WO2000068427A1 - yphC - Google Patents

yphC Download PDF

Info

Publication number
WO2000068427A1
WO2000068427A1 PCT/US2000/011894 US0011894W WO0068427A1 WO 2000068427 A1 WO2000068427 A1 WO 2000068427A1 US 0011894 W US0011894 W US 0011894W WO 0068427 A1 WO0068427 A1 WO 0068427A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
seq
polynucleotide
sequence
compnsmg
Prior art date
Application number
PCT/US2000/011894
Other languages
English (en)
Inventor
Magdalena Zalacain
Sanjoy Biswas
Martin K. R. Burnham
Patrick V. Warren
Karen A. Ingraham
Alison F. Chalker
Chi Young So
David J. Holmes
Richard L. Warren
Stephanie Van Horn
Christopher M. Traini
Original Assignee
Smithkline Beecham Corporation
Smithkline Beecham Plc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Smithkline Beecham Corporation, Smithkline Beecham Plc filed Critical Smithkline Beecham Corporation
Publication of WO2000068427A1 publication Critical patent/WO2000068427A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C07K14/3156—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)

Definitions

  • This uwention relates to newh identified polynucleotides and pohpeptides. and their production and uses, as well as their variants, agonists and antagonists, and their uses
  • the invention relates to polynucleotides and pohpeptides of the yphC (GTP-binding proteins) family, as well as their va ⁇ ants. herem referred to as "yphC,” “yphC polynucleot ⁇ de(s),” and “yphC polypept ⁇ de(s)” as the case be
  • the Streptococci make up a medically important genera of microbes known to cause several types of disease in humans, mcludmg, for example, otitis media, conjunctivitis, pneumonia, bacteremia. meningitis, sinusitis, pleural empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospinal fluid Smce its isolation more than 100 years ago.
  • Streptococcus pneumomae has been one of tlie more intensively studied microbes For example, much of our earlv understandmg that DNA is in fact tlie genetic mate ⁇ al was predicated on the work of G ⁇ ffith and of Avery, Macleod and McCartv us g this microbe Despite the vast amount of research with S pneumomae, many questions concerning tlie virulence of this microbe remain It is particularly preferred to employ Streptococcal genes and gene products as targets for tlie development of antibioUcs
  • Tlie frequency of Streptococcus pneumomae infections has ⁇ sen dramaticalh in tlie past few decades This has been att ⁇ ubbed to the emergence of multiply antibiotic resistant strains and an mcreasmg population of people with weakened immune systems It is no longer uncommon to isolate Streptococcus pneumomae strains that are resistant to some or all of tlie standard antibioUcs This phenomenon has created an unmet medical need and demand for new anti-microbial agents, vaccmes.
  • polynucleotides and pohpeptides such as the ⁇ phC embodiments of the invention, that have a present benefit of. among other things, bemg useful to screen compounds for antimicrobial activity Such factors are also useful to determine their role in pathogenesis of infection. dysfunction and disease There is also a need for identification and characterization of such factors and their antagonists and agonists to find ways to prevent, ameliorate or correct such infection. d ⁇ sfunction and disease
  • the present mvention relates to yphC, m particular yphC polypeptides and yphC polynucleotides recombinant mate ⁇ als and methods for their production
  • the mvention relates to methods for usmg such pohpeptides and polynucleotides.
  • the invention relates to methods for identifying agonists and antagonists using the mate ⁇ als provided by the invention, and for treatmg microbial infections and conditions associated ith such infections with the identified agomst or antagomst compounds
  • the mvention relates to diagnostic assays for detecting diseases associated w th microbial infections and conditions associated with such infections, such as assays for detectmg yphC expression or activity
  • the mvention relates to yphC polypeptides and polynucleotides as desc ⁇ bed in greater detail below
  • the mvention relates to polypeptides and polynucleotides of a yphC of Streptococcus pneumomae, that is related by ammo acid sequence homology to B subtilis yphC pohpeptide
  • the mvention relates especially to yphC having a nucleotide and ammo acid sequences set out m Table 1 as SEQ ID NO 1 and SEQ ID NO 2 respectively
  • sequences recited in the Sequence Listmg below as "DNA” represent an exemplification of the mvention. smce those of ordmary skill will recogmze that such sequences can be usefully employed m polynucleotides m general, mcludmg ⁇ bopolynucleotides
  • a deposit compnsing a Streptococcus pneumomae 0100993 strain has been deposited with the National Collections of Industrial and Marine Bactena Ltd (herem “NCIMB”). 23 St Machar D ⁇ e Aberdeen AB2 1RY, Scotland on 11 April 1996 and assigned deposit number 40794 The deposit was desc ⁇ bed as Streptococcus pneumomae 0100993 on deposit On 17 Ap ⁇ l 1996 a Streptococcus pneumomae 0100993 DNA hbraiy m E coli was similarh deposited with the NCIMB and assigned deposit number 40800 The Streptococcus pneumomae strain deposit is referred to herem as "the deposited strain” or as "the DNA of the deposited strain "
  • the deposited strain comp ⁇ ses a full length yphC gene
  • the sequence of the polynucleotides comp ⁇ sed m the deposited strain, as well as the ammo acid sequence of any pohpeptide encoded thereby, are controlling m the event of any conflict with any desc ⁇ ption of sequences herem
  • the deposit of the deposited strain has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for Purposes of Patent Procedure
  • the deposited strain will be irrevocably and without restnction or condition released to the public upon tlie issuance of a patent
  • the deposited strain is provided merely as convemence to those of skill m tlie art and is not an admission that a deposit is required for enablement, such as that required under 35 U S C ⁇ 112
  • a license may be required to make, use or sell the deposited strain, and compounds de ⁇ ved therefrom, and no such license is hereby granted
  • an isolated nucleic acid molecule encoding a mature polypeptide expressible by the Streptococcus pneumomae 0100993 strain, which polypeptide is comp ⁇ sed in the deposited strain
  • Furtlier provided by the mvention are yphC polynucleotide sequences m the deposited strain, such as DNA and RNA, and ammo acid sequences encoded thereby Also provided by the mvention are yphC polypeptide and polynucleotide sequences isolated from the deposited strain
  • YphC polypeptide of the mvention is substantially phylogenetically related to other proteins of the yphC (GTP-binding proteins) family
  • polypeptides of Streptococcus pneumomae referred to herem as "yphC” and “yphC polypeptides” as well as biologically, diagnostically . proplwlacticalh clinically or therapeutically useful variants thereof, and compositions compnsing the same
  • the present mvention further provides for an isolated polypeptide that (a) comp ⁇ ses or consists of an am o acid sequence that has at least 95% identity, most preferably at least 97-99% or exact identity to that of SEQ ID NO 2 over the entire length of SEQ ID NO 2.
  • polypeptides of the mvention mclude a polypeptide of Table 1 [SEQ ID NO 2] (in particular a mature polypeptide) as well as polypeptides and fragments, particularly those that has a biological activity of yphC.
  • R 1 X-(R 1 ) m -(R 2 )-(R 3 )n-Y
  • X is hydrogen, a metal or any other moiety descnbed herem for modified polypeptides, and at the carboxyl terminus
  • Y is hydrogen, a metal or any other moiety descnbed herem for modified polypeptides
  • Ri and R3 are any ammo acid residue or modified ammo acid residue
  • m is an mteger between 1 and 1000 or zero
  • n is an mteger between 1 and 1000 or zero
  • R 2 is an ammo acid sequence of the mvention, particularly an ammo acid sequence selected from Table 1 or modified forms thereof
  • R 2 is o ⁇ ented so that its am o terminal ammo acid residue is at the left, covalently bound to Ri and its carboxy terminal ammo acid residue is at the ⁇ ght, covalently bound to R3 Any stretch of ammo acid residues denoted by
  • a polypeptide of the mvention is denved from Streptococcus pneumomae. however, it may preferably be obtained from other organisms of the same taxonomic genus
  • a polypeptide of the mvention may also be obtained, for example, from organisms of the same taxonomic family or order
  • a fragment is a va ⁇ ant polypeptide havmg an ammo acid sequence that is entirely the same as part but not all of any ammo acid sequence of any polypeptide of the mvention
  • fragments may be "free-standing," or compnsed within a larger polypeptide of which they form a part or region, most preferably as a smgle continuous region m a smgle larger polypeptide Preferred fragments mclude.
  • truncation polypeptides havmg a portion of an am o acid sequence of Table 1 [SEQ ID NO 2], or of variants thereof, such as a continuous senes of residues that mcludes an ammo- and/or carboxyl-terminal ammo acid sequence Degradation forms of the polypeptides of the mvention produced by or m a host cell, particularly a Streptococcus pneumomae.
  • fragments characterized bv structural or functional att ⁇ butes such as fragments that compnse alpha-helix and alpha-hehx forming regions, beta-sheet and beta-sheet-forming regions, turn and tum-formmg regions, coil and coil-forming regions, hydrophihc regions, hydrophobic regions alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic mdex regions
  • fragments m include an isolated polypeptide comprising an amino acid sequence havmg at least 15, 20, 30, 40, 50 or 100 contiguous amino acids trom the amino acid sequence of SEQ ID NO.2, or an isolated polypeptide comprising an amino acid sequence havmg at least 15, 20, 30, 40, 50 or 100 contiguous amino acids truncated or deleted trom the amino acid sequence ot SEQ ID NO.2 Fragments of the polypeptides of the mvention may be employed for producmg the
  • the polynucleotide compnses a region encoding yphC polypeptides comp ⁇ smg a sequence set out m Table 1 [SEQ ID NO 1] that mcludes a full length gene, or a variant thereof The Applicants beheve that this full length gene is essential to the growth and/or survival of an organism that possesses it, such as Streptococcus pneumomae
  • isolated nucleic acid molecules encoding and/or expressing yphC polypeptides and polynucleotides, particularly Streptococcus pneumomae yphC polypeptides and polynucleotides, mcludmg, for example, unprocessed RNAs, nbozyme RNAs, mRNAs, cDNAs, genomic DNAs, B- and Z-DNAs
  • Further embodiments of the mvention mclude biological
  • mcludmg at least one full length gene, that encodes a yphC polypeptide having a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] and polynucleotides closely related thereto and variants thereof
  • yphC polypeptide from Streptococcus pneumomae compnsmg or consisting of an ammo acid sequence of Table 1 [SEQ ID NO 2], or a variant thereof
  • a polynucleotide of the mvention encoding yphC polypeptide may be obtained usmg standard cloning and screening methods, such as those for cloning and sequencmg chromosomal DNA fragments from bactena usmg Streptococcus pneumomae 0100993 cells as starting matenal.
  • a polynucleotide sequence of the invention such as a polynucleotide sequence given m Table 1 [SEQ ID NO 1]
  • a library of clones of chromosomal DNA of Streptococcus pneumomae 0100993 in E coh or some other suitable host is probed with a radiolabeled ohgonucleotide preferably a 17-mer or longer, denved from a partial sequence
  • Clones carrying DNA identical to that of the probe can then be distinguished usmg stringent hybndization conditions
  • sequencmg the individual clones thus identified by hybndization with sequencmg primers designed from the ongmal polypeptide or polynucleotide sequence it is then possible to extend the polynucleotide sequence in both directions to determine a full length gene sequence Convemently, such sequencmg is performed, for example,
  • each DNA sequence set out m Table 1 [SEQ ID NO 1] contains an open reading frame encoding a protem havmg about the number of ammo acid residues set forth m Table 1 [SEQ ID NO 2] with a deduced molecular weight that can be calculated usmg ammo acid residue molecular weight values well known to those skilled in the art
  • the present mvention provides for an isolated polynucleotide compnsmg or consistmg of (a) a polynucleotide sequence that has at least 95% identity, even more preferably at least 97%. still more preferably at least 99%, yet still more preferably at least 99 5% or exact identity to SEQ ID NO 1 over the entire length of SEQ ID NO 1, or the entire length of that portion of SEQ ID NO 1 which encodes SEQ ID NO 2, (b) a polynucleotide sequence encoding a polypeptide that has at least 95% identity, even more preferably at least 97-99% or 100% exact, to the ammo acid sequence of SEQ ID NO 2, over the entire length of SEQ ID NO 2
  • mcludmg homologs and orthologs from species other than Streptococcus pneumomae may be obtained by a process that compnses the steps of screening an approp ⁇ ate library under stringent hybndization conditions with a labeled or detectable probe consistmg of or compnsmg the sequence of SEQ ID NO 1 or a fragment thereof, and isolating a full-length gene and/or genomic clones compnsmg said polynucleotide sequence
  • the mvention provides a polynucleotide sequence identical over its entire length to a coding sequence (open reading frame) m Table 1 [SEQ ID NO 1] Also provided by the mvention is a coding sequence for a mature polypeptide or a fragment thereof, by itself as well as a coding sequence for a mature pohpeptide or a fragment in reading frame with another coding sequence, such as a sequence encoding a leader or secretory sequence, a pre-, or pro- or prepro-protein sequence
  • the polynucleotide of the mvention may also compnse at least one non-coding sequence, mcludmg for example, but not limited to at least one non-coding 5' and 3' sequence, such as the transcnbed but non-translated sequences, termination signals (such as rho-dependent and rho-mdependent termination signals), nbosome bmdmg sites, Kozak sequences, sequences that stabilize mRNA, introns, and
  • the marker sequence is a hexa-histidine peptide, as provided m the pQE vector (Qiagen, Inc ) and descnbed m Gentz et al , Proc Natl Acacl Set , USA 86 821-824 (1989), or an HA peptide tag (Wdson et al . Cell 37 767 (1984). both of that may be useful m purifying polypeptide sequence fused to them
  • Polynucleotides of the mvention also mclude. but are not limited to, polynucleotides compnsmg a structural gene and its naturally associated sequences that control gene expression
  • a prefened embodiment of the mvention is a polynucleotide of consistmg of or compnsmg nucleotide 1 to the nucleotide immediately upstream of or mcludmg nucleotide 1309 set forth m SEQ ID NO 1 of Table 1, both of that encode a yphC polypeptide
  • the mvention also mcludes a polynucleotide consisting of or compnsmg a polynucleotide of the formula
  • Ri and R3 is independently any nucleic acid residue or modified nucleic acid residue
  • m is an mteger between 1 and 3000 or zero
  • n is an mteger between 1 and 3000 or zero
  • R 2 is a nucleic acid sequence or modified nucleic acid sequence of the mvention.
  • R 2 is oriented so that its 5' end nucleic acid residue is at the left, bound to Ri and its 3' end nucleic acid residue is at the nght. bound to R3 Any stretch of nucleic acid residues denoted by either Rj and/or R . where m and/or n is greater than 1. may be either a heteropolymer or a homopolymer, preferably a heteropolymer Where, m a prefened embodiment.
  • the polynucleotide of the above formula is a closed, circular polynucleotide, that can be a double-stranded polynucleotide wherem the formula show s a first strand to which the second strand is complementary
  • m and/or n is an mteger between 1 and 1000.
  • Other prefened embodiments of the mvention are provided where m is an mteger between 1 and 50. 100 or 500, and n is an mteger between 1 and 50, 100, or 500
  • polynucleotide of the mvention is denved from Streptococcus pneumomae, however, it may preferably be obtained from other organisms of the same taxonomic genus
  • a polynucleotide of tlie mvention may also be obtained, for example, from organisms of the same taxonomic family or order
  • polynucleotide encoding a polypeptide encompasses polynucleotides that mclude a sequence encoding a polypeptide of the mvention, particularly a bactenal polypeptide and more particularly a polypeptide of the Streptococcus pneumomae yphC havmg an ammo acid sequence set out in Table 1 [SEQ ID NO.2]
  • the term also encompasses polynucleotides that mclude a smgle contmuous region or discontinuous regions encoding the polypeptide (for example, polynu).
  • the mvention further relates to variants of the polynucleotides descnbed herem that encode variants of a polypeptide having a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] Fragments of polynucleotides of the mvention may be used, for example, to synthesize full-length polynucleotides of the mvention
  • prefened embodiments are polynucleotides encoding yphC variants, that have the ammo acid sequence of yphC polypeptide of Table 1 [SEQ ID NO.2] m which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, modified, deleted and/or added, in any combmation Especially prefened among these are silent substitutions, additions and deletions, that do not alter the properties and activities of yphC polypeptide
  • Prefened isolated polynucleotide embodiments also mclude polynucleotide fragments, such as a polynucleotide comprising a nuclic acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous nucleic acids from the polynucleotide sequence of SEQ ID NO: l, or an polynucleotide comprising a nucleic acid sequence havmg at least 15, 20, 30, 40, 50 or 100 contiguous nucleic acids truncated or deleted from the 5' and/or 3' end of the polynucleotide sequence of SEQ ID NO. l
  • prefened embodiments of the mvention are polynucleotides that are at least 95% or 97% identical over their entire length to a polynucleotide encoding yphC polypeptide havmg an am o acid sequence set out m Table 1 [SEQ ID NO 2], and polynucleotides that are complementary to such polynucleotides
  • Most highly prefened are polynucleotides that compnse a region that is at least 95% are especially prefened
  • those with at least 97% are highly prefened among those with at least 95% and among these those with at least 98% and at least 99% are particularly highly preferred, with at least 99% bemg the more prefened
  • Prefened embodiments are polynucleotides encoding polypeptides that retain substantialh the same biological function or activity as a mature polypeptide encoded by a DNA of Table 1 [SEQ ID NO 1]
  • polynucleotides that hybndize, particularly under strmgent conditions to yphC polynucleotide sequences, such as those polynucleotides in Table 1
  • the mvention further relates to polynucleotides that hybndize to the polynucleotide sequences provided herem
  • the mvention especially relates to polynucleotides that hybndize under strmgent conditions to the polynucleotides descnbed herem
  • strmgent conditions and “strmgent hybndization conditions” mean hybndization occurring only if there is at least 95% and preferably at least 97% identity between the sequences
  • strmgent hvbridization conditions is overnight incubation at 42°C m a solution compnsmg 50% formamide, 5x SSC (150mM NaCl, 15mM t ⁇ sodium citrate), 50 M sodium phosphate (pH7 6), 5x Denhardt's solution, 10% dextran sulfate, and 20 micrograms/ml of denatured, sheared salmon sperm DNA.
  • the mvention also provides a polynucleotide consistmg of or compnsmg a polynucleotide sequence obtained by screening an appropnate library compnsmg a complete gene for a polynucleotide sequence set forth m SEQ ID NO 1 under strmgent hybndization conditions with a probe having the sequence of said polynucleotide sequence set forth in SEQ ID NO 1 or a fragment thereof, and isolating said polynucleotide sequence Fragments useful for obtaining such a polynucleotide mclude. for example, probes and pnmers fully descnbed elsewhere herem As discussed elsewhere herem regarding polynucleotide assays of the mvention.
  • the polynucleotides of the mvention. may be used as a hybndization probe for RNA, cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding yphC and to isolate cDNA and genomic clones of other genes that have a high identity, particularly high sequence identity, to a yphC gene
  • Such probes generally will compnse at least 15 nucleotide residues or base pairs
  • such probes will at least 30 nucleotide residues or base pairs and may have at least 50 nucleotide residues or base pairs
  • Particularh prefened probes will have at least 20 nucleotide residues or base pairs and will have lee than 30 nucleotide residues or base pairs
  • a coding region of a yphC gene may be isolated by screening usmg a DNA sequence provided in Table 1 [SEQ ID NO 1] to synthesize an ohgonucleotide probe
  • a labeled ohgonucleotide having a sequence complementary to that of a gene of the mvention is then used to screen a librarv of cDNA, genomic DNA or mRNA to determine which members of the library the probe hybndizes to
  • polynucleotides and polypeptides of the mvention may be employed, for example, as research reagents and matenals for discovery of treatments of and diagnostics for diseases, particularly human diseases, as further discussed herem relating to polynucleotide assays
  • SEQ ID NOS 1 or 2 may be used m the processes herem as described, but preferably for PCR, to determine whether or not the polynucleotides identified herem in whole or m part are transcnbed m bactena m infected tissue It is recognized that such sequences will also have utility m diagnosis of the stage of infection and type of mfection the pathogen has attained
  • the mvention also provides polynucleotides that encode a polypeptide that is a mature protem plus additional ammo or carboxyl-terminal ammo acids, or ammo acids intenor to a mature pohpeptide (when a mature form has more than one polypeptide chain, for instance) Such sequences may play a role in processing of a protem from precursor to a mature form, may allow protem transport, may lengthen or shorten protem half-life or may facilitate manipulation of a protem for assay or production, among other things As generally is the case in vivo, the additional ammo acids may be processed
  • a precursor protein, havmg a mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such inactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called proproteins As will be recognized, the entire polypeptide encoded by an open reading frame is often not required for activity Accordingly, it has become routine m molecular biology to map the boundanes of the primary structure required for activity with N-terrninal and C-terminal deletion experiments These experiments utilize exonuclease digestion or convement restriction sites to cleave coding nucleic acid sequence For example,
  • nucleic acid of SEQ ED NO 1 readily provides contiguous fragments of SEQ ID NO 2 sufficient to provide an activity, such as an enzymatic, bmdmg or antibody-inducing activity Nucleic acid sequences encoding such fragments of SEQ ID NO 2 and variants thereof as descnbed herem are within the mvention. as are polypeptides so encoded
  • a polynucleotide of the mvention may encode a mature protein, a mature protem plus a leader sequence (which may be refened to as a preprotem), a precursor of a mature protem havmg one or more prosequences that are not the leader sequences of a preprotem, or a preproprotein. that is a precursor to a proprotein. havmg a leader sequence and one or more prosequences, that generally are removed du ⁇ ng processing steps that produce active and mature forms of the polypeptide
  • the mvention also relates to vectors that comp ⁇ se a polynucleotide or polynucleotides of tlie mvention, host cells that are genetically engmeered with vectors of the mvention and the production of polypeptides of the mvention by recombinant techniques Cell-free translation systems can also be employed to produce such proteins using RNAs denved from the DNA constructs of the mvention
  • Recombinant polypeptides of the present mvention may be prepared by processes well known m those skilled m the art from genetically engmeered host cells compnsmg expression sy stems Accordingly .
  • the present mvention relates to expression systems that compnse a polynucleotide or polvnucleotides of the present mvention, to host cells that are genetically engmeered w th such expression systems, and to the production of polypeptides of the mvention by recombinant techniques
  • host cells can be genetically engmeered to incorporate expression systems or portions thereof or polynucleotides of the mvention
  • Introduction of a polynucleotide mto the host cell can be effected by methods descnbed in mans standard laboratory manuals, such as Davis, et al . BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook. et al , MOLECULAR CLONING A LABORATORY MANUAL. 2nd Ed . Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y (1989), such as, calcium phosphate transfection, DEAE-dextran mediated transfection. transvection, microinjection, catiomc hpid-mediated transfection. electroporation transduction, scrape loading, ballistic introduction and infection
  • bactenal cells such as cells of streptococci, staphylococci, enterococci E colt, streptomyces, cyanobactena, Bacillus subtilis, and Streptococcus pneumomae
  • fungal cells such as cells of a yeast, Kluveromyce , Saccharomyces , a basidiomycete, Candida a ⁇ bicans and Aspergillus
  • insect cells such as cells of Drosoph ⁇ a S2 and Spodoptera Sf9.
  • animal cells such as CHO, COS, HeLa, C 127, 3T3, BHK, 293, CV-1 and Bowes melanoma cells
  • plant cells such as cells of a gymnosperm or angiosperm
  • vectors include, among others, chromosomal-, episomal- and virus-denved vectors, for example, vectors denved from bactenal plasmids, from bacte ⁇ ophage. from transposons, from yeast episomes.
  • the expression system constructs ma ⁇ comp ⁇ se control regions that regulate as well as engender expression
  • any system or vector suitable to maintain, propagate or express polynucleotides and/or to express a polypeptide m a host may be used for expression in this regard
  • the appropnate DNA sequence may be inserted mto the expression system by any of a vanety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al , MOLECULAR CLONING, A LABORATORY MANUAL,
  • appropnate secretion signals may be incorporated mto the expressed polypeptide
  • These signals may be endogenous to the polypeptide or they may be heterologous signals
  • Polypeptides of the invention can be recovered and purified from recombinant cell cultures bv well- known methods mcludmg ammomum sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography. phosphocellulose chromatography , hydrophobic interaction chromatographv affinity chromatography. hydroxylapatite chromatography . and lectin chromatography Most preferably , high performance hquid chromatography is employed for purification
  • Well known techniques for refolding protem may be employed to regenerate active conformation when the polypeptide is denatured dunng isolation and or purification
  • This mvention is also related to the use of yphC polynucleotides and polypeptides of the mvention for use as diagnostic reagents Detection of yphC polynucleotides and/or polypeptides in a eukaryote particularly a mammal, and especially a human, will provide a diagnostic method for diagnosis of disease.
  • Eukaryotes, particularly mammals, and especially humans, particularly those infected or suspected to be infected with an orgamsm comp ⁇ smg the yphC gene or protein may be detected at the nucleic acid or ammo acid level by a vanety of ell known techniques as well as by methods provided herem
  • Polypeptides and polynucleotides for prognosis, diagnosis or other analysis may be obtained from a putatively infected and/or infected individual's bodily matenals
  • Polynucleotides from any of these sources, particularly DNA or RNA may be used directly for detection or may be amplified enzymatically by usmg PCR or any other amplification technique p ⁇ or to analysis RNA, particularly mRNA.
  • cDNA and genomic DNA may also be used m the same ways Usmg amplification, characterization of the species and stram of infectious or resident orgamsm present m an mdividual, may be made by an analysis of the genotype of a selected polynucleotide of the organism Deletions and insertions can be detected by a change m size of the amplified product m comparison to a genotype of a reference sequence selected from a related orgamsm, preferably a different species of the same genus or a different strain of the same species Pomt mutations can be identified by hybndizmg amplified DNA to labeled yphC polynucleotide sequences Perfectly or significantly matched sequences can be distinguished from imperfectly or more significantly mismatched duplexes by DNase or RNase digestion, for DNA or RNA respectively, or by detecting differences m meltmg temperatures or renaturation kinetics Polynucleotide sequence differences may also be detected by alterations
  • an array of ohgonucleotides probes comp ⁇ smg yphC nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of. for example, genetic mutations serotype.
  • the present mvention relates to a diagnostic kit that compnses
  • kits (a) a polynucleotide of the present mvention, preferably the nucleotide sequence of SEQ ID NO 1, or a fragment thereof, (b) a nucleotide sequence complementary to that of (a), (c) a polypeptide of the present mvention, preferably the polypeptide of SEQ ID NO 2 or a fragment thereof, or (d) an antibodv to a polypeptide of the present mvention, preferably to the polypeptide of SEQ ID NO 2
  • any such kit may compnse a substantial component
  • Such a kit will be of use m diagnosing a disease or susceptibility to a Disease, among others
  • This mvention also relates to the use of polynucleotides of the present mvention as diagnostic reagents Detection of a mutated form of a polynucleotide of the mvention, preferable. SEQ ED NO 1.
  • Organisms particularly infectious organisms, carrymg mutations m such polynucleotide may be detected at the polynucleotide level by a vanety of techniques, such as those descnbed elsewhere herem
  • the differences in a polynucleotide and/or polypeptide sequence between organisms possessing a first phenotype and organisms possessmg a different, second different phenotype can also be determined If a mutation is observed m some or all organisms possessmg the first phenotype but not in any organisms possessmg the second phenotype, then the mutation is likely to be the causative agent of the first phenotype
  • Cells from an organism carrymg mutations or polymorphisms (allehc variations) m a polynucleotide and/or polypeptide of the mvention may also be detected at the polynucleotide or polypeptide level bv a vanety of techniques, to allow for serotyping, for example For example.
  • RT-PCR can be used to detect mutations in the RNA It is particularly prefened to use RT-PCR m conjunction with automated detection systems, such as, for example, GeneScan RNA, cDNA or genomic DNA may also be used for the same purpose PCR
  • PCR primers complementary to a polynucleotide encoding yphC polypeptide can be used to identify and analyze mutations
  • the mvention further provides these printers with 1. 2. 3 or 4 nucleotides removed from the 5' and/or the 3' end These primers may be used for, among other things, amplifying yphC DNA and/or RNA isolated from a sample de ⁇ v ed from an mdividual.
  • the primers may be used to amplify a polynucleotide isolated from an infected mdividual, such that the polynucleotide may then be subject to vanous techmques for elucidation of the polynucleotide sequence In this way . mutations in the polynucleotide sequence may be detected and used to diagnose and/or prognose the infection or its stage or course, or to serotype and/or classify' the infectious agent
  • the mvention further provides a process for diagnosing, disease, preferably bactenal infections more preferably infections caused by Streptococcus pneumomae. comprising determining from a sample derived from an individual, such as a bodily material an increased level of expression of poly nucleotide having a sequence of Table 1 [SEQ ID NO 1] Increased or decreased expression of a yphC polynucleotide can be measured usmg any on of the methods well known m the art for the quantitation of polynucleotides. such as. for example, amplification.
  • a diagnostic assay m accordance with the mvention for detecting over-expression of yphC polypeptide compared to normal control tissue samples may be used to detect the presence of an infection, for example Assay techmques that can be used to determine levels of a yphC polypeptide, m a sample denved from a host, such as a bodily matenal, are well-known to those of skill m the art
  • Assay techmques that can be used to determine levels of a yphC polypeptide, m a sample denved from a host, such as a bodily matenal, are well-known to those of skill m the art
  • Such assay methods mclude radioimmunoassays, competitive-binding assays.
  • Polypeptides and polynucleotides of the mvention may also be used to assess the bmdmg of small molecule substrates and hgands in, for example, cells, cell-free preparations, chemical hbranes. and natural product mixtures
  • substrates and hgands may be natural substrates and hgands or may be structural or functional rnimetics See, e g , Cohgan et al , Current Protocols in Immunology 1(2) Chapter 5 (1991)
  • Polypeptides and polynucleotides of the present mvention are responsible for many biological functions, mcludmg many disease states, in particular the Diseases herem mentioned It is therefore desirable to devise screenmg methods to identify compounds that agonize (e g , stimulate) or that antagonize (e g , ⁇ nl ⁇ b ⁇ t) the function of the polypeptide or polynucleotide Accordingly, m a further aspect the present mvention provides for a method of
  • Compounds may be employed for therapeutic and prophylactic purposes for such Diseases as herem mentioned
  • Compounds may be identified from a vanety of sources, for example, cells, cell-free preparations, chemical hbranes. and natural product mixtures
  • Such agonists and antagonists so-identified may be natural or modified substrates, hgands. receptors, enzymes, etc as the case may be. of yphC polypeptides and polynucleotides. or may be structural or functional mimetics thereof (see Cohgan et al , Current Protocols in Immunology 1(2) Chapter 5 (1991))
  • the screenmg methods mav simply measure the bmdmg of a candidate compound to the polypeptide or polynucleotide, or to cells or membranes bearing the polypeptide or polynucleotide. or a fusion protem of the polypeptide by means of a label directly or indirectly associated with the candidate compound Alternatively, the screenmg method may involve competition with a labeled competitor Further, these screening methods may test whether the candidate compound results m a signal generated by activation or inhibition of the polypeptide or polynucleotide usmg detection systems appropriate to die cells compnsmg the polypeptide or polynucleotide Inhibitors of activation are generally assayed in the presence of a known agomst and the effect on activation bv the agonist by the presence of the candidate compound is observed Constitutively active polypeptide and/or constitutiv ely expressed polypeptides and polynucleotides may be employed m screenmg methods for inverse agonists, in the absence of an
  • polypeptides and antibodies that bmd to and/or mteract with a polypeptide of the present mvention may also be used to configure screenmg methods for detectmg the effect of added compounds on the production of mRNA and/or polypeptide in cells
  • an ELISA assay may be constructed for measurmg secreted or cell associated levels of polypeptide usmg monoclonal and polyclonal antibodies by standard methods known in the art This can be used to discover agents that may inhibit or enhance the production of polypeptide (also called antagomst or agomst, respectively) from suitably manipulated cells or tissues
  • the mvention also provides a method of screenmg compounds to identify those that enhance (agomst) or block (antagomst) the action of yphC polypeptides or polynucleotides, particularly those compounds that are bacte ⁇ static and/or bactencidal
  • the method of screenmg may mvolve high-throughput techmques
  • a synthetic reaction mix to screen for agonists or antagonists, a synthetic reaction mix, a cellular compartment, such as a membrane, cell envelope or cell wall, or a preparation of any thereof, compnsmg yphC polypeptide and a labeled substrate or hgand of such polypeptide is incubated m the absence or the presence of a candidate molecule that may be a yphC agomst or antagomst
  • the ability of the candidate molecule to agonize or antagonize the yphC polypeptide is reflected in decreased bmdmg of the label
  • Molecules that bmd ell and. as the case mav be increase the rate of product production from substrate, mcrease signal transduction. or mcrease chemical channel activity are agonists Detection of the rate or level of, as the case may be, production of product from substrate, signal transduction, or chemical channel activity may be enhanced by usmg a reporter system Reporter systems that may be useful m this regard mclude but are not limited to colonmetnc. labeled substrate converted mto product, a reporter gene that is responsive to changes m yphC polynucleotide or pohpeptide activity, and bmdmg assays known in the art
  • Polypeptides of the mvention may be used to identify membrane bound or soluble receptors, if any, for such polypeptide, through standard receptor bmding techmques known m the art These techmques mclude, but are not limited to, hgand binding and crosslinking assays m which the polypeptide is labeled with a radioactive isotope (for instance, * ⁇ I), chemically modified (for instance, biotinylated), or fused to a peptide sequence suitable for detection or punfication, and mcubated with a source of the putative receptor (e g , cells, cell membranes, cell supernatants, tissue extracts, bodily matenals) Other methods mclude biophysical techmques such as surface plasmon resonance and spectroscopy These screenmg methods may also be used to identify agomsts and antagonists of the polypeptide that compete with the bindmg of the polypeptide to its receptor(s), if any Standard methods for conducting such assays are well
  • the fluorescence polarization value for a fluorescently-tagged molecule depends on the rotational correlation time or tumblmg rate Protem complexes, such as formed by yphC polypeptide associating vvrth another yphC polypeptide or other polypeptide, labeled to comprise a fluorescently- labeled molecule will have higher polarization values than a fluorescently labeled monome ⁇ c protem It is preferred that this method be used to characte ⁇ ze small molecules that disrupt polypeptide complexes
  • Fluorescence energy transfer may also be used charactenze small molecules that interfere with the formation of yphC polypeptide dimers, tnmers, tetramers or higher order structures, or structures formed by yphC polypeptide bound to another polypeptide
  • YphC polypeptide can be labeled with both a donor and acceptor fluorophore Upon mixing of the two labeled species and excitation of the donor fluorophore, fluorescence energy transfer can be detected by observing
  • YphC polypeptide can be coupled to a sensor chip at low site density such that covalently bound molecules will be monome ⁇ c Solution protem can then passed over the yphC polypeptide -coated surface and specific bmding can be detected in real-time by monitoring the change in resonance angle caused by a change in local refractive index
  • This technique can be used to characterize the effect of small molecules on kinetic rates and equilibrium bmdmg constants for yphC polypeptide self-association as well as an association of yphC polypeptide and another polypeptide or small molecule
  • a scintillation proximity assay may be used to characterize the interaction between an association of yphC polypeptide ith another yphC polypeptide or a different polypeptide YphC polypeptide can be coupled to a scintillation-filled bead Addition of radio-labeled yphC polypeptide results in bmding where the radioactive source molecule is in close proximity to the scintillation fluid Thus, signal is emitted upon yphC polypeptide bmdmg and compounds that prevent yphC polypeptide self-association or an association of yphC polypeptide and another polypeptide or small molecule will dimmish signal
  • bmdmg or mteraction preferably bemg associated with a second component capable of providing a detectable signal m response to the bmdmg or mteraction of the polypeptide and/or polynucleotide with the compound, and determining whether the compound bmds to or otherwise interacts with and activates or inhibits an activity or expression of the polypeptide and/or polynucleot
  • a polypeptide and/or polynucleotide of the present mvention may also be used m a method for the structure-based design of an agomst or antagomst of the polypeptide and/or polynucleotide, by (a) determinmg m the first mstance the three- dimensional structure of the polypeptide and/or polynucleotide.
  • the present mvention provides methods of treating abnormal conditions such as for instance, a Disease, related to either an excess of. an under-expression of, an elevated activity of, or a decreased activity of yphC polypeptide and/or polynucleotide
  • the invention also provides the use of the polypeptide. polynucleotide, agonist or antagonist of the invention to interfere with the initial physical mteraction between a pathogen or pathogens and a eukaryotic. preferably mammalian, host responsible for sequelae of infection
  • the molecules of the invention may be used m the prevention of adhesion of bacteria in particular gram positive and/or gram negative bactena, to eukaryotic, preferably mammalian, extracellular matrix protems on in-dwelling devices or to extracellular matnx protems in wounds, to block bacterial adhesion between eukaryotic, preferably mammalian, extracellular matnx protems and bacterial yphC protems that mediate tissue damage and/or, to block the normal progression of pathogenesis m infections initiated other than by the implantation of in-dwelling devices or by other surgical techniques
  • yphC agonists and antagonists to interfere with the initial physical mteraction between a
  • the antagonists and agonists of the mvention may be employed, for instance, to prevent, inhibit and/or treat diseases Hehcobacter pylori (herein "H pylori”) bacteria infect the stomachs of over one-third of the world's population causing stomach cancer, ulcers, and gastntis (International Agency for Research on Cancer (1994) Schistosomes, Liver Flukes and Hehcobacter Pylori (International Agency for Research on Cancer, Lyon.
  • H pylori diseases Hehcobacter pylori
  • Bodily mate ⁇ al(s) means any matenal denved from an mdividual or from an orgamsm infecting, infesting or inhabiting an mdividual, mcludmg but not limited to, cells, tissues and waste, such as. bone, blood, serum, cerebrospinal fluid, semen, saliva, muscle, cartilage, organ tissue, skm, urine, stool or autopsy mate ⁇ als
  • D ⁇ sease(s) means any disease caused by or related to infection by a bacte ⁇ a, mcludmg , for example, otitis media, conjunctivitis, pneumonia, bacteremia. meningitis, sinusitis, pleura! empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospmal fluid
  • “Host cell(s)” is a cell that has been introduced (e g , transformed or transfected) or is capable of mtroduction (e g , transformation or transfection) by an exogenous polynucleotide sequence
  • Identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case may be, as determined by comparing the sequences
  • identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determmed by the match between strings of such sequences "Identit " can be readily calculated by known methods, mcludmg but not limited to those described m
  • Polynucleotide embodiments further mclude an isolated polynucleotide compnsing a polynucleotide sequence having at least a 95, 97, 99, 99 5 or 100% identity to the reference sequence of SEQ ID NO 1.
  • said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO 1 or may mclude up to a certam mteger number of nucleotide alterations as compared to the reference sequence, wherem said alterations are selected from the group consistmg of at least one nucleotide deletion, substitution, mcludmg transition and transversion, or insertion, and wherem said alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, mterspersed either individually among the nucleotides m the reference sequence or m one or more contiguous groups within the reference sequence, and wherem said number of nucleotide alterations is determmed by multiplying the total number of nucleotides in SEQ ID NO 1 by the integer defining the percent identity divided by 100 and then subtractmg that product from said total number of nucleotides in SEQ ID NO 1, or
  • n n is the number of nucleotide alterations
  • x n is the total number of nucleotides m SEQ ID NO 1
  • y is 0 95 for 95%.
  • any non-mteger product of x n and y is rounded down to the nearest mteger prior to subtractmg it from x n
  • Alterations of a polynucleotide sequence encodmg the polypeptide of SEQ ID NO 2 may create nonsense, rmssense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations
  • Polypeptide embodiments further include an isolated polypeptide comprising a polypeptide having at least a 95, 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO 2.
  • said polypeptide sequence may be identical to the reference sequence of SEQ ID NO 2 or may include up to a certain integer number of amino acid alterations as compared to the reference sequence, wherem said alterations are selected from the group consisting of at least one amino acid deletion, substitution, mcludmg conservative and non-conservative substitution, or insertion, and wherem said alterations may occur at the ammo- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, mterspersed either individually among the ammo acids m the reference sequence or m one or more contiguous groups within the reference sequence, and wherein said number of ammo acid alterations is determmed by multiplying the total number of ammo acids in SEQ ID NO 2 by the integer defining the percent identity divided by 100 and then subtractmg that product from said total number of am
  • n a is the number of amino acid alterations
  • x a is the total number of ammo acids in SEQ ID NO 2
  • y is 0 95 for 95%, 0 97 for 97% or 1 00 for 100%
  • • is the symbol for the multiplication operator, and wherem any non-integer product of x a and y is rounded down to the nearest integer pnor to subtractmg it from x a
  • Ind ⁇ v ⁇ dual(s) means a multicellular eukaryote, mcludmg, but not limited to a metazoan. a mammal, an ov ⁇ d. a bov ⁇ d, a simian, a primate, and a human
  • Isolated means altered “by the hand of man” from its natural state, / e , if it occurs m nature, it has been changed or removed from its onginal environment, or both
  • a polvnucleotide or a polypeptide naturally present m a living organism is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting matenals of its natural state is “isolated", as the term is employed herem
  • a polynucleotide or polypeptide that is introduced mto an orgamsm by transformation, genetic manipulation or by any other recombinant method is "isolated” even if it is still present in said orgamsm which orgamsm may be living or non-living
  • Organ ⁇ sm(s) means a (1) prokaryote. mcludmg but not limited to, a member of the genus Streptococcus, Staphylococcus, Bordetella, Corynebactenum Mycobactenum, Neissena, Haemoph ⁇ us Actinomycetes, Streptomycetes, Nocardia, Enter obacter, Yersima, Fancisella, Pasturella, Moraxella, Acmetobacter Erysipelothnx, Branhamella, Actinobacillus, Streptobacillus, Listena Calymmatobactenum, Brucella Bacillus, Clostndium, Treponema, Eschenchia, Salmonella, Kleibsiella Vibrio, Proteus, Erwinia, Borre a, Leptospira, Spirillum, Campylobacter, Shigella, Legtonella Pseudomonas, Aero
  • Streptococcus faecium a member of the species or group, Group A Streptococcus, Group B Streptococcus, Group C Streptococcus, Group D Streptococcus, Group G Streptococcus, Streptococcus pneumomae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus faecahs. Streptococcus faecium.
  • Streptococcus duram Neissena gonorrheae, Neissena memngitidis, Staphylococcus aureus Staphylococcus epidermidis Corynebactenum d ⁇ thenae Gardnerella vagina s, Mycobactenum tuberculosis, Mycobactenum bovis Mycobactenum ulcerans, Mycobactenum leprae, Actinomyctes israelu, Listena monocytogenes, Bordetella pertusis, Bordatella parapertusis, Bordetella bronchiseptica, Eschenchia co , Shigella dysentenae, Haemoph ⁇ us influenzae, Haemoph ⁇ us aegyphus, Haemophilus parainfluenzae, Haemop lus ducreyi, Bordetella, Salmonella typhi, Citrobacter freundn, Proteus mirabi s, Proteus vulgans
  • Polynucleotide(s) generally refers to any poly ⁇ bonucleotide or polydeoxynbonucleotide, that may be unmodified RNA or DNA or modified RNA or DNA
  • Polynucleot ⁇ de(s)" mclude, without limitation, smgle- and double-stranded DNA, DNA that is a mixture of smgle- and double-stranded regions or smgle-, double- and triple-stranded regions, smgle- and double-stranded RNA, and RNA that is mixture of smgle- and double-stranded regions, hybnd molecules compnsing DNA and RNA that may be smgle-stranded or.
  • polynucleotide refers to triple-stranded regions compnsmg RNA or DNA or bodi RNA and DNA
  • the strands m such regions may be from the same molecule or from different molecules
  • the regions may mclude all of one or more of the molecules, but more typically mvolve only a region of some of the molecules
  • One of the molecules of a t ⁇ ple-hehcal region often is an ohgonucleotide
  • the term "polynucleotide(s)” also mcludes DNAs or RNAs as descnbed above that compnse one or more modified bases
  • DNAs or RNAs with backbones modified for stability- or for other reasons are "polynucleot ⁇ de(s)" as that term is mtended herem Moreover.
  • DNAs or RNAs compnsmg unusual bases such as inosine. or modified bases, such as t ⁇ tylated bases, to name just two examples, are polynucleotides as the term is used herem It will be appreciated that a great vanety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill m the art
  • polynucleot ⁇ de(s) as it is employed herem embraces such chemically, enzymatically or metabo cally modified forms of polynucleotides, as well as the chemical forms of DNA and RNA charactenstic of viruses and cells, including for example, simple and complex cells
  • Polynucleo ⁇ de(s) also embraces short polynucleotides often refened to as ohgonucleotide(s)
  • Polypept ⁇ de(s) refers to any peptide or protem compnsmg two or more ammo acids jomed to each other by peptide bonds or modified peptide bonds
  • Polypeptide(s) refers to both short chains, commonh refened to as peptides, ohgopeptides and o gomers and to longer chains generally refened to as protems
  • Polypeptides may compnse ammo acids other than the 20 gene encoded ammo acids
  • Polypept ⁇ de(s)” mclude those modified either by natural processes, such as processmg and other post-transla ⁇ onal modifications, but also by chemical modification techmques Such modifications are well descnbed m basic texts and m more detailed monographs, as well as m a voluminous research literature, and they are well known to those of skill m the art It will be appreciated that the same type of modification may be present in the same or varymg degree at several sites m a given polypeptide Also, a given polypeptide
  • acetylation for example acetylation, acylation, ADP-nbosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide denvative. covalent attachment of a hpid or hpid denvative, covalent attachment of phosphotidylmositol, cross-linking, cyclization. disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine.
  • Polypeptides may be branched or cyclic, with or without branching Cyclic, branched and branched circular polypeptides may result from posttranslational natural processes and may be made by entirely synthetic methods, as ell "Recombinant expression system(s)" refers to expression systems or portions thereof or polynucleotides of the mvention introduced or transformed mto a host cell or host cell lysate for the production of the polynucleotides and polypeptides of the mvention
  • 'Nanant(s) is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties
  • a typical va ⁇ ant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide Changes m the nucleotide sequence of the vanant may or may not alter the ammo acid sequence of a pohpeptide encoded by the reference polynucleotide Nucleotide changes may result in ammo acid substitutions additions, deletions, fusion proteins and truncations in the polypeptide encoded by the reference sequence, as discussed below
  • a typical variant of a polypeptide differs m ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference polypeptide and the vanant are closely similar overall and, m many regions, identical A vanant and reference polypeptide may differ in ammo acid sequence
  • a variant of a polynucleotide or polypeptide may be a naturally occurring such as an alle c variant, or it may be a variant that is not known to occur naturally
  • Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techmques, by direct synthesis, and by other recombinant methods known to skilled artisans
  • Example 1 Strain selection, Library Production and Sequencing
  • the polynucleotide havmg a DNA sequence given m Table 1 [SEQ ID NO 1] was obtained from a library of clones of chromosomal DNA of Streptococcus pneumomae in E coli
  • the sequencmg data from two or more clones compnsmg overlappmg Streptococcus pneumomae DNAs w as used to construct the contiguous DNA sequence m SEQ ID NO 1 Libraries may be prepared by routme methods, for example Methods 1 and 2 below
  • Total cellular DNA is isolated from Streptococcus pneumomae 0100993 according to standard procedures and size-fractionated by either of two methods
  • Method 1 Total cellular DNA is mechanically sheared by passage through a needle in order to size- fractionate accordmg to standard procedures
  • DNA fragments of up to 1 lkbp m size are rendered blunt by treatment with exonuclease and DNA polymerase. and EcoRI linkers added Fragments are ligated mto the vector Lambda Zapll that has been cut with EcoRI, the library packaged by standard procedures and E coli mfected with the packaged library
  • the library is amplified by standard procedures
  • Total cellular DNA is partially hydrolyzed with a one or a combination of restriction enzymes appropriate to generate a series of fragments for clonmg mto library vectors (e g . Rsal. Pall, Alul. Bshl235I), and such fragments are size-fractionated accordmg to standard procedures EcoRI linkers are ligated to the DNA and the fragments then ligated into the vector Lambda Zapll that have been cut with EcoRI, the library packaged by standard procedures, and E coli infected with the packaged library The library is amplified by standard procedures Example 2 yphC Characterization
  • the S. pneumoniae yphC gene is expressed during infection in a respiratory tract infection model
  • RNAase free, DNAase free, DNA and protein free preparations of RNA obtained are suitable for Reverse Transcription PCR (RT-PCR) usmg unique primer pairs designed from the sequence of each gene of Streptococcus pneumomae 0100993 a) Isolation of tissue infected with Streptococcus pneumomae 0100993 from a mouse animal model of mfection (lungs)
  • Streptococcus pneumomae 0100993 is seeded onto TSA (Tryptic Soy Agar BBL) plates contaimng 5% horse blood and allowed to grow overnight at 37°C in a C02 incubator Bacterial growth is scraped into 5 ml of phosphate-buffered salme (PBS) and adjusted to an A600 ⁇ 0 6 (4 x 106/ml) Mice (male CBA/J-1 mice, approximately 20g) were anaesthetized with isoflurane and 50 microhters of the prepared bacterial inoculum is delivered by mtranasal instillation Animals are allowed to recover and observed twice daily for signs of mo ⁇ bundancy Forty-eight hours after infection the animals are euthanized by carbon dioxide overdose and their torsos swabbed ith ethanol and then RNAZap The torso is then opened, and the lungs are aseptically removed Half of each pair of lungs is placed m a cry
  • RNA preparations are stored at -80 oC for up to one month
  • the RNA precipitate can be stored at the wash stage of the protocol m 75% ethanol for at least one year at -20 oC
  • RNA isolation is assessed by running samples on 1% agarose gels 1 x TBE gels stamed with ethidium bromide are used to visualise total RNA yields
  • 2 2M formaldehyde gels are run and vacuum blotted to Hybond-N (Amersham)
  • the blot is then hybndised with a 32P-labelled ohgonucletide probe, of sequence 5' AACTGAGACTGGCTTTAAGAGATTA 3' [SEQ ID NO 3], specific to 16S rRNA of Streptococcus pneumomae
  • the size of the hybridising band is compared to that of control RNA isolated from m vitro grown Streptococcus pneumomae 0100993 m the Northern blot Correct sized bacterial 16S rRNA bands can be detected m total RNA samples which show degradation of the mammalian RNA when visualised on TBE gel
  • PCR reactions are set up on ice m 0 2ml tubes by adding the following components 43 microhtres PCR Master Mix (Advanced Biotechnologies Ltd ), 1 micro tre PCR primers (optimally 18- 25 basepairs m length and designed to possess similar annealing temperatures), each pnmer at 1 OmM initial concentration, and 5 microhtres cDNA
  • PCR reactions are run on a Perkin Elmer GeneAmp PCR System 9600 as follows 2 minutes at 94 oC, then 50 cycles of 30 seconds each at 94 oC, 50 oC and 72 oC followed by 7 minutes at 72 oC and then a hold temperature of 20 oC (the number of cycles is optimally 30-50 to determine the appearance or lack of a PCR product and optimally 8-30 cycles if an estimation of the starting quantity of cDNA from the RT reaction is to be made), 10 microhtre aliquots are then run out on 1% 1 x TBE gels stained with ethidium bromide, with PCR product, if present, sizes estimated by comparison to a 100 bp DNA Ladder (Gibco BRL, Life Technologies) Alternatively if the PCR products are convemently labelled by the use of a labelled PCR pnmer (e g labelled at the 5'end with a dye) a smtable aliquot of the PCR product is run out on
  • Primer pairs which fail to give the predicted sized product in either DNA PCR or RT/PCR are PCR failures and as such are uninformative Of those which give the correct size product widi DNA PCR two classes are distinguished m RT/PCR 1 Genes which are not transcribed m vivo reproducibh fail to give a product m RT/PCR. and 2 Genes which are transcribed m vivo reproducibh giv e the correct size product m RT/PCR and show a stronger signal in the +RT samples than the signal (if at all present) m -RT controls
  • the yphC gene is essential for S. pneumoniae in vitro growth.
  • allelic replacement cassette was generated usmg PCR technology
  • the cassette consisted of a pair of 500bp chromosomal DNA fragments flanking an erythromycm resistance gene
  • the chromosomal DNA sequences are the 500bp preceding and following the DNA sequence encodmg the yphC gene contained m Seq ID NO 1
  • the allelic replacement cassette was mtroduced mto S pneumomae R6 by transformation Competent cells were prepared according to published protocols
  • DNA was mtroduced mto the cells by mcubation of ng quantities of allelic replacement cassette with 10" cells at 30°C for 30 minutes The cells were transferred to 37°C for 90 minutes to allow expression of the erythromycm resistance gene
  • Cells were plated in agar containmg lug erythromycm per ml Following mcubation at 37°C for 36 hours, colonies are picked and grown overnight m Todd-Hewitt broth supplemented with 0 5% yeast extract Typically 1000 transformants containmg the appropnate allelic replacement are obtained If no transformants are obtained m three separate transformation experiments as w as the case for this gene yphC, then the gene is considered as bemg essential in vitro

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pulmonology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des polypeptides yphC et des polynucléotides codant lesdits polypeptides yphC, et des méthodes de production desdits polypeptides par des techniques recombinantes. L'invention concerne également des méthodes de criblage utilisant les polypeptides yphC pour obtenir des composés antibactériens.
PCT/US2000/011894 1999-05-07 2000-05-02 yphC WO2000068427A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US30700399A 1999-05-07 1999-05-07
US09/307,003 1999-05-07

Publications (1)

Publication Number Publication Date
WO2000068427A1 true WO2000068427A1 (fr) 2000-11-16

Family

ID=23187823

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/011894 WO2000068427A1 (fr) 1999-05-07 2000-05-02 yphC

Country Status (1)

Country Link
WO (1) WO2000068427A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000014200A2 (fr) * 1998-09-09 2000-03-16 Millennium Pharmaceuticals, Inc. Genes bacteriens essentiels et leur utilisation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000014200A2 (fr) * 1998-09-09 2000-03-16 Millennium Pharmaceuticals, Inc. Genes bacteriens essentiels et leur utilisation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE CAPLUS ON STN FRITZ C. ET AL.: "Two genes of steptococcus pneumoniae essential for bacterial survival and widely distributed among eubacteria as potential targets for antibiotics", XP002953091 *
KUNST F. ET AL.: "The complete genome sequence of the gram-positive bacterium bacillus subtilis", vol. 390, no. 20, 20 November 1997 (1997-11-20), pages 249 - 256, XP002929157 *

Similar Documents

Publication Publication Date Title
US6268177B1 (en) Isolated nucleic acid encoding nucleotide pyrophosphorylase
WO2000027427A1 (fr) POLYPEPTIDES trmD
WO2000078782A1 (fr) Carboxylase a de coenzyme acetyle provenant de staphylococcus aureus
WO2000026377A1 (fr) POLYNUCLEOTIDES ET POLYPEPTIDES CODANT metK ISOLE A PARTIR DE $i(STREPTOCOCCUS PNEUMONIAE)
WO2000049042A1 (fr) nadE
US6326172B1 (en) ytgP
WO2000065026A2 (fr) Polypeptides yycg
US6225457B1 (en) murF2
WO2000068427A1 (fr) yphC
WO2000050602A1 (fr) Polypeptides et polynucleotides de thymidylate kinase, et methodes associees
WO2001007463A1 (fr) Represseur
US20020091237A1 (en) nusB
WO2000068365A1 (fr) ARNt METHYLTRANSFERASES PROVENANT DE STREPTOCOCCUS PNEUMONIAE
WO2001010904A1 (fr) Map
WO2000068426A1 (fr) Ups
WO2000024754A1 (fr) POLYPEPTIDES infb ET POLYNUCLEOTIDES DE STREPTOCOCCUS PNEUMONIAE
WO2000043491A2 (fr) yhxB
WO2001024635A1 (fr) Asue
WO2000068425A1 (fr) ysxC
WO2000018797A1 (fr) Map
EP1080181A1 (fr) clpX DE STREPTOCOCCUS PNEUMONIAE
WO2000070075A1 (fr) Streptococcus pneumoniae yers
WO2001016351A1 (fr) Adne
WO2001007458A1 (fr) POLYPEPTIDES lacR
WO2001011970A1 (fr) POLYPEPTIDES ET POLYNUCLEOTIDES yloV

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP