies are provided by the invention.

However, there is no requirement for the components to be matched on the basis of proteins, peptides or antibodies. Indeed, multi-component vaccines or "vaccine systems" are provided by the invention, including those that comprise an "initiating or priming" combination or composition and a "boosting" combination or composition. The priming combination or composition typically comprises at least one Dbp nucleic acid and at least one Osp nucleic acid. The boosting combination or composition then typically comprises at least one Dbp protein, polypeptide or a peptide and at least one Osp protein, polypeptide or a peptide.

Whether based upon proteins, polypeptides, peptides, nucleic acids or antibodies, the decorin binding protein components for the combined formulations of the invention are preferably DbpA or DbpB components. More preferably, the Dbp components are DbpA components and, most preferably, the Dbp components are DbpA proteins.

Whether based upon proteins, polypeptides, peptides, nucleic acids or antibodies, the outer surface protein components of the invention are preferably OspA, OspB, OspC, OspD, OspE or OspF components. More preferably, the Osp components are OspA and/or OspC components (in combination with a Dbp component); more preferably, they are OspA components; and most preferably, the Osp components are OspA proteins.

In certain preferred embodiments, the combined elements, whether proteins, polypeptides, peptides, nucleic acids or antibodies, are DbpA components and OspA components. The invention thus provides combinations, compositions, pharmaceutical compositions, vaccines and kits that comprise combinations of DbpA and OspA proteins, DbpA and OspA polypeptides, DbpA and OspA peptides, DbpA and OspA nucleic acids and DbpA and OspA antibodies. The invention also provides combinations, compositions, pharmaceutical compositions, vaccines and kits that comprise combinations of DbpA proteins, polypeptides or peptides with OspA nucleic acids or antibodies, DbpA nucleic acids or antibodies with OspA proteins, polypeptides or peptides, and such like.

In certain preferred embodiments, the combinations, compositions, pharmaceutical compositions, vaccines and kits will comprise at least a first Borrelia DbpA protein, polypeptide or peptide and at least a first Borrelia OspA protein, polypeptide or peptide. Although not currently preferred, fusion proteins, chemically linked proteins and synthetic peptides in which a DbpA protein, polypeptide, peptide or epitope is operatively attached, linked, joined or cross- linked to an OspA protein, polypeptide, peptide or epitope are included within the compositions and methods of the present invention.

In other preferred embodiments, the combinations, compositions, pharmaceutical compositions, vaccines and kits of the invention will comprise at least one DbpA nucleic acid or coding segment and at least one OspA nucleic acid or coding segment. Compositions of nucleic acids or coding segments that encode a Borrelia DbpA protein and a Borrelia OspA protein are currently preferred.

In certain aspects, the first nucleic acid or coding segment and the second nucleic acid or coding segment are comprised on a single polynucleotide, for example a plasmid, cosmid, viral genome and the like. Expression may be co-ordinated from one or two promoters even on a single polynucleotide. In other embodiments the first nucleic acid coding segment and the second nucleic acid coding segment are comprised on distinct polynucleotides, such as distinct plasmids, cosmids, viral genomes and the like.

Any of the compositions of the present invention may comprise a pharmaceutically acceptable excipient, diluent, carrier or vehicle. Exemplary pharmaceuticals include adjuvants, such as aluminum adjuvants and aluminum hydroxide adjuvants. Compositions wherein the pharmaceutically acceptable excipient is Alhydrogel® are certain preferred examples. Pharmaceutical compositions and vaccines may be formulated for administration via any convenient or advantageous route, such as by intradermal injection, subcutaneous injection and intranasal administration.

The inventive combinations, compositions, pharmaceutical compositions, vaccines and kits may also further Borrelia proteins, polypeptides, peptides, nucleic acids or antibodies. Such third Borrelia proteins, polypeptides, peptides, nucleic acids or antibodies may be distinct decorin binding protein components; distinct outer surface protein components; or flagellin, SI . T5, EppA, p39-alpha, p39-beta, pl3, pl7, p28, p35, p37, Vmp7 and or pi 10 proteins, polypeptides, peptides, nucleic acids or antibodies.

The present invention also provides various methods and uses for the combinations, compositions, pharmaceutical compositions, vaccines and kits of the invention, as described above. These include methods and uses of the invention for generating an anti-Borrelia immune response, which preferably comprise administering to an animal or human a combined biologically effective amount of at least a first Dbp protein, polypeptide, peptide, nucleic acid or anti-Dbp antibody, and at least a first Borrelia Osp protein, polypeptide, peptide, nucleic acid or anti-Osp antibody. The methods and uses preferably generate a significant anti-Borrelia immune response.

In generating an anti-Borrelia immune response, the Dbp and Osp components may be administered in different combinations and at different times. Any administration regimen is suitable so long as their administration is effective to achieve a combined effect in the animal or human to which they are administered. The animal or human may have, be suspected of having or at risk for developing a Borrelia infection or Lyme disease.

Exemplary methods and uses of the invention provide for generating an anti-Borrelia immune response by preferably first administering to an animal or human a combined biologically effective amount of at least a first nucleic acid encoding a Dbp protein, polypeptide or peptide and at least a second nucleic acid encoding an Osp protein, polypeptide or peptide; followed by later boosting the animal or human with a combined biologically effective amount of at least a first Dbp protein, polypeptide or peptide and at least one Osp protein, polypeptide or peptide.

Methods and uses for generating a protective anti-Borrelia immune response are included herewith, which preferably comprise administering to an animal or human a combined biologically effective amount of at least a first Dbp protein, polypeptide, peptide, nucleic acid or anti-Dbp antibody, and at least a first Borrelia Osp protein, polypeptide, peptide, nucleic acid or anti-Osp antibody.

Yet further methods and uses are those of treating or preventing a Borrelia infection, which preferably comprise administering to an animal or human subject in need thereof a combined biologically effective amount of at least a first Dbp protein, polypeptide, peptide, nucleic acid or anti-Dbp antibody, and at least a first Borrelia Osp protein, polypeptide, peptide, nucleic acid or anti-Osp antibody.

Accordingly, methods and uses of vaccinating against Borrelia infections are also provided, which preferably comprise administering to an animal or human subject in need thereof a combined biologically effective amount of at least a first Dbp protein, polypeptide, peptide, nucleic acid or anti-Dbp antibody, and at least a first Borrelia Osp protein, polypeptide, peptide, nucleic acid or anti-Osp antibody.

Methods and uses of treating or preventing Lyme disease are further aspects of the present invention, and preferably comprise administering to an animal or human a combined therapeutically effective amount of at least a first Dbp protein, polypeptide, peptide, nucleic acid or anti-Dbp antibody, and at least a first Borrelia Osp protein, polypeptide, peptide, nucleic acid or anti-Osp antibody.

The present invention further provides the use of a combination, composition, pharmaceutical composition, vaccine and/or kit in accordance with any one of those described herein in the manufacture of a medicament for use in generating an anti-Borrelia immune response upon administration to an animal. Such a use may be a use in the manufacture of a medicament for use in preventing or treating Lyme disease and/or a use in the manufacture of a medicament intended for administration to a human subject or patient.

Currently, preferred methods and uses of the present invention comprise administering to an animal or human a combined therapeutically effective amount of at least a first Borrelia DbpA component and at least a first Borrelia OspA component; with at least a first Borrelia DbpA protein and at least a first Borrelia OspA protein being preferred.

A range of doses are useful and, as is known in the art, the doses will generally depend on the animal to be treated, particularly on the size of the animal. Overall, doses for administration are between about 1 ng and about 100 μg each, more preferably, between about 100 ng and about 50 μg each, and most preferably, about 30 μg each of a DbpA and OspA protein. Amounts of DbpA and OspA within these ranges, such as about 2 ng, 3 ng, 4 ng, 5 ng, 6 ng, 7 ng, 8 ng, 9 ng, about 15 ng, about 20 ng, about 30 ng, about 50 ng, about 75 ng, about 100 ng, about 200 ng, about 400 ng, about 400 ng, about 500 ng, about 600 ng, about 700 ng, about 800 ng, about 900 ng, about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 10 μg, about 15 μg, about 20 μg, about 25 μg, about 30 μg, about 35 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg and about 90 μg or so are contemplated for use.

Biologically potent immune responses have been achieved in small animals with DbpA and OspA doses in the sub-microgram range. However, for use in a large animal or humans, doses of each component in the microgram range are preferred, with doses in the tens of microgram range being particularly preferred. For example, ImuLyme™ OspA subunit (FDA dosing information specifically incorporated herein by reference) was efficacious at a 30 microgram dose level in humans.

Preferred doses of each component for use in humans are therefore in the range of about 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 11 μg, 12 μg, 13 μg, 14 μg, 15 μg, 16 μg, 17 μg, 18 μg, 19 μg, 20 μg, 21 μg, 22 μg, 23 μg, 24 μg, 25 μg, 26 μg, 27 μg, 28 μg, 29 μg, 30 μg, 31 μg, 32 μg, 33 μg, 34 μg, 35 μg, 36 μg, 37 μg, 38 μg, 39 μg, 40 μg, 41 μg, 42 μg, 43 μg, 44 μg, 45 μg, 46 μg, 47 μg, 48 μg, 49 μg, 50 μg, 51 μg, 52 μg, 33 μg, 54 μg, 55 μg, 56 μg, 57 μg, 58 μg, 59 μg, 60 μg, 61 μg, 62 μg, 63 μg, 64 μg, 65 μg, 66 μg, 67 μg, 68 μg, 69 μg, 70 μg, 71 μg, 72 μg, 73 μg, 74 μg, 75 μg, 76 μg, 77 μg, 78 μg, 79 μg, 80 μg, 81 μg, 82 μg, 83 μg, 84 μg, 85 μg, 86 μg, 87 μg, 88 μg, 89 μg, 90 μg, 91 μg, 92 μg, 93 μg, 94 μg, 95 μg, 96 μg, 97 μg, 98 μg, 99 μg, or about 100 μg or so.

Likewise, in certain embodiments, the amount of DbpA and OspA will not be the same. In some aspects of the invention the amount of DbpA will be about 1.5 times, about 2 times, about 3 times, about 4 times, about 5 times, about 6 times, about 7 times, about 8 times, about 9 times or about 10 times or more of the amount of OspA, while in other aspects the amount of OspA will be about 1.5 times, about 2 times, about 3 times, about 4 times, about 5 times, about 6 times, about 7 times, about 8 times, about 9 times or about 10 times or more the amount of DbpA.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

Despite approval of an OspA vaccine by the FDA, the present inventors realized that broad, sustained protection of humans may be difficult to achieve with vaccines based solely on OspA. Drawing together various lines of evidence, the inventors analyzed the drawbacks of the single OspA vaccines and arrived at the following reasoning. It is recognized that B. burgdorferi undergoes a dramatic modulation of protein expression during tick engorgement and transmission from the vector (de Silva et al, 1996). B. burgdorferi in feeding ticks is highly vulnerable to OspA antibodies imbibed from immunized hosts (de Silva et al. , 1996), but after adaptation to the mammalian host environment following natural or experimental inoculation, most spirochetes down-regulate OspA expression and become resistant to OspA antibodies (de Silva et al, 1996; Barthold et al, 1995a; Hanson et al, 1998; Cassatt et al, 1998). Protection from tick-borne transmission of B. burgdorferi appears to depend on OspA vaccination achieving a critical threshold level of circulating antibodies prior to the tick bite (de Silva et al. , 1999). Additionally, the inventors realized that modulation of OspA expression by B. burgdorferi may limit the site of action of OspA-specific antibodies to spirochetes residing in the tick midgut - - as these antibodies are ineffective shortly after infection. Moreover, human immune responses to OspA subunit vaccines have not matched those of rodents in level or duration. Furthermore, OspA is serologically diverse, particularly among European and Asian B. garinii and B. afzelii isolates. Reactivity with panels of OspA monoclonal antibodies (mAbs), and DNA sequence analysis has shown that as many as seven different OspA subgroups can be distinguished (Wilske et al, 1991; 1993a, b).

The inventors realized that such variations would limit the cross-protection that could be achieved with OspA vaccines. Cross-protection was seen by one group using an immunocompetent mouse model (Fikrig et al, 1995), but cross-protection was weak or absent in SCID mouse or hamster models used by other (Schaible et al, 1993; Lovrich et al, 1995). A further concern is that as many as 10% of B. burgdorferi isolates fail to express OspA in culture (Wilske et al, 1991; 1993a, b). In addition to Schaible et al. (1993) and Lovrich et al. (1995), other studies have also shown that immunization (active or passive) with OspA from a particular Borrelia strain provides limited or no protection against heterologous Borrelia species (Probert et al, 1997; Fikrig et al, 1995c).

Modulation of Borrelia antigen expression within feeding ticks has been reported for OspC; initially low in resting ticks, OspC levels increase on B. burgdorferi after initiation of tick feeding (Schwan et al, 1995). OspC might appear to be a promising in vivo target, but the inventors reason that its high level of antigenic variation complicates its development as a single component vaccine (Probert and LeFebvre, 1995).

In vitro cultivation of B. burgdorferi suggests that the genes for OspA and OspC are inversely regulated. Preliminary findings of some researchers do suggest that OspA levels similarly decrease after initiation of tick feeding. These studies suggest that OspA antibodies need to pre-exist at high levels in human or animal hosts prior to the tick bite to be effective 18

against OspA-expressing borrelias in the tick, and may receive little or no boosting upon delivery of the spirochetes into the skin within the milieu of immunosuppressive components of the tick saliva (Urioste et al, 1994). OspC has been evaluated as a combination vaccine with OspA (Bockenstedt et al, 1997). The addition of OspC did not improve upon the vaccine efficacy of OspA alone, however OspC immunization was ineffective against challenge with the particular B. burgdorferi strain used (N40).

The inventors thus summarized the problems with the use of OspA alone as an antigen for stimulating an immune response in an affected patient as the fact that OspA protein expressed during infection is either poorly immunogenic in humans, or more likely not expressed by B. burgdorferi in vivo until late in infection. Lyme disease patients, mice, hamsters, and dogs infected by tick bite or low-doses of cultured B. burgdorferi fail to mount substantial anti-OspA immune responses for many months following infection, although they do mount early responses to other B. burgdorferi antigens (flagellin, OspC, etc.) (Steere, 1989; Barthold and Bockenstedt, 1993). OspA is expressed by B. burgdorferi within ticks (Barbour et al, 1983), but detection of OspA on borreliae in tissue early after infection is difficult. Passive immunization of mice with OspA antibody (Schaible et al, 1990), or immunization with recombinant OspA, after challenge does not eliminate infection and only partially alters disease.

OspA-immunized mice are not protected from a challenge with host-adapted spirochetes delivered in the form of skin biopsy transplants or blood from infected mice (Barthold et al , 1995b; Cassatt et al., 1998). The bacteria appear to express OspA in vivo only at later stages when the infection becomes disseminated. This would be explained by down-regulation of OspA expression by Borrelia shortly after initiation of feeding by the tick. It has been demonstrated that when OspA-specific antibodies were administered to mice before or at the time of attachment of infected-infected ticks these mice were protected from spirochetal infection (de Silva et al, 1996). However, when OspA-specific antibody was administered 48 hr after tick attachment no protection was observed (de Silva et al, 1996). Only a limited number of bacterial vaccines have provided high levels of efficacy with a single, antigenically invariant subunit; for example, those against tetanus, diphtheria, and invasive Haemophilus influenzae disease. In contrast, single component pertussis toxin toxoid vaccines were found to be less effective at preventing laboratory-confirmed pertussis than multi- component acellular pertussis vaccines that contained one or more surface antigens in addition to pertussis toxin toxoid (Cherry, 1997).

The complex biology of arthropod-borne pathogens such as B. burgdorferi presents additional challenges to vaccine design. Preclinical studies in mice suggest that OspA vaccines protect against tick-borne B. burgdorferi infection by a novel, vector-stage transmission- blocking mechanism (de Silva et al, 1996; de Silva et al, 1999). In two recent Phase III clinical trials, vaccinees receiving all three scheduled OspA vaccinations were well-protected through the subsequent Lyme disease transmission season (Sigal et al, 1998; Steere et al, 1998). However, it is not yet known how long circulating OspA antibodies will remain at protective levels, nor what booster regimen might be required for sustained efficacy.

Even after a realization that OspA alone may not be optimal for use as a human vaccine, the state of the art prior to the present invention suggested no remedies or improvements. The entire biological make-up of B . burgdorferi could potentially be used in an attempt to formulate improved vaccines. However, the clinical limits of administration, as well as other immunological factors, must be considered in vaccine formulation. Thus, there is a need to pick one component or group of components over another, but without any direction in the literature as to which components would be advantageous.

The present inventors contemplated preparing additional vaccine components based upon bacterial surface adhesins, which mediate bacterial adherence to host tissues by binding to extracellular matrix (ECM) components. Borrelial species, as with many pathogenic bacteria, specifically recognize and bind to various mammalian ECM components in an interaction that represents a host tissue colonization mechanism. Decorin is one such ECM component to which B. burgdorferi bind. The bacterial components that mediate such binding are termed decorin binding proteins (Dbp's) and have only been characterized convincingly in B. burgdorferi and related spirochetes.

Decorin, also known as PG-40, PG-II, PG-S2 and CSIDS-PGII, is a small proteoglycan with a single chondroitin or dermatan sulfate chain attached to the fourth amino acid of the secreted 36-38 kDa protein. Decorin, so named because it "decorates" collagen fibers in the intracellular matrix, is associated with collagen fibrils in virtually all connective tissues. B. burgdorferi was shown to adhere to Decorin in a specific manner by virtue of constituents in the B. burgdorferi membrane, which were characterized, then cloned and sequenced, and purified, and termed Dbp's (U.S. Patent No. 5,853,987). A number of Dbp genes and proteins are now known, and generally fall within the decorin binding protein A (DbpA) and decorin binding protein B (DbpB) categories.

The present inventors observed that B. burgdorferi remains vulnerable to DbpA antibodies during at least the early stages of disseminating infection in mice following cutaneous inoculation with cultured spirochetes (Hanson et al, 1998; Cassatt et al, 1998) and reasoned that this protein would provide a target for immune resolution of early infections. Therefore, despite the wide range of biological components available, the present inventors sought to combine Osp proteins, particularly as OspA, with decorin binding proteins, particularly DbpA, in the formulation of new vaccines and therapeutics. It was reasoned that the Osp-Dbp combination would produce a vaccine that provides protection against a wide range of, or even all of, the clinically relevant B. burgdorferi strains.

Surprisingly, the combination of DbpA with OspA was discovered to provide protection against challenge with B. burgdorferi in accepted in vivo models that exceeded reasonable scientific expectation. In particular, it is shown herein that co-formulation of DbpA with OspA provides mice with protection against challenge doses of B. burgdorferi that are at least 100-fold higher than the highest dose against which OspA alone was protective. Protection was also achieved with lower doses of the combined DbpA-OspA vaccines than with DbpA or OspA alone. Additionally, combined DbpA-OspA vaccines had better efficacy than single antigen vaccines against strains and species of B. burgdorferi sensu lato heterologous to the vaccine antigens.

I. Borrelial Compositions The compositions of the present invention include at least a first and at least a second isolated Borrelial protein component, element or immunogenic component or element. As used herein, an "isolated Borrelial protein component, element or immunogenic component or element" includes an immunogenic Borrelial protein, Borrelial polypeptide or Borrelial peptide, a nucleic acid encoding such a Borrelial protein, polypeptide or peptide, or an antibody, or antigen binding fragment thereof, that specifically binds to a Borrelial protein, polypeptide or peptide; wherein the protein, polypeptide peptide, nucleic acid or antibody component is isolated or purified away from their natural environment, that is, away from the starting Borrelia.

In preferred embodiments, the compositions of the invention comprise a Borrelia decorin binding protein component and a Borrelia outer surface protein component. Combinations of

Borrelial decorin binding proteins and outer surface proteins, particularly DbpA and OspA, are preferred in certain embodiments of the present invention. Combinations of the Borrelial outer surface proteins OspA and OspC alone are not encompassed within the present invention.

Additional Borrelia components find uses in combined aspects of the present invention.

Borrelia components contemplated for use in the compositions and methods of the invention include, but are not limited to, proteins, polypeptides, peptides, nucleic acids and antibody components such as EppA, SI, T5, p39-alpha, p39-beta, p28, pl3, p35, p37, Vmp7, pi 10 and flagellin proteins, polypeptides, peptides and nucleic acids and antibodies that bind thereto.

A. Borrelial Decorin Binding Protein (Dbp) Compositions Two proteins, each about 18 kDa, which bind to the proteoglycan decorin have been isolated in recombinant form derived from B. burgdorferi. These proteins have named decorin binding protein A (DbpA) and decorin binding protein B (DbpB). U.S. Patent No. 5,853,987 (incorporated herein by reference in its entirety, including all sequences) discloses DbpA protein, polypeptide, peptide, nucleic acid and antibody compositions contemplated for use in the present invention. Exemplary DbpA compositions from U.S. Patent No. 5,853,987 include the B. burgdorferi strain 297 DbpA nucleic acid sequence shown in SEQ ID NO:l and the DbpA amino acid sequence shown in SEQ ID NO:2 (the sequence identification numbers correspond to those used in U.S. Patent 5,853,987, specifically incorporated herein by reference).

Since the original isolation of these proteins from B. burgdorferi strain 297, DbpA and

DbpB genes and proteins have been isolated from other strains of B. burgdorferi, as well as from other strains of Borreliae such as B. afzelii and B. garinii. The published PCT patent application WO 96/34106 (incorporated herein by reference in its entirety) discloses additional DbpA protein, polypeptide, peptide, nucleic acid and antibody compositions.

Exemplary DbpA compositions disclosed in WO 96/34106 include the B. burgdorferi strain B31 DbpA nucleic acid sequence shown in SEQ ID NO: 12, the B. burgdorferi strain Sh.2.82 DbpA nucleic acid sequence shown in SEQ ID NO: 14. the B. burgdorferi strain HB-19 DbpA nucleic acid sequence shown in SEQ ID NO: 16, the B. afzelii strain PGau DbpA nucleic acid sequence shown in SEQ ID NO: 18, the B. garinii strain IP90 DbpA nucleic acid sequence shown in SEQ ID NO:20, the B. burgdorferi strain LP4 DbpA nucleic acid sequence shown in SEQ ID NO:22, the B. burgdorferi strain LP7 DbpA nucleic acid sequence shown in SEQ ID NO:24 and the B. burgdorferi strain JDl nucleic acid sequence shown in SEQ ID NO:26 (the sequence identification numbers correspond to those used in PCT patent application WO 96/34106).

Further DbpA compositions disclosed in WO 96/34106 include the B. burgdorferi strain B31 DbpA amino acid sequence shown in SEQ ID NO: 13. the B. burgdorferi strain Sh.2.82 DbpA amino acid sequence shown in SEQ ID NO: 15, the B. burgdorferi strain HB-19 DbpA amino acid sequence shown in SEQ ID NO: 17, the B. afzelii strain PGau DbpA amino acid sequence shown in SEQ ID NO: 19, the B. garinii strain IP90 DbpA amino acid sequence shown in SEQ ID NO:21, the B. burgdorferi strain LP4 DbpA amino acid sequence shown in SEQ ID NO:23, the B. burgdorferi strain LP7 DbpA amino acid sequence shown in SEQ ID NO:25 and the B. burgdorferi strain JDl DbpA amino acid sequence shown in SEQ ID NO:27 (the sequence identification numbers correspond to those used in PCT patent application WO96/34106).

The published PCT patent application WO 97/27301 (incorporated herein by reference in its entirety) discloses DbpB protein, polypeptide, peptide, nucleic acid and antibody compositions, as well as additional DbpA protein, polypeptide, peptide, nucleic acid and antibody compositions, each of which are also contemplated for use in the present invention. Exemplary DbpA and DbpB compositions disclosed in WO 97/27301 include the B. burgdorferi strain 297 and LP4 DbpA nucleic acid sequence shown in SEQ ID NO:29, the B. burgdorferi strain SH2 DbpA nucleic acid sequence shown in SEQ ID NO:31, the B. burgdorferi strain N40 DbpA nucleic acid sequence shown in SEQ ID NO:33, the B. burgdorferi strain JDl DbpA nucleic acid sequence shown in SEQ ID NO:35, the B. burgdorferi strain HB19 DbpA nucleic acid sequence shown in SEQ ID NO:37, the B. burgdorferi strain B31, BR4 and 3028 DbpA nucleic acid sequence shown in SEQ ID NO:39, the B. burgdorferi strain G3940 DbpA nucleic acid sequence shown in SEQ ID NO:41, the B. burgdorferi strain IP90 DbpA nucleic acid sequence shown in SEQ ID NO:43, the B. burgdorferi strain ZS7 DbpA nucleic acid sequence shown in SEQ ID NO:45, the B. afzelii strain PGau DbpA nucleic acid sequence shown in SEQ ID NO:47, the B. afzelii strain B023 DbpA nucleic acid sequence shown in SEQ ID NO:49 and the B. garinii strain IP90 DbpA nucleic acid sequence shown in SEQ ID NO:51 (the sequence identification numbers correspond to those used in PCT patent application WO 97/27301).

Additional Dbp compositions disclosed in published PCT patent application WO 97/27301 (incorporated herein by reference in its entirety) include the B. burgdorferi strain CA287 DbpB nucleic acid sequence shown in SEQ ID NO:53, the B. burgdorferi strain IPS DbpB nucleic acid sequence shown in SEQ ID NO:55, the B. burgdorferi strain JDl DbpB nucleic acid sequence shown in SEQ ID NO:57, the B. burgdorferi strain 297, SH2 and LP4 DbpB nucleic acid sequence shown in SEQ ID NO:59, the B. burgdorferi strain N40, LP7 and B afzelii strain PKo DbpB nucleic acid sequence shown in SEQ ID NO:61, the B. burgdorferi strain HB19, G3940, LP5, ZS7, NCH-1, FRED and B. garinii strain 20047 DbpB nucleic acid sequence shown in SEQ ID NO: 63 and the B. garinii strain IP90 DbpB nucleic acid sequence shown in SEQ ID NO:65 (the sequence identification numbers correspond to those used in PCT patent application WO 97/27301).

Further Dbp compositions disclosed in published PCT patent application WO 97/27301 (incoφorated herein by reference in its entirety) include the B. burgdorferi strain 297 and LP4 DbpA amino acid sequence shown in SEQ ID NO:30, the B. burgdorferi strain SH2 DbpA amino acid sequence shown in SEQ ID NO:32, the B. burgdorferi strain N40 DbpA amino acid sequence shown in SEQ ID NO:34, the B. burgdorferi strain JDl DbpA amino acid sequence shown in SEQ ID NO:36, the B. burgdorferi strain HB19 DbpA amino acid sequence shown in SEQ ID NO:38, the B. burgdorferi strain B31, BR4 and 3028 DbpA amino acid sequence shown in SEQ ID NO:40, the B. burgdorferi strain G3940 DbpA amino acid sequence shown in SEQ ID NO:42, the B. burgdorferi strain IP90 DbpA amino acid sequence shown in SEQ ID NO:44, the B. burgdorferi strain ZS7 DbpA amino acid sequence shown in SEQ ID NO:46, the B. afzelii strain PGau DbpA amino acid sequence shown in SEQ ID NO:48, the B. afzelii strain B023 DbpA amino acid sequence shown in SEQ ID NO:50 and the B. garinii strain IP90 DbpA amino acid sequence shown in SEQ ID NO:52 (the sequence identification numbers correspond to those used in PCT patent application WO 97/27301).

Yet further Dbp compositions disclosed in published PCT patent application WO 97/27301 (incoφorated herein by reference in its entirety) include the B. burgdorferi strain

CA287 DbpB amino acid sequence shown in SEQ ID NO:54, the B. burgdorferi strain IPS

DbpB amino acid sequence shown in SEQ ID NO:56, the B. burgdorferi strain JDl DbpB amino acid sequence shown in SEQ ID NO:58, the B. burgdorferi strain 297, SH2 and LP4 DbpB amino acid sequence shown in SEQ ID NO:60, the B. burgdorferi strain N40, LP7 and B afzelii strain PKo DbpB amino acid sequence shown in SEQ ID NO:62, the B. burgdorferi strain

HB19, G3940, LP5, ZS7, NCH-1, FRED and B. garinii strain 20047 DbpB amino acid sequence shown in SEQ ID NO: 64 and the B. garinii strain IP90 DbpB amino acid sequence shown in

SEQ ID NO:66 (the sequence identification numbers correspond to those used in PCT patent application WO 97/27301). Further DbpA and DbpB protein, nucleic acid and antibody compositions contemplated for use in the present invention are found in Roberts et al. (1998) and U.S. Provisional Patent Application Serial No. 60/103,728, filed October 9, 1998, each incoφorated herein by reference in their entirety. Exemplary are the B. burgdorferi strain 297 DbpA sequence (Genbank accession number U75866), the B. burgdorferi strain B31 DbpA sequence (Genbank accession number AF069269), the B. burgdorferi strain Sh-2-82 DbpA sequence (Genbank accession number AF069253), the B. burgdorferi strain N40 DbpA sequence (Genbank accession number

AF069252 the B. burgdorferi strain JDl DbpA sequence (Genbank accession number AF069257 the B. burgdorferi strain HB19 DbpA sequence (Genbank accession number AF069254 the B. burgdorferi strain 3028 DbpA sequence (Genbank accession number AF069286 the B. burgdorferi strain G39/40 DbpA sequence (Genbank accession number AF069256 the B. burgdorferi strain LP4 DbpA sequence (Genbank accession number AF069271 the B. burgdorferi strain LP7 DbpA sequence (Genbank accession number AF069255 the B. burgdorferi strain NCH-1 DbpA sequence (Genbank accession number AF069285 the B. burgdorferi strain ZS7 DbpA sequence (Genbank accession number AF069251 the B. burgdorferi strain CA-3-87 DbpA sequence (Genbank accession number AF069276 the B. burgdorferi strain HBNC DbpA sequence (Genbank accession number AF069275 and the B. burgdorferi strain MCI DbpA sequence (Genbank accession number AF079361 (the sequences of all Genbank accession numbers are specifically incoφorated herein by reference).

Additional Dbp compositions for use in the present invention are the B. afzelii strain PGau DbpA sequence (Genbank accession number AF069270), the B. afzelii strain ACA1 DbpA sequence (Genbank accession number AF069278), the B. afzelii strain M7 DbpA sequence (Genbank accession number AF069280), the B. afzelii strain IPF DbpA sequence (Genbank accession number AF069274), the B. afzelii strain BO23 DbpA sequence (Genbank accession number AF069267), the B. afzelii strain VS461 DbpA sequence (Genbank accession number AF069282) and the B. afzelii strain U01 DbpA sequence (Genbank accession number AF069284) (the sequences of all Genbank accession numbers are specifically incoφorated herein by reference). Further Dbp compositions for use in the present invention include the B. garinii strain PBr DbpA sequence (Genbank accession number AF069281), the B. garinii strain IP90 DbpA sequence (Genbank accession number AF069258), the B. garinii strain 20047 DbpA sequence (Genbank accession number AF069277), the B. garinii strain G25 DbpA sequence (Genbank accession number AF069279), the B. garinii strain VSBP DbpA sequence (Genbank accession number AF069272), the B. garinii strain JEM4 DbpA sequence (Genbank accession number AF069262), the B. garinii strain 153 DbpA sequence (Genbank accession number AF069283) and the Group 25015 DbpA sequence (Genbank accession number AF069273) (the sequences of all Genbank accession numbers are specifically incoφorated herein by reference).

Still further Dbp compositions for use in the present invention include the B . burgdorferi strain 297 DbpB sequence (Genbank accession number U75867), the B. burgdorferi strain B31 DbpB sequence (Genbank accession number AF069266), the B. burgdorferi strain Sh-2-82 DbpB sequence (Genbank accession number AF069253), the B. burgdorferi strain N40 DbpB sequence (Genbank accession number AF069252), the B. burgdorferi strain JDl DbpB sequence (Genbank accession number AF069257), the B. burgdorferi strain HB19 DbpB sequence (Genbank accession number AF069254), the B. burgdorferi strain G39/40 DbpB sequence (Genbank accession number AF069256), the B. burgdorferi strain LP4 DbpB sequence (Genbank accession number AF069264), the B. burgdorferi strain LP5 DbpB sequence (Genbank accession number AF069261), the B. burgdorferi strain LP7 DbpB sequence (Genbank accession number AF069255), the B. burgdorferi strain NCH-1 DbpB sequence (Genbank accession number AF069259), the B. burgdorferi strain ZS7 DbpB sequence (Genbank accession number AF069251), the B. burgdorferi strain CA-2-87 DbpB sequence (Genbank accession number AF069262), the B. burgdorferi strain FRED DbpB sequence (Genbank accession number AF069260), the B. burgdorferi strain IPS DbpB sequence (Genbank accession number AF079365) and the B. garinii strain 20047 DbpB sequence (Genbank accession number AF069263) (Genbank accession number AF069273) (the sequences of all Genbank accession numbers are specifically incoφorated herein by reference). A number of other Borrelial protein, polypeptide, peptide, nucleic acid (and antibody) compositions have been described in the literature that, although not specifically designated as a "decorin binding" protein, polypeptide, peptide or nucleic acid, nonetheless have a high degree of homology to the DbpA and DbpB proteins, polypeptides, peptides and nucleic acid compositions as set forth in U.S. Patent 5,853,987, PCT patent application WO96/34106, PCT patent application WO97/27301 and U.S. Provisional Patent Application Serial No. 60/103,728. For the puφoses of the present invention, such Borrelial protein compositions are considered "decorin binding protein compositions".

As used herein, the term "decorin binding protein (Dbp) nucleic acid or gene" is used to refer to a bacterial gene or DNA coding region, preferably a borrelial gene or DNA coding region, which encodes a protein, polypeptide or peptide that is capable of binding decorin. Examples of decorin binding assays suitable for use with bacterial proteins are described in U.S. Patent 5,853,987, incoφorated herein by reference in its entirety. The bacterial gene, or preferably borrelial, origin of the nucleic acids, genes and DNA coding regions is important to the invention. The term "decorin binding protein", as used herein, thus is not intended to cover proteins expressed by the vertebrate host, such as collagen, complement Cl q, transforming growth factor beta (TGFβ), that bind decorin in a physiologically relevant manner.

Equally, "decorin binding protein nucleic acid or gene", as used herein, also refers to a nucleic acid or gene that hybridizes, under relatively stringent hybridization conditions (see, e.g., Maniatis et al, 1982 and Sambrook et al, 1989, each specifically incoφorated herein by reference), to DNA sequences presently known to include Dbp gene sequences (Detailed Description, Section ID). Further, "decorin binding protein composition, nucleic acid or gene", as used herein, refers to a protein, polypeptide, peptide, nucleic acid or gene that exhibits significant sequence identity or homology to protein, polypeptide, peptide. nucleic acid or gene sequences presently known to include Dbp gene sequences (Detailed Description, Section ID).

Examples of such "decorin binding protein compositions" are found in published PCT patent application WO 98/06850 (incoφorated herein in its entirety by reference). Additional examples include the pi 7 genes and proteins from B. afzelii strains PAlt (Genbank accession number AJ131976), PWudl (Genbank accession number AJ131975), PWesI (Genbank accession number AJ131974), PRui (Genbank accession number AJ131973), PLud (Genbank accession number AJ131972), PSp (Genbank accession number AJ131971), PBo (Genbank accession number AJ131970), PLe (Genbank accession number AJ131969), PGau (Genbank accession number AJ131968) and PKo (Genbank accession number AJ131967) (the sequences of all Genbank accession numbers are specifically incoφorated herein by reference).

It will be understood that one or more than one Dbp protein, polypeptide, peptide, nucleic acid, gene or antibody may be used in the methods and compositions of the invention. The compositions and methods disclosed herein may therefore entail the administration of one, two, three, four, five, six, seven, eight, nine, ten or more, Dbp proteins, polypeptides, peptides, nucleic acids, genes or antibodies. The maximum number of such components that may be used is limited only by practical considerations, such as the cost and effort involved in simultaneously preparing a large number of components, the upper limits of formulations and administration techniques or even the possibility of eliciting a significant adverse cytotoxic effect.

B. Borrelial Outer Surface Protein (Osp) Compositions

The term "outer surface protein" was originally applied in the Borrelia field to the molecules "OspA and OspB". The term "Osp" was later used for other Borrelia proteins that share their lipoprotein biochemical property and putative surface localization with OspA. Six

Osps that have been identified and characterized to date are OspA, OspB, OspC, OspD, OspE and OspF.

Exemplary Borrelial outer surface protein, polypeptide, peptide, nucleic acid and antibody compositions contemplated for use in the present invention are disclosed in U.S. Patent Nos. 4,888,276, 5,178,859, 5,530,103, 5,571,718, 5,582,990, 5,620,862, 5,656,451 , 5,686,267, 5,688,512, 5,747,294, 5,777,095, 5,780,030, 5,807,685, 5,846,946 and 5,856,447, each incoφorated herein by reference in their entirety, including all sequences. Examples of OspA sequences include those from B. burgdorferi strain N40 (Genbank accession number M57248) and B. garinii strain G25 (Genbank accession number Z29086). Combinations of the Borrelial outer surface proteins OspA and OspC alone, i.e., without a decorin binding protein, are not encompassed within the present invention.

As used herein, the term "outer surface protein (Osp) nucleic acid or gene" is used to refer to a bacterial gene or DNA coding region, preferably a borrelial gene or DNA coding region, which encodes a protein, polypeptide or peptide that is surface accessible and that does significantly bind decorin (exemplary decorin binding assays are described in U.S. Patent 5,853,987, incoφorated herein by reference in its entirety). "Outer surface protein nucleic acid or gene", as used herein, also refers to a nucleic acid or gene that does not hybridize, under relatively stringent hybridization conditions (see, e.g., Maniatis et al, 1982 and Sambrook et al, 1989, each specifically incoφorated herein by reference), to DNA sequences presently known to include Dbp gene sequences (Detailed Description, Section ID). Further, "outer surface protein composition, nucleic acid or gene", as used herein, refers to a protein, polypeptide, peptide, nucleic acid or gene that does not exhibit significant sequence identity or homology to protein, polypeptide, peptide, nucleic acid or gene sequences presently known to include Dbp gene sequences (Detailed Description, Section ID).

Thus, sharing the lipoprotein biochemical property and surface localization of OspA is not sufficient to identify a protein as an Osp, rather than a Dbp. This is evident in that DbpA and DbpB share these properties with OspA, but have the additional activity of decorin binding that Osps A, B, C, and others lack. It may be that the use of "decorin binding" as a descriptive criterion, as developed by Guo and Hook (U.S. Patent 5,853,987), has yet to be exclusively adopted in the art. Thus, the "Osp" terminology should not be accepted at face value without an assessment of the structural, particularly sequence, and functional properties of the actual molecules.

Despite the potential lack of complete accuracy in the use of the term Osp in certain publications, there will be no difficulty for one of ordinary skill in the art in the art to determine whether a given component is an "Osp" or a "Dbp" as used herein. The ability to determine whether a given surface localized Borrelial protein is an Osp or a Dbp, as used herein, is exemplified in reference to the case of "Osp 17" (Jauris-Heipke et al, 1999). Thus, in light of the present disclosure, no ambiguity will remain as to what is "a decorin binding protein" and to their classification as a separate group within the larger category of "outer surface proteins."

Jauris-Heipke et al. (1999) puφorts to have identified "Ospl7", which is said to be a "novel Osp". In fact, the Ospl7 of Jauris-Heipke et al. (1999), as characterized from Borrelia afzelii strain PKo (Genbank accession number AJ131967) is 87.6% identical to the DbpA sequence from B. afzelii strain BO23 (Genbank accession number AF069267; SEQ ID NO:50 in PCT/US96/17081 ; each specifically incoφorated herein by reference). Ospl7 is also 92.4% identical to the DbpA sequence from B. afzelii strain ACA-1 (Genbank accession number AF069278; SEQ ID NO:4 in U.S. Provisional Patent Application Serial No. 60/103,728, filed October 9, 1998, each incoφorated herein by reference.

In light of the foregoing significant sequence identities, the present inventors expressed and purified a recombinant version of the so-called Osp 17 of Jauris-Heipke et al. (1999) and determined that it binds decorin in the blot system used by Guo and Hook (U.S. Patent No. 5,853,987; WO 96/34106; WO 97/27301 ; each specifically incoφorated herein by reference). Thus, by the readily testable criteria of the present disclosure, the molecule called "outer surface protein 17" is actually "DbpA-Pko", an allele of DbpA, and is a "DpA" molecule in the context of the present application.

C. Other Borrelial Protein Compositions

A number of other Borrelial proteins, nucleic acids and antibodies have been described that are contemplated for use in certain aspects of the present invention. Examples include EppA (disclosed in U.S. Patent Nos. 5,558,993 and 5,854,395, incoφorated herein by reference in their entirety), SI and T5 (disclosed in U.S. Patent Nos. 5,656,451 and 5,807,685), p39-alpha, p39-beta and p28 (disclosed in U.S. Patent Nos. 5,470,712 and 5,780,041, incoφorated herein by reference in their entirety), flagellin (disclosed in U.S. Patent No. 5,618,533, incoφorated herein by reference in its entirety), B. hermsii variable major protein 7 (Vmp7; disclosed in U.S. Patent No. 5,571,718, incoφorated herein by reference in its entirety), pi 10 (disclosed in U.S. Patent No. 5,554,371 , incoφorated herein by reference in its entirety), p60-68 (Hansen et al, 1988, incoφorated herein by reference in its entirety), p35 and p37 (Genbank accession numbers U82107 and U82106, respectively; Fikrig et al, 1997, incoφorated herein by reference in its entirety) and pi 3 (Sadziene et al, 1995; published PCT Patent Application No. WO 95/35119, each incoφorated herein by reference in their entirety).

D. Nucleic Acid Compositions

Aspects of the present invention concern combinations of isolated nucleic acids and DNA segments and recombinant vectors encoding Borrelia proteins, polypeptides and peptides, such as Borrelia decorin binding proteins, polypeptides and peptides, and Borrelia outer surface proteins, polypeptides and peptides, and the creation and use of recombinant host cells through the application of DNA technology, that express Borrelia proteins, polypeptides and peptides, using the Borrelia nucleic acid sequences disclosed and specifically incoφorated herein by reference. Combined DNA segments, recombinant vectors, recombinant host cells and expression methods involving the Borrelia sequences are also provided.

Each of the foregoing Borrelia decorin binding protein (Dbp) proteins, polypeptides, nucleic acids and genes (Detailed Description, Section IA), Borrelia outer surface protein (Osp) proteins, polypeptides, nucleic acids and genes (Detailed Description, Section IB) and Borrelia nucleic acids and genes that encode Borrelia proteins and polypeptides other than Dbp and Osp proteins and polypeptides (Detailed Description, Section IC) are included within all aspects of the following description.

The present invention concerns combinations of nucleic acids or DNA segments, isolatable from Borrelial cells, that are free from total genomic DNA and that are capable of expressing a Borrelia protein, polypeptide or peptide. As used herein, the terms "nucleic acid" and "DNA segment" refers to nucleic acid and DNA molecules that have been isolated free of total genomic DNA of a particular species. Therefore, for example, a nucleic acid or DNA segment encoding a Borrelia decorin binding protein, polypeptide or peptide or outer surface protein, polypeptide or peptide refers to a nucleic acid or DNA segment that contains decorin binding protein, polypeptide or peptide or outer surface protein, polypeptide or peptide coding sequences yet is isolated away from, or purified free from, total genomic DNA. Included within the terms "nucleic acids" and "DNA segments", are nucleic acids and DNA segments, smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like.

Similarly, a nucleic acid or DNA segment comprising an isolated or purified decorin binding protein, polypeptide or peptide gene or an outer surface protein, polypeptide or peptide gene refers to nucleic acids or DNA segments including wild-type, polymoφhic or mutant decorin binding protein or outer surface protein coding sequences and, in certain aspects, regulatory sequences, isolated substantially away from other naturally occurring genes or protein encoding sequences. In this respect, the term "gene" is used for simplicity to refer to a functional protein, polypeptide or peptide encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences, cDNA sequences and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins and mutants.

"Isolated substantially away from other coding sequences" means that the gene of interest, for example a decorin binding protein or outer surface protein gene, forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or protein coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to the segment by the hand of man.

In particular embodiments, the invention concerns combinations of isolated DNA segments and recombinant vectors incoφorating DNA sequences that encode, for example, a decorin binding protein or outer surface protein, polypeptide or peptide, that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially as set forth in, the amino acid sequences disclosed and specifically incoφorated herein (see above), corresponding to wild-type, polymoφhic or mutant decorin binding protein or outer surface protein.

The term "a sequence essentially as set forth in" means that the sequence substantially corresponds to a portion of the amino acid sequence disclosed and specifically incoφorated herein (see above), and has relatively few amino acids that are not identical to, or a biologically functional equivalent of, the amino acids of the disclosed or incoφorated amino acid sequence.

The term "biologically functional equivalent" is well understood in the art and is further defined in detail herein. Accordingly, sequences that have between about 70% and about 80%; or more preferably, between about 81 % and about 90%; or even more preferably, between about 91% and about 99%; of amino acids that are identical or functionally equivalent to the amino acids of the disclosed and incoφorated sequences will be sequences that are "essentially as set forth in" the disclosed and incoφorated amino acid sequences, provided the biological activity of the protein is maintained.

In certain other embodiments, the invention concerns combinations of isolated DNA segments and recombinant vectors that include within their sequence a nucleic acid sequence essentially as set forth in the nucleic acid sequences disclosed and specifically incoφorated herein (see above). The term "essentially as set forth in" is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a portion of the disclosed or incoφorated nucleic acid sequence and has relatively few codons that are not identical, or functionally equivalent, to the codons of the disclosed or incoφorated nucleic acid sequence.

The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids (see Table 1). It will also be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed or incoφorated herein, so long as the sequence meets the criteria set forth above, particularly including the maintenance of biological (immunological) protein function. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region.

Excepting flanking regions, and allowing for the degeneracy of the genetic code, sequences that have between about 70% and about 79%; or more preferably, between about 80% and about 89%; or even more preferably, between about 90% and about 99%; of nucleotides that are identical to the nucleotides of the disclosed or incoφorated nucleic acid sequences will be sequences that are "essentially as set forth in" these sequences.

Sequences that are essentially the same as those set forth in the disclosed or incoφorated nucleic acid sequences may also be functionally defined as sequences that are capable of hybridizing to a nucleic acid segment containing the complement of the disclosed or incoφorated nucleic acid sequences under relatively stringent conditions. Suitable relatively stringent hybridization conditions will be well known to those of skill in the art, as disclosed herein.

The present invention also encompasses combinations of DNA segments that are complementary, or essentially complementary, to the sequence set forth in the disclosed or incoφorated nucleic acid sequences. Nucleic acid sequences that are "complementary" are those that are capable of base-pairing according to the standard Watson-Crick complementarity rules. As used herein, the term "complementary sequences" means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the disclosed or incoφorated nucleic acid sequences under relatively stringent conditions such as those described herein. The nucleic acid segments for use in the present invention, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.

For example, nucleic acid fragments may be prepared that include a short contiguous stretch identical to or complementary to the disclosed or incoφorated nucleic acid sequences, such as about 8, about 10 to about 14, or about 15 to about 20 nucleotides, and that are up to about 20,000, or about 10,000, or about 5,000 base pairs in length, with segments of about 3,000 being preferred in certain cases. DNA segments with total lengths of about 1 ,000, about 500, about 200, about 100 and about 50 base pairs in length (including all intermediate lengths) are also contemplated to be useful.

It will be readily understood that "intermediate lengths", in these contexts, means any length between the quoted ranges, such as 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.; 21, 22, 23, etc.; 30, 31, 32, etc.; 50, 51, 52, 53, etc.; 100, 101, 102, 103, etc.; 150, 151, 152, 153, etc.; including all integers through the 200-500; 500-1,000; 1,000-2,000; 2,000-3.000; 3,000-5,000; 5,000-10,000 ranges, up to and including sequences of about 12,001, 12,002, 13,001, 13,002, 15,000, 20,000 and the like.

The various probes and primers designed around the disclosed or incoφorated nucleotide sequences of the present invention may be of any length. By assigning numeric values to a sequence, for example, the first residue is 1, the second residue is 2, etc., an algorithm defining all primers can be proposed:

n to n + y where n is an integer from 1 to the last number of the sequence and y is the length of the primer minus one, where n + y does not exceed the last number of the sequence. Thus, for a 10-mer, the probes correspond to bases 1 to 10, 2 to 1 1, 3 to 12 ... and so on. For a 15-mer, the probes correspond to bases 1 to 15, 2 to 16, 3 to 17 ... and so on. For a 20-mer, the probes correspond to bases 1 to 20, 2 to 21, 3 to 22 ... and so on.

It will also be understood that this invention is not limited to the use of the particular disclosed or incoφorated nucleic acid and amino acid sequences. Recombinant vectors and isolated DNA segments may therefore variously include these coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include such coding regions or may encode biologically functional equivalent proteins or peptides that have variant amino acids sequences.

Certain of the DNA segments for use in the present invention encompass biologically functional equivalent proteins and peptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity of the protein or to test mutants in order to examine activity at the molecular level.

One may also prepare fusion proteins and peptides, e.g., where the protein coding regions are aligned within the same expression unit with other proteins or peptides having desired functions, such as for purification or immunodetection puφoses (e.g., proteins that may be purified by affinity chromatography and enzyme label coding regions, respectively).

Encompassed by the invention are DNA segments encoding relatively small peptides, such as, for example, peptides of from about 5, 8, 10, 12, 15 or so to about 25, 30, 35, 40, 45 or 50 or so amino acids in length. More preferably, the peptides are from about 12 or 15 to about 25, 30 or 35 amino acids in length.

E. Protein, Polypeptide and Peptide Compositions The present invention therefore provides combinations of purified, and in preferred embodiments, combinations of substantially purified, Borrelia proteins, polypeptides and peptides, for example Borrelia decorin binding proteins, polypeptides and peptides and outer surface proteins, polypeptides and peptides. The term "purified Borrelia protein, polypeptide or peptide", for example "purified decorin binding protein, polypeptide or peptide" and "purified outer surface protein, polypeptide or peptide" as used herein, is intended to refer to, for example, a wild-type, polymoφhic or mutant decorin binding or outer surface proteinaceous composition, isolatable from bacterial cells or recombinant host cells, wherein the wild-type, polymoφhic or mutant decorin binding or outer surface protein, polypeptide or peptide is purified to any degree relative to its naturally-obtainable state, i.e., relative to its purity within a cellular extract. A purified decorin binding or outer surface protein, polypeptide or peptide therefore also refers to a decorin binding or outer surface protein, polypeptide or peptide free from the environment in which it naturally occurs.

Proteins for use in the present invention may be full length proteins, while in certain aspects of the invention they may also be less then full length proteins, such as individual domains, regions or even epitopic peptides. Where less than full length proteins are concerned, the most preferred will be those containing predicted immunogenic sites and those containing the functional domains identified herein.

Generally, "purified" will refer to, for example, a decorin binding or outer surface protein, polypeptide or peptide composition that has been subjected to fractionation to remove various non-wild-type, polymoφhic or mutant decorin binding or outer surface protein, polypeptide or peptide components, and which composition substantially retains its decorin binding or outer surface functionality and immunogenicity. Where the term "substantially purified" is used, this will refer to a composition in which the protein, polypeptide or peptide forms the major component of the composition, such as constituting about 50% or more of the proteins, polypeptides or peptides in the composition. In preferred embodiments, a substantially purified protein, polypeptide or peptide will constitute more than 60%, 70%, 80%, 90%, 95%, 99% or even more of the proteins, polypeptides or peptides in the composition.

A protein, polypeptide or peptide that is "purified to homogeneity," as applied to the present invention, means that the protein, polypeptide or peptide has a level of purity where the protein, polypeptide or peptide is substantially free from other proteins, polypeptides, peptides and biological components. For example, a purified protein, polypeptide or peptide will often be sufficiently free of other protein, polypeptide or peptide components so that degradative sequencing may be performed successfully.

Various methods for quantifying the degree of purification the disclosed and incoφorated proteins, polypeptides or peptides will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the number of proteins, polypeptides or peptides within a fraction by gel electrophoresis. Assessing the number of proteins, polypeptides or peptides within a fraction by SDS/PAGE analysis will often be preferred in the context of the present invention as this is straightforward.

To purify a protein, polypeptide or peptide, such as a Borrelia decorin binding or outer surface protein, polypeptide or peptide, a natural or recombinant composition comprising at least some decorin binding or outer surface protein, polypeptide or peptide components will be subjected to fractionation to remove various non-decorin binding or outer surface protein, polypeptide or peptide components from the composition. Various techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite, and affinity chromatography; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques.

Another example is the purification of a fusion protein using a specific binding partner. Such purification methods are routine in the art. This is currently exemplified by the generation of a glutathione S-transferase fusion protein, expression in E. coli, and isolation to homogeneity using affinity chromatography on glutathione-agarose. DbpA fusion proteins with polyhistidine tags, as purified by immobilized metal affinity chromatography, are further suitable examples.

Although preferred for use in certain embodiments, there is no general requirement that the disclosed proteins, polypeptides or peptides always be provided in their most purified state. Indeed, it is contemplated that less substantially purified proteins, polypeptides or peptides, which are nonetheless enriched in, for example, decorin binding or outer surface proteins, polypeptides or peptides, relative to the natural state, will have utility in certain embodiments. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of proteinaceous product, or in maintaining the activity of an expressed protein, polypeptide or peptide. "Inactive" products also have utility in certain embodiments, such as, e.g., in antibody generation, and are therefore useful as vaccine components.

II. Recombinant Expression of Borrelial Protein Compositions

Combinations of recombinant vectors form further aspects of the present invention. Particularly useful vectors are contemplated to be those vectors in which the coding portion of a Borrelia DNA segment, whether encoding a full length protein or smaller peptide, is positioned under the control of a promoter. For expression in this manner, one would position the coding sequences adjacent to and under the control of the promoter. It is understood in the art that to bring a coding sequence under the control of a promoter, one positions the 5' end of the transcription initiation site of the transcriptional reading frame of the protein between about 1 and about 50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter. The promoter may be in the form of the promoter that is naturally associated with a particular Borrelia gene, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment, for example, using recombinant cloning and/or PCR™ technology, in connection with the compositions disclosed herein. Direct amplification of nucleic acids using the PCR™ technology of U.S. Patents 4,683,195 and 4,683,202 (herein incoφorated by reference) are particularly contemplated to be useful in such methodologies.

In other embodiments, it is contemplated that certain advantages will be gained by positioning the coding DNA segment under the control of a recombinant, or heterologous, promoter. As used herein, a recombinant or heterologous promoter is intended to refer to a promoter that is not normally associated with a particular Borrelia gene in its natural environment. Such promoters may include Borrelia promoters normally associated with other genes, and/or promoters isolated from any bacterial, viral, eukaryotic, or mammalian cell. Naturally, it will be important to employ a promoter that effectively directs the expression of the DNA segment in the cell type, organism, or even animal, chosen for expression. The use of promoter and cell type combinations for protein expression is generally known to those of skill in the art of molecular biology, for example, see Sambrook et al, 1989. The promoters employed may be constitutive, or inducible, and can be used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or peptides.

It will be understood that one or more than one nucleic acid or gene encoding Borrelial proteins, polypeptides and/or peptides may be used in the methods and compositions of the invention. The nucleic acid compositions and methods disclosed herein may entail the administration of one, two, three, four, five, six, seven, eight, nine, ten or more, nucleic acids or genes. The maximum number of genes that may be used is limited only by practical considerations, such as the cost and effort involved in simultaneously preparing a large number of gene constructs, the upper limits of formulations and administration techniques or even the possibility of eliciting a significant adverse cytotoxic effect. In using multiple genes, they may be combined on a single genetic construct under control of one or more promoters, or they may be prepared as separate constructs of the same of different types. Thus, an almost endless combination of different genes and genetic constructs may be employed. The technical ability to generate such single or combined expression constructs is common in the art.

Certain gene combinations may be designed to, or their use may otherwise result in, achieving synergistic effects on formation of an immune response, such as those described herein, or the development of antibodies to gene products encoded by such nucleic acid segments, or in the production of diagnostic and treatment protocols for Borrelia infection, and in particular, infection with B. burgdorferi, B. afzelii, B. garinii, B. andersonii, B. japonica or B. bissettii and those infections leading to Lyme disease. Any and all such combinations are intended to fall within the scope of the present invention.

Prokaryotic expression of nucleic acid segments of the present invention may be performed using methods known to those of skill in the art, and will likely comprise expression vectors and promoter sequences such as those provided by tac. trp, lac, lacUV5 or T7. Those promoters most commonly used in recombinant DNA construction include the β-lactamase (penicillinase) and lactose promoter systems (Chang et al. 1978; Itakura et al, 1977; Goeddel et al, 1979) or the tryptophan (trp) promoter system (Goeddel et al, 1980).

When expression of the recombinant Borrelia proteins is desired in eukaryotic cells, a number of expression systems are available and known to those of skill in the art. For eukaryotic expression, preferred promoters include those such as CMV, RSV LTR, the SV40 promoter alone, and the SV40 promoter in combination with the SV40 enhancer. Another eukaryotic system contemplated for use in high-level expression is the Pichia expression vector system (Pharmacia LKB Biotechnology). Where eukaryotic expression is contemplated, one will also typically desire to incoφorate into the transcriptional unit an appropriate polyadenylation site (e.g., 5'-AATAAA-3') if one was not contained within the original cloned segment. Typically, the poly- A addition site is placed about 30 to 2000 nucleotides "downstream" of the termination site of the protein at a position prior to transcription termination.

In connection with expression embodiments to prepare recombinant Borrelia proteins, polypeptides and peptides, DNA segments encoding the entire protein or functional domains, epitopes, ligand binding domains, subunits, etc. may be used. It will be appreciated that the use of shorter DNA segments to direct the expression of peptides or epitopic core regions, such as may be used to generate antibodies against a selected Borrelia protein, fall within the scope of the invention. DNA segments that encode polypeptide or peptide antigens from about 5, 8, 10, 12, 15 or so to about 25, 30, 35, 40, 45, 50 or 100 or so amino acids in length, or more preferably, from about 12 or 15 to about 25, 30 or 35 amino acids in length are contemplated to be particularly useful.

It is contemplated that virtually any recombinant host cell may be employed for expression of Borrelia gene(s), but certain advantages may be found in using a bacterial host cell such as E. coli, S. typhimurium, B. subtilis, or others. Examples of preferred prokaryotic hosts are E. coli, and in particular, E. coli strains ATCC69791, BL21(DE3), JM101, XL 1 -Blue™, RR1, LE392, B, X1776 (ATCC No. 31537), and W3110 (F\ λ\ prototrophic, ATCC273325). Alternatively, other Enterobacteriaceae species such as Salmonella typhimurium and Serratia marcescens, or even other Gram-negative hosts including various Pseudomonas species may be used in the recombinant expression of the genetic constructs disclosed herein. Borreliae themselves may be used to express these constructs, and in particular, B. burgdorferi, B. afzelii, B. bissettii, B. japonica and B. garinii.

In general, plasmid vectors containing replicon and control sequences that are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences that are capable of providing phenotypic selection in transformed cells. For example, E. coli may be typically transformed using vectors such as pBR322, or any of its derivatives (Bolivar et al, 1977). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. pBR322, its derivatives, or other microbial plasmids or bacteriophage may also contain, or be modified to contain, promoters which can be used by the microbial organism for expression of endogenous proteins. Preferred vectors for cloning the dbp constructs, in addition to those described in the Example below, are pBlueScript™, and vectors based on the pET vector series (Novagen, Inc., Madison, WI; U.S. Patent 4,952,496, incoφorated herein by reference).

In addition, phage vectors containing replicon and control sequences that are compatible with the host microorganism can be used as transforming vectors in connection with these hosts. For example, bacteriophage such as λGEM™-l l may be utilized in making a recombinant vector that can be used to transform susceptible host cells such as E. coli LE392.

As used herein, the term "engineered" or "recombinant" cell is intended to refer to a cell into which a recombinant gene, such as a gene encoding a Borrelial protein, polypeptide or peptide, has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells that do not contain a recombinantly introduced gene. Engineered cells are thus cells having a gene or genes introduced through the hand of man. Recombinantly introduced genes will either be in the form of a single structural gene, an entire genomic clone comprising a structural gene and flanking DNA, or an operon or other functional nucleic acid segment which may also include genes positioned either upstream and/or downstream of the promoter, regulatory elements, or structural gene itself, or even genes not naturally associated with the particular structural gene of interest.

Expression in eukaryotic cells is also contemplated such as those derived from yeast. insect, or mammalian cell lines. Saccharomyces cerevisiae, or common bakers' yeast is the most commonly used among eukaryotic microorganisms, although a number of other species may also be employed for such eukaryotic expression systems. For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used (Stinchcomb et al, 1979; Kingsman et al, 1979; Tschumper et al, 1980). This plasmid already contains the trp gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, 1977). The presence of the trp lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoting sequences in yeast vectors include the promoters for

3-phosphoglycerate kinase (Hitzeman et al, 1980) or other glycolytic enzymes (Hess et al, 1968; Holland et al, 1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination. Other promoters, which have the additional advantage of transcription controlled by growth conditions are the promoter region for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Any plasmid vector containing a yeast-compatible promoter, an origin of replication, and termination sequences is suitable.

In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts in the routine practice of the disclosed methods. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture. However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years. Examples of such useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, BHK, COS-7, 293 and MDCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences. For use in mammalian cells, the control functions on the expression vectors are often provided by viral material. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment that also contains the SV40 viral origin of replication (Fiers et al, 1978). Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the H/«dIII site toward the BgH site located in the viral origin of replication. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems. The origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from S V40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.

These recombinant host cells may be employed in connection with "overexpressing" Borrelia proteins, polypeptides and peptides that is, increasing the level of expression over that found naturally in B. burgdorferi. Many such vectors and host cells are readily available, one particular example of a suitable vector for expression in mammalian cells is that described in U. S. Patent 5.168,050, incoφorated herein by reference. However, there is no requirement that a highly purified vector be used, so long as the coding segment employed encodes a protein or peptide of interest (e.g., a protein from Borrelia, and particularly from B. burgdorferi, B. afzelii, B. garinii, B. bissettii or B. japonica), and does not include any coding or regulatory sequences that would have an adverse effect on cells. Therefore, it will also be understood that useful nucleic acid sequences may include additional residues, such as additional non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various regulatory sequences.

It is further contemplated that the Borrelial proteins or epitopic peptides derived from native or recombinant Borrelial proteins are typically "overexpressed", i.e., expressed in increased levels relative to their natural expression, or even relative to the expression of other proteins in a recombinant host cell containing Borrelial protein-encoding DNA segments. Such overexpression may be assessed by a variety of methods, including radiolabeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or Western blotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein or peptide in comparison to the level in Borrelial cells is indicative of overexpression, as is a relative abundance of the specific protein in relation to the other proteins produced by the host cell and, e.g., visible on a gel.

It will be further understood that certain of the polypeptides may be present in quantities below the detection limits of the Coomassie brilliant blue staining procedure usually employed in the analysis of SDS/PAGE gels, or that their presence may be masked by an inactive polypeptide of similar M_r. Although not necessary to the routine practice of the present invention, it is contemplated that other detection techniques may be employed advantageously in the visualization of particular polypeptides of interest. Immunologically-based techniques such as Western blotting using enzymatically-, radiolabel-, or fluorescently-tagged antibodies described herein are considered to be of particular use in this regard. Alternatively, the peptides of the present invention may be detected by using antibodies of the present invention in combination with secondary antibodies having affinity for such primary antibodies. This secondary antibody may be enzymatically- or radiolabeled, or alternatively, fluorescently-, or colloidal gold-tagged. Means for the labeling and detection of such two-step secondary antibody techniques are well-known to those of skill in the art.

III. Biological Functional Equivalents

Modification and changes may be made in the structure of the peptides of the present invention and DNA segments that encode them and still obtain a functional molecule that encodes a protein or peptide with desirable characteristics. The following is a discussion based upon changing the amino acids of a protein to create an equivalent, or even an improved. second-generation molecule. The amino acid changes may be achieved by changing the codons of the DNA sequence, according to Table 1.

Table 1

Amino Acids Codons

Alanine Ala A GCA GCC GCG GCU

Cysteine Cys C UGC UGU

Aspartic acid Asp D GAC GAU

Glutamic acid Glu E GAA GAG

Phenylalanine Phe F UUC UUU

Glycine Gly G GGA GGC GGG GGU

Histidine His H CAC CAU

Isoleucine He I AUA AUC AUU

Lysine Lys K AAA AAG

Leucine Leu L UUA UUG CUA CUC CUG CUU

Methionine Met M AUG

Asparagine Asn N AAC AAU

Proline Pro P CCA CCC CCG CCU

Glutamine Gin Q CAA CAG

Arginine Arg R AGA AGG CGA CGC CGG CGU

Serine Ser S AGC AGU UCA UCC UCG UCU

Threonine Thr T ACA ACC ACG ACU

Valine Val V GUA GUC GUG GUU

Tryptophan Tφ w UGG

Tyrosine Tyr Y UAC UAU

For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a protein sequence, and, of course, its underlying DNA coding sequence, and nevertheless obtain a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the peptide sequences of the disclosed compositions, or corresponding DNA sequences which encode said peptides without appreciable loss of their biological utility or activity.

In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982, incoφorate herein by reference). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics (Kyte and Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (- 1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, i.e., still obtain a biological functionally equivalent protein. In making such changes, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those that are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred. It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incoφorated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an immunologically equivalent protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those that are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

As outlined above, amino acid substitutions are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

IV. Site-Specific Mutagenesis Site-specific mutagenesis is a technique useful in the preparation of individual peptides, or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA. The technique, well-known to those of skill in the art, further provides a ready ability to prepare and test sequence variants, for example, incoφorating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 14 to about 25 nucleotides in length is preferred, with about 5 to about 10 residues on both sides of the junction of the sequence being altered. In general, the technique of site-specific mutagenesis is well known in the art, as exemplified by various publications. As will be appreciated, the technique typically employs a phage vector that exists in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the Ml 3 phage. These phage are readily commercially-available and their use is generally well-known to those skilled in the art. Double-stranded plasmids are also routinely employed in site directed mutagenesis that eliminates the step of transferring the gene of interest from a plasmid to a phage.

In general, site-directed mutagenesis in accordance herewith is performed by first obtaining a single-stranded vector or melting apart of two strands of a double-stranded vector which includes within its sequence a DNA sequence which encodes the desired peptide. An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically. This primer is then annealed with the single-stranded vector, and subjected to DNA polymerizing enzymes such as E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells, such as E. coli cells, and clones are selected which include recombinant vectors bearing the mutated sequence arrangement.

The preparation of sequence variants of the selected peptide-encoding DNA segments using site-directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting as there are other ways in which sequence variants of peptides and the DNA sequences encoding them may be obtained. For example, recombinant vectors encoding the desired peptide sequence may be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants. Specific details regarding these methods and protocols are found in the teachings of Maloy et al, 1994; Segal, 1976; Prokop and Bajpai, 1991; Kuby, 1994; and Maniatis et al, 1982, each incoφorated herein by reference, for that puφose. The PCR™-based strand overlap extension (SOE) (Ho et al, 1989) for site-directed mutagenesis is particularly preferred for site-directed mutagenesis of the nucleic acid compositions of the present invention. The techniques of PCR™ are well-known to those of skill in the art, as described hereinabove. The SOE procedure involves a two-step PCR™ protocol, in which a complementary pair of internal primers (B and C) are used to introduce the appropriate nucleotide changes into the wild-type sequence. In two separate reactions, flanking PCR™ primer A (restriction site incoφorated into the oligo) and primer D (restriction site incoφorated into the oligo) are used in conjunction with primers B and C, respectively to generate PCR™ products AB and CD. The PCR™ products are purified by agarose gel electrophoresis and the two overlapping PCR™ fragments AB and CD are combined with flanking primers A and D and used in a second PCR™ reaction. The amplified PCR™ product is agarose gel purified, digested with the appropriate enzymes, ligated into an expression vector, and transformed into E. coli JM101, XL 1 -Blue™ (Stratagene, LaJolla, CA), JM105, or TGI (Carter et al, 1985) cells. Clones are isolated and the mutations are confirmed by sequencing of the isolated plasmids.

V. Generating an Immune Response

The present invention provides methods of generating an immune response in an animal, including a human. The methods generally involve administering to an animal or human a pharmaceutical composition comprising an immunologically effective amount of a combined Borrelial protein, polypeptide, peptide, nucleic acid or antibody composition as disclosed and incoφorated herein. Animals to be immunized include mammals, particularly humans, but also murine, bovine, equine, porcine, canine, feline and non-human primate species.

By "immunologically effective amount" is meant an amount of a combined Borrelial protein, polypeptide, peptide, nucleic acid or antibody composition that is capable of generating an immune response in the recipient animal or human. This includes both the generation of an antibody response (B cell response), and/or the stimulation of a cytotoxic immune response (T cell response). In terms of preventative and treatment measures, these methods may be used for the prevention or treatment of infections caused by pathogens such as B. burgdorferi, B. afzelii, B. garinii, and related borrelial species.

However, the generation of such an immune response will have utility in the production of useful bioreagents, e.g., cytotoxic T lymphocytes (CTLs) and, more particularly, reactive antibodies, as well as in prophylactic and therapeutic embodiments. Bioreagents such as CTLs and antibodies have numerous practical uses outside prophylaxis and therapy, such as in in vitro diagnostics. Therefore, although these methods for the stimulation of an immune response include vaccination regimens designed to prevent or lessen significant infections caused by borrelias, and treatment regimens that may lessen the severity or duration of any infection, it will be understood that achieving either of these end results is not necessary for practicing these aspects of the invention.

In terms of the prevention of infections caused by pathogens such as B. burgdorferi, B. afzelii, B. garinii, and related borrelial species, in many instances, it will be desirable to have multiple administrations of the vaccine, usually not exceeding six vaccinations, more usually not exceeding four vaccinations and preferably one or more, usually at least about three vaccinations. The vaccinations will normally be at from two to twelve week intervals, more usually from three to five week intervals. Periodic boosters at intervals of 1-5 years, usually three years, will be desirable to maintain protective levels of the antibodies.

The course of the immunization may be followed by assays for antibodies for the supernatant antigens. The assays may be performed by labeling with conventional labels, such as radionuclides, enzymes, fiuorescers, and the like. These techniques are well known and may be found in a wide variety of patents, such as U.S. Patent Nos. 3,791,932; 4,174,384 and

3,949,064, as illustrative of these types of assays.

The invention thus encompasses combined Borrelial protein, polypeptide and peptide antigen compositions, and or nucleic acids, together with pharmaceutically-acceptable excipients, carriers, diluents, adjuvants, and other components, for the formulation of particular vaccines. Other components include additional peptides, antigens, or outer membrane preparations, as may be employed in the formulation of particular vaccines.

The pharmaceutical, vaccine or other compositions for administration to generate an immune response will typically include combinations of partially or significantly purified Borrelial proteins, polypeptides and/or peptides, obtained from natural or recombinant sources, which proteins, polypeptides and/or peptides may be obtainable naturally or either chemically synthesized, or alternatively produced in vitro from recombinant host cells expressing DNA segments encoding such proteins, polypeptides and/or peptides. Smaller peptides that include reactive epitopes, such as those between about 10 amino acids and about 50 amino acids, between about 15 amino acids and about 25 amino acids in length, or even between about 50 amino acids and about 100 amino acids in length will often be preferred. The antigenic proteins, polypeptides and/or peptides may also be combined with other agents, such as other borrelial peptide or nucleic acid compositions, if desired.

The combined nucleic acid sequences of the present invention may also be administered to provide recombinant Borrelial proteins, polypeptides and/or peptides by expression in situ. Accordingly, the invention includes methods of generating an immune response in an animal comprising administering to an animal, or human subject, a pharmaceutically-acceptable composition comprising an immunologically effective amount of a nucleic acid composition encoding combinations of Borrelial protein, polypeptide and/or peptide epitope. The "immunologically effective amounts" are those amounts capable of stimulating a B-cell and/or T-cell responses against the encoded proteins, polypeptides and/or peptides.

Immunoformulations of this invention, whether intended for vaccination, treatment, or for the generation of antibodies, may comprise native, or synthetically-derived antigenic peptide fragments from these proteins. As such, antigenic functional equivalents of the proteins and peptides described herein also fall within the scope of the present invention. An "antigenically functional equivalent" protein or peptide is one that incoφorates an epitope that is immunologically cross-reactive with one or more epitopes derived from any of the particular Borrelial proteins disclosed. Antigenically functional equivalents, or epitopic sequences, may be first designed or predicted and then tested, or may simply be directly tested for cross-reactivity.

The identification or design of suitable epitopes, and/or their functional equivalents, suitable for use in immunoformulations, vaccines, or simply as antigens, is a relatively straightforward matter. For example, one may employ the methods of Hopp, as enabled in U.S. Patent 4,554,101, incoφorated herein by reference, which teaches the identification and preparation of epitopes from amino acid sequences on the basis of hydrophilicity. The methods described in several other papers, and software programs based thereon, can also be used to identify epitopic core sequences. For example, Chou and Fasman (1974a, b; 1978; 1979); Jameson and Wolf (1988); Wolf et al (1988); and Kyte and Doolittle (1982), each specifically incoφorated herein by reference, all address this subject.

Another method for determining the major antigenic determinants of a polypeptide is the SPOTs™ system (Genosys Biotechnologies, Inc., The Woodlands, TX). In this method, overlapping peptides are synthesized on a cellulose membrane, which following synthesis and deprotection, is screened using a polyclonal or monoclonal antibody. The antigenic determinants of the peptides that are initially identified can be further localized by performing subsequent syntheses of smaller peptides with larger overlaps, and by eventually replacing individual amino acids at each position along the immunoreactive peptide. The amino acid sequence of these "epitopic core sequences" may then be readily incoφorated into peptides, either through the application of peptide synthesis or recombinant technology.

A. Antibodies In other aspects of the present invention, administration of antibodies reactive with

Borrelial proteins to at-risk subjects will be effective for prophylaxis of, and in the case of infected subjects for therapy of, Lyme disease. Antibodies may be of several types including those raised in heterologous donor animals or human volunteers immunized with Borrelial proteins, monoclonal antibodies (mAbs) resulting from hybridomas derived from fusions of B cells from immunized animals or humans with compatible myeloma cell lines, so-called "humanized" mAbs resulting from expression of gene fusions of combinatorial determining regions of mAb-encoding genes from heterologous species with genes encoding human antibodies, or antibody-containing fractions of plasma from human donors residing in Lyme disease-endemic areas. It is contemplated that any of the techniques described herein might be used for the passive immunization of subjects for protection against, or treatment of, Borrelial infections, such as Lyme disease.

As used herein, the term "antibody" is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting. Reference to antibodies throughout the specification includes whole polyclonal and monoclonal antibodies (mAbs), and parts thereof, either alone or conjugated with other moieties. Antibody parts include Fab', Fab, F(ab')₂, single domain antibodies (DABs), Fv, scFv (single chain Fv). and the like. The techniques for preparing and using various antibody-based constructs and fragments are well known in the art. The antibodies may be made in vivo in suitable laboratory animals or in vitro using recombinant DNA techniques.

Means for preparing and characterizing antibodies are well known in the art (See, e.g., Harlow and Lane (1988); incoφorated herein by reference). Briefly, a polyclonal antibody is prepared by immunizing an animal with an immunogen comprising a polypeptide of the present invention and collecting antisera from that immunized animal. A wide range of animal species can be used for the production of antisera. Typically an animal used for production of anti- antisera is a rabbit, a mouse, a rat, a hamster or a guinea pig. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies.

As is well known in the art, a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Methods for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis-biazotized benzidine.

As is also well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Suitable adjuvants include all acceptable immunostimulatory compounds, such as cytokines, toxins or synthetic compositions. Adjuvants that may be used include IL-1, IL-2, IL-4, IL-7, IL-12, g-interferon, GMCSP, BCG, aluminum hydroxide, MDP compounds, such as thur-MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL). RIBI, which contains three components extracted from bacteria, MPL, trehalose dimycolate (TDM) and cell wall skeleton (CWS) in a 2% squalene/Tween 80 emulsion. MHC antigens may even be used. Exemplary, often preferred adjuvants include complete Freund's adjuvant (a non- specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum adjuvants.

In addition to adjuvants, it may be desirable to coadminister biologic response modifiers (BRM), which have been shown to upregulate T cell immunity or downregulate suppressor cell activity. Such BRMs include, but are not limited to, Cimetidine (CIM; 1200 mg/d) (Smith/Kline, PA); or low-dose Cyclophosphamide (CYP; 300 mg/m²) (Johnson Mead, NJ) and Cytokines such as γ-interferon, IL-2, or IL-12 or genes encoding proteins involved in immune helper functions, such as B-7.

The amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intranasal, intravenous and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection, may also be given. The process of boosting and titering is repeated until a suitable titer is achieved. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored, and/or the animal can be used to generate MAbs.

MAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incoφorated herein by reference. Typically, this technique involves immunizing a suitable animal with a selected immunogen composition, e.g. , a purified or partially purified Borrelial protein, polypeptide, peptide or domain. The immunizing composition is administered in a manner effective to stimulate antibody producing cells. The methods for generating monoclonal antibodies (MAbs) generally begin along the same lines as those for preparing polyclonal antibodies. Rodents such as mice and rats are preferred animals, however, the use of rabbit, sheep frog cells is also possible. The use of rats may provide certain advantages (Goding, 1986, pp. 60-61), but mice are preferred, with the BALB/c mouse being most preferred as this is most routinely used and generally gives a higher percentage of stable fusions. The animals are injected with antigen, generally as described above. The antigen may be coupled to carrier molecules such as keyhole limpet hemocyanin if necessary. The antigen would typically be mixed with adjuvant, such as Freund's complete or incomplete adjuvant. Booster injections with the same antigen would occur at approximately two-week intervals.

Following immunization, somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol. These cells may be obtained from biopsied spleens, tonsils or lymph nodes, or from a peripheral blood sample. Spleen cells and peripheral blood cells are preferred, the former because they are a rich source of antibody-producing cells that are in the dividing plasmablast stage, and the latter because peripheral blood is easily accessible. Often, a panel of animals will have been immunized and the spleen of animal with the highest antibody titer will be removed and the spleen lymphocytes obtained by homogenizing the spleen with a syringe. Typically, a spleen from an immunized mouse contains approximately 5 x 10⁷ to 2 x 10⁸ lymphocytes. The antibody-producing B lymphocytes from the immunized animal are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized. Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render then incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas).

Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, 1986, pp. 65-66; Campbell, 1984, pp. 75-83). For example, where the immunized animal is a mouse, one may use P3-X63/Ag8, X63-Ag8.653, NSl/l.Ag 4 1, Sp210-Agl4, FO, NSO/U, MPC-1 1, MPC11-X45-GTG 1.7 and S194/5XX0 Bui; for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in connection with human cell fusions. One preferred murine myeloma cell is the NS-1 myeloma cell line (also termed P3-NS-l-Ag4-l), which is readily available from the NIGMS Human Genetic Mutant Cell Repository by requesting cell line repository number GM3573. Another mouse myeloma cell line that may be used is the 8-azaguanine-resistant mouse murine myeloma SP2/0 non-producer cell line.

Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually comprise mixing somatic cells with myeloma cells in a 2: 1 proportion, though the proportion may vary from about 20:1 to about 1 :1, respectively, in the presence of an agent or agents (chemical or electrical) that promote the fusion of cell membranes. Fusion methods using Sendai virus have been described by Kohler and Milstein (1975; 1 76), and those using polyethylene glycol (PEG), such as 37% (v/v) PEG, by Gefter et al. (1977). The use of electrically induced fusion methods is also appropriate (Goding, 1986, pp. 71-74).

Fusion procedures usually produce viable hybrids at low frequencies, about 1 x 10^"6 to

1 x 10^"8. However, this does not pose a problem, as the viable, fused hybrids are differentiated from the parental, unfused cells (particularly the unfused myeloma cells that would normally continue to divide indefinitely) by culturing in a selective medium. The selective medium is generally one that contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture media. Exemplary and preferred agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis. Where aminopterin or methotrexate is used, the media is supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT medium). Where azaserine is used, the media is supplemented with hypoxanthine.

The preferred selection medium is HAT. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium. The myeloma cells are defective in key enzymes of the salvage pathway, e.g. , hypoxanthine phosphoribosyl transferase (HPRT), and they cannot survive. The B cells can operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells.

This culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired reactivity. The assay should be sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays, dot immunobinding assays, and the like. The selected hybridomas would then be serially diluted and cloned into individual antibody-producing cell lines, which clones can then be propagated indefinitely to provide MAbs. The cell lines may be exploited for MAb production in two basic ways.

A sample of the hybridoma can be injected (often into the peritoneal cavity) into a histocompatible animal of the type that was used to provide the somatic and myeloma cells for the original fusion (e.g., a syngeneic mouse). Optionally, the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection. The injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, can then be tapped to provide MAbs in high concentration. The individual cell lines could also be cultured in vitro, where the MAbs are naturally secreted into the culture medium from which they can be readily obtained in high concentrations.

MAbs produced by either means may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as HPLC or affinity chromatography. Fragments of the monoclonal antibodies of the invention can be obtained from the monoclonal antibodies so produced by methods that include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer.

It is also contemplated that a molecular cloning approach may be used to generate monoclonals. For this, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the spleen of the immunized animal, and phagemids expressing appropriate antibodies are selected by panning using cells expressing the antigen and control cells. The advantages of this approach over conventional hybridoma techniques are that approximately 10⁴ times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies. Alternatively, monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer, or by expression of full-length gene or of gene fragments in E. coli.

VI. Pharmaceutical Compositions and Vaccines The combinations of Borrelial components of the present invention may be used in preventative and treatment embodiments. In both such uses, the components are typically dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. Preferably, the materials are extensively dialyzed to remove undesired small molecular weight molecules and/or lyophilized for more ready formulation into a desired vehicle. The phrases "pharmaceutically or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absoφtion delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incoφorated into the compositions.

The present invention contemplates vaccines for use in both active and passive immunization embodiments. Immunogenic compositions suitable for use as a vaccine may be prepared from the immunogenic proteins and/or peptide epitopes described herein, or the corresponding nucleic acids may be used to express such components in vivo. The preparation of vaccines that contain peptide sequences as active ingredients is generally well understood in the art, as exemplified by U.S. Patents 4,608,251; 4,601,903; 4,599,231 ; 4,599,230; 4,596,792; and 4,578,770, each specifically incoφorated herein by reference. Typically, such vaccines are prepared as injectables, as described immediately below, although other vaccine formulations are known to those of ordinary skill in the art and are further described herein below.

Upon formulation, the pharmaceutical or vaccine formulations will be administered in a manner compatible with the dosage formulation and in such amount as is immunogenic and therapeutically effective. The quantity to be administered depends on the subject to be treated, including, e.g., the capacity of the individual's immune system to synthesize antibodies, and the degree of protection desired. The formulations are easily administered in a variety of dosage forms, such as injectable solutions, drug release capsules and the like. Precise amounts of active ingredient required to be administered will be readily determinable by the skilled practitioner. However, suitable dosage ranges are of the order of several hundred micrograms active ingredient per vaccination. Suitable regimes for initial administration and booster shots are also known in the art and are typified by an initial administration followed by subsequent inoculations or other administrations.

A. Injectables The active compounds will may be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, intralesional, or even intraperitoneal routes. The preparation of an aqueous composition that contains combinations of Borrelial components as active ingredients will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.

The pharmaceutical forms suitable for injectables include immunogenic ingredients mixed with excipients that are pharmaceutically acceptable and compatible with the immunogenic ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the injectable or vaccine may contain minor amounts of auxiliary substances such as wetting or emulsifying agents. pH buffering agents, or adjuvants that enhance the effectiveness of the vaccines.

Sterile aqueous solutions or dispersions for injection include formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The preparation of such compositions that are essentially free from endotoxin can be achieved, for example, as described in U.S. Patent 4,271,147 (incoφorated herein by reference).

Combinations of Borrelial components can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.

The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial ad antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absoφtion of the injectable compositions can be brought about by the use in the compositions of agents delaying absoφtion, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incoφorating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incoφorating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The preparation of more, or highly, concentrated solutions for intramuscular injection is also contemplated.

For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to lOOOmL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035- 1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

In addition to the compounds formulated for parenteral administration, such as intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g., tablets or other solids for oral administration; time release capsules; and any other form currently used, including suppositories, cremes, lotions, mouthwashes, inhalants and the like. For suppositories, traditional binders and carriers may include, for example, polyalkalene glycols or triglycerides. Such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1 -2%.

B. Adjuvants

Various methods of achieving adjuvant effects for the pharmaceuticals and vaccines of the invention may be employed. These include the use of agents such as aluminum hydroxide or phosphate (alum), commonly used as 0.05 to 0.1 percent solution in phosphate buffered saline, admixtures with synthetic polymers of sugars (Carbopol®) used as 0.25% solution, aggregation of the protein in the vaccine by heat treatment with temperatures ranging between about 70°C and about 101°C for 30 second to 2 minute periods, respectively. Aggregation by reactivating with pepsin treated F(ab) antibodies to albumin, mixture with bacterial cells such as C. parvum or endotoxins or lipopolysaccharide components of gram-negative bacteria, emulsion in physiologically acceptable oil vehicles such as mannide monooleate (Aracel-A™) or emulsion with 20 percent solution of a perfluorocarbon (Fluosol-DA™) used as a block substitute may also be employed.

C. DNA Vaccination

Virtually all vaccination regimens of the present invention will be appropriate for use with DNA vectors and constructs in the form of DNA vaccination, e.g., as described by Ulmer et al. (1993), Tang et al. (1992), Cox et al. (1993), Fynan et al. (1993), Wang et al. (1993a, b) and Whitton et al. (1993), each incoφorated herein by reference. In addition to parenteral routes of DNA inoculation, including intramuscular and intravenous injections, mucosal vaccination is also contemplated, as may be achieved by administering drops of DNA compositions to the nares or trachea. It is also contemplated that a gene-gun could be used to deliver an effectively immunizing amount of DNA to the epidermis (Fynan et al, 1993).

It is also contemplated that live antigen delivery systems will be useful in the practice of certain embodiments of the present invention. Examples of these include, but are not limited to, vaccinia virus, poliovirus, Salmonella sp. , Vibrio sp. and Mycobacteria sp. (Edelman, 1997).

D. Liposomes and Nanocapsules In certain embodiments, the inventors contemplate the use of liposomes and/or nanocapsules for the introduction of particular proteins, polypeptides, peptides, nucleic acid segments or antibodies. The formation and use of liposomes is generally known to those of skill in the art (see for example, Couvreur et al. , 1977, which describes the use of liposomes and nanocapsules in the targeted antibiotic therapy of intracellular bacterial infections and diseases). Recently, liposomes were developed with improved serum stability and circulation half-times (Gabizon and Papahadjopoulos, 1988; Allen and Choun, 1987).

Nanocapsules can generally entrap compounds in a stable and reproducible way (Henry-Michelland et al, 1987). To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 μm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles (Couvreur et al, 1977; 1988), which meet these requirements, are contemplated for use in the present invention.

Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles

(MLVs). MLVs generally have diameters of from 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 A, containing an aqueous solution in the core.

In addition to the teachings of Couvreur et al. (1988), the following information may be utilized in generating liposomal formulations. Phospholipids can form a variety of structures other than liposomes when dispersed in water, depending on the molar ratio of lipid to water. At low ratios the liposome is the preferred structure. The physical characteristics of liposomes depend on pH, ionic strength and the presence of divalent cations. Liposomes can show low permeability to ionic and polar substances, but at elevated temperatures undergo a phase transition that markedly alters their permeability. The phase transition involves a change from a closely packed, ordered structure, known as the gel state, to a loosely packed, less-ordered structure, known as the fluid state. This occurs at a characteristic phase-transition temperature and results in an increase in permeability to ions, sugars and drugs.

Liposomes interact with cells via four different mechanisms: Endocytosis by phagocytic cells of the reticuloendothelial system such as macrophages and neutrophils; adsoφtion to the cell surface, either by nonspecific weak hydrophobic or electrostatic forces, or by specific interactions with cell-surface components; fusion with the plasma cell membrane by insertion of the lipid bilayer of the liposome into the plasma membrane, with simultaneous release of liposomal contents into the cytoplasm; and by transfer of liposomal lipids to cellular or subcellular membranes, or vice versa, without any association of the liposome contents. It often is difficult to determine which mechanism is operative and more than one may operate at the same time.

E. Oral Administration

The pharmaceutical compositions disclosed herein may be orally administered, for example, with an inert diluent, excipient or with an assimilable edible carrier. The active combinations may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incoφorated directly with the food of the diet. Oral formulations may include normally employed excipients such as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like.

For oral therapeutic administration, the active compounds may be incoφorated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 95% of the weight of the unit, preferably 25-70%. The amount of active compounds in such therapeutically useful compositions is such that a suitable dosage will be obtained.

The tablets, troches, pills, capsules and the like may also contain the following: a binder, as gum tragacanth, acacia, cornstarch, or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin may be added or a flavoring agent, such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup of elixir may contain the active compounds sucrose as a sweetening agent methyl and propylparabens as preservatives, a dye and flavoring, such as cherry or orange flavor. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compounds may be incoφorated into sustained-release preparation and formulations.

F. Nasal Solutions, Inhalations and Inhalants The administration of the combined agents described herein as nasal solutions or sprays, aerosols, inhalations or inhalants is also contemplated. The range of doses described throughout will generally be suitable, as modified by the attending physician according to the administrative route.

Nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, the aqueous nasal solutions usually are isotonic and slightly buffered to maintain a pH of between about 5.5 and about 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, and appropriate drug stabilizers, if required, may be included in the formulation. Various commercial nasal preparations are known and include, for example, antibiotics and antihistamines used for asthma prophylaxis. Any of the underlying formulations can be adapted or use herewith.

Inhalations and inhalants are pharmaceutical preparations designed for delivering a drug or compound initially into the respiratory tree of a patient. A vapor or mist is administered and reaches the affected area. Inhalations may be administered by the nasal or oral respiratory routes.

The administration of inhalation solutions is most effective if the droplets are sufficiently fine and uniform in size so that the mist reaches the bronchioles. Another group of products, also known as inhalations, and sometimes called insufflations, consists of finely powdered or liquid drugs that are carried into the respiratory passages by the use of special delivery systems, such as pharmaceutical aerosols, that hold a solution or suspension of the drug in a liquefied gas propellant. When released through a suitable valve and oral adapter, a metered dose of the inhalation is propelled into the respiratory tract of the patient.

Particle size is important in the administration of this type of preparation. It has been reported that the optimum particle size for penetration into the pulmonary cavity is of the order of 0.5 to 7 μm. Fine mists are produced by pressurized aerosols and hence their use in considered advantageous.

VII. Therapeutic Kits

Therapeutic kits comprising, in a suitable container, at least a first and a second Borrelial component in a pharmaceutically acceptable formulation represent another aspect of the invention. In a preferred embodiment, the first and second Borrelial component composition is a DbpA and OspA composition, respectively. Borrelial protein compositions may be native Borrelial proteins, truncated Borrelial proteins, site-specifically mutated Borrelial proteins, or Borrelial protein-encoded peptide epitopes, or alternatively antibodies which bind native Borrelial proteins, truncated Borrelial proteins, site-specifically mutated Borrelial proteins, or Borrelial protein-encoded peptide epitopes. The Borrelial component compositions may be nucleic acid segments encoding native Borrelial proteins, truncated Borrelial proteins, site- specifically mutated Borrelial proteins, or Borrelial protein-encoded peptide epitopes. Such nucleic acid segments may be DNA or RNA, and may be either native, recombinant, or mutagenized nucleic acid segments. The Borrelial component compositions may also be antibodies.

The kits may comprise a single container that contains the Borrelial component compositions. The container may, if desired, contain a pharmaceutically acceptable sterile excipient, having associated with it the Borrelial component compositions. The formulation may be in the form of a gelatinous composition, e.g., a collagenous-Borrelial component composition, or may even be in a more fluid form that nonetheless forms a gel-like composition upon administration to the body. In these cases, the container means may itself be a syringe, pipette, or other such like apparatus, from which the Borrelial component composition may be applied to a tissue site, skin lesion, wound area, or other site of borrelial infection. However, the single container means may contain a dry, or lyophilized, mixture of a Borrelial component composition, which may or may not require pre-wetting before use.

Alternatively, the kits of the invention may comprise a distinct container for each component. In such cases, separate or distinct containers would contain the Borrelial component composition, either as a sterile protein or DNA solution or in a lyophilized form. The kits may also comprise a third container for containing a sterile, pharmaceutically acceptable buffer, diluent or solvent. Such a solution may be required to formulate the Borrelial components into a more suitable form for application to the body, e.g., as a topical preparation, or alternatively, in oral, parenteral, or intravenous forms. It should be noted, however, that all components of a kit could be supplied in a dry form (lyophilized), which would allow for "wetting" upon contact with body fluids. Thus, the presence of any type of pharmaceutically acceptable buffer or solvent is not a requirement for the kits of the invention.

The container(s) will generally be a container such as a vial, test tube, flask, bottle, syringe or other container, into which the components of the kit may placed. The Borrelial p component compositions may also be aliquoted into smaller containers, should this be desired. The kits of the present invention may also include material for containing the individual containers in close confinement for commercial sale, such as, e.g., injection or blow-molded plastic containers into which the desired vials or syringes are retained. Irrespective of the number of containers, the kits of the invention may also comprise, or be packaged with, an instrument for assisting with the placement of the Borrelial component compositions within the body of an animal. Such an instrument may be a syringe, pipette, forceps, or any such medically approved delivery vehicle. The following example is included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the example which follows represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1

B. burgdorferi DbpA and OspA Exhibit Vaccine Synergy In Vivo

Vaccination with either of the Borrelia burgdorferi lipoproteins Outer Surface Protein A (OspA), or Decorin Binding Protein A (DbpA), protects mice against experimental infection. DbpA is expressed during the early stages of infection in mice, but OspA is not. This Example shows that vaccinations of mice with both recombinant DbpA and OspA proteins show greater efficacy against dermal challenges with cultured B. burgdorferi than either DbpA or OspA alone. Protective efficacy was evaluated using both challenge dose- and vaccine dose-escalation protocols. All mice immunized with both DbpA and OspA were protected against all challenge doses tested (10³ to 10⁶ spirochetes), while the single antigens gave significant protection only against lower challenge doses. Aluminum-adjuvanted DbpA-OspA combination vaccines outperformed either monovalent vaccine in each of several vaccine dose escalation studies, even showing partial protection at a dose of 80 ng where DbpA or OspA alone were ineffective. DbpA and OspA appear to act synergistically as protective immunogens.

A Materials and Methods

1. B. burgdorferi isolates and culture conditions. A clonal line of B. burgdorferi sensu stricto strain N40 (Barthold et al, 1993) was provided by Stephen Barthold. Uncloned B. burgdorferi Sh-2-82 was provided by Alan Barbour. Uncloned isolates B. garinii G25 and B. afzelii IPF were provided by Russell Johnson. Spirochetes were cultured at 33°C in BSKII medium, and enumerated by darkfield microscopy as previously described (Hanson et al, 1998). B. garinii G25 was cultured at 37°C.

2. Protein antigens. The coding sequences of the mature portions of DbpA and OspA lipoproteins were amplified by polymerase chain reaction from B. burgdorferi N40 template

DNA, cloned into the vector pT7Lpp2 (Hanson et al, 1998) as fusions to the E coli Lpp lipoprotein leader, and expressed in the E. coli host strain BL21(DΕ3)pLysS (Studier et al, 1990). Chimeric lipoprotein Lpp2:OspA_N40 (OspA_N40), expressed from plasmid pWCR141, was purified by ion exchange chromatography (Cassatt et al, 1998). Chimeric lipoprotein Lpp2:DbpA_N40(His)₆ (DbpA_N40) was expressed from plasmid pWCR129 with a carboxy-terminal polyhistidine tag (Hanson et al, 1998). The procedures for culture of

BL21(DE3)pLysS/pWCR129 and extraction of membrane proteins with 3-[(3-cholamidopropyl) dimethylammonio]-l propane-sulfonate (CHAPS) are described below (Hanson et al, 1998; Cassatt et al, 1998).

3. Expression and purification of recombinant proteins. DbpA_N40 (Roberts et al, 1998), and OspA_N40 (Fikrig et al, 1990) were expressed in the E. coli host strain BL21(DE3)pLysS as chimeric lipoproteins from the vector pT7Lpp2 (Hanson et al. , 1998). DNA fragments encoding the entire sequence of the mature proteins after the cysteine at the site of posttranslational modification, were amplified from B. burgdorferi N40 template DNA by PCR using standard reagents and conditions. The following oligonucleotide primer pairs were used for the PCR:

DbpA_N40, 5'-CCGGATCCCGGATTAAAAGGAGAAACAAA-3' (SEQ ID NO:l ; added Bamlil site underlined); and 5 '-CTGTCTAAGCTTAGTCGACGTTA TTTTTGCATTTTTC-3 ' (SEQ ID NO:2; added Hwdlll and Sail sites underlined);

OspA_N40, 5'- CCC jATC£CAAGCAAAATGTTAGCAGCCTT-3^" (SEQ ID NO:3; added BamHl site underlined) and 5'- CGATCGGTCGACCTATTTTAAAGCGTTTTTATT - 3' (SEQ ID NO:4; added Sail site underlined). The amplification products were digested with BamHl and Sail and cloned into the comparable sites of pT7Lpp2 by standard techniques (Sambrook et al, 1989) to yield plasmids pWCR129 expressing Lpp2:DbpA_N40(His)₆ and pWCR141 expressing Lpp2:OspA_N40.

For production of the chimeric lipoproteins the appropriate E. coli clone was grown overnight in LB broth (Sambrook et al, 1989) containing 50 μg/ml kanamycin and 25 μg/ml chloramphenicol. The cells were diluted 1:100 into LB containing 50 μg/ml kanamycin and grown to an A_550nm of 0.8 prior to induction of expression with 1 mM isopropyl β-D-thiogalactopyranoside (IPTG). Cells were induced for 2 hours prior to harvesting at 7000 x g for 10 minutes. Sedimented cells were suspended into 50 mM Tris-HCl, pH 8.0, 5 mM ΕDTA, 1 mM benzamidine, 0.2 mM phenylmethylsulfonyl fluoride (PMSF) and 5 μg/ml aprotinin. The suspension was chilled on ice and cells were lysed by passage through a French pressure cell at 10,000 pounds per square inch (psi). Cellular debris was removed by centrifugation at 8000 x g for 10 minutes. A membrane-enriched fraction was then obtained by centrifugation at 100,000 x g for 1 hour. The pellet from the centrifugation was then suspended into 20 mM NaPO₄, pH 7.4, 100 mM NaCl, 4% 3-[(3-cholamidopropyl) dimethylammonio]-l- propanesulfonate (CHAPS) and incubated with mixing for 1 hour at room temperature. The detergent soluble fraction was obtained following a second centrifugation at 100,000 x g for 1 hour.

The CHAPS extract containing DbpA_N40 was diluted to a final concentration of 10 mM sodium phosphate, pH 8.0, 100 mM NaCl, 10 mM CHAPS (equilibration buffer) and incubated with Ni-NTA Agarose (Qiagen, Valencia, CA) at room temperature. The immobilized metal affinity column with bound protein was washed with equilibration buffer plus 15% (v/v) elution buffer (equilibration buffer plus 250 mM imidazole), then application of a linear 15% to 100% gradient of elution buffer eluted bound DbpA_N40 at -100 mM imidazole. The purified proteins were concentrated by ultrafiltration with a Centricon-30 device (Millipore, Bedford, MA), and dialyzed against phosphate buffered saline, pH 7.4, (PBS), 8 mM CHAPS. The purified proteins were 90-95% homogenous by SDS-PAGΕ (Hanson et al, 1998). An extract of E. coli BL21(DΕ3)pLysS/pT7Lpp2 membrane proteins solubilized in PBS plus 1% (wt./vol.) CHAPS was used as a negative control antigen preparation. The final protein concentration was determined by bicinchoninic acid (BCA) assay (Pierce Chemical Company, Rockford, IL).

Lpp2:OspA_N40 was isolated from strain B21(DE3)pLysS/pWCR141. The cells were grown as described above and the lysate was prepared as above with a change in the suspension buffer to 20 mM NaPO₄, pH 7.4, 10 mM NaCl, 1 mM benzamidine, 0.2 mM PMSF, 4 μg/ml aprotinin, 10 mg/ml RNAse and 5 mg/ml DNAse. The cells were lysed and the membrane enriched fraction was solubilized in 10 mM NaPO₄, pH 7.4, 10 mM NaCl, 5% CHAPS and was isolated as described above. Following removal of insoluble material by centrifugation, the CHAPS-soluble supernatant was applied to a MacroPrep High Q column (2.5 x 4 cm) pre-equilibrated in 10 mM NaPO₄, pH 7.4. 10 mM NaCl, 15 mM CHAPS. The sample was passed over the column and was washed with 2 column volumes of the equilibration buffer. The Lpp2:OspA_N40 in the flow through fraction was adjusted to pH 4.2 with acetic acid, concentrated in a stirred cell concentrator using a PM30 membrane and was buffer exchanged into 20 mM sodium acetate, pH 4.2, 15 mM CHAPS, and the concentrated sample was then applied to a MacroPrep High S column (BioRad; Hercules, CA) (2.5 x 6 cm) column equilibrated in this same buffer. The sample was washed with equilibration buffer followed by a pH gradient from 25 mM sodium acetate, pH 4.2, 50 mM NaCl, 15 mM CHAPS to 25 mM sodium acetate, pH 5.5, 50 mM NaCl, 15 mM CHAPS. Additional protein was eluted from the column by an increase in the NaCl concentration to 150 mM and an increase of the pH to 7.4 with sodium phosphate.

The purified protein was concentrated using a YM10 (Millipore, Bedford, MA) ultrafiltration membrane and the sample was dialyzed against PBS containing 8 mM CHAPS. CHAPS concentrations in the concentrated protein samples was determined by treating the samples in 75% (v/v) sulfuric acid at 70°C for 30 minutes which results in the production of a fluorescent product (Fini et al, 1992). Measurement of the fluorescence was performed using an excitation wavelength of 480 nm and an emission wavelength of 520 nm using a F-2000 fluorescence spectrophotometer (Hitachi, San Jose, CA). Purified protein samples were found to have CHAPS concentrations between 10 and 13 mM. 4. Immunization and challenge of mice. Seven week old female C3H/HeJ mice (The

Jackson Laboratory, Bar Harbor, ME) were used for vaccination and challenge. In one study groups of 20 mice were immunized by intraperitoneal injection of 0.1 ml of an emulsion (1 :1 v/v) of complete Freund's adjuvant and 10 μg DbpA, 10 μg OspA, 5 μg DbpA + 5 μg OspA, or 2.5 μg of E. coli protein extract. Mice were given a second immunization four weeks later with protein in incomplete Freund's adjuvant. At week six, five of the mice in each vaccination group were challenged by subcutaneous injection at the base of the tail with B. burgdorferi from an exponentially growing culture diluted with BSKII to give doses of 10³, 10⁴, 10⁵, or 10⁶ spirochetes in 0.1 ml.

The remaining studies were done using antigens formulated with the aluminum hydroxide adjuvant Alhydrogel® (Superfos Biosector, Kvistgard, Denmark) except for one study evaluating adjuvant-free immunogens. One protocol evaluated AlhydrogeKD-protein formulations with a dose range of 0.08, 0.4, 2.0, or 10 μg DbpA, OspA, or combined DbpA plus OspA, with five mice per group. The second protocol evaluated Alhydrogel®-protein formulations with a dose range of 1.0, or 10 μg DbpA, OspA, or combined DbpA plus OspA, with ten mice per group. A third protocol evaluated Alhydrogel®-protein formulations at a dose of 0.1 μg DbpA, OspA, or DbpA+OspA combined. Mice in negative control groups were vaccinated with 2.5 μg of E. coli protein extract, or 0.025 μg in one study.

Vaccines were prepared by mixing 0.1 volume of Alhydrogel® slurry (2% w/v) with 0.9 volumes of protein diluted to achieve the target dose in 0.1 ml. After incubation for 1 h at room temperature, adsorbed protein was sedimented by centrifugation at 500 x g for 1 min, the supernatant was discarded, and the Alhydrogel®-adsorbed protein was resuspended in PBS to the original volume. Mice were immunized at weeks 0, 4,^' and 8 by subcutaneous injection of 0.1 ml of vaccine in the dorsolateral thorax, and challenged with 10⁴ spirochetes at week 10 near the same site. The study evaluating 0.1 μg doses of immunogen, and the study evaluating adjuvant-free formulations used a three dose immunization schedule at weeks 0, 4, and 19, followed by challenge with B. burgdorferi at week 21. Two weeks after challenge the mice were killed by CO₂ asphyxiation, and samples of the inoculation site skin, blood, ear, urinary bladder, and both tibiotarsal joints were cultured in BSKII plus antibiotics to detect spirochetal infection (Hanson et al, 1998). Mice were scored as infected if any of these five cultures were positive.

5. Immunoassays. An enzyme linked immunosorbant assay (ELISA) was used as previously described (Hanson et al, 1998) to determine the pre-challenge DbpA and OspA IgG endpoint titers of antisera from each mouse, or from antisera pooled from mice within each immunization group.

For determination of borreliacidal activity, the pre-challenge antisera were serially twofold diluted in BSKII, then combined with 10⁵ spirochetes and 20 μl guinea pig complement (ICN Biomedicals. Aurora OH) in 96 well microtiter plate. The 0.2 ml mixtures were incubated for three days at 33°C (Hanson et al, 1998), and spirochete replication was quantified by one of two methods. Direct microscopic counting of spirochetes was used to determine the inhibition endpoint titer (Hanson et al, 1998) for antisera pooled from mice within each vaccination group. In some studies, the ³H adenine metabolic labeling assay (Pavia et al. 1991) was used to determine the dilution of antiserum from each individual mouse giving 50% growth inhibition relative to control wells without antiserum. Preliminary studies showed that 50% inhibition dilutions determined by inhibition of ³H adenine uptake were within one or two dilutions of titration endpoints determined by direct microscopic counting of spirochete numbers.

Routinely, small numbers of spirochetes survived the three day incubation in the lowest dilutions of DbpA or OspA antisera, similar to earlier observations of others using this assay (Sadziene et al.. 1992). To determine whether these survivors were variants resistant to killing by the original antiserum, or whether the borreliacidal activity of the antiserum was merely depleted during the three-day incubation period, these spirochetes were subjected to a second round of antibody incubation. The contents of microtiter well cultures with 1 :100 DbpA antiserum and 1 :2.000 OspA antiserum (dilutions 10-fold below those for 50% inhibition) were pooled, divided into three equal parts, and 1 :100 normal mouse serum, 1 :100 DbpA antiserum, or 1 :2,000 OspA antiserum was freshly added to each part along with 20 μl complement. After incubation for 1 hr. at 33°C, the spirochete-anti serum mixture was combined with molten BSKII agar containing the same antiserum dilution, and overlayed on solidified BSKII agar containing the same antiserum. Colony forming units were counted after incubation of the plates at 33°C for 10 days (Cassatt et al, 1998).

Antigen expression by the spirochetes was also evaluated using an indirect immunofluorescence assay (Cassatt et al, 1998) with pre-challenge antiserum from the mice immunized with DbpA, or OspA, or antiserum from the E. coli- vaccinated mice infected by challenge with 10⁶ spirochetes, as the primary antibody.

6. Enzyme-Linked Immunosorbant Assay (ELISA). Wells of 96-well microtiter plates

(Immulon, Dynatech, Chantilly, VA) were coated with antigen by incubating 50 μl of 1 μg/ml antigen solution in 0.1 M sodium carbonate buffer at pH 9.6. After decanting unbound antigen, additional binding sites were blocked by incubating 200 μl of 3% nonfat milk in wash buffer (PBS, 0.2% Tween 20, pH 7.4). After washing, duplicate serial two-fold dilutions of sera in PBS, Tween 20, 1% fetal bovine serum, were incubated for 1 h, removed, wells were washed three times, and incubated with horseradish peroxidase-conjugated goat anti-mouse IgG. After three washes, bound antibodies were detected with H₂O₂ and [(2,2^"-azino-di-[3- ethylbenzthiazoline sulfonate (6)] (ABTS®, Kirkegaard & Perry Labs, Gaithersburg, MD) and A40₅ was quantified with a Molecular Devices, Coφ. (Menlo Park, CA) Vmax™ plate reader.

B. Results The first study examining the relative efficacy of DbpA-OspA combination vaccines used a fixed dose of immunogen(s) emulsified with Freund's adjuvants and escalating challenge doses of the homologous B. burgdorferi N40 strain. Immunizations with either 10 μg DbpA or OspA elicited strong serum IgG responses in all mice (Table 2). Immunizations with a mixture of DbpA plus OspA at a combined dose of 10 μg elicited levels of serum IgG comparable to immunizations with 10 μg of either protein alone, suggesting a lack of interference between these two immunogens under these formulation conditions. Antisera from mice immunized with DbpA or OspA reacted weakly with E. coli proteins, most likely due to the presence of small amounts of host cell protein impurities in the recombinant immunogens.

The antisera from all mice immunized with either DbpA or OspA, or the combination of both proteins, inhibited the in vitro growth of B. burgdorferi. Interestingly, the combined vaccine elicited antiserum that was not significantly different (p = 0.43, two-tailed students t- test) in potency in vitro (50% inhibition titer) than antiserum to OspA alone. The in vitro potency of the antisera from DbpA-immunized mice was about 20-fold lower, and antisera from E. co//-immunized mice were not borreliacidal. DbpA is expressed at much lower levels than OspA in vitro (Hanson et al, 1998; Cassatt et al, 1998) explaining, at least in part, the lower in vitro potency of DbpA antiserum.

Table 2 Comparison of the immunogenicity and in vitro potency of antisera from mice vaccinated with DbpA and OspA, singly, and in combination, and their protective efficacy against_challenge with escalating B. burgdorferi N40 doses

Mice infected at

Antiserum geometric mean titer⁵* challenge dose of:

50% Growth

Immunogen (dose) DbpA IgG OspA IgG inhibition 10³ 10⁴ 10⁵ 10⁶

DbpA (10 μg) 1,910,852 500 2,263 0/5 0/5 2/5 2/5

OspA (10 μg) 966 4,389,984 67,559 0/5 1/5 3/5 5/5

DbpA (5 μg) + OspA (5μg) 2,048,000 4,389,984 53,006 0/5 0/5 0/5 0/5

E. coli extract (2.5 μg) 3,364 27,858 <50⁺ 5/5 5/5 5/5 5/5

* Values are the geometric means of the 20 mice in each immunization group ^f No inhibition at lowest dilution tested (1 :50)

Nearly all mice immunized with either DbpA or OspA were completely protected from challenge with 10³ or 10⁴ spirochetes (Table 2), as expected from earlier observations of the inventors (Hanson et al, 1998). Mice immunized with OspA alone were only partially protected against a challenge dose of 10⁵ spirochetes, and all OspA-immunized mice challenged with 10⁶ spirochetes became infected. DbpA immunity was only partially protective against the two highest challenge doses. However, all mice immunized with the combined DbpA-OspA vaccine were protected against even the highest challenge dose. The 10⁶-challenge inoculum is at least 3,000 times higher than the median infectious dose (ID₅₀) of approximately 3 x 10² determined previously by the inventors (Hanson et al, 1998) for this B. burgdorferi strain using the same mouse strain and inoculation site as in the present study. At each challenge dose, all mice vaccinated with the E. coli extract were infected, with at least three of the five tissues culture-positive for B. burgdorferi.

Missense, nonsense, and deletion mutations in the ospA gene arise spontaneously at high frequency in vitro, with resistance to the borreliacidal action of the OspA monoclonal antibody H5332 arising at a frequency of 10^"4 to 10^"5 (Sadziene et al, 1992). The inventors next determined whether the rare spirochetes surviving antisera from DbpA- and OspA-immunized mice (Table 2) remained resistant upon reexposure to the original selecting antiserum, and also whether they were sensitive to the antiserum directed to the complementary specificity not used in the initial incubation.

The viable counts of antiserum-resistant spirochetes reexposed to the same antiserum used for the initial selection were similar to those incubated with normal mouse serum (Table 3). However, the majority of spirochetes surviving the initial OspA antiserum treatment were susceptible to killing by DbpA antiserum, and vice-versa (Table 3). By immunofluorescence assay, the spirochetes that survived growth in DbpA antiserum were labeled with, and agglutinated by, OspA antiserum, but their labeling with DbpA antiserum was at background levels. The converse was true for spirochetes surviving growth in OspA antiserum. Infected mouse antiserum labeled and agglutinated all spirochetes. Table 3

Spontaneously arising variants of B. burgdorferi selected by resistance to either DbpA or OspA antiserum remain sensitive to the antiserum not used for selection

Spirochetes surviving* second round incubation with: NMS¹, DbpA antiserum, OspA antiserum,

Initial selection with: 1 :100 1 :100 1 :2,000

DbpA antiserum, 1 :100 Ϊ47 Ϊ28* 2

OspA antiserum, 1 :2,000 64 7 50 * Colony forming units on BSKII agarose supplemented with the indicated antiserum. Values are the means of triplicate platings. ⁺ NMS: normal mouse serum. ^% Mean of duplicate platings.

Next, the relative efficacy of DbpA-OspA combinations formulated with Alhydrogel®, an adjuvant approved for use in humans, was evaluated. All single component and DbpA-OspA combination vaccines formulated with this adjuvant were immunogenic at all four dose levels in the escalating dose range (Table 4). Although the IgG titers of mice immunized with Alhydrogel® formulations were lower than those elicited by the same dose antigen(s) formulated with Freund's adjuvant, the in vitro potencies of the antisera were similar between the two formulations. The antisera from all mice immunized with Alhydrogel® formulations of either DbpA or OspA, or the combination of both proteins, inhibited the in vitro growth of B. burgdorferi.

The relative in vitro potency of the antisera tended to show a vaccine dose-dependency relationship, with growth inhibition titers of the OspA antisera being 5- to 20-fold higher than those of DbpA antisera. As before, the growth inhibition titers of antisera from mice immunized with both antigens were similar to the titers of antisera from mice immunized with the same amount of OspA alone. The single antigen vaccines conferred protection against challenge with 10⁴ B. burgdorferi N40 only at the highest dose of 10 μg. However, the DbpA-OspA combination vaccines gave significant protection at both the 10 μg and 2 μg vaccination doses. Partial protection (3 of 5 mice protected) was seen with the combination vaccines even at lowest dose of 80 ng.

Table 4

Comparison of the immunogenicity and in vitro potency of antisera from mice vaccinated with escalating doses DbpA and OspA, singly, and in combination, and their protective efficacy against challenge with B. burgdorferi N40

Immunogen(s) Dose (μg) Growth inhibition titer^f Infection prevalence P value⁴

DbpA 10 2,560 0/5 0.004

2 320 4/5 0.5

0.4 160 4/5 0.5

0.08 40 5/5 1.0

OspA 10 12,800 0/5 0.004

2 6,400 3/5 0.22

0.4 2,560 5/5 1.0

0.08 640 5/5 1.0

DbpA+OspA 5+5 12,800 0/5 0.004

1+1 6,400 1/5 0.024

0.2+0.2 1,280 2/5 0.083

0.04+0.04 640 2/5 0.083

E coli 2.5 <40 5/5 n.a.

None n.a.* n.d. * 5/5 n.a. * n.a.: not applicable.

⁺ Values are the means of duplicate determinations on antisera pooled from the ten mice within each immunization group. ^ϊ n.d.: not determined. Fishers exact test; experimental group vs. E. coli negative control group. Immunization with the 2 μg dose regimen using the combined vaccine (1 μg DbpA plus 1 μg OspA) on Alhydrogel® was protective while the 2 μg dose of either antigen alone was not. This suggested that the enhanced efficacy of the combination was not simply due to an additive effect of the immunogens. To confirm and extend these observations, larger groups of mice were used to examine the relative efficacy of single antigen and combination vaccines at low and high doses. All ten mice immunized with the 10 μg high dose regimen of either single antigen or combination vaccine were protected against the homologous challenge with the B burgdorferi N40 strain (Table 5). Most of the mice immunized with the 1 μg low dose regimen of the combination vaccine were protected, but only a few mice immunized with 1 μg DbpA or OspA were protected. Again, the DbpA-OspA combination vaccine elicited significant protection at a dose level where the single antigen vaccines were partially protective.

Table 5

Comparison of the relative protective efficacy of vaccinations with DbpA and OspA singly, and in combination at either of two dose levels, against homologous challenge with B. burgdorferi N40

Immunogen(s) Dose (μg) Growth inhibition titer* Infection prevalence P value¹

DbpA 10 1,600 1/10 0.00006

1 200 6/10 0.043

OspA 10 12,800 0/10 0.000005

1 3,200 7/10 0.1

DbpA+OspA 5+5 6,400 0/10 0.000005

0.5+0.5 3,200 2/10 0.0003

E coli 2.5 <50 10/10 n.a.^J

* Values are the means of duplicate determinations on antisera pooled from the ten mice within each immunization group. ⁺ Fishers exact test; experimental group vs. E. coli negative control group. ^J n.a.: not applicable. Next, the relative efficacy of single antigen and combination vaccines were studied at low and high doses against challenge with the 10⁴ cells of the heterologous B. burgdorferi Sh-2- 82 isolate, a dose 17 times higher than the ID₅₀ of approximately 6 x 10² previously determined (Hanson et al, 1998). OspA from isolate Sh-2-82 (Rosa et al. 1992) shares 99.6% sequence identity (Myers and Miller, 1988) with the OspA immunogen derived from strain N40, but DbpA from Sh-2-82 (Roberts et al, 1998) has only 65.6% sequence identity with the DbpA_N40 immunogen.

Vaccinations with either low or high doses of OspA_N40 alone protected very few mice from challenge with the heterologous Sh-2-82 isolate (Table 6). Vaccinations with DbpA_N40 alone did not prevent infection in any mouse, although evidence of disseminated infection was absent in seven of ten mice immunized with 10 μg doses of DbpA. The poor efficacy of the single antigen vaccines against the heterologous challenge was somewhat suφrising since the in vitro potencies of the antisera (Table 6) were nearly identical to those against the homologous N40 strain (Table 5). However, all ten mice immunized with either low or high doses of the DbpA-OspA combination vaccine were protected against challenge with the Sh-2-82 isolate.

Table 6

Comparison of the relative protective efficacy of vaccinations with DbpA and OspA singly, and in combination at either of two dose levels, against heterologous challenge with B. burgdorferi Sh-2-82

Immunogen Dose (μg) Growth inhibition titer* Infection prevalence P value

DbpA 10 1,600 10/10 1.0

1 200 10/10 1.0 OspA 10 12,800 6/10 0.043 1 3,200 9/10 0.5

DbpA+OspA 5+5 12,800 0/10 0.000005 0.5+0.5 3,200 0/10 0.000005 E. coli 2.5 <50 10/10 n.a.^J

* Values are the means of duplicate determinations on antisera pooled from the ten mice within each immunization group.

¹ Fishers exact test; experimental group vs. E. coli negative control group.

^.a.: not applicable.

Next, the relative efficacy of single antigen and combination vaccines were studied at low and high doses against challenge with 10⁵ cells of the heterologous B. garinii G25 isolate, a dose 20 times higher than the ID₅₀ of approximately 5 x 10³. OspA from isolate G25 (Godfroid et al, 1995) shares 80.7% sequence identity with the OspA immunogen derived from strain N40, and DbpA from G25 has only 53.3% sequence identity with the DbpA_N40 immunogen.

Vaccinations with either low or high doses of OspA_N40 alone protected 7 or 5 mice, respectively, from challenge with the heterologous G25 isolate (Table 7). Vaccinations with DbpA_N40 alone also gave only partial protection. However, the majority of mice immunized with either low or high doses of the DbpA-OspA combination vaccine were protected against challenge with the G25 isolate. The relatively high level of efficacy of the combination vaccine, comprised of antigens derived from B. burgdorferi strain N40, against challenge with a heterologous species of Lyme disease spirochete, B. garinii isolate G25, was suφrising and unexpected due to the substantial amount of divergence in the sequence identities between the vaccine antigens and the target organism.

Table 7

Comparison of the relative protective efficacy of vaccinations with DbpA and OspA singly, and in combination at either of two dose levels, against heterologous challenge with B. garinii G25

Immunogen Dose (μg) Growth inhibition titer* Infection prevalence P value¹

DbpA 10 200 6/10 0.043

1 n.d.¹ 8/10 0.24

OspA 10 800 5/10 0.016

1 n.d. 7/10 0.1

DbpA+Osp_ \ 5+5 3,200 2/10 0.00036

0.5+0.5 n.d. 3/10 0.0016

E. coli 2.5 <50 10/10 n.a.^§

* Values are the means of duplicate determinations on antisera pooled from the ten mice within each immunization group. ^f Fishers exact test; experimental group vs. E. coli negative control group.

* n.d.: not determined. ^§ n.a.: not applicable.

The relative efficacy of single antigen and combination vaccines were next studied at low and high doses against challenge with 10^"' cells of the heterologous B. afzelii IPF isolate, a dose 5 times higher than the ID₅₀ of approximately 2 x 10⁴. DbpA from isolate IPF (Roberts et al, 1998) has only 33.7% sequence identity with the DbpA_N40 immunogen. The OspA sequence from isolate IPF, and its identity with the DbpA_N40 immunogen, is not known, but others have reported OspA sequence identities between B. burgdorferi and B. afzelii isolates on the order of 75% to 78% (Will et al, 1995). Vaccinations of mice with either low or high doses of OspA_N40 or DbpA_N40 alone gave no significant protection from challenge with the heterologous IPF isolate (Table 8). However, the DbpA_N40-OspA_N40 combination vaccine at the lOμg dose gave significant, albeit partial protection against challenge with the IPF isolate.

Table 8

Comparison of the relative protective efficacy of

Vaccinations with DbpA and OspA singly, and in combination at either of two dose levels, against heterologous challenge with B. afzelii IPF

Immunogen Dose (μg) Growth Infection P value inhibition titer* prevalence

DbpA 10 200 10/10 0.5

1 n.d.¹ 9/10 0.53

OspA 10 800 7/10 0.25

1 n.d. 9/10 0.53

DbpA+OspA 5+5 800 4/10 0.027

0.5+0.5 n.d. 7/10 0.25

E. coli 2.5 <50 9/10 n.a.^§

⁺ Fishers exact test; experimental group vs. E. coli negative control group. * n.d.: not determined. ^§ n.a.: not applicable.

It is likely that the efficacy of DbpA_N40-OspA_N40 combination vaccines against challenge with heterologous B. burgdorferi sensu lato species would be even higher if DbpA or OspA antigens from additional isolates were included. Practical considerations, and possibly immunological considerations as well, would limit the mass of each component in such a multivalent vaccine for human or veterinary use. The inventors therefore investigated whether the dose of the DbpA_N40-OspA_N40 combination vaccine could be reduced even further and still provide protection. Mice were vaccinated twice with 100 ng of DbpA_N40 or OspA_N40, or with 50 ng of each immunogen, in an Alhydrogel-adsorbed formulation and given a third immunization after their serum IgG against the immunogens dropped 4-fold from peak levels. Immunization with 50 ng each of DbpA_N40 and OspA_N40 (Table 9) provided the same level of protection against homologous challenge (10⁴ B. burgdorferi N40) as 10-fold higher doses of this combination (Table 5), while 100 ng doses of the single antigen vaccines were ineffective.

Table 9

Comparison of the relative protective efficacy of immunizations with DbpA and OspA singly, and in combination at a 0.1 μg dose level with Alhydrogel, against homologous challenge with B. burgdorferi N40

Immunogen(s) Dose (μg) Growth Infection P value* inhibition titer* prevalence

DbpA 0.1 50 6/9 0.087

OspA 0.1 1,600 8/10 0.24

DbpA+OspA 0.05+0.05 1,600 2/10 0.00036

E. coli 0.025 <50 10/10 n.a.¹

⁺ Fishers exact test; experimental group vs. E. coli negative control group.

* n.a.: not applicable.

It has been observed that mice immunized with the lipoprotein form of OspA in the absence of adjuvant can be protected from challenge with a homologous B. burgdorferi isolate (Εrdile et al, 1993). Accordingly, the inventors investigated whether adjuvant-free formulations of DbpA_N40, OspA_N40, and DbpA_N40-OspA_N40 combination vaccines would protect against homologous challenge with B. burgdorferi strain N40. Mice were vaccinated twice with 1 μg or 10 μg of DbpA_N40 or OspA_N40, or with DbpA_N40+OspA_N40 in an adjuvant-free formulation and given a third immunization after their serum IgG against the immunogens dropped 4-fold from peak levels. The high dose level of the single immunogen and the DbpA_N40+OspA_N40 combination vaccines all gave significant protection against challenge with strain N40, and the DbpA_N40+OspA_N40 combination vaccine gave significant protection at the lower dose level as well (Table 10). Importantly, the protective efficacies of the DbpA_N40, OspA_N40, and DbpA_N40+OspA_N40 combination vaccines in the absence of adjuvant were comparable to the Alhydrogel formulations of these immunogens at the same dose level (Table 5).

Table 10

Comparison of the relative protective efficacy of immunizations with

DbpA and OspA singly, and in combination at either of two dose levels in the absence of adjuvant, against homologous challenge with B. burgdorferi N40

Immunogen Dose (μg Infection prevalence P value

DbpA 10 3/10 0.0024

1 10/10 1.0

OspA 10 1/10 0.0001 1

1 1 4/5 0.34

DbpA+OspA 5+5 0/10 0.00001

0.5+0.5 1/10 0.0001 1

E. coli 2.5 9/9 n.a.*

⁺ Fishers exact test; experimental group vs. E. coli negative control group. ^J n.a.: not applicable.

The synergistic effect of co-formulation of DbpA and OspA vaccines can be explained by several possible mechanisms. B. burgdorferi N40 and Sh-2-82 express both OspA and DbpA under standard culture conditions, and antibodies against either of these proteins are borreliacidal in vitro. Also, challenge doses of >10⁵ cloned B. burgdorferi N40 exceeded the protective capacity of OspA immunization in C3H mice, allowing recovery of ospA escape mutants from the infected OspA-immunized mice (Fikrig et al, 1995a). B. burgdorferi variants resistant to OspA antibodies may not be merely a phenomenon of in vitro culture. Evidence exists that, in at least one case, a spirochete with an ospA frame shift mutation conferring resistance to a borreliacidal OspA monoclonal antibody was transmitted to a Lyme disease patient (Fikrig et al, 1995b).

The inventors have shown herein above that OspA antibody-resistant variants of cloned N40 remained sensitive to killing by DbpA antibodies, and vice versa (Table 3). Without being held to any particular theory, the higher efficacy of the combination vaccine may be due to, at least in part, its ability to protect against infection by B. burgdorferi variants resistant to either OspA or DbpA antibodies alone. While variants of B. burgdorferi that are resistant to killing by antibodies against both these surface proteins are theoretically possible (Sadziene et al. , 1992), such variants are likely to be rare, and may not be capable of maintaining the normal transmission cycle in the natural reservoir.

The combination DbpA-OspA vaccines were highly effective against challenge with both the homologous B. burgdorferi N40 strain and the heterologous Sh-2-82 and B. garinii G25 isolates while the single antigen vaccines were highly efficacious only against the homologous challenge. The Sh-2-82 and B. garinii G25 isolates used were not cloned, and it is possible that these cultures contain more variants resistant to either DbpA or OspA antibodies than cultures of the cloned strain N40. It is likely that the uncloned strain more closely approximate the situation of natural infection. The frequency of borreliae that labelled weakly with DbpA or OspA antibodies in an immunofluorescence assay was greater for Sh-2-82 than for N40.

The antisera from the mice uniformly protected by immunization with the combination

DbpA-OspA vaccines and the antisera from the partially protected OspA-immunized mice had comparable in vitro potencies, suggesting that protection in the DbpA-OspA groups can not be wholly explained by direct antibody-mediated inactivation of the inoculum. The higher efficacy of the combination DbpA-OspA vaccines over OspA alone may also have been due to sustained vulnerability to DbpA antibodies by those spirochetes that adapt most rapidly to the mammalian environment.

These studies show that DbpA and OspA act synergistically as vaccines against experimental infection in the mouse model. These studies also suggest that the DbpA-OspA combination vaccines have higher efficacy than OspA alone against the natural tick-borne route of infection as well.

All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods, and in the steps or in the sequence of steps of the methods described herein, without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incoφorated herein by reference.

Allen and Choun, "Large Unilamellar Liposomes with Low Uptake into the Reticuloendothelial System," FEBS Lett., 223:42-46, 1987.

Barbour, Tessier and Todd, "Lyme Disease Spirochetes and Ixodid Tick Spirochetes Share a Common Surface Antigenic Determinant Defined by a Monoclonal Antibody," Infect.

Immun. 41 :795-804, 1983.

Barthold and Bockenstedt, "Passive immunizing activity of sera from mice infected with Borrelia burgdorferi," Infect. Immun., 61 :4696-4702, 1993.

Barthold et al, "Circumvention of outer surface protein A immunity by host-adapted Borrelia burgdorferi," Infect. Immun., 63:2255-2261, 1995b.

Barthold et al, "Kinetics of Borrelia burgdorferi Dissemination and Evolution of Disease After Intradermal Inoculation of Mice," Am. J. PathoL, 139:263-273, 1991.

Barthold et al, "Lyme borreliosis in the Laboratory Mouse," In: Lyme Disease: Molecular and Immunology Approaches, S. E. Schutzer (ed.), Cold Spring Harbor Press, Plainview, N.Y., p. 223-242, 1992.

Barthold, deSouza and Feng, "Serum-mediated resolution of Lyme arthritis in mice," Lab. Invest. 74:57-67, 1996.

Barthold, deSouza, Janotka, Smith and Persing, "Chronic Lyme borreliosis in the laboratory mouse," Am. J. PathoL 143:959-971, 1993.

Barthold, Fikrig, Bockenstedt and Persing, "Circumvention of Outer Surface Protein A Immunity by Host- Adapted Borrelia burgdorferi," Infect. Immun. 63:2255-2261, 1995a.

Bockenstedt, Hodzic, Feng, Bourrel, de Silva, Montgomery, Fikrig, Radolf and Barthold,

"Borrelia burgdorferi Strain-Specific Osp C-Mediated Immunity in Mice," Infect. Immun. 65:4661-4776, 1997.

Bolivar et al, "Construction and characterization of new cloning vehicles. II. A multipuφose cloning system," Gene, 2:95-113, 1977. Campbell, "Monoclonal Antibody Technology, Laboratory Techniques in Biochemistry and Molecular Biology," Vol. 13, Burden and Von Knippenberg, Eds. pp. 75-83, Elsevier, Amsterdam, 1984.

Carter et al, "Improved oligonucleotide site-directed mutagenesis using Ml 3 vectors," Nucl

Acids Res., 13:4431-4443, 1985.

Cassatt, Patel, Ulbrandt and Hanson, "DbpA, but not OspA, is expressed by Borrelia burgdorferi during spirochetemia and is a target for protective antibodies," Infect. Immun. 66:5379- 5387, 1998.

Chang et al, "Phenotypic expression in E. coli of a DNA sequence coding for mouse dihydrofolate reductase," Nature, 275:617-624, 1978.

Chang, Jacobson, Haφending, Straubinger, Patrican, Mohammed and Summers, "Recombinant

OspA protects dogs against infection and disease caused by Borrelia burgdorferi," Infect. Immun. 63:3543-3549, 1995.

Cherry, "Comparative efficacy of acellular pertussis vaccines: an analysis of recent trials," J. Pediatr. Infect. Dis. 16 : S90-S96, 1997.

Chou and Fasman, "Conformational Parameters for Amino Acids in Helical, .beta.-Sheet, and Random Coil Regions Calculated from Proteins," Biochemistry, 13:211-222, 1974b.

Chou and Fasman, "Empirical Predictions of Protein Conformation," Ann. Rev. Biochem.,

47:251-276, 1978.

Chou and Fasman, "Prediction of β-Turns," Biophys. J., 26:367-384, 1979.

Chou and Fasman, "Prediction of Protein Conformation," Biochemistry, 13:222-245, 1974a.

Couvreur et al, "Nanocapsules, a New Lysosomotropic Carrier," FEBSLett., 84:323-326, 1977.

Couvreur, "Polyalkyleyanoacrylates as Colloidal Drug Carriers," Crit. Rev. Ther. Drug Carrier Syst., 5:1-20, 1988.

Cox et al, J. Virol, "Bovine heφesvirus 1 : immune responses in mice and cattle injected with plasmid DNA," 67:5664-5667, 1993.

de Silva, Telford, Brunet, Barthold and Fikrig, "Borrelia burgdorferi OspA is an arthropod- specific transmission-blocking Lyme disease vaccine," J. Exp. Med. 183:271-275, 1996.

de Silva, Zeidner, Zhang, Dolan, Piesman and Fikrig, "Influence of outer surface protein A antibody on Borrelia burgdorferi within feeding ticks," Infect. Immun. 67:30-35, 1999. Duray, "Target Organs of Borrelia burgdorferi Infections: Functional Responses and Histology," In: Lyme Disease: Molecular and Immunologic Approaches, S. E. Schutzer (ed.), Cold Spring Harbor Press, Plainview, N.Y., p. 11-30, 1992.

Erdile et al, "Role of attached lipid in immunogenicity of Borrelia burgdorferi OspA," Infect. Immun. 61(l):81-90, 1993.

Edelman, New Generation Vaccines (Levine, M.M., Woodrow, G.C., Kaper, J.B., and Cobon, G.S., Eds.) Second Edition, Revised and Expanded edition. Marcel Dekker, Inc., New

York. pp. 897-912, 1997.

Feng, Hodzic, Stevenson and Barthold, "Humoral Immunity to Borrelia burgdorferi N40 Decorin Binding Proteins during Infection of Laboratory Mice," Infect. Immun. 66:2827- 2835, 1998.

Fiers et al, "Complete nucleotide sequence of SV40 DNA," Nature, 273:113-120, 1978.

Fikrig et al, "Vaccination against Lyme disease caused by diverse Borrelia burgdorferi," J. Exp. Med., 181 :215-221, 1995c.

Fikrig, Barthold, Kantor and Flavell, "Protection of Mice Against the Lyme Disease Agent by Immunizing with Recombinant OspA," Science 250:553, 1990.

Fikrig, Barthold, Sun, Feng, Telford and Flavell, "Borrelia burgdorferi P35 and P37 Proteins,

Expressed in vivo, Elicit Protective Immunity," Immun. 6:531-539, 1997.

Fikrig, Lui, Fu, Das, Smallwood, Flavell, Persing, Schoen, Barthold and Malawista, "An ospA Frame Shift, Identified from DNA in Lyme Arthritis Synovial Fluid, Results in an Outer Surface Protein A that Does Not Bind Protective Antibodies," J. Immunol. 155:5700-

5704, 1995b.

Fikrig, Tao, Barthold and Flavell, "Selection of variant Borrelia burgdorferi isolates from mice immunized with outer surface protein A or B," Infect. Immun. 63:1658-1662, 1995a.

Fikrig, Telford, Barthold, Kantor, Spielman and Flavell, "Elimination of Borrelia burgdorferi from vector ticks feeding on OspA-immunized mice," Proc. Natl Acad. Sci. USA 89:5418-5421, 1992.

Fini, Fazio, Tonelli, Roda and Zuman, "Chemical Properties of Bile Acids. V. Interaction with

Concentrated Sulfuric Acid," Farmaco 47:741-752, 1992.

Fynan et al, "DNA vaccines: protective immunizations by parenteral, mucosal, and gene gun inoculations," Proc. Natl. Acad. Sci. USA, 90:11478-11482, 1993. Gabizon and Papahadjopoulos, "Liposomes formulations with prolonged circulation time in blood and enhanced uptake by tumors," Proc. Natl. Acad. Sci. USA, 85:6949-6953, 1988.

Godfroid, Ben Messaoud, Poliszczak, Lobet and Bollen, "Assignment of Borrelia burgdorferi strains G25 and VS461 to the Borrelia garinii and Borrelia afzelii genespecies, respectively: a comparison of OspA protein sequences," DNA Seq. 5:251-254, 1995.

Goding, "Monoclonal Antibodies: Principles and Practice," pp. 60-74. 2nd Edition, Academic Press, Orlando, Fla., 1986.

Goeddel et al, "Direct expression in Escherichia coli of a DNA sequence coding for human growth hormone," Nature, 281 :544-548, 1979.

Goeddel et al. "Synthesis of human fibroblast interferon by E. coli," Nucl Acids Res., 8:4057-

4074, 1980.

Hagman. Lahdenne, Popova, Porcella, Akins, Radolf and Norgard, "Decorin-Binding Protein of Borrelia burgdorferi is Encoded within a Two-Gene Operon and Is Protective in the Murine Model of Lyme Borreliosis," Infect. Immun. 66:2674-2683, 1998.

Hansen, Bangsborg, Fjordvang, Pedersen and Hindersson, "Immunochemical characterization of and isolation of the gene for a Borrelia burgdorferi immunodominant 60-kilodalton antigen common to a wide range of bacteria," Infect. Immun. 56:2047-2053, 1988.

Hanson, Cassatt, Guo, Patel, McCarthy, Dorward and Hook, "Active and Passive Immunity against Borrelia burgdorferi Decorin Binding Protein A (DbpA) Protects against Infection," Infect. Immun. 66:2143-2153, 1998.

Harlow and Lane, "Antibodies: a Laboratory Manual," Cold Spring Harbor Laboratory, Cold

Spring Harbor, N.Y. 1988.

Haupl et al. "Persistence of Borrelia burgdorferi in Ligamentous Tissue From a Patient With Chronic Lyme borreliosis," Arthritis Rheum., 36:1621-1626, 1993.

Henry-Michelland et al, "Attachment of Antibiotics to Nanoparticles; Preparation, Drug-Release and Antimicrobial Activity in vitro, "Int. J. Pharm., 35:121-127, 1987.

Hess et al, J. Adv. Enzyme Reg., 7:149, 1968.

Hitzeman et al, "Isolation and characterization of the yeast 3-phosphoglycerokinase gene (PGK) by an immunological screening technique," J. Biol Chem., 255:12073-12080, 1980. Ho et al, "Site-Directed Mutagenesis by Overlap Extension Using the Polymerase Chain Reaction," Gene, 77:51-59, 1989.

Holland et al, "Isolation and identification of yeast messenger ribonucleic acids coding for enolase, glyceraldehyde-3 -phosphate dehydrogenase, and phosphoglycerate kinase," Biochemistry, 17:4900-4907, 1978.

Itakura et al, "Expression in Escherichia coli of a chemically synthesized gene for the hormone somatostatin," Science, 198:1056-1063, 1977.

Jameson and Wolf, "The antigenic index: a novel algorithm for predicting antigenic determinants," Compu. Appl Biosci., 4:181-186, 1988.

Jauris-Heipke et al., "Ospl7, a novel immunodominant outer surface protein of Borrelia afzelii: recombinant expression in Escherichia coli and its use as a diagnostic antigen for serodiagnosis of Lyme borreliosis," Med. Microbiol Immunol, 187(4):213-219, 1999.

Johnson, Sviat, Happ, Dunn, Frantz, Mayer and Piesman, "Incomplete protection of hamsters vaccinated with unlipidated OspA from Borrelia burgdorferi infection is associated with low levels of antibody to an epitope defined by mAb LA-2," Vaccine 13:1086-1094,

1995.

Jones, "Proteinase mutants of Saccharomyces cerevisiae," Genetics, 85:23-33 1977.

Kingsman et al. "Replication in Saccharomyces cerevisiae of plasmid pBR313 carrying DNA from the yeast tφl region," Gene, 7: 141-152, 1979.

Kohler and Milstein, "Continuous cultures of fused cells secreting antibody of predefined specificity," Nature, 256:495-497, 1975.

Kohler and Milstein, "Derivation of specific antibody-producing tissue culture and tumor lines by cell fusion," Eur. J. Immunol, 6:51 1-519, 1976.

Kuby, "Immunology" 2nd Edition. W. H. Freeman & Company, New York. 1994.

Kyte and Doolittle, "A simple method for displaying the hydropathic character of a protein," J. Mol. Biol.. 157:105-132, 1982.

Lovrich et al, "Abilities of OspA proteins from different seroprotective groups of Borrelia burgdorferi to protect hamsters from infection," Infect. Immun., 63:21 13-21 19, 1995.

Maloy et al, "Microbial Genetics" 2nd Edition. Jones and Bartlett Publishers, Boston, Mass., 1994. Maniatis et al, "Molecular Cloning: a Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982.

Myers and Miller, "Optimal alignments in linear space," Comput. Appl Biosci. 4:1 1-17, 1988.

Pavia, Kissel, Bittker, Cabello and Levine, "Antiborrelial Activity Serum from Rats Injected with the Lyme Disease Spirochete," J. Infect. Dis. 163:656-659, 1991.

PCT Patent Application WO 97/27301

Philipp, Lobet, Bohn, Roberts, Dennis, Gu, Lowrie, Desmons, Duray, England, Hauser, Piesman and Xu, "The outer surface protein A (OspA) vaccine against Lyme disease: efficacy in the rhesus monkey," Vaccine 15:1872-1887, 1997.

Probert and LeFebvre, 95th Gen. Mtg. Am. Soc. Microbiol, Abstr. #E-56, 1995.

Probert, Crawford, Cadiz and LeFebvre, "Immunization with Outer Surface Protein (Osp) A, but not OspC, provides cross-protection of mice challenged with North American isolates of Borrelia burgdorferi," J. Infect. Dis. 175:400-405, 1997.

Prokop and Bajpai, "Recombinant DNA Technology I" Ann. N.Y. Acad. Sci., Vol. 646, 1991.

Roberts, Mullikin, Lathigra and Hanson, "Molecular analysis of sequence heterogeneity among genes encoding decorin binding proteins A and B of Borrelia burgdorferi sensu lato," Infect. Immun. 66:5275-5285, 1998.

Rosa, Schwan and Hogan, "Recombination between genes encoding major outer surface proteins A and B of Borrelia burgdorferi," Molec. Microbiol. 6:3031-3040, 1992.

Sadziene, Rosa, Thompson, Hogan and Barbour, "Antibody-resistant Mutants of Borrelia burgdorferi: In vitro selection and Characterization," J. Exp. Med. 176:799-809, 1992.

Sadziene, Thomas and Barber, "Borrelia burgdorferi mutant lacking Osp: Biological and immunological characterization," Infect. Immun. 63:1573-1580, 1995.

Sambrook, Fritsch and Maniatis, Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989.

Schaible et al, "Immune sera to individual Borrelia burgdorferi isolates or recombinant OspA thereof protect SCID mice against infection with homologous strains but only partially or not at all against those of different OspA/OspB genotype," Vaccine, 1 1 : 1049-1054, 1993. Schaible et al, "Monoclonal antibodies specific for the outer surface protein A (OspA) of Borrelia burgdorferi prevent Lyme borreliosis in severe combined immunodeficiency (scid) mice," Proc. Natl. Acad. Sci. USA, 87:3768-3772, 1990.

Schwan et al, "Induction of an outer surface protein on Borrelia burgdorferi during tick feeding,"

Proc. Natl. Acad. Sci. USA, 92:2909-2913, 1995.

Segal, "Biochemical Calculations" 2nd Edition. John Wiley and Sons, New York, 1976.

Sigal, Zahradnik, Lavin, Patella, Bryant, Haselby, Hilton, Kunkel, Adler-Klein, Doherty, Evans,

Malawista and The Recombinant Outer-Surface Protein A Lyme Disease Vaccine Study Consortium, "A Vaccine Consisting of Recombinant Borrelia burgdorferi Outer-Surface Protein A to Prevent Lyme Disease," NEJM 339:216-222, 1998.

Steere, "Lyme Disease," NEJM 321 :586-596, 1989.

Steere, "Lyme disease: a growing threat to urban populations," Proc. Natl. Acad. Sci. USA 91 :2378-2383, 1994.

Steere, Sikand, Meurice, Parenti, Fikrig, Schoen, Νowakowski, Schmid, Laukamp, Buscarino,

Krause and The Lyme Disease Vaccine Study Group, "Vaccination against Lyme Disease with Recombinant Borrelia burgdorferi Outer-Surface Lipoprotein A with Adjuvant," NEJM 339:209-215, 1998.

Stinchcomb et al, "Isolation and characterisation of a yeast chromosomal replicator," Nature,

282:39-43, 1979.

Studier, Rosenberg, Dunn and Dubendorff, "Use of T7 RΝA polymerase to direct expression of cloned genes," Methods Enzymol 185:60-89, 1990.

Tang et al, "Genetic immunization is a simple method for eliciting an immune response," Nature, 356:152-154, 1992.

Tschumper et al, "Sequence of a yeast DΝA fragment containing a chromosomal replicator and the TRP1 gene," Gene, 10:157, 1980.

Ulmer et al, "Heterologous Protection Against Influenza by Injection of DΝA Encoding a Viral Protein," Science, 259:1745-1749, 1993.

Urioste et al, "Saliva of the Lyme disease vector. Ixodes dammini, blocks cell activation by a nonprostaglandin E2-dependent mechanism," J. Exp. Med., 180:1077-1085, 1994.

U.S. Patent No. 3,791,932. U.S. Patent No. 3,949,064, issued April 6, 1976.

U.S. Patent No. 4,174,384, issued November 13, 1979.

U.S. Patent No. 4,196,265, issued April 1, 1980.

U.S. Patent No. 4,271,147, issued June 2, 1981.

U.S. Patent No. 4,554,101, issued November 19, 1985.

U.S. Patent No. 4,578,269, issued March 25, 1986.

U.S. Patent No. 4,596,792, issued June 24, 1986.

U.S. Patent No. 4,599,230, issued July 8, 1986.

U.S. Patent No. 4,599,231, issued July 8, 1986.

U.S. Patent No. 4,601 ,903, issued July 22, 1986.

U.S. Patent No. 4,608,251, issued August 26, 1986.

U.S. Patent No. 4,683,195, issued July 28, 1987.

U.S. Patent No. 4,683,202, issued July 28, 1987.

U.S. Patent No. 4,888,276, issued December 19, 1989.

U.S. Patent No. 4,952,496, issued August 28, 1990.

U.S. Patent No. 5,168,050, issued December 1, 1992.

U.S. Patent No. 5,178,859, issued January 12, 1993.

U.S. Patent No. 5,470,712, issued November 28, 1995.

U.S. Patent No. 5,530,103, issued June 25, 1996.

U.S. Patent No. 5,554,371, issued September 10, 1996.

U.S. Patent No. 5,558,993, issued September 24, 1996.

U.S. Patent No. 5,571 ,718, issued November 5, 1996. U.S. Patent No. 5,582,990, ssued December 10, 1996.

U.S. Patent No. 5,618,533, ssued April 8, 1997.

U.S. Patent No. 5,620,862, ssued April 15, 1997.

U.S. Patent No. 5,656,451 , ssued August 12, 1997.

U.S. Patent No. 5,686,267, ssued November 11, 1997.

U.S. Patent No. 5,688,512, ssued November 18, 1997.

U.S. Patent No. 5,747,294, ssued May 5, 1998.

U.S. Patent No. 5,777,095. ssued July 7, 1998.

U.S. Patent No. 5,780,030. ssued July 14, 1998.

U.S. Patent No. 5,780,041 , ssued July 14, 1998.

U.S. Patent No. 5,807,685, ssued September 15, 1998.

U.S. Patent No. 5,846,946, ssued December 8, 1998.

U.S. Patent No. 5,853,987, ssued December 29, 1998.

U.S. Patent No. 5,854,395, ssued December 29, 1998.

U.S. Patent No. 5,856,447, issued January 5, 1999.

Wang et al, "Human recombinant macrophage inflammatory protein- 1 alpha and -beta and monocyte chemotactic and activating factor utilize common and unique receptors on human monocytes." J. Immunol, 150:3022-3029, 1993b.

Wang et al, "Identification of RANTES receptors on human monocytic cells: competition for binding and desensitization by homologous chemotactic cytokines," J. Exp. Med., 177:699-705, 1993a.

Whitton et al, "A "string-of-beads" vaccine, comprising linked minigenes, confers protection from lethal-dose virus challenge," J. Virol, 67:348-352, 1993.

Will et al., "Sequence analysis of OspA genes shows homogeneity within Borrelia burgdorferi sensu stricto and Borrelia afzelii strains but reveals major subgroups within Borrelia garinii species," Med. Microbiol. Immunol, 184:73-80, 1995. Wilske et al, "An OspA serotyping system for Borrelia burgdorferi based on reactivity with monoclonal antibodies and OspA sequence analysis," J. Clin. Microbiol, 31 :340-350, 1993b.

Wilske et al, "Immunological and molecular polymoφhisms of OspC, an immunodominant major outer surface protein of Borrelia burgdorferi," Infect. Immun., 61 :2182-2191 , 1993a.

Wilske et al, "Taxonomy of Borrelia spp.," Scand. J. Infect. Dis. Suppl, 77:108-129, 1991.

Wolf et al, "An integrated family of amino acid sequence analysis programs," Compu. Appl 5/α.ct., 4:187-91, 1988.

Zhong, Stehle, Museteanu, Seibers, Gern, Kramer, Wallich and Simon, "Therapeutic passive vaccination against chronic Lyme disease in mice," Proc. Natl. Acad. Sci. USA 94:12533- 12538, 1997.

Zimmer et al, "Lyme Carditis in Immunodeficient Mice During Experimental Infection of Borrelia burgdorferi," Virchows Arch. A PathoL Anat., 417:129-135, 1990.

Claims

CLAIMS:

1. A composition comprising a biologically effective combined amount of at least a first and second Borrelia component, wherein:

(a) said at least a first Borrelia component is a Borrelia decorin binding protein or a polypeptide or peptide from said Borrelia decorin binding protein; or a nucleic acid that encodes said Borrelia decorin binding protein, polypeptide or peptide; or an antibody, or antigen binding fragment thereof, that binds to said Borrelia decorin binding protein, polypeptide or peptide; and

(b) said at least a second Borrelia component is a Borrelia outer surface protein or a polypeptide or peptide from said Borrelia outer surface protein; or a nucleic acid that encodes said Borrelia outer surface protein, polypeptide or peptide; or an antibody, or antigen binding fragment thereof, that binds to said Borrelia outer surface protein, polypeptide or peptide.

2. The composition of claim 1, wherein said composition comprises at least a first Borrelia decorin binding protein, polypeptide or peptide and at least a first Borrelia outer surface protein, polypeptide or peptide.

3. The composition of claim 2, wherein said at least a first Borrelia decorin binding protein, polypeptide or peptide is operatively attached to said least a first Borrelia outer surface protein, polypeptide or peptide.

4. The composition of claim 1 , wherein said composition comprises at least a first nucleic acid that encodes a Borrelia decorin binding protein, polypeptide or peptide and at least a second nucleic acid that encodes a Borrelia outer surface protein, polypeptide or peptide.

5. The composition of claim 4, wherein said at least a first and second nucleic acids are comprised on the same polynucleotide segment.

6. The composition of claim 4, wherein said at least a first and second nucleic acids are comprised on distinct polynucleotide segments.

7. The composition of claim 1, wherein said composition comprises at least a first antibody, or antigen binding fragment thereof, that specifically binds to a Borrelia decorin binding protein, polypeptide or peptide and at least a second antibody, or antigen binding fragment thereof, that specifically binds to a Borrelia outer surface protein, polypeptide or peptide.

8. The composition any preceding claim, wherein said at least a first Borrelia component is a Borrelia DbpA or DbpB protein, polypeptide, peptide, nucleic acid or antibody.

9. The composition of claim 8, wherein said at least a first Borrelia component is a

Borrelia DbpA protein, polypeptide, peptide, nucleic acid or antibody.

10. The composition of claim 9, wherein said at least a first Borrelia component is a Borrelia DbpA protein or nucleic acid.

11. The composition of claim 10, wherein said at least a first Borrelia component is a Borrelia DbpA protein.

12. The composition any preceding claim, wherein said at least a second Borrelia component is a Borrelia OspA, OspB, OspC, OspD, OspE or OspF protein, polypeptide, peptide, nucleic acid or antibody.

13. The composition of claim 12, wherein said at least a second Borrelia component is Borrelia OspA protein, polypeptide, peptide, nucleic acid or antibody.

14. The composition of claim 13, wherein said at least a second Borrelia component is a Borrelia OspA protein or nucleic acid.

15. The composition of claim 14, wherein said at least a second Borrelia component is a

Borrelia OspA protein.

16. The composition of any preceding claim, wherein said at least a first Borrelia component is a Borrelia DbpA protein, polypeptide, peptide, nucleic acid or antibody and said at least a second Borrelia component is a Borrelia OspA protein, polypeptide, peptide, nucleic acid or antibody.

17. The composition of claim 16, wherein said at least a first Borrelia component is a Borrelia DbpA protein or nucleic acid and said at least a second Borrelia component is a Borrelia OspA protein or nucleic acid.

18. The composition of claim 17, wherein said at least a first Borrelia component is a Borrelia DbpA protein and said at least a second Borrelia component is a Borrelia OspA protein.

19. The composition any preceding claim, wherein said composition further comprises at least a third Borrelia protein, polypeptide or peptide; or a nucleic acid that encodes said third Borrelia protein, polypeptide or peptide; or an antibody, or antigen binding fragment thereof, that binds to said third Borrelia protein, polypeptide or peptide.

20. The composition of claim 19, wherein said at least a third Borrelia protein, polypeptide or peptide is a distinct Borrelia decorin binding protein, polypeptide or peptide, a distinct Borrelia outer surface protein, polypeptide or peptide, or a flagellin, SI, T5, EppA, p39-alpha, p39-beta, pl3, pl7, p28, p35, p37, Vmp7 or pi 10 protein, polypeptide or peptide.

21. The composition of any preceding claim, wherein said composition is pharmaceutically acceptable composition.

22. The composition of claim 21, wherein said pharmaceutically acceptable composition is formulated for intradermal injection, subcutaneous injection or intranasal administration.

23. The composition of any preceding claim, wherein said composition further comprises an adjuvant.

24. The composition of claim 23, wherein said composition comprises an aluminum, an aluminum hydroxide or Alhydrogel® adjuvant.

25. The composition of any preceding claim, for use in generating an anti-Borrelia immune response upon administration to an animal.

26. The composition of claim 25, for use in generating an anti-Borrelia immune response upon administration to an animal having, suspected of having or at risk for developing a Borrelia infection.

27. The composition of claim 26, wherein at least one of said first or second immunogenic Borrelia components is derived from a Borrelia species that is heterologous to the species of said Borrelia infection.

28. The composition of claim 27, wherein each of said first and second immunogenic Borrelia components are derived from a Borrelia species that is heterologous to the species of said Borrelia infection.

29. The composition of any one of claims 25 through 28, wherein each of said first and second immunogenic Borrelia components are present at low doses and wherein administration of said composition to said animal generates a significant anti-Borrelia immune response.

30. The composition of any preceding claim, for use in preventing or treating Lyme disease.

31. A pharmaceutical formulation comprising a composition in accordance with any preceding claim.

32. A vaccine comprising a composition in accordance with any one of claims 1 through 30 and a pharmaceutically acceptable excipient.

33. A therapeutic kit comprising, in at least a first suitable container, a composition in accordance with any one of claims 1 through 30.

34. Use of a composition in accordance with any one of claims 1 through 30 in the manufacture of a medicament for use in generating an anti-Borrelia immune response upon administration to an animal.

35. Use of a composition in accordance with any one of claims 1 through 30 in the manufacture of a medicament for use in preventing or treating Lyme disease.

36. Use according to claim 34 or 35, wherein said medicament is intended for administration to a human subject or patient.

37. A method of generating an anti-Borrelia immune response, comprising administering to an animal a biologically effective amount of at least a first composition in accordance with any one of claims 1 through 30.

38. The method of claim 37, wherein said composition comprises between about 1 ng and about 100 μg each of at least a first DbpA protein and at least a first OspA protein.

39. The method of claim 38, wherein said composition comprises between about 1 μg and about 50 μg each of at least a first DbpA protein and at least a first OspA protein.

40. The method of claim 39, wherein said composition comprises about 30 μg each of at least a first DbpA protein and at least a first OspA protein.

41. The method of any one of claims 37 through 40, comprising:

(a) initiating said immune response by administering to an animal at least a first nucleic acid that encodes said Borrelia decorin binding protein, polypeptide or peptide and at least a second nucleic acid that encodes said Borrelia outer surface protein, polypeptide or peptide; and

(b) boosting said immune response by subsequently administering to said animal at least a first Borrelia decorin binding protein, polypeptide or peptide and at least a first Borrelia outer surface protein, polypeptide or peptide.

42. The method of any one of claims 37 through 41, wherein said animal has, is suspected of having or is at risk for developing a Borrelia infection or Lyme disease.

43. The method of any one of claims 37 through 42, wherein at least one of said first and second immunogenic Borrelia components is derived from a Borrelia species that is heterologous to the species of said Borrelia infection.

44. The method of any one of claims 37 through 43, wherein each of said first and second immunogenic Borrelia components are derived from a Borrelia species that is heterologous to the species of said Borrelia infection.

45. The method of any one of claims 37 through 44, wherein said animal is a human subject.