WO2000078785A1 - Laca - Google Patents

Laca Download PDF

Info

Publication number
WO2000078785A1
WO2000078785A1 PCT/US2000/017051 US0017051W WO0078785A1 WO 2000078785 A1 WO2000078785 A1 WO 2000078785A1 US 0017051 W US0017051 W US 0017051W WO 0078785 A1 WO0078785 A1 WO 0078785A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
tlie
gene
promoter
sequence
Prior art date
Application number
PCT/US2000/017051
Other languages
English (en)
Inventor
Magdalena Zalacain
Pan Fong Chan
Sanjoy Biswas
David J. Holmes
Michael A. Lonetto
Stephanie Van Horn
Richard L. Warren
Christopher M. Traini
Original Assignee
Smithkline Beecham Corporation
Smithkline Beecham Plc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Smithkline Beecham Corporation, Smithkline Beecham Plc filed Critical Smithkline Beecham Corporation
Publication of WO2000078785A1 publication Critical patent/WO2000078785A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C07K14/3156—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present lmention relates to lacA. in particular lacA promoter pohmicleotides. recombinant matenals and metliods for their production
  • the invention relates to methods for using such polynucleotides including treatment of microbial diseases, amongst others
  • the invention relates to methods for identifying agonists and antagonists using the materials provided by the invention, and for treating microbial infections and conditions associated with such infections with the identified agonist or antagonist compounds
  • the invention relates to diagnostic assa ⁇ s for detecting diseases associated with microbial infections and conditions associated with such infections, such as assays for detecting lacA promoter driven expression or activity
  • the invention relates to lacA pohnucleotides as descnbed in greater detail below
  • the invention relates to polynucleotides of a lacA of Streptococcus pneumomae.
  • the invention relates especialh to lacA promoter polynucleotides having the nucleotides sequences set out in Table 1 Note that sequences recited in the Sequence Listmg below as "DNA " represent an exemplification of the invention, since those of ordinaiy skill will recognize that such sequences can be usefully employed in polynucleotides in general, including ⁇ bopolynucleotides
  • Methods to identify promoters include techniques known m the art as well as those pro ⁇ ded herein Art techniques include, but are not limited to. the following RT-PCR
  • RT-PCR anah sis of total RNA isolated from infected tissue or m vitro grown cells Using genome databases, primer pairs are designed to predict transcripts of the selected pathogen and arrayed in microtitcr dish format Total RNA is isolated from an in vitro grown pathogen and RT- PCR performed w lth all the primer pairs Similarly RT-PCR is performed with total RNA isolated at varying times from infections of the selected pathogen m a variety of appropriate animal models Comparison of the PCR profiles which reflect the ratio of a given mRNA to internal standards such as rRNA or housekeeping genes pro ⁇ ides identification of those transc ⁇ pts which are essentialK absent m vitro, but are on throughout, or during, various phases of infection
  • Specific sequence detection occurs by amplification of target sequences in the PE Applied Biosystems 7700 Sequence Detection System in the presence of an ohgonucleotide probe labeled at the 5' and 3' ends with a reporter and quencher fluorescent dye.
  • TaqMan FQ probe which anneals between the two PCR p ⁇ mers Only specific product will be detected when the probe is bound between the primers
  • the 5'-nuclease activity of Taq polymerase initially cleaves the reporter dye from the probe
  • the signal generated when the reporter dye is physically separated from the quencher dye is measured with an attached CCD camera
  • Each signal generated equals one probe cleaved which corresponds to amplification of one target strand RT/PCR controls include +/- reverse transc ⁇ ptase reactions, amplification along side genes known to be transcribed under the conditions of study and amplification of se ⁇ al dilutions of genomic DNA
  • the level of transcription under in vivo and in vitro conditions is quantified compa ⁇ son of signal generated from these samples to that of a standard curve generated from signal resultmg from amplification of the genomic DNA
  • Aid/or the promoter region can be cloned upstream of a reporter gene in a vector approp ⁇ ate for the selected pathogen B "appropriate" it is meant a vector capable of replicating stabh m a selected pathogen
  • Beta-galactosidase include, but are not limited to. beta-galactosidase. beta-lactamase. bacterial luciferase. firefh luciferase. beta-glucuronidase Mam other reporter genes known m the art mat be used in the methods and compositions of matter of the invention
  • Primer extension A primer especific for the gene which transcription to be analyse is designed at the appropiate distance from the ATG start codon
  • Total RNA is isolated from an in vitro grown pathogen and a reverse transc ⁇ ptase reaction is carried out
  • Primers are fluorescently labelled at the 5 'end using FAM.
  • HEX or NED dyes Primer extension products can be separated on a polyaciy lamide sequencing gel and detected using a suitable gel scanning system (e g ABI PrismTM 377 Sequencer using GeneScanTM softw are as supplied by Perkin Elmer)
  • a deposit containing a Streptococcus pneumomae 0100993 strain has been deposited w th the National Collections of Indust ⁇ al and Marine Bacte ⁇ a Ltd (herein "NCIMB"). 23 St Machar D ⁇ ve, Aberdeen AB2 IRY. Scotland on 11 Ap ⁇ l 1996 and assigned deposit number 40794 The deposit was desc ⁇ bed as Streptococcus pneumomae 0100993 on deposit
  • Streptococcus pneumomae 0100993 DNA libran in E coli was similarh deposited with tlie NCIMB and assigned deposit number 40800
  • the Streptococcus pneumomae strain deposit is refe ⁇ ed to herein as "tlie deposited stram” or as "tlie DNA of the deposited strain"
  • Tl e deposited stram contains the full length lacA gene comp ⁇ smg the promoter polynucleotide of the invention
  • Tlie sequence of the promoter polynucleotides contained m the deposited stram are controUmg m tl e event of any conflict with any desc ⁇ ptioii of sequences herem
  • the deposit of the deposited stram has been made under the terms of the Budapest Treaty on the International Recognition of tlie Deposit of Micro-organisms for Purposes of Patent Procedure
  • the deposited stram will be l ⁇ evocably and without rest ⁇ ction or condition released to the public upon the issuance of a patent
  • the deposited stram is provided merely as convemence to those of skill m the art and is not an admission that a deposit is required for enablement. such as that required under 35 U S C ⁇ 112
  • Further prov ided b> tlie liiv ention are lacA pohnucleotide sequences m the deposited stram. such as DNA and RNA. and ammo acid sequences encoded therebv
  • tlie invention provides promoter polvnucleotides from a lacA gene
  • the pohnucleotide comp ⁇ ses a promoter region from lacA gene comp ⁇ smg a sequence set out in Table 1 [SEQ ID NO 1]. or a variant thereof
  • isolated promoter nucleic acid molecules from a lacA gene including, for example, pol nucleotides de ⁇ ved from such molecules, such as. unprocessed RNAs. ⁇ bozyme RNAs. mRNAs. cDNAs, genomic DNAs.
  • tlie mvention mclude biologicalh . diagnostical . prophv tactically, clinically or therapeuticalK useful polynucleotides. and vanants thereof, and compositions comp ⁇ smg the same
  • Another aspect of the mvention relates to isolated polvnucleotides. including, for example polynucleotides closelv related to a lacA promoter havmg a pohnucleotide sequence of Table 1 [SEQ ID NO l]
  • lacA polynucleotide from Streptococcus pneumomae comprising or consisting of an nucleotide sequence of Table 1 [SEQ ID NO 1]. or a variant thereof
  • a pohnucleotide of the mvention may be obtained usmg standard cloning and screening methods, such as tliose for clonmg and sequencmg chromosomal (genomic) DNA fragments from bactena usmg Streptococcus pneumomae 0100993 cells as startmg mate ⁇ al.
  • a polynucleotide sequence of the invention such as a polynucleotide sequence given in Table 1 [SEQ ID NO 1]
  • a hbrarv of clones of chromosomal DNA of Streptococcus pneumomae 0100993 in E coh or some other suitable host is probed with a radiolabeled ohgonucleotide.
  • Clones carrying DNA identical to that of the probe can then be distinguished using stringent hybridization conditions
  • sequencing primers designed from the original polynucleotide sequence it is then possible to extend the polynucleotide sequence both directions to determine a functional promoter region sequence or full length gene sequence Convementh .
  • sequencing is performed, for example, using denatured double stranded DNA prepared from a plasmid clone Suitable techniques are described by Maniatis. T . Fritsch. E F and Sambrook et al . MOLECULAR CLONING. A LABORATORY MANUAL. 2nd Ed .
  • tlie present mvention provides for an isolated polvnucleotide comprising or consisting of a polvnucleotide sequence which has at least 70% identitv . preferably at least 80% identitv . more preferablv at least 90% identitv . v et more preferablv at least 95% identity, even more preferablv at least 97-99% or exact identitv to SEQ ID NO 1 over the entire length of SEQ ID NO 1
  • Tlie mvention also includes a polvnucleotide consistmg of or compnsmg a polvnucleotide of the formula
  • X is hydrogen, a metal or a modified nucleotide residue, or together with Y defines a covalent bond, and at the 3' end of the molecule.
  • Y is hydrogen, a metal, or a modified nucleotide residue, or together with X defines the covalent bond, each occurrence of Rj and R3 is independently am nucleic acid residue or modified nucleic acid residue, m is an integer between 1 and 3000 or zero .
  • R 2 is a nucleic acid sequence or modified nucleic acid sequence of the invention, particularly a nucleic acid sequence selected from Table 1 or a modified nucleic acid sequence thereof In the polynucleotide formula above.
  • R 2 is oriented so that its 5' end nucleic acid residue is at the left, bound to R j and its 3' end nucleic acid residue is at the right, bound to R3 Am stretch of nucleic acid residues denoted by either Rj and/or R 2 .
  • m and/or n is greater than 1.
  • mav be either a heteropolvmer or a homopolymer. preferably a hetcropolv mer Where, in a preferred embodiment.
  • the polvnucleotide of the above fon ula is a closed, circular polynucleotide.
  • m and/or n is an integer between 1 and 1000.
  • Other prefe ⁇ ed embodiments of tlie mvention are provided where m is an integer between 1 and 50. 100 or 500. and n is an integer between 1 and 50. 100. or 500 It is most prefe ⁇ ed that a polvnucleotide of the mvention is denved from Streptococcus pneumomae.
  • a polvnucleotide of tlie mvention mav also be obtained, for example, from organisms of the same taxonomic family or order
  • Prefe ⁇ ed embodiments are polynucleotides that retain substantially the same biological function or activ ltv as tlie promoter region DNA of Table 1 [SEQ ID NO 1 ] hi accordance with certain prefe ⁇ ed embodiments of this mvention there are provided polynucleotides that hv b ⁇ dize.
  • tlie mvention especially relates to polynucleotides that h b ⁇ dize under stringent conditions to tlie polvnucleotides desc ⁇ bed herem
  • strmgent conditions and “strmgent hybndization conditions” mean hyb ⁇ dization occurring only if there is at least 95%) and preferably at least 97% identity between the sequences
  • a specific example of st ⁇ ngent hybridization conditions is overnight incubation at 42°C m a solution comprising 50% formamide.
  • Prefe ⁇ ed polynucleotides that h b ⁇ dize under st ⁇ ngent conditions are polynucleotide sequences comp ⁇ smg of at least 50. 100. 500. 1000. or 3000 nucleotides
  • the polynucleotides of tlie mvention may be used as a hybndization probe genomic DNA to isolate genomic clones encoding lacA and to isolate genomic clones of other genes that have a high identity, particularly high sequence identit .
  • Such probes generally will compnse at least 15 nucleotide residues or base pairs Preferably, such probes will have at least 30 nucleotide residues or base pairs and may have at least 50 nucleotide residues or base pairs Particularly prefe ⁇ ed probes will ha e at least 20 nucleotide residues or base pairs and will have lee than 30 nucleotide residues or base pairs
  • Tlie polynucleotides of the mvention may be employed, for example, as research reagents and matenals for discovery of treatments of and diagnostics for diseases, particularly human diseases, as further discussed herem relating to polynucleotide assays
  • N means that any of the four DNA or RNA nucleotides may appear at such a designated position in the DNA or RNA sequence, except it is preferred that N is not a nucleic acid that when taken in combination with adjacent nucleotide positions, when read in the correct reading frame, would have the effect of generating a premature termination codon in such reading frame Vectors, Host Cells, Expression Systems
  • Tlie invention also relates to vectors that comp ⁇ se a polynucleotide or polynucleotides of the inv ention.
  • host cells that are genetically engmeered with vectors of the mvention and the production of polynucleotides of tlie mv ention by recombmant techniques
  • the promoter polynucleotides of the mvention can be used to dnve the expression of heterologous proteins or over-expression of naturally associated protems Smce the promoter polynucleotide of the mvention is inducible. such as by mannose or by any other approp ⁇ ate mducers as tlie case may be.
  • the further aspect relates to direct or indirect up- or down-regulation of expression or transc ⁇ ption of a target gene Recombmant proteins (polypeptides) may be prepared by processes well known m the art from genetically engmeered host cells comp ⁇ smg expression vectors
  • host cells can be genetically engmeered to mcorporate replication systems or portions thereof or polynucleotides of the mvention
  • Introduction of a polynucleotide mto tlie host cell can be effected by methods desc ⁇ bed m many standard laboratory manuals, such as Davis, et al . BASIC METHODS IN MOLECULAR BIOLOGY. (1986) and Sambrook. et al . MOLECULAR CLONING A LABORATORY MANUAL. 2nd Ed . Cold Spring Harbor Laboratory Press. Cold Spring Harbor. N Y (1989). such as. calcium phosphate transfection. DEAE-dextran mediated transfection.
  • bactenal cells such as cells of streptococci, staphylococci. enterococci. E coh. streptomyces, cy anobacte ⁇ a. Bacillus subtihs. and Streptococcus- pneumomae. fungal cells, such as cells of a yeast. Kluver ⁇ myces . Satcharomyces. a basidiomycete. Candida albwans and Aspergi Hits, insect cells such as cells of Drosop la S2 and Sp ⁇ doptera Sf9.
  • Such vectors mclude. among others, chromosomal-, episomal- and v ⁇ rus-de ⁇ ved vectors, for example, vectors denved from bactenal plasmids. from bacte ⁇ ophage. from transposons. from y east episomes. from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses. papova viruses, such as SV40. vaccinia viruses, adenoviruses fowl pox viruses, pseudorabies viruses, picornaviruses and retrov lruses.
  • the replication system constructs may contain control regions other than tlie promoter of the mvention that regulate as well as engender expression, such as marker gene expression Generally .
  • any sy stem or vector suitable to maintain, propagate or express polynucleotides in a host may be used for expression m this regard
  • the approp ⁇ ate DNA sequence may be mserted mto tl e expression system by any of a va ⁇ ety of well-known and routme techmques. such as. for example tliose set forth in Sa brook et al . MOLECULAR CLONING A LABORATORY MANUAL, (supra)
  • Assays of the invention mav be performed by determining the effect of transcript level on cell phenotype These assay s will help to characterize, among other things, temporal relevance of transcription to phenotype
  • Promoter polynucleotides of the invention may be used for overproduction of heterologous proteins
  • Essentiality Testing Promoter polynucleotides of the invention may be used to assess gene essentiality in a bacteria Example 2 provides one embodiment of this type of assay Skilled artisans can readily determine other ways to perform such analyses based on the present invention and the teachings herein
  • Polynucleotides of the mvention may also be used to assess the binding of small molecule substrates and ligands in. for example, cells, cell-free preparations, chemical branes. and natural product mixtures
  • substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics See. e g . Coligan et al . Current Protocols in Immunology 1(2) Chapter 5 (1991)
  • Polynucleotides of tlie present mvention are responsible for many biological functions, including many disease states, m particular the Diseases hereinbefore mentioned It is therefore desirable to devise screenmg methods to identif compounds which stimulate or which inhibit the function of the polynucleotide Accordingly .
  • the present invention provides for a method of screenmg compounds to identify those which stimulate or which inhibit the function of a polvnucleotide of the mvention.
  • agonists or antagonists may be emplo ed for therapeutic and prophylactic purposes for such Diseases as hereinbefore mentioned
  • Compounds may be identified from a va ⁇ ety of sources, for example, cells, cell-free preparations, chemical libra ⁇ es. and natural product mixtures
  • agomsts. antagonists or inhibitors so-identified may be natural or modified substrates, ligands receptors, enzymes, etc . as tlie case may be. of lacA polynucleotides. or may be structural or functional mimetics thereof (see Coligan et al . Current Protocols in Immunology 1(2) Chapter 5 (1991))
  • the screening methods may simply measure the binding of a candidate compound to the polv nucleotide. or to cells or membranes bearing the polynucleotide Alternatively .
  • the screening method may inv olve competition with a labeled competitor Further, these screening methods may test whether the candidate compound results in a signal generated by activation or inhibition of the polynucleotide.
  • the screening methods may simply comprise the steps of mixing a candidate compound with a solution containing a polynucleotide of the present invention, to form a mixture, measu ⁇ ng lacA promoter poly nucleotide activ lty in the mixture, and comparing the lacA promoter polynucleotide activ ity of the mixture to a standard Fusion proteins, such as those made from Fc portion and lacA promoter poly nucleotide. as hereinbefore described, can also be used for high-throughput screening assays to identify antagonists of the polynucleotide of the present invention, as well as of phy logenetically and and/or functionally related promoters
  • polypeptides and antibodies that bind to and/or interact with a polynucleotide of the present invention may also be used to configure screening methods for detecting the effect of added compounds on the production of mRNA and/or promoter polynucleotide in cells
  • Tlie invention also provides a method of screenmg compounds to identify those which enhance (agonist) or block (antagonist) tlie action of lacA polynucleotides. particularly those compounds that are bactenstatic and/or bacte ⁇ cidal Tlie method of screenmg may mvolve high-throughput techmques For example, to screen for agomsts or antagonists, a synthetic reaction mix.
  • a cellular compartment such as a membrane, cell envelope or cell wall, or a preparation of any thereof, comp ⁇ smg lacA polynucleotide and a labeled substrate or ligand of such polynucleotide is mcubated in the absence or the presence of a candidate molecule that may be a lacA agonist or antagonist
  • a candidate molecule that may be a lacA agonist or antagonist
  • the ability of the candidate molecule to agonize or antagonize tlie lacA polynucleotide is reflected m decreased binding of tlie labeled ligand or decreased production of product from such substrate Molecules that bmd gratuitously. I c .
  • lacA polynucleotide without inducing the effects of lacA polynucleotide are most likely to be good antagonists Molecules that bmd well and. as the case may be. increase tlie rate of product production from substrate, mcrease signal transduction. or mcrease chemical channel activ lty are agonists Detection of the rate or level of. as the case may be. production of product from substrate, signal transduction. or chemical channel activity may be enhanced by usmg a reporter system Reporter sy stems that may be useful m this regard include but are not limited to colo ⁇ metnc. labeled substrate
  • Polynucleotides of the inv ention may be used to identify promoter binding protems. such as sigma factors, if an . for such polynucleotide. through standard binding techniques known m the art. for example, gel retardation assay s Other of these techniques include, but are not limited to. ligand binding and crosslinking assay s in which the polynucleotide is labeled with a radioactive isotope (for instance. J -P). chemically modified (for instance, biotinylated or fluorescent tagged), or fused to a polvnucleotide sequence suitable for detection or purification, and incubated with a source of the putative binding compound or ligand (e g .
  • a source of the putative binding compound or ligand e g .
  • the fluorescence polarization value for a fluorescently -tagged molecule depends on the rotational correlation time or tumbling rate
  • Protem-polynucleotide complexes such as formed by lacA polynucleotide associating with polypeptide or other factor, labeled to comprise a fluorescently - labeled molecule w ill have higher polarization values than a fluorescently labeled monome ⁇ c polynucleotide It is preferred that this method be used to characterize small molecules that disrupt polypeptide-polynucleotide complexes Fluorescence energy transfer may also be used to characterize small molecules that interfere with the formation of lacA polynucleotide-poly peptide dimers. t ⁇ mers.
  • LacA polynucleotides can be labeled with both a donor and acceptor fluorophore Upon mixing of the two labeled species and excitation of the donor fluorophore.
  • fluorescence energy transfer can be detected by observing fluorescence of the acceptor Compounds that block dime ⁇ zation will inhibit fluorescence energy transfer hi other embodiments of the mvention there are provided methods for identifying compounds which bmd to or otherwise mteract with and inhibit or activate an activity or expression of a polynucleotide of the invention comp ⁇ smg contacting a polynucleotide of the mvention w th a compound to be screened under conditions to permit bmdmg to or other mteraction between the compound and the polynucleotide to assess the binding to or other mteraction with the compound, such bmdmg or mteraction preferably bemg associated with a second component capable of providmg a detectable signal m response to the bmdmg or mteraction of the pol nucleotide ith the compound, and determining whether the compound binds to or otherwise interacts
  • lacA agonists or antagonists is a competitiv e assay that combines lacA and a potential agonist or antagonist with lacA-bmdmg molecules, recombmant lacA bmdmg molecules. natural substrates or ligands. or substrate or ligand mimetics. under appropnate conditions for a competitive inhibition assay LacA can be labeled, such as by radioactivity or a colonmetnc compound, such that the number of lacA molecules bound to a bmdmg molecule or converted to product can be determined accuratelv to assess tlie eftectiv eness of tlie potential antagonist or agonist
  • Promoter pol nucleotides of the invention may also be used to determine a target of unknown antibacterial susceptibility
  • Promoter pol nucleotides of the invention may also be used to assess the effect of transc ⁇ pt level on antibacterial susceptibility
  • promoter polynucleotides of the invention may also be used in whole cell screens
  • Inducible promoters can be used to up and down regulate expression of target gene directly, or indirectly by transcription anti-sense RNA or ⁇ bozymes
  • Potential antagonists mclude. among others, small orgamc molecules, peptides. polypeptides that bmd to a polynucleotide of the mvention and thereby inhibit or extmguish its activity or expression Potential antagonists also mav be small orgamc molecules, a peptide.
  • a polypeptide such as a closely related protein that bmds tlie same sites on a bmdmg molecule, such as a bmdmg molecule, without inducing lacA promoter- induced activities, thereby preventmg the action of lacA polynucleotides by excluding lacA polynucleotides from bmdmg
  • Potential antagonists m include a small molecule that bmds to and occupies the bmdmg site of the polynucleotide thereby preventmg bmdmg to cellular bmdmg molecules, such that normal biological activity is prevented
  • small molecules include but are not limited to small orgamc molecules, peptides or peptide-like molecules
  • Oilier potential antagonists m clude antisense molecules (see Okano. J Neurochem 56 560 ( 1991 ).
  • OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION. CRC Press. Boca Raton. FL (1988). for a descnption of these molecules)
  • Prefe ⁇ ed potential antagonists m include compounds related to and vanants of lacA
  • polypeptide antagonists include oligonucleotides or proteins which are closely related to tlie ligands. substrates, receptors, enzymes, etc . as the case may be. of the polynucleotide.
  • Certam of tlie polynucleotides of tlie mvention are biomimetics. functional mimetics of the natural lacA polynucleotide These functional mimetics may be used for. among other things, antagonizing the activity of lacA polynucleotide
  • Functional mimetics of the polynucleotides of tlie invention mclude but are not limited to truncated polynucleotides
  • prefe ⁇ ed functional mimetics mclude. a polynucleotide comp ⁇ smg tlie polynucleotide sequence set forth m SEQ ID NO 1 lacking 5. 10. 20. 30. 40. 50. 60.
  • polynucleotides of these functional mimetics may be used to d ⁇ ve the expression of expression cassettes and marker genes It is prefe ⁇ ed that these cassettes compnse 5' and 3' restnction sites to allow for a convenient means to ligate the cassettes together when desired It is further prefe ⁇ ed that these cassettes compnse gene expression signals known m the art or desc ⁇ bed elsewhere herem
  • the present invention relates to a screening kit for identifying agonists. antagonists, ligands. receptors, substrates, enzymes, etc for a polynucleotide of the present invention, or compounds hich decrease or enhance the production of such polynucleotides .
  • polynucleotide is preferably that of SEQ ID NO 1
  • a polynucleotide of the present invention may also be used in a method for the structure-based design of an agonist, antagonist or inhibitor of the polynucleotide. by (a) determining in the first instance the three-dimensional structure of the polynucleotide. or complexes thereof, (b) deducmg the three-dimensional structure for the likely reactive s ⁇ te(s). binding s ⁇ te(s) or mot ⁇ f(s) of an agonist, antagonist or inhibitor, (c) synthesizing candidate compounds that are predicted to bind to or react with the deduced binding s ⁇ te(s). reactive s ⁇ te(s). and/or mot ⁇ f(s). and (d) testing whether the candidate compounds are indeed agonists, antagonists or inhibitors
  • this will normally be an iterative process, and this iterative process may be performed using automated and computer-controlled steps
  • tlie present mvention provides methods of treatmg abnormal conditions such as. for instance, a Disease, related to either an excess of. an under-expression of. an elevated activity of. or a decreased activity of lacA polynucleotide
  • tlie expression and/or activity of the polynucleotide is m excess, several approaches are available. One approach compnses administering to an individual m need thereof an inhibitor compound (antagonist) as herein descnbed. optionally in combination with a pharmaceutically acceptable earner, m an amount effective
  • promoter activ lty can be inhibited using expression blocking techniques This blocking is preferably targeted against transcription
  • This blocking is preferably targeted against transcription
  • a known technique of this sort inv olve the use of antisense sequences, either internally generated or separately administered (see for example. O ' Connor. .1 Neurochem (1991) 56 560 in Ohgodeoxynucleotides as Antisense Inhibitors of Gene Expression. CRC Press Boca Raton. FL (1988))
  • ohgonucleotides which fo ⁇ n triple helices with the gene can be supplied (see. for example. Lee et al Nucleic Acids Res ( 1979) 6 3073. Cooney et al Science (1988) 241 456.
  • promoter polynucleotides of the invention are useful for ascertaining the functionality or essentiality of the target gene (gene-of-mterest) in a cell through expression blocking techniques
  • a method comp ⁇ ses "knocking-out" the transcription or expression of gene-of-interest by expressing an anti-sense sequence to the gene-of-interest under the transc ⁇ ptional control of the promoter pol nucleotides of the invention, particularly those contained in SEQ ID NO 1
  • the method comprises, in a cell, (a) disabling ("knocking-out") the gene-of-interest, (b) reintroducing.
  • the gene-of-interest now under the operational control of the inducible promoter polynucleotides of the invention (particularly those contained m SEQ ID NO 1), and (c) adding the inducer thereby providing information to the essentiality or functionality of the gene of interest
  • Hehcobacter pylori (herein "H pylori”) bacteria infect the stomachs of over one-third of the world's population causing stomach cancer, ulcers, and gastritis (International Agency for Research on Cancer (1994) Schistosomes, Liver Flukes and Hehcobacter Pylori (International Agency for Research on Cancer. Lyon. France, http //www uicc ch/ecp/ecp2904 htm)
  • the International Agency for Research on Cancer recently recognized a cause-and-effect relationship between H pylon and gastric adenocarcinoma.
  • Prefe ⁇ ed antimicrobial compounds of the invention agonists and antagonists of lacA polynucleotides found using screens provided by the invention or known in the art. particularly narrow -spectrum antibiotics.
  • Prefe ⁇ ed antimicrobial compounds of the invention agonists and antagonists of lacA polynucleotides found using screens provided by the invention or known in the art. particularly narrow -spectrum antibiotics.
  • should be useful in the treatment of H pylori infection Such treatment should decrease the advent of H pylon-m ⁇ uce ⁇ cancers, such as gastrointestinal carcinoma
  • Such treatment should also prevent, inhibit and/or cure gastric ulcers and gast ⁇ tis
  • Bodilv mate ⁇ al(s) means am mate ⁇ al de ⁇ ved from an individual or from an organism infecting, infesting or inhabiting an individual, including but not limited to. cells, tissues and waste, such as. bone. blood, serum, cerebrospmal fluid, semen, saliv a. muscle, cartilage, organ tissue, skin. unne. stool or autopsy matenals
  • D ⁇ sease(s) means am disease caused by or related to infection bv a bactena. including . for example, otitis media, conjunctivitis, pneumonia, bacteremia. meningitis, sinusitis, pleural empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospmal fluid "Host cell(s)” is a cell which has been transformed or transfected. or is capable of transformation or transfection by an exogenous poly nucleotide sequence
  • Identity as known m the art. is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case mav be. as determined bv comparing the sequences In the art. "identit " also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be. as determined by the match between st ⁇ ngs of such sequences "Identity " can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology. Lesk. A M . ed . Oxford University Press. New York. 1988. Bwcomputing Informatics and Genome Projects. Smith. D W . ed . Academic Press. New York, 1993.
  • Polv nucleotide embodiments further include an isolated polynucleotide comprising a polvnucleotide sequence hav ing at least a 50. 60. 70. 80, 85, 90. 95. 97 or 100%o identity to the reference sequence of SEQ ID NO 1.
  • polynucleotide sequence may be identical to the reference sequence of SEQ ID NO 1 or may include up to a certain integer number of nucleotide alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion.
  • alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anyvv here between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence, and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides in SEQ ID NO 1 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of nucleotides in SEQ ID NO 1. or
  • n n is the number of nucleotide alterations.
  • x n is the total number of nucleotides in SEQ ID NO 1.
  • y is 0 50 for 50%. 0 60 for 60%. 0 70 for 70%. 0 80 for 80%. 0 85 for 85%. 0 90 for 90%. 0 95 for 95%. 0 97 for 97% or 1 00 for 100%.
  • • is the symbol for the multiplication operator, and wherein any non-integer product of x n and y is rounded down to the nearest integer prior to subtractmg it from x.
  • a polynucleotide sequence of the present invention may be identical to the reference sequence of SEQ ID NO 1. that is it may be 100% identical, or it may include up to a certain integer number of nucleic acid alterations as compared to the reference sequence such that the percent identity is less than 100% identity
  • Such alterations are selected from the group consisting of at least one nucleic acid deletion, substitution, including transition and transversion.
  • nucleic acid alterations for a given percent identity is determined by multiply ing the total number of nucleic acids in SEQ ID NO 1 by the integer defining the percent identity div ided by 100 and then subtracting that product from said total number of nucleic acids in SEQ ID NO 1. or
  • n n is the number of nucleic acid alterations.
  • x n is the total number of nucleic acids m SEQ ID NO 1.
  • y is. for instance 0 70 for 70%. 0 80 for 80%,. 0 85 for 85%, etc . • is the symbol for the multiplication operator, and wherein any non-integer product of x n and y is rounded down to the nearest integer prior to subtracting it from x n
  • h ⁇ d ⁇ v ⁇ dual(s) means a multicellular eukaryote. mcludmg. but not limited to a metazoan. a mammal. an ovid. a bov id. a smiian. a primate, and a human
  • Isolated means altered "by tlie hand of man” from its natural state. i e . if it occurs m nature, it has been changed or removed from its o ⁇ gmal environment, or both For example, a polynucleotide or a polypeptide naturally present in a living orgamsm is not "" isolated.
  • Orgamsm(s) means a (I) prokaryote, mcludmg but not limited to. a member of the genus Streptococcus. Staphyl ⁇ coccus, Bordetella Corynebactenum, Mycobacterium Ne ssena, Haemophilus. Actinomycetes Streptomycetes Nocardia. Enterobacter, Yersm a. Fancisella Pasturella Moraxella Acinetobacter Erysipelothnx, Branhamella. Actinobacillus Srreptobacillus, Listena,
  • eukar ote a unicellular or filamentous eukar ote.
  • mcludmg but not limited to a protozoan, a fungus, a member of tlie genus Saccharomyces Kluveromyces or Candida and a member of the species Saccharomyces cenviseae Kluveromyces lactis or Candida albicans
  • Polynucleot ⁇ de(s) generally refers to any polynbonucleotide or polydeoxy ⁇ bonucleotide. which mav be unmodified RNA or DNA or modified RNA or DNA "Polynucleot ⁇ de(s)” mclude. without limitation- smgle- and double-stranded DNA. DNA that is a mixture of smgle- and double-stranded regions or smgle-. double- and t ⁇ ple-stranded regions, smgle- and double-stranded RNA. and RNA that is mixture of smgle- and double-stranded regions hyb ⁇ d molecules compnsing DNA and RNA that may be single-stranded or. more typicall .
  • polystyrene resin refers to t ⁇ ple-stranded regions compnsmg RNA or DNA or both RNA and DNA Tlie strands in such regions mav be from the same molecule or from different molecules Tlie regions mav mclude all of one or more of the molecules, but more typicallv mvolv e only a region of some of tlie molecules One of tlie molecules of a t ⁇ ple-hehcal region often is an ohgonucleotide As used herem.
  • polyvnucleot ⁇ de(s) also includes DNAs or RNAs as descnbed above that contain one or more modified bases Thus. DNAs or RNAs with backbones modified for stability or for other reasons are "polvnucleot ⁇ de(s)" as that tenn is mtended herein Moreover. DNAs or RNAs comp ⁇ smg unusual bases.
  • polynucleot ⁇ de(s) as it is emploved herem embraces such chemically enzymatically or metabolicalh modified forms of polynucleotides.
  • Polynucleot ⁇ de(s) also embraces short polynucleotides often refe ⁇ ed to as ol ⁇ gonucleot ⁇ dc(s)
  • Polypept ⁇ de(s) refers to any peptide or protem comp ⁇ smg two or more ammo acids jomed to each other by peptide bonds or modified peptide bonds "Polypept ⁇ de(s)” refers to both short chains, commonly refe ⁇ ed to as peptides.
  • Polypeptides may contain ammo acids other than the 20 gene encoded ammo acids "Polypept ⁇ de(s)" mclude tliose modified either by natural processes, such as processmg and other post-translational modifications, but also by chemical modification techmques Such modifications are well descnbed m basic texts and m more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill m tlie art It w ill be appreciated that the same type of modification may be present in the same or varying degree at several sites in a gi en polypeptide Also, a given polypeptide may contain many types of modifications Modifications can occur anywhere m a polypeptide.
  • Modifications mclude. for example, acetylation. acylation. AD P- ⁇ bosv lation. amidation. covalent attachment of flavin, covalent attachment of a heme moiety . covalent attachment of a nucleotide or nucleotide de ⁇ vative. covalent attachment of a lipid or lipid de ⁇ vative. covalent attachment of phosphotidyimositol. cross-linking, cychzation. disulfide bond formation, demetliy lation. fo ⁇ nation of covalent cross-links, formation of cysteine.
  • Polypeptides may be branched or cyclic, with or without branchmg Cyclic, branched and branched circular polypeptides may result from posttranslational natural processes and may be made by entirely synthetic methods, as well "Recombmant expression system(s)” and “recombmant replication system(s) "refers to expression sy stems or portions thereof or polynucleotides of tlie mvention mtroduced or transformed mto a host cell or host cell lysate for tlie production of the polynucleotides and polypeptides of the mvention
  • 'Na ⁇ ant(s) is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties
  • a polynucleotide differs in nucleotide sequence from another, reference polynucleotide Changes m the nucleotide sequence of the v a ⁇ ant may or may not alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result in ammo acid substitutions, additions, deletions, fusion proteins and truncations in the polypeptide encoded by the reference sequence, as discussed below
  • a typical variant of a polypeptide differs in ammo acid sequence from another, reference poly peptide Generally . differences are limited so that the sequences of the reference polypeptide and the v ariant are closely similar overall and.
  • a variant and reference poly peptide may differ in ammo acid sequence by one or more substitutions, additions, deletions in any combination
  • a substituted or inserted ammo acid residue may or may not be one encoded by the genetic code
  • Tlie present mvention also mcludes mclude vanants of each of the polypeptides of tlie invention, that is polypeptides that vary from the referents by conservative ammo acid substitutions, whereby a residue is substituted by another with like charactenstics Typical such substitutions are among Ala. Val. Leu and He. among Ser and Thr. among the acidic residues Asp and Glu. among Asn and Gin. and among tlie basic residues Lys and Arg.
  • a variant of a poly nucleotide or polypeptide may be a naturally occur ⁇ ng such as an allehc variant, or it may be a variant that is not known to occur naturally
  • Non-naturally occur ⁇ ng variants of polynucleotides and polypeptides may be made by mutagenesis techniques, by direct synthesis, and by other recombmant methods known to skilled artisans
  • the polynucleotide having a DNA sequence given m Table 1 [SEQ ID NO 1] was obtamed from a library of clones of chromosomal DNA of Streptococcus pneumomae m E coh
  • the sequencmg data from two or more clones containing overlapping Streptococcus pneumomae DNAs was used to construct the contiguous DNA sequence m SEQ ID NO 1 Libraries may be prepared by routine methods, for example Methods 1 and 2 below
  • Total cellular DNA is partially hydrolyzed with a one or a combination of restriction enzymes appropriate to generate a series of fragments for cloning into library vectors (e g . Rsal. Pall. Alul. Bshl235I). and such fragments are size-fractionated according to standard procedures EcoRI linkers are ligated to the DNA and the fragments then ligated into the vector Lambda ZapII that have been cut with EcoRI.
  • a promoter replacement cassette is generated using PCR technology
  • the cassette consists of a pair of 500bp chromosomal DNA fragments flanking an erythromycin resistance gene divergently transcribed w ith respect to the liiducible/repressible promoter
  • the chromosomal DNA sequences are the 500bp preceding and following the promoter region of the gene whose essentiality is going to be tested
  • the promoter replacement cassette is introduced into S pneumomae R6 by transformation
  • Competent cells are prepared according to published protocols DNA is introduced into the cells by incubation of ⁇ g quantities of promoter replacement cassette with 10" cells at 30°C for 30 minutes The cells are transferred to 37°C for 90 minutes to allow expression of the erythromycin resistance gene
  • Cells are plated in agar containing 1 ⁇ g erythromycin per ml and the appropriate concentration of the inducer molecule Following incubation at 37°C for 36 hours, colonies are picked and grown overnight in Todd-Hewitt broth supplemented with 0 5% yeast extract and the appropiate amount of inducer Gene essentiality is tested by decreasing the amount of inducer and/or increasing the amount of repressor and monitoring cell viability If the promoter replacement has occurred upstream of an essential gene, v iability of the bacteria will be absolutely dependent on the presence of inducer or the absence of repressor
  • lntergemc noncoding regions which are considered to contain promoters
  • putativ e promoter sequences are identified by homology with a consensus sequence for bacterial promoters Such a sequence consists of a -10 region (TATAAT). a 17bp/19bp spacer and a -35 region (TTGACA) S pneumomae promoters hav e sometimes a characte ⁇ stic extended -10 region (TI.
  • TGN TATAAT [SEQ ID NO 2]and lack a -35 region In Seq ID Nol a -10 ( 66 TATATT 71 ) and -35 ( 4, TTGACT 4!l ) regions hav e been identified Tins promoter controls the lactose metabolism operon
  • S. pneumomae R6 is grow n statically at 37oC in the semi-defined AGCH media (Lacks S ( 1968) Genetics 60 4685-706 ), supplemented with 0 2% yeast extract (YE) and different test sugars added as the sole sugar source
  • S. pneumomae was shown to grow to an OD 650 of 0 6 at approximately the same growth rate, when sucrose, glucose, trehalose or lactose were added to the medium at the point of inoculation as the sugar source at 1% (w/v) final concentration.
  • pneumomae was unable to utilize a sugar as the single carbon source (fucose and galactose), or showed a significantly reduced growth rate (raffinose), glucose was supplemented to the media at a concentration of 0.2%) (w/v) to maintain growth
  • the sugar growth conditions tested are 1 % glucose, 1% sucrose. 1% lactose, 1% trehalose, 1 % fructose, 1 % mannose, 0.2% glucose, 0.2% glucose + 1% fucose, 0.2% glucose+ 1 % galactose, 0 2% glucose + 0 5%> raffinose and 1 % raffinose
  • lOO ⁇ l of a glycerol stock of S. pneumomae R6 is diluted in 4ml of AGCH +YE media supplemented with the test sugar(s) and grown to exponential phase until OD 6 so reached 0.29 -0.31 Cultures (0. lml) are rediluted in 4ml fresh AGCH +YE containing the same sugar(s) and re-incubated at 37°C to exponential phase This is repeated for a third time Glycerol is added to 10% (v/v) final concentration, and cells are frozen in dry ice/ ethanol bath and stored at -70oC as stocks of "synchronised " S.
  • RNA preparation is extracted using the FastRNA Kit (Biol 01 ) according to the manufacturers instuctions with slight modifications Briefly, 5ml of S pneumomae cells are cent ⁇ fuged at 6000 rpm and 4oC, the supernatanrt is removed and the pellet is resuspended in 200 ⁇ l of AGCH and added to a FastPrep tube containing lysing matrix and 1 ml of extraction reagents (FastRNA) The tubes are shaken in a reciprocating shaker (FastPrep FP120. BIOIOI) at 6000 rpm for 45 sec The cnide RNA preparation is extracted with chloroform/isoamy 1 alcohol (24 1).
  • RNA preparations are stored in this isopropanol solution at -80°C if necessarv
  • the RNA is pelleted (12.000g for 10 mm ). washed with 75% ethanol (v/v in DEPC-treated water), air-dried for 5-10 mm. and resuspended in 0 1 ml of DEPC-treated water, followed bv 5-10 minutes at 55 oC Finally , after at least 1 minute on ice 200 units of Rnasin (Promega) are added
  • RNA preparations are stored at -80 oC for up to one month
  • the RNA precipitate can be stored at the wash stage of the protocol in 75%) ethanol for at least one year at -20 oC
  • Quality of the RNA isolated is assessed by running samples on 1 % agarose gels 1 x TBE gels stained with ethidium bromide are used to visualise total RNA yields c) The removal of DNA from Streptococcus pneumomae-derwed RNA
  • DNA is removed from 50 microgram samples of RNA by a 30 minute treatment at 37°C with 20 units of RNAase-free DNAasel (GenHunter) in the buffer supplied in a final volume of 57 microhters
  • the DNAase is inactivated and removed by treatment with TRIzol LS Reagent (Gibco BRL. Life Technologies) according to the manufacturers protocol
  • DNAase treated RNA is resuspended in 100 microhtres of DEPC treated water with the addition of Rnasin as described before d) Primer extension analysis
  • RNAse-treated RNA 15 ⁇ g of DNAse-treated RNA is denatured together with 5pmol of 6-FAM-5' fluorescently tagged primer (5 ' CTTCTGCAGCAACAGCGAGAGTCACATCA3 ' ) [SEQ ID NO 3] (PE Applied Biosystems). corresponding to the 5' end of the lacA gene, in lO ⁇ l final volume at 70oC for 10 mm The mixture is allowed to cool down to 55oC over a 30 mm period and lO ⁇ l of cDNA synthesis reagents (Thermosc ⁇ pt RT-PCR S stem. Gibco BRL) are added cDNA synthesis is performed at 55oC for 60 mm After denaturation of the reverse transc ⁇ ptase at 85oC for 5mm. the RNA is degraded bv a RNAse treatment at 37oC for 20 mm with 2 units of RNAse H and 2196 units of RNAse T
  • RNA samples 5 microgram samples of DNAase-treated RNA are reverse transc ⁇ bed using a SuperSc ⁇ pt
  • Specific sequence quantification occurs by amplification of target sequences m the PE Applied Biosv stems 7700 Sequence Detection System with template specific primers and in the presence of Sybr Green dye Amplification with annealing temperatures that only allow specific product formation is monitored by measuring the signal generated by accumulation of Sybr Green dy e with an attached CCD camera Standardization to chromosomal DNA allows correlation between signal generated and product accumulated Relative quantitation is normalized to a housekeepmg gene and a calibrator sample (umnduced control)
  • PCR reactions are set up using the PE Applied Biosystem SybrGreen PCR Core Reagent Kit according to the instructions supplied such that each reaction contains 5 microhters 10X SybrGreen buffer. 7 microhters 25 mM MgCl 2 . 5 microhters 300 nM forward primer. 5 microhters reverse primer 1 microhter each 10 mM dATP. 10 mM dCTP. 10 mM dGTP and 20 mM dUTP. 13 25 microhters distilled water. 0 5 microhters AmpErase UNG. and 0 25 microhters AmpliTaq DNA polymerase to give a total volume of 45 microhters
  • - 24 Amplification proceeds under the following thermal cycling conditions 50°C hold for 2 minutes. 95 °C hold for 10 minutes. 40 cycles of 95 °C for 15 seconds and 60°C for 1 minute, followed by a 25 °C hold until sample is retrieved Detection occurs real-time Data is collected at the end of the reaction RT/PCR controls may include no reverse transc ⁇ ptase reactions to verify the absence of contaminating genomic DNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pulmonology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des polynucléotides agents promoteurs lacA et des procédés de production et d'utilisation de ces polynucléotides, ainsi que de leurs variants, agonistes and antagonistes, et leurs utilisations.
PCT/US2000/017051 1999-06-22 2000-06-21 Laca WO2000078785A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14034799P 1999-06-22 1999-06-22
US60/140,347 1999-06-22

Publications (1)

Publication Number Publication Date
WO2000078785A1 true WO2000078785A1 (fr) 2000-12-28

Family

ID=22490827

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/017051 WO2000078785A1 (fr) 1999-06-22 2000-06-21 Laca

Country Status (1)

Country Link
WO (1) WO2000078785A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998018931A2 (fr) * 1996-10-31 1998-05-07 Human Genome Sciences, Inc. Polynucleotides et sequences de streptococcus pneumoniae

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998018931A2 (fr) * 1996-10-31 1998-05-07 Human Genome Sciences, Inc. Polynucleotides et sequences de streptococcus pneumoniae

Similar Documents

Publication Publication Date Title
US6268177B1 (en) Isolated nucleic acid encoding nucleotide pyrophosphorylase
WO2000027427A1 (fr) POLYPEPTIDES trmD
WO2000078784A1 (fr) Trep
WO2000078785A1 (fr) Laca
US6228625B1 (en) metK from Streptococcus pneumoniae
US20060115831A1 (en) Map
WO2000044778A1 (fr) mvk
US6511839B1 (en) Fucose kinase
US6270762B1 (en) tdk
WO2001012649A1 (fr) Aga
US6291230B1 (en) Galk promoter
US6245891B1 (en) nusB polypeptides and polynucleotides and methods thereof
WO2000049042A1 (fr) nadE
WO2000024754A1 (fr) POLYPEPTIDES infb ET POLYNUCLEOTIDES DE STREPTOCOCCUS PNEUMONIAE
WO2001007463A1 (fr) Represseur
WO2000065026A2 (fr) Polypeptides yycg
WO2001007458A1 (fr) POLYPEPTIDES lacR
WO2001024635A1 (fr) Asue
WO2001032021A1 (fr) ytgp
EP1130969A1 (fr) Polypeptides et polynucleotides murf2
WO2000070075A1 (fr) Streptococcus pneumoniae yers
WO2000068427A1 (fr) yphC
WO2000065089A1 (fr) Tkta
WO2001007460A1 (fr) FucR
WO2000018797A1 (fr) Map

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP