WO2000075135A1 - Inhibiteurs biaryliques de la prenyl-proteine transferase - Google Patents

Inhibiteurs biaryliques de la prenyl-proteine transferase Download PDF

Info

Publication number
WO2000075135A1
WO2000075135A1 PCT/US2000/015461 US0015461W WO0075135A1 WO 2000075135 A1 WO2000075135 A1 WO 2000075135A1 US 0015461 W US0015461 W US 0015461W WO 0075135 A1 WO0075135 A1 WO 0075135A1
Authority
WO
WIPO (PCT)
Prior art keywords
aryl
alkyl
heteroaryl
substituted
unsubstituted
Prior art date
Application number
PCT/US2000/015461
Other languages
English (en)
Inventor
Theresa M. Williams
Original Assignee
Merck & Co., Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck & Co., Inc. filed Critical Merck & Co., Inc.
Priority to AU54642/00A priority Critical patent/AU5464200A/en
Publication of WO2000075135A1 publication Critical patent/WO2000075135A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/06—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms

Definitions

  • Ras proteins are part of a signalling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein.
  • Ras In the inactive state, Ras is bound to GDP.
  • Ras Upon growth factor receptor activation Ras is induced to exchange GDP for GTP and undergoes a conformational change.
  • the GTP-bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and D.M.
  • Mutated ras genes (Ha-ms, Ki4a-ras, Ki4b- ras and N-r ⁇ s) are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal. Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras.
  • the Ras C-terminus contains a sequence motif termed a "CAAX” or "Cys-Aaa -Aaa -Xaa” box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al, Nature 3.20:583-586 (1984)).
  • this motif serves as a signal sequence for the enzymes prenyl-protein transferase or geranylgeranyl -protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a Cl5 or C20 isoprenoid, respectively.
  • prenyl-protein transferase may be used to refer generally to farnesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • the Ras protein is one of several proteins that are known to undergo post-translational prenylation. Other prenylated proteins include the Ras-related GTP-binding proteins such as Rho, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin. James, et al., J. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also prenylated. James, et al., have also suggested that there are prenylated proteins of unknown structure and function in addition to those listed above.
  • prenyl-protein transferase Inhibition of prenyl-protein transferase has been shown to block the growth of Ras-transformed cells in soft agar and to modify other aspects of their transformed phenotype. It has also been demonstrated that certain inhibitors of prenyl-protein transferase selectively block the processing of the Ras oncoprotein intracellularly (N.E. Kohl et al. , Science, 260:1934-1937 (1993) and G.L. James et al., Science, 260:1937-1942 (1993). Recently, it has been shown that an inhibitor of a prenyl-protein transferase blocks the growth of r ⁇ s-dependent tumors in nude mice (N.E. Kohl et al. , Proc Natl. Acad.
  • Prenyl-protein transferases utilizes prenyl pyrophosphates to covalently modify the Cys thiol group of the Ras CAAX box with a prenyl group (Reiss et al., Cell, 62:81-88 (1990); Schaber et al., J. Biol. Chem., 265:14701-14704 (1990); Schafer et al., Science, 249:1133- 1139 (1990); Manne et al, Proc. Natl. Acad. Sci USA, 87:7541-7545 (1990)).
  • Inhibition of prenyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks Ras membrane localization in cultured cells.
  • FPTase farnesyl-protein transferase
  • FPP farnesyl diphosphate
  • Ras protein substrates
  • Such inhibitors may inhibit proteinfarnesylation while serving as alternate substrates for the farnesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al. , Science, 260:1934-1937 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)).
  • deletion of the thiol from a CAAX derivative has been shown to dramatically reduce the inhibitory potency of the compound.
  • the thiol group potentially places limitations on the therapeutic application of FPTase inhibitors with respect to pharmacokinetics, pharmacodynamics and toxicity. Therefore, a functional replacement for the thiol is desirable.
  • prenyl-protein transferase inhibitors are inhibitors of proliferation of vascular smooth muscle cells and are therefore useful in the prevention and therapy of arteriosclerosis and diabetic disturbance of blood vessels (JP H7-112930).
  • the present invention comprises peptidomimetic biaryl- containing compounds which inhibit prenyl-protein transferase. Further contained in this invention are chemotherapeutic compositions containing these prenyl transferase inhibitors and methods for their production.
  • the compounds of this invention are useful in the inhibition of prenyl-protein transferase and the prenylation of the oncogene protein Ras.
  • the inhibitors of prenyl- protein transferase are illustrated by a compound of Formula I or a pharmaceutically acceptable salt thereof:
  • n 0, 1, 2, or 3
  • p 0, 1, 2, 3, or 4;
  • G is H2 or O
  • Rl, R2, and R ⁇ are independently selected from:
  • Ci-C ⁇ alkyl substituted by Ci-C ⁇ perfluoroalkyl, R 1 0 ⁇ -,R 10 C(O)NR 10 -, (RlO) 2 N-C(NRlO)-, RlOC(O)-, -N(RlO)2, or R 1 OOC(0)NR!0-;
  • R4 is selected from H and Cl-6 alkyl
  • R a and R D are independently selected from hydrogen and C1 -C6 alkyl
  • R c is independently selected from:
  • Ci -C ⁇ alkyl unsubstituted or substituted by aryl, heteroaryl, cycloalkyl, alkenyl, R ⁇ O-, or -N(R ⁇ )2;
  • R5 and R ⁇ are independently selected from the following: 1) H,
  • Ro and R" are attached to the same C atom and are joined to form 5 or 6 membered ring wherein one of the carbon atoms is optionally replaced by a moiety selected from: O,
  • R 7 , R and R8a are independently selected from the following unsubstituted or substituted moieties: 1) Cl-4 alkyl,
  • R 7 and R8 are joined to form a ring;
  • R8 and R8a are joined to form a ring;
  • R 9 is independently selected from hydrogen, Cl-C ⁇ alkyl, benzyl and aryl; RlO is independently selected from Cl-C ⁇ alkyl and aryl.
  • n 0, 1, 2, or 3
  • p 0, 1, 2, 3, or 4;
  • A is N or C-H
  • Zl and Z2 are independently selected from the following:
  • Cl-4 alkyl unsubstituted or substituted with: a) Cl-4 alkoxy, b) NR 7 R8, c) C3-6 cycloalkyl, d) aryl or heteroaryl, e) OH, f) -S(0) m R a, or g) -C(0)NR 7 R8,
  • R.3 are independently selected from:
  • R ⁇ is selected from H and Cl-6 a lkyl; R5 and R" are independently selected from the following:
  • substituted moiety is substituted with one or more of the following:
  • R 7 and R8 are independently selected from the following unsubstituted or substituted moieties:
  • R 7 and R8 are joined to form a ring
  • R9 is independently selected from hydrogen, C1-C6 a lkyl, benzyl and aryl;
  • R O is independently selected from Ci-C ⁇ alkyl and aryl.
  • A is N or C-H
  • G is H2 or O
  • Rl, R2, and R ⁇ are independently selected from:
  • R4 is selected from H and Cl-6 alkyl
  • R a and R ⁇ are independently selected from hydrogen and Cl-C ⁇ alkyl
  • R c is independently selected from:
  • R5 and R ⁇ are independently selected from the following:
  • substituted moiety is substituted with one or more of the following:
  • R 7 and R8 are independently selected from the following unsubstituted or substituted moieties: 1) Cl-4 alkyl,
  • R 7 and R8 are joined to form a ring
  • R 9 is independently selected from hydrogen, C1-C6 lkyl, benzyl and aryl;
  • RIO is independently selected from Cl-C ⁇ alkyl and aryl.
  • n 0, 1, 2, or 3
  • p 0, 1, 2, 3, or 4;
  • A is N or C-H
  • G is H2 or O
  • Cl-4 a lkyl unsubstituted or substituted with: a) Cl-4 a lkoxy, b) NR 7 R 8 , c) C3-6 cycloalkyl, d) aryl or heteroaryl, e) OH, f) -S(0) m R 7a , or g) -C(0)NR 7 R8,
  • Rl, R2, and B are independently selected from: 1) hydrogen, as long as Rl and R ⁇ are not both H,
  • R4 is selected from H and Cl-6 a lkyl
  • R5 and R" are independently selected from the following: 1) H, 2) substituted or unsubstituted aryl,
  • substituted moiety is substituted with one or more of the following:
  • R5 and R" are optionally attached to the same carbon atom
  • R 7 and R8 are independently selected from the following unsubstituted or substituted moieties:
  • R 7 and R are joined to form a ring
  • R9 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl;
  • RIO is independently selected from Cl-C ⁇ alkyl and aryl.
  • n 0, 1, 2, or 3
  • p 0, 1, 2, 3, or 4;
  • A is N or C-H
  • G is H2 or O
  • Cl-4 a lkyl unsubstituted or substituted with: a) Cl-4 a lkoxy, b) NR 7 R8, c) C3-6 cycloalkyl, d) aryl or heteroaryl, e) OH, f) -S(0) m R 7a , or g) -C(0)NR 7 R8,
  • Rl, R2, and R ⁇ are independently selected from:
  • R ⁇ is selected from H and Cl-6 alkyl
  • R5 and R ⁇ are independently selected from the following:
  • substituted moiety is substituted with one or more of the following: 1) aryl,
  • R5 and R ⁇ are optionally attached to the same carbon atom
  • R 7 and R8 are independently selected from the following unsubstituted or substituted moieties:
  • substituents are one or two functional groups selected from the following:
  • R 7 and R8 are joined to form a ring;
  • R is independently selected from hydrogen, Cl-C ⁇ alkyl, benzyl and aryl;
  • RlO is independently selected from Cl-C ⁇ alkyl and aryl.
  • A is N or C-H
  • G is H2 or O
  • Cl-4 alkyl unsubstituted or substituted with: a) Cl-4 alkoxy, b) NR 7 R 8 , c) C3-6 cycloalkyl, d) aryl or heteroaryl, e) OH, f) -S(0) m R a , or g) -C(0)NR 7 R 8 ,
  • Rl, R2, and R ⁇ are independently selected from:
  • R 4 is selected from H and Cl-6 alkyl
  • R5 and R" are independently selected from the following:
  • substituted moiety is substituted with one or more of the following:
  • R5 and R" are optionally attached to the same carbon atom
  • R 7 and R are independently selected from the following unsubstituted or substituted moieties:
  • R 7 and R8 are joined to form a ring
  • R9 is independently selected from hydrogen, Cl-C ⁇ alkyl, benzyl and aryl;
  • RlO is independently selected from C1-C6 alkyl and aryl.
  • n 0, 1, 2, or 3
  • p 0, 1, 2, 3, or 4;
  • A is N or C-H
  • Zl and Z2 are independently selected from the following: 1) Cl-4 alkyl, unsubstituted or substituted with: a) Cl-4 alkoxy, b) NR 7 R8, c) C3-6 cycloalkyl, d) aryl or heteroaryl, e) OH, f) -S(0) m R 7 a, or g) -C(0)NR 7 R 8 ,
  • R.3 are independently selected from:
  • R4 is selected from H and Cl-6 alkyl
  • R5 and R ⁇ are independently selected from the following:
  • substituted moiety is substituted with one or more of the following:
  • R5 and R° are optionally attached to the same carbon atom
  • R 7 and R8 are independently selected from the following unsubstituted or substituted moieties:
  • R 7 and R8 are joined to form a ring
  • R9 is independently selected from hydrogen, Cl-C ⁇ alkyl, benzyl and aryl;
  • RIO is independently selected from Cl-C ⁇ alkyl and aryl.
  • RIO is independently selected from Cl-C ⁇ alkyl and aryl.
  • Yet another preferred embodiment is a compound of Formula VIII or a pharmaceutically acceptable salt thereof:
  • n 0, 1, or 2;
  • A is C-H or N
  • Zl and Z2 are in dependently selected from the following:
  • R 1 , R2, and R3 are independently selected from:
  • Rl0 ⁇ C(O)NRl0- and 16) Cl-C ⁇ alkyl substituted by C1-C6 perfluoroalkyl, R!0O-,R10C(O)NR10-, (R10)2N-C(NR10)-, Rl°C(0)-, -N(Rl°)2, or Rl0OC(O)NRl0-;
  • R 7 and R8 are independently selected from the following unsubstituted or substituted moieties:
  • R 7 and R8 are joined to form a ring
  • R is independently selected from hydrogen, Cl-C ⁇ alkyl, benzyl and aryl;
  • RIO is independently selected from Cl-C ⁇ alkyl and aryl.
  • Zl and Z are independently selected from the following: 1) Cl- alkyl, unsubstituted or substituted with: a) Cl-4 alkoxy, b) NR 7 R8, c) C3-6 cycloalkyl, d) aryl or heteroaryl, e) OH, f) -S(0) m R 7 a, or g) -C(0)NR 7 R8,
  • R 1 , R2, and [ R3 are independently selected from:
  • Rl°OC(0)NRl°- 15) Rl°OC(0)NRl°-, and 16) Cl-C ⁇ alkyl substituted by Cl-C ⁇ perfluoroalkyl, Rl0O-,Rl°C(O)NRl0-, (RlO)2N-C(NRl°)-, RlOC(O)-, -N(RlO)2, or Rl°OC(0)NRl°-;
  • R 7 and R8 are in ⁇ iependently selected from the following unsubstituted or substituted moieties:
  • R 7 and R8 are joined to form a ring
  • R9 is independently selected from hydrogen, Cl-C ⁇ alkyl, benzyl and phenyl;
  • RIO is independently selected from Cl-C ⁇ alkyl and phenyl.
  • Zl and Z are independently selected from the following:
  • R,3 are independently selected from:
  • R4 is selected from H and CH3;
  • R ⁇ and B ⁇ are independently selected from the following:
  • R and R" are optionally attached to the same carbon atom
  • R 7 and R8 are independently selected from the following: 1) Cl-4 alkyl,
  • R 7 and R are joined to form a ring
  • R 7a is selected from Ci_4 alkyl, C3-6 cycloalkyl, heteroaryl, and aryl;
  • R is independently selected from hydrogen, Cl-C ⁇ lkyl, benzyl and phenyl;
  • RlO is independently selected from Cl-C ⁇ alkyl and phenyl.
  • n 1 or 2;
  • A is N or C-H
  • X is a bond
  • Zl and Z are independently selected fn
  • Rl, R2, and R ⁇ are independently selected from:
  • R 4 is selected from H and CH3;
  • R 7 and R8 are independently selected from the following:
  • R 7 and R8 are joined to form a ring
  • R 7a is selected from Cl-4 alkyl, C3-6 cycloalkyl, heteroaryl, and aryl;
  • R9 is independently selected from hydrogen, C1-C6 lkyl, benzyl and phenyl;
  • RlO is independently selected from Cl-C ⁇ alkyl and phenyl.
  • a pharmaceutical composition comprising a pharmaceutical carrier and a compound as described above.
  • the invention further encompasses a method for inhibiting prenyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound as described above.
  • a method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound as described above.
  • the invention further includes a method for treating neurofibromin benign proliferative disorder which comprises administering to a mammal in need thereof a therapeutically effective amount of the disclosed compounds and a method for treating blindness related to retinal vascularization which comprises administering to a mammal in need thereof a therapeutically effective amount of the disclosed compounds.
  • Also disclosed and claimed is a method for treating infections from hepatitis delta and related viruses which comprises administering to a mammal in need thereof a therapeutically effective amount of the disclosed compounds and a method for preventing restenosis which comprises administering to a mammal in need thereof a therapeutically effective amount of the disclosed compounds.
  • Another embodiment of the disclosed invention is a method for treating polycystic kidney disease which comprises administering to a mammal in need thereof a therapeutically effective amount of the disclosed compounds.
  • a further embodiment is a method of conferring radiation sensitivity on a tumor cell which comprises administering to a mammal in need thereof a therapeutically effective amount of a disclosed compound in combination with radiation therapy.
  • Yet another embodiment of the present invention is a method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a disclosed compound in combination with an antineoplastic and the method wherein the antineoplastic is paclitaxel.
  • the compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention.
  • any variable e.g. aryl, heterocycle, Rl, R2 etc.
  • its definition on each occurence is independent at every other occurence.
  • combinations of substituents/or variables are permissible only if such combinations result in stable compounds.
  • (CRC2)2 may be any of the following if Rc is defined as H, CH3, or OH: CH2C(OH)(CH3), CH(OH)CH(OH), CH(OH)CH(CH3),
  • alkyl is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms.
  • Cl-8 a s in Cl-8 a lkyl is defined to identify the group as having 1, 2, 3, 4, 5, 6, 7 or 8 carbons in a linear or branched arrangement, such that Cl-8alkyl specifically includes methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl and octyl.
  • Alkoxy represents an alkyl group of indicated number of carbon atoms attached through an oxygen bridge.
  • Halogen or "halo” as used herein means fluoro, chloro, bromo and iodo.
  • Cycloalkyl refers to a cyclic or bicyclic saturated chain of three to ten carbons. Examples of cycloalkyls are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, tetrahydronaphthalene, etc.
  • aryl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic.
  • aryl elements include phenyl, naphthyl, tetrahydronaphthyl, indanyl, biphenyl, phenanthryl, anthryl or acenaphthyl.
  • heteroaryl represents, a 5- to 7- membered aromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes any bicyclic group in which any of the above-defined heteroaryl rings is fused to a benzene ring.
  • Heteroaryl groups within the scope of this definition include but are not limited to: acridinyl, carbazolyl, cinnolinyl, quinoxalinyl, pyrrazolyl, indolyl, benzotriazolyl, furanyl, thienyl, benzothienyl, benzofuranyl, quinolinyl, isoquinolinyl, pyrazinyl, pyridazinyl, pyridinyl, pyrimidinyl, and pyrrolyl.
  • Lines drawn into the ring systems from substituents indicate that the indicated bond may be attached to any of the substitutable ring carbon atoms.
  • substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
  • the pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids.
  • such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluene sulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
  • inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like
  • organic acids such as acetic, propionic, succinic, glycolic,
  • the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • biaryl-containing imidazolylalkyl piperazinones can be prepared by several methods. For example, 4- bromombenzyl imidazole 5 can be reacted with dihydroxyacetone in the presence of potassium thiocyanate to give 2-mercaptoimidazole 6. Oxidative removal of the thiol group with acidic hydrogen peroxide gives benzylimidazole 7. Benzylimidazole 7 is then reacted with arylboronic acids under known Suzuki coupling conditions to give biaryl 8.
  • Oxidation of the primary alcohol in 8 to aldehyde 9 can be achieved under a variety of conditions, including sulfur trioxide-dimethylsulfoxide and triethylamine.
  • Biarylimidazole aldehyde 9 can reductively alkylate intermediate piperazinone 4 (preparation of 4 is described in Scheme 1) to give biarylmethylimidazole 10.
  • SCHEME 2 (cont'd)
  • l-(4-bromombenzyl)-5-hydroxymethylimidazole 7 can be converted to chloromethylimidazole 11 with thionyl chloride, as described in Scheme 3.
  • Chloromethylimidazole 11 is sufficiently electrophilic to alkylate piperazinone 4 to produce 12.
  • Bromobenzyl imidazole 12 can be converted to the final biaryl product 10 by reacting 12 with arylboronic acids in the presence of a catalyst, usually palladium (0), under standard Suzuki coupling conditions.
  • a catalyst usually palladium (0)
  • Tritylated imidazole 16 used to prepare the heterobiaryl- containing imidazolylalkyl piperazinones described below, are prepared according to Scheme 4.
  • Heterobiaryl-containing imidazolylalkyl piperazinones can be prepared as described in Scheme 5.
  • the resulting 19 can then be converted to the final product 20 by treating it with arylboronic acid under normal Suzuki coupling conditions.
  • heterobiaryl-containing imidazolylalkyl piperazinones can also be prepared by alkylating the protected imidazole 21 with bromomethyl heteroaryl electrophiles such as pyridine 18. Deprotection of the hydroxyl group of 22 to hydroxymethyl imidazole 23 proceeds smoothly. The hydroxymethyl imidazole 23 can be converted to the chloromethyl imidazole 24, which can alkylate piperazinone 4 under basic conditions to give 19. Finally 19 can be converted to final products 20 by reacting it with arylboronic acids in the presence of palladium (0).
  • a biarylalkyl halide such as 26 can be synthesized, then used to alkylate the trityl-protected imidazole piperazinone 16 to give the final product 20.
  • homologated analogs can be prepared by reacting a suitably protected histamine like 23 with an N-aryl chloroacetamide to give compounds like 24.
  • Reductive alkylation of 24 with glycolaldehyde dimer furnishes the hydroxyethyl intermediate 25, which can be cyclized to piperazinone 26 under Mitsunobu conditions.
  • the trityl imidazole in 26 can be alkylated regioselectively with various alkylating agents, including the triflate derived from hydroxymethyl biaryl or hydroxymethyl heterobiaryl intermediates.
  • Methanolysis of the intermediate imidazolium salt leads to final products 27.
  • Scheme 9 depicts the synthesis of 5-arylmethyl-l-imidazolylethyl analogs.
  • Activated zinc is added to an aryl methylhalide in THF to form the arylmethyl zinc halide, which is subsequently coupled to an N- protected 4-iodoimidazole to give compound 29.
  • Regiospecfic alkylation of the imidazole ring is accomplished with ethyl bromoacetate, with subsequent methanolysis of the intermediate imidazolium salt giving 30.
  • Elaboration of 30 to the primary amine proceeds through standard chemistry, yielding 34.
  • Scheme 10 illustrates the synthesis of ring-substituted piperazinones like 45.
  • a wide variety of Weinreb amides 38 are available from commercial sources, or through well-established chemical procedures. Reduction of Weinreb amide 38 furnishes the aldehyde 39, which can be reductively alkylated with an arylamine or heteroarylamine to give 40. Reaction of 40 with chloroacetylchloride gives 41, which can undergo base-induced cyclization to compounds 42. Removal of the N-£- butyloxycarbonyl protecting group, and reaction of the thus formed piperazinone 43 with an imidazole carboxaldehyde furnishes 44. Regioselective alkylation of 44 and methanolysis of the intermediate imidazolium salt gives the target compound 45.
  • Scheme 11 illustrates the synthesis of additionally substituted piperazinones.
  • the £-butyloxycarbonyl-protected piperazinone 42 can be deprotonated with lithium hexamethyl-disilylazide (LiHMDS) at low temperature, and the resulting carbanion reacted with an alkyl halide or triflate to give compound 46.
  • LiHMDS lithium hexamethyl-disilylazide
  • the target compounds 49 can be obtained.
  • Imidazole carboxaldehydes 50 are either commercially available, or prepared by known literature methods and well-established chemical procedures. These can be alkylated in the presence of various bases, such as alkali metal carbonates, to give compounds 51, which can then be converted to final products 52.
  • the instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer.
  • Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors. Such tumors may arise by mutations in the ras genes themselves, mutations in the proteins that can regulate Ras activity (i.e., neurofibromin (NF-1), neu, scr, abl, lck, fyn) or by other mechanisms.
  • the compounds of the instant invention inhibit prenyl- protein transferase and the prenylation of the oncogene protein Ras.
  • the instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575-4580 (1995)). Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of blindness related to retinal vascularization.
  • the compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment.
  • a component of NF-1 is a benign proliferative disorder.
  • the instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S. Glenn et al. Science, 256:1331-1333 (1992).
  • the compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1:541-545(1995).
  • the instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of Pathology, 142:1051-1060 (1993) and B. Cowley, Jr. et e .FASEB Journal, 2:A3160 (1988)).
  • the instant compounds may also be useful for the treatment of fungal infections.
  • the compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers or diluents, optionally with known adjuvants, such as alum, in a pharmaceutical composition, according to standard pharmaceutical practice.
  • the compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration .
  • the selected compound may be administered, for example, in the form of tablets or capsules, or as an aqueous solution or suspension.
  • carriers which are commonly used include lactose and corn starch, and lubricating agents, such as magnesium stearate, are commonly added.
  • useful diluents include lactose and dried corn starch.
  • aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavoring agents may be added.
  • sterile solutions of the active ingredient are usually prepared, and the pH of the solutions should be suitably adjusted and buffered.
  • the total concentration of solutes should be controlled in order to render the preparation isotonic.
  • the compounds of the instant invention may also be co- administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the instant compounds may be useful in combination with known anti-cancer and cytotoxic agents.
  • the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restinosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections. If formulated as a fixed dose, such combination products employ the compounds of this invention within the dosage range described below and the other pharmaceutically active agent(s) within its approved dosage range.
  • Compounds of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a combination formulation is inappropriate.
  • the present invention also encompasses a pharmaceutical composition useful in the treatment of cancer, comprising the administration of a therapeutically effective amount of the compounds of this invention, with or without pharmaceutically acceptable carriers or diluents.
  • suitable compositions of this invention include aqueous solutions comprising compounds of this invention and pharmacolo-gically acceptable carriers, e.g., saline, at a pH level, e.g., 7.4.
  • the solutions may be introduced into a patient's blood-stream by local bolus injection.
  • the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, and response of the individual patient, as well as the severity of the patient's symptoms.
  • a suitable amount of compound is administered to a mammal undergoing treatment for cancer.
  • Administration occurs in an amount between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
  • the compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of prenyl-protein transferase in a composition.
  • the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of prenyl-protein transferase (for example a tetrapeptide having a cysteine at the amine terminus) and prenyl pyrophosphate and, in one of the mixtures, a compound of the instant invention.
  • the assay mixtures are incubated for an sufficient period of time, well known in the art, to allow the FPTase to prenylate the substrate, the chemical content of the assay mixtures may be determined by well known immunological, radiochemical or chromatographic techniques.
  • the compounds of the instant invention are selective inhibitors of FPTase
  • absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of FPTase in the composition to be tested. It would be readily apparent to one of ordinary skill in the art that such an assay as described above would be useful in identifying tissue samples which contain prenyl-protein transferase and quantitating the enzyme.
  • potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample.
  • a series of samples composed of aliquots of a tissue extract containing an unknown amount of prenyl-protein transferase, an excess amount of a known substrate of Prenyl-protein transferase (for example a tetrapeptide having a cysteine at the amine terminus) and prenyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention.
  • concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
  • concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
  • the compounds of the instant invention may also be useful in the prevention and treatment of endometriosis, uterine fibroids, dysfunctional uterine bleeding and endometrial hyperplasia.
  • the prenyl- protein transferase inhibitor may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the prenyl- protein transferase inhibitor may be useful in further combination with drugs known to supress the activity of the ovaries and slow the growth of the endometrial tissue.
  • drugs include but are not limited to oral contraceptives, progestins, danazol and GnRH (gonadotropin-releasing hormone) agonists.
  • Administration of the prenyl-protein transferase inhibitor may also be combined with surgical treatment of endometriosis (such as surgical removal of misplaced endometrial tissue) where appropriate.
  • the instant compounds may also be useful as inhibitors of corneal inflammation. These compounds may improve the treatment of corneal opacity which results from cauterization-induced corneal inflammation. The instant compounds may also be useful in reducing corneal edema and neovascularization. (K. Sonoda et al., Invest. Ophthalmol. Vis. Sci., 1998, vol. 39, p 2245-2251).
  • the compounds of the invention are selective inhibitors of farnesyl-protein transferase.
  • a compound is considered a selective inhibitor of farnesyl- protein transferase, for example, when its in vitro farnesyl-protein transferase inhibitory activity, as assessed by the assay described in Assay 1, is at least 100 times greater than the in vitro activity of the same compound against geranylgeranyl-protein transferase-type I in the assay described in Assay 2.
  • a selective compound exhibits at least 1000 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl-protein transferase inhibition.
  • the selective inhibitor of farnesyl- protein transferase is further characterized by an IC50 (a measure of in vitro inhibitory activity) for inhibition of the prenylation of newly synthesized K-Ras protein more than about 100-fold higher than the EC50 for the inhibition of the farnesylation of hDJ protein.
  • IC50 a measure of in vitro inhibitory activity
  • the assays described in Assay 6 may be utilized.
  • the selective inhibitor of farnesyl- protein transferase is further characterized by an IC50 (a measurement of in vitro inhibitory activity) for inhibition of K4B-Ras dependent activation of MAP kinases in cells at least 100-fold greater than the IC50 for inhibition of the farnesylation of the protein hDJ in cells.
  • the selective inhibitor of farnesyl- protein transferase is further characterized by an IC5-9 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells at least 1000 fold lower than the inhibitory activity (IC50) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells.
  • IC5-9 a measurement of in vitro inhibitory activity against H-Ras dependent activation of MAP kinases in cells at least 1000 fold lower than the inhibitory activity (IC50) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells.
  • IC5-9 a measurement of in vitro inhibitory activity against H-Ras dependent activation of MAP kinases in cells at least 1000 fold lower than the inhibitory activity (IC50) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kin
  • the compounds of the invention are dual inhibitors of farnesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • a dual inhibitor may be termed a Class II prenyl-protein transferase inhibitor and will exhibit certain characteristics when assessed in in vitro assays, which are dependent on the type of assay employed.
  • IC50 in vitro inhibitory activity
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells between 0.1 and 100 times the IC50 for inhibiting the farnesylation of the protein hDJ in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV- SEAP plasmid that constitutively expresses the SEAP protein.
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC5-9 (a measurement of in vitro inhibitory activity) against
  • H-Ras dependent activation of MAP kinases in cells greater than 2 fold lower but less than 20,000 fold lower than the inhibitory activity (IC50) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) against IC50 against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) against
  • SEAP plasmid that constitutively expresses the SEAP protein.
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 10-fold lower but less than 2,500 fold lower than the inhibitory activity (IC50) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) against
  • IC50 inhibitory activity
  • a method for measuring the activity of the inhibitors of prenyl-protein transferase, as well as the instant combination compositions, utilized in the instant methods against Ras dependent activation of MAP kinases in cells is described in Assay 5.
  • a compound of the instant invention may be a more potent inhibitor of geranylgeranyl-protein transferase-type I than it is an inhibitor of farnesyl-protein transferase.
  • Isoprenyl-protein transferase activity assays are carried out at 30 °C unless noted otherwise.
  • a typical reaction contains (in a final volume of 50 ⁇ L): [ 3 H]prenyl diphosphate, Ras protein , 50 mM HEPES, pH 7.5, 5 mM MgCl 2 , 5 mM dithiothreitol, 10 ⁇ M ZnCl 2 , 0.1% polyethyleneglycol (PEG) (15,000-20,000 mw) and isoprenyl-protein transferase.
  • PEG polyethyleneglycol
  • the Prenyl-protein transferase employed in the assay is prepared by recombinant expression as described in Omer, C.A., Krai, A.M., Diehl, R.E., Prendergast, G.C., Powers, S., Allen, CM., Gibbs, J.B. and Kohl, N.E. (1993) Biochemistry 32:5167-5176. After thermally pre-equilibrating the assay mixture in the absence of enzyme, reactions are initiated by the addition of isoprenyl-protein transferase and stopped at timed intervals (typically 15 min) by the addition of 1 M HCl in ethanol (1 mL). The quenched reactions are allowed to stand for 15 m (to complete the precipitation process).
  • FTase 650 nM Ras-CVLS (SEQ.ID.NO.: 1), 100 nM prenyl diphosphate.
  • the modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature.
  • a typical reaction contains (in a final volume of 50 ⁇ L): [ 3 H]geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgCl 2 , 10 ⁇ M ZnCl 2 , 0.1% PEG
  • the GGTase-type I enzyme employed in the assay is prepared as described in U.S. Pat. No. 5,470,832, incorporated by reference.
  • the Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCVIM (single amino acid code) (SEQ. ID. NO.: 2).
  • Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 ⁇ L of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter.
  • streptavidin SPA beads Scintillation Proximity Assay beads
  • IC50 values are determined with Ras peptide near KM concentrations. Enzyme and substrate concentrations for inhibitor IC 50 determinations are as follows: 75 pM GGTase-I, 1.6 ⁇ M Ras peptide, 100 nM geranylgeranyl diphosphate.
  • the cell line used in this assay is a v-ras line derived from either Ratl or NIH3T3 cells, which expressed viral Ha-ras p21.
  • the assay is performed essentially as described in DeClue, J.E. et al., Cancer Research 51:712-717, (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound (final concentration of solvent, methanol or dimethyl sulfoxide, is 0.1%).
  • the cells are labeled in 3 mL methionine-free DMEM supple-mented with 10% regular DMEM, 2% fetal bovine serum and 400 mCi[35S]methionine (1000 Ci mmol). After an additional 20 hours, the cells are lysed in 1 mL lysis buffer (1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2 lmM DTT/10 mg/mL aprotinen/2 mg/mL leupeptin/2 mg/m-L antipain/0.5 mM PMSF) and the lysates cleared by centrifugation at 100,000 x g for 45 min.
  • 1 lysis buffer 1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2 lmM DTT/10 mg/mL aprotinen/2 mg/mL leupeptin/2 mg/m-L antipain/0.5 mM PMSF
  • the immunoprecipitates are washed four times with IP buffer (20 nM HEPES, pH 7.5/1 mM EDTA 1% Triton X-100.0.5% deoxycholate/0.1%/SDS/0.1 M NaCl) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands corresponding to prenylated and nonprenylated ras proteins are compared to determine the percent inhibition of prenyl transfer to protein.
  • IP buffer 20 nM HEPES, pH 7.5/1 mM EDTA 1% Triton X-100.0.5% deoxycholate/0.1%/SDS/0.1 M NaCl
  • Rat 1 cells transformed with either v-ras, v-raf, or v-mos are seeded at a density of 1 x 10 4 cells per plate (35 mm in diameter) in a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum) over a bottom agarose layer (0.6%). Both layers contain 0.1% methanol or an appropriate concentration of the compound (dissolved in methanol at 1000 times the final concentration used in the assay).
  • the cells are fed twice weekly with 0.5 mL of medium A containing 0.1% methanol or the concentration of the instant compound. Photomicrographs are taken 16 days after the cultures are seeded and comparisons are made.
  • the SEAP reporter plasmid, pDSElOO was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI.
  • the SEAP gene is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA).
  • the plasmid pCMV-RE-AKI contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus immediate early promoter.
  • the plasmid also contains a bovine growth hormone poly-A sequence.
  • the plasmid, pDSElOO was constructed as follows. A restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2-Basic using the restriction enzymes EcoRl and Hpal. The ends of the linear DNA fragments were filled in with the Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment. The vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-II and the ends filled in with Klenow DNA Polymerase I.
  • the SEAP DNA fragment was blunt end ligated into the pCMV-RE-AKI vector and the ligation products were transformed into DH5-alpha E. coli cells (Gibco- BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
  • the SEAP repotrer plasmid, pDSElOl is also constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI.
  • the SEAP gene is derived from plasmid P GEM7zf(-)/SEAP.
  • the plasmid pDSElOl was constructed as follows: A restriction fragment containing part of the SEAP gene coding sequence was cut out of the plasmid pGEM7zf(-)/SEAP using the restriction enzymes Apa I and Kpnl. The ends of the linear DNA fragments were chewed back with the Klenow fragment of E. coli DNA Polymerase I. The "blunt ended" DNA containing the truncated SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1910 base pair fragment. This 1910 base pair fragment was ligated into the plasmid pCMV-RE-AKI which had been cut with Bgl-II and filled in with E. coli Klenow fragment DNA polymerase.
  • the plasmid pCMV-RE-AKI is derived from plasmid pCMVIE- AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61, 1796-1807) by removing an EcoRI fragment containing the DHFR and Neomycin markers.
  • the plasmid pGEM7zf(-)/SEAP was constructed as follows.
  • the SEAP gene was PCRed, in two segments from a human placenta cDNA library (Clontech) using the following oligos.
  • Sense strand N-terminal SEAP 5' GAGAGGGAATTCGGGCCCTTCCTGCAT GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID.NO.:3)
  • Antisense strand N-terminal SEAP 5' GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO.:4)
  • Sense strand C-terminal SEAP 5' GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3' (SEQ.ID.NO.:5)
  • Antisense strand C-terminal SEAP 5' GAAGAGGAAGCTTGGTACCGCCACTG GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO.:6)
  • the N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and Hpal restriction sites at the ends.
  • the Antisense N-terminal oligo (SEQ.ID.NO.: 4) introduces an internal translation STOP codon within the SEAP gene along with the Hpal site.
  • the C-terminal oligos (SEQ.ID.NO.: 5 and SEQ.ID.NO.: 6) were used to amplify a 412 bp C-terminal PCR product containing Hpal and Hindlll restriction sites.
  • the sense strand C-terminal oligo introduces the internal STOP codon as well as the Hpal site.
  • the N-terminal amplicon was digested with EcoRI and Hpal while the C-terminal amplicon was digested with Hpal and Hindlll.
  • the two fragments comprising each end of the SEAP gene were isolated by electro- phoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments. These two fragments were then co-ligated into the vector pGEM7zf(-) (Promega) which had been restriction digested with EcoRI and Hindlll and isolated on an agarose gel.
  • the resulting clone, pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene from amino acids.
  • a constitutively expressing SEAP plasmid pCMV-SEAP An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegalovirus (CMV) IE-1 promoter.
  • the expression plasmid also includes the CMV intron A region 5' to the SEAP gene as well as the 3' untranslated region of the bovine growth hormone gene 3' to the SEAP gene.
  • the plasmid pCMVIE-AKI-DHFR (Whang et al, 1987) containing the CMV immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV- AKI.
  • the cytomegalovirus intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV-AKI.
  • the intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid pl6T-286.
  • the intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer, R.M., Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979-3986) to remove a Sacl restriction site using site directed mutagenesis.
  • the mutated intron A sequence was PCRed from the plasmid pl6T-287 using the following oligos.
  • Sense strand 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 7)
  • Antisense strand 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.ID.NO.: 8)
  • Sad site incorporated by the sense oligo and a Bgl-II fragment incorporated by the antisense oligo.
  • the PCR fragment is trimmed with Sad and Bgl-II and isolated on an agarose gel.
  • the vector pCMV-AKI is cut with Sad and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis. The two gel isolated fragments are ligated at their respective Sad and Bgl-II sites to create plasmid pCMV-AKI-InA.
  • the DNA sequence encoding the truncated SEAP gene is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector.
  • the SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above) using EcoRI and Hindlll. The fragment is filled in with Klenow DNA polymerase and the 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis.
  • the pCMV-AKI-InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the pCMV-AKI-InA vector.
  • pCMV-SEAP contains a modified SEAP sequence downstream of the cytomegalovirus immediately early promoter IE-1 and intron A sequence and upstream of the bovine growth hormone poly-A sequence.
  • the plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells.
  • a DNA fragment containing viral-H-r ⁇ s can be PCRed from plasmid "H-l” (Ellis R. et al. J. Virol. 36, 408, 1980) or "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) using the following oligos.
  • the sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5' to the ATG start site.
  • cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo.
  • the PCR primer oligos introduce an Xhol site at the 5' end and a Xbal site at the 3'end.
  • the Xhol-Xbal fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with Xhol and Xbal. This results in a plasmid in which the recombinant myr-viral-H-ras gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • a viral-H-ras-CVLL expression plasmid A viral-H-ras-CVLL expression plasmid "H-l" (Ellis R. et al. J.
  • Antisense strand
  • the sense strand oligo optimizes the 'Kozak' sequence and adds an Xhol site.
  • the antisense strand mutates serine 189 to leucine and adds an Xbal site.
  • the PCR fragment can be trimmed with Xhol and Xbal and ligated into the Xhol-Xbal cut vector pCI (Promega). This results in a plasmid in which the mutated viral-H-ras-CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • the human c-H-r ⁇ s gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-H-r ⁇ s encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C- terminal end.
  • the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-H-r ⁇ s-Leu61 can be excised from the pAlter-1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-H-ras-Leu61 from the CMV promoter of the pCI vector.
  • the human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-N-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C- terminal end.
  • the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glycine-12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-N-ras-Val-12 can be excised from the pAlter-1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-N-ras -Val- 12 from the CMV promoter of the pCI vector.
  • the human c-K-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-K-r ⁇ s encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a Kpnl site at the N-terminus and a Sal I site at the C-terminal end.
  • the c-K-r ⁇ s fragment can be ligated into a Kpnl -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of cysteine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-K-ras-Val-12 can be excised from the pAlter-1 vector, using Kpnl and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with Kpnl and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-K-r ⁇ s -Val- 12 from the CMV promoter of the pCI vector.
  • Human C33A cells (human epitheial carcenoma - ATTC collection) are seeded in 10cm tissue culture plates in DMEM + 10% fetal calf serum + IX Pen/Strep + IX glutamine + IX NEAA. Cells are grown at 37°C in a 5% C ⁇ 2 atmosphere until they reach 50 -80% of confluency. The transient transfection is performed by the CaPO-4 method (Sambrook et al., 1989). Thus, expression plasrnids for H-ras, N- ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the DSE- SEAP reporter construct. For 10cm plates 600 ⁇ L of CaCl 2 -DNA solution is added dropwise while vortexing to 600 ⁇ L of 2X HBS buffer to give
  • the cells are washed with PBS and trypsinized with lmL of 0.05% trypsin.
  • the 1 mL of trypsinized cells is diluted into lOmL of phenol red free DMEM + 0.2% charcoal stripped calf serum + IX (Pen/Strep, Glutamine and NEAA ).
  • Transfected cells are plated in a 96 well microtiter plate (lOO ⁇ L/well) to which drug, diluted in media, has already been added in a volume of lOO ⁇ L.
  • the final volume per well is 200 ⁇ L with each drug concentration repeated in triplicate over a range of half-log steps.
  • the heat treated media is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD®
  • Luminescence reflects the level of activation of the fos reporter construct stimulated by the transiently expressed protein.
  • DNA-CaP0 4 precipitate for 10cm. plate of cells
  • PSN-1 human pancreatic carcinoma cells are used for analysis of protein processing.
  • Subconfluent cells in 100 mm dishes are fed with 3.5 mL of media (methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine-free/methionine-free DMEM supplemented with 0.035 mL of 200 mM glutamine (Gibco), 2% fetal bovine serum, respectively) containing the desired concentration of test compound, lovastatin or solvent alone.
  • media methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine-free/methionine-free DMEM supplemented with 0.035 mL of 200 mM glutamine (Gibco), 2% fetal bovine serum, respectively
  • lovastatin 5-10 ⁇ M
  • a compound that blocks Ras processing in cells by inhibiting a rate-limiting step in the isoprenoid biosynthetic pathway serve as a positive control.
  • Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%. Following incubation at 37°C for two hours 204 ⁇ Ci/mL [35s]Pro-Mix (Amersham, cell labeling grade) is added. After introducing the label amino acid mixture, the cells are incubated at 37°C for an additional period of time (typically 6 to 24 hours). The media is then removed and the cells are washed once with cold PBS.
  • the cells are scraped into 1 mL of cold PBS, collected by centrifugation (10,000 x g for 10 sec at room temperature), and lysed by vortexing in 1 mL of lysis buffer (1% Nonidet P-40, 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, 10 ⁇ g/mL AEBSF, 10 ⁇ g/mL aprotinin, 2 ⁇ g/mL leupeptin and 2 ⁇ g/mL antipain). The lysate is then centrifuged at 15,000 x g for 10 min at 4°C and the supernatant saved.
  • lysis buffer 1% Nonidet P-40, 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, 10 ⁇ g/m
  • Ki4B-Ras For immunoprecipitation of Ki4B-Ras, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 mL with lysis buffer lacking DTT and 8 ⁇ g of the pan Ras monoclonal antibody, Y13-259, added. The protein/antibody mixture is incubated on ice at 4°C for 24 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 4°C for 45 minutes.
  • pansorbin Calbiochem
  • the pellet is washed 3 times with 1 mL of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ⁇ L elution buffer (10 mM Tris pH 7.4, 1% SDS).
  • the Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature). The supernatant is added to 1 mL of Dilution Buffer 0.1%
  • Triton X-100 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4 with 2 ⁇ g Kirsten-ras specific monoclonal antibody, c-K-ras Ab-1 (Calbiochem).
  • the second protein/antibody mixture is incubated on ice at 4°C for 1-2 hours.
  • the immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 4°C for 45 minutes.
  • the pellet is washed 3 times with 1 mL of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer.
  • the Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis-acrylamide:acrylamide, 1:100), and the Ras visualized by fluorography.
  • PSN-1 cells are seeded in 24-well assay plates. For each compound to be tested, the cells are treated with a minimum of seven concentrations in half-log steps. The final solvent (DMSO) concentration is 0.1%. A vehicle-only control is included on each assay plate. The cells are treated for 24 hours at 37°C / 5% C0 2 .
  • the growth media is then aspirated and the samples are washed with PBS.
  • the cells are lysed with SDS-PAGE sample buffer containing 5% 2-mercaptoethanol and heated to 95 DC for 5 minutes. After cooling on ice for 10 minutes, a mixture of nucleases is added to reduce viscosity of the samples.
  • the plates are incubated on ice for another 10 minutes.
  • the samples are loaded onto pre-cast 8% acrylamide gels and electrophoresed at 15 mA/gel for 3-4 hours.
  • the samples are then transferred from the gels to PVDF membranes by Western blotting.
  • the membranes are blocked for at least 1 hour in buffer containing 2% nonfat dry milk.
  • the membranes are then treated with a monoclonal antibody to HDJ-2 (Neomarkers Cat. # MS-225), washed, and treated with an alkaline phosphatase-conjugated secondary antibody.
  • the membranes are then treated with a fluorescent detection reagent and scanned on a phosphorimager. For each sample, the percent of total signal corresponding to the unprenylated species of HDJ (the slower-migrating species) is calculated by densitometry. Dose-response curves and IC50 values are generated using 4-parameter curve fits in SigmaPlot software.
  • PSN-1 human pancreatic carcinoma cells are used for analysis of protein processing.
  • Subconfluent cells in 150 mm dishes are fed with 20 mL of media (RPMI supplemented with 15% fetal bovine serum) containing the desired concentration of prenyl-protein transferase inhibitor or solvent alone.
  • Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%.
  • the cells are incubated at 37°C for 24 hours, the media is then removed and the cells are washed twice with cold PBS.
  • the cells are scraped into 2 mL of cold PBS, collected by centrifugation (10,000 x g for 5 min at 4°C) and frozen at -70 °C.
  • Cells are lysed by thawing and addition of lysis buffer (50 mM HEPES, pH 7.2, 50 mM NaCl, 1% CHAPS, ON ⁇ g/mL aprotinin, ON ⁇ g/mL leupeptin 300 ⁇ g/mL pefabloc, and 0.3 mM EDTA).
  • the lysate is then centrifuged at 100,000 x g for 60 min at 4°C and the supernatant saved.
  • the supernatant may be subjected to SDS- PAGE, HPLC analysis, and/or chemical cleavage techniques.
  • the lysate is applied to a HiTrap-SP (Pharmacia Biotech) column in buffer A (50 mM HEPES pH 7.2) and resolved by gradient in buffer A plus 1 M ⁇ aCl. Peak fractions containing Ki4B-Ras are pooled, diluted with an equal volume of water and immunoprecipitated with the pan Ras monoclonal antibody, Y13-259 linked to agarose.
  • the protein antibody mixture is incubated at 4°C for 12 hours.
  • the immune complex is washed 3 times with PBS, followed by 3 times with water.
  • the Ras is eluted from the beads by either high pH conditions (pH>10) or by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation.
  • the supernatant may be subjected to SDS-PAGE, HPLC analysis, and/or chemical cleavage techniques.
  • the pellet is washed 3 times with 1 mL of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ⁇ L elution buffer (10 mM Tris pH 7.4, 1% SDS).
  • the Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
  • the supernatant is added to 1 mL of Dilution Buffer (0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 ⁇ g Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech).
  • Dilution Buffer 0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4
  • Rapl antibody Rapl/Krevl (121) (Santa Cruz Biotech).
  • the second protein/antibody mixture is incubated on ice at 4°C for 1-2 hours.
  • the immune complex is collected on pansorbin (Calbiochem) by tumbling at 4°C for 45 minutes.
  • the pellet is washed 3 times with 1 mL of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer.
  • Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis- acrylamide:acrylamide, 1:100), and the Rapl visualized by fluorography.
  • PSN-1 cells are passaged every 3-4 days in 10cm plates, splitting near-confluent plates 1:20 and 1:40. The day before the assay is set up, 5x 10 cells are plated on 15cm plates to ensure the same stage of confluency in each assay.
  • the media for these cells is RPMl 1640 (Gibco), with 15% fetal bovine serum and lx Pen/Strep antibiotic mix.
  • cells are collected from the 15cm plates by trypsinization and diluted to 400,000 cells/mL in media. 0.5mL of these diluted cells are added to each well of 24-well plates, for a final cell number of 200,000 per well. The cells are then grown at 37C overnight.
  • the compounds to be assayed are diluted in DMSO in 1/2-log dilutions.
  • the range of final concentrations to be assayed is generally 0.1-100 ⁇ M. Four concentrations per compound is typical.
  • the compounds are diluted so that each concentration is lOOOx of the final concentration (i.e., for a lO ⁇ M data point, a lOmM stock of the compound is needed).
  • each lOOOx compound stock is diluted into lmL media to produce a 2X stock of compound.
  • a vehicle control solution (2 ⁇ L DMSO to lmL media), is utilized.
  • 0.5 mL of the 2X stocks of compound are added to the cells. After 24 hours, the media is aspirated from the assay plates.
  • RNAse/DNase mix is added per well. This mix is lmg/mL DNasel (Worthington Enzymes), 0.25mg/mL Rnase A (Worthington Enzymes), 0.5M Tris-HCl pH8.0 and 50mM MgCl2. The plate is left on ice for 10 minutes.
  • Samples are then either loaded on the gel, or stored at -70 DC until use.
  • Each assay plate (usually 3 compounds, each in 4-point titrations, plus controls) requires one 15-well 14% Novex gel. 25 ⁇ L of each sample is loaded onto the gel. The gel is run at 15mA for about 3.5 hours. It is important to run the gel far enough so that there will be adequate separation between 21kd (Rapl) and 29kd (Rab6).
  • the gels are then transferred to Novex pre-cut PVDF membranes for 1.5 hours at 30V (constant voltage). Immediately after transferring, the membranes are blocked overnight in 20mL Western blocking buffer (2% nonfat dry milk in Western wash buffer (PBS + 0.1% Tween-20). If blocked over the weekend, 0.02% sodium azide is added. The membranes are blocked at 4°C with slow rocking.
  • the blocking solution is discarded and 20mL fresh blocking solution containing the anti Rapla antibody (Santa Cruz Biochemical SC1482) at 1:1000 (diluted in Western blocking buffer) and the anti Rab6 antibody (Santa Cruz Biochemical SC310) at 1:5000 (diluted in Western blocking buffer) are added.
  • the membranes are incubated at room temperature for 1 hour with mild rocking. The blocking solution is then discarded and the membrane is washed 3 times with Western wash buffer for 15 minutes per wash.
  • the developed transparency sheet is scanned on a phosphorimager and the Rapla Minimum Inhibitory Concentration is determined from the lowest concentration of compound that produces a detectable Rapla Western signal.
  • the Rapla antibody used recognizes only unprenylated/unprocessed Rapla, so that the presence of a detectable Rapla Western signal is indicative of inhibition of Rapla prenylation.
  • Rodent fibroblasts transformed with oncogenically mutated human Ha-ras or Ki-ras (10 cells/animal in 1 mL of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0.
  • the mice in each oncogene group are randomly assigned to a vehicle or compound treatment group. Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment.
  • the prenyl-protein transferase inhibitor may be administered by a continuous infusion pump.
  • Compound or vehicle is delivered in a total volume of 0.1 mL. Tumors are excised and weighed when all of the vehicle-treated animals exhibited lesions of 0.5 - 1.0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.
  • Step A l-(4-Bromobenzyl)-2-mercapto-5-hvdroxy ⁇ nethylimidazole
  • 4-bromobenzylamine (10.0 g, 44.9 mmol)
  • acetic acid (6.8 mL, 89.8 mmol)
  • potassium thiocyanate 6.6 g, 67.4 mmol
  • 1,3-dihydroxyacetone dimer 5.3 g, 29.2 mmol
  • the slurry was warmed to 80 °C then cooled to room temperature and placed in an ice bath for 4 h.
  • the solid was filtered and washed with ft-butanol, isopropanol, water and water-methanol (9:1). The solid was dried under vacuum to yield the title compound.
  • Step B l-(4-Bromobenzyl)-5-hydroxymethylimidazole l-(4-Bromo)-2-mercapto-5-hydroxymethylimidazole (16 g,
  • Step C l- ⁇ 4-(4-Trifluoromethylphenyl)benzyl ⁇ -5-hydroxymethyl- imidazole l-(4-Bromobenzyl)-5-hydroxymethylimidazole (0.5 g, 1.87 mmol) and 4-trifluoromethylbenzeneboronic acid (711 mg, 3.74 mmol) were dissolved in dimethoxyethane (15 mL) under argon. To this solution was added potassium carbonate (2.58 g, 9.36 mmol), water (7 mL), palladium tetrakistriphenylphosphine (432 mg, 0.37 mmol) and the reaction refluxed until complete. Workup and chromatography on silica get using 10% methanol in methylene chloride gave the title compound.
  • Step D l- ⁇ 4-(4-Trifluoromethylphenyl)benzyl ⁇ -5-imidazole- carboxaldehyde l- ⁇ 4-(4-Trifluoromethylphenyl)benzyl ⁇ -5-hydroxymethyl- imidazole (1.0 g, 3.0 mmol) was dissolved in dimethylsulfoxide (10 mL) under argon. To this was added triethylamine (1.67 mL, 12 mmol) and sulfur trioxide pyridine complex (1.2 g, 7.5 mmol). After 2 h 45 min, added another portion of sulfur trioxide pyridine complex ( 1.2 g). After 45 min, the reaction was poured into water and worked up with ethyl acetate. The crude product was chromatographed with 3% methanol in chloroform to give the title compound.
  • Step E l-(3-Chlorophenyl)-2-piperazinone
  • Step F l-(3-chlorophenyl)-4-[l- ⁇ 4-(4-trifluoromethylphenyl)benzyl ⁇ -5- imidazolylmethyl] -2-piperazinone dihydrochloride
  • Step A l-(4-Bromobenzyl)-5-chloromethylimidazole hydrochloride l-(4-Bromobenzyl)-5-hydroxymethylimidazole (3.0 g, 11.2 mmol) was dissolved in DMF under argon. The reaction was cooled to 0°C and thionyl chloride (1.5 mL, 20.2 mmol) was added slowly. The reaction was stirred for 30 min at 0°C and at room temperature for 1 h. The reaction was cooled to 0°C and quenched with isopropanol (1 mL). Ethyl acetate (15 mL) was added and the reaction stirred for 1 h.
  • Step B l-(3-chlorophenyl)-4-[(4-bromophenyl)benzyl]-5- imidazolylmethyl-2-piperazinone l-(3-Chlorophenyl)-2-piperazinone hydrochloride (764 mg, 3.1 mmol) and l-(4-bromobenzyl)-5-chloromethylimidazole hydrochloride is suspended in acetonitrile (10 mL). The reaction is cooled to 0°C under argon and diisopropylethylamine added. When the reaction was judged complete by HPLC, the solvent was removed in vacuo, and the residue partitioned between ethyl acetate and water and worked up. The title compound was obtained in sufficient purity for the next step.
  • Step C l-(3-Chlorophenyl)-4-[l- ⁇ 4-(4-chlorophenyl)benzyl ⁇ -5- imidazolylmethyll -2-piperazinone dihydrochloride l-(3-Chlorophenyl)-4-[(4-bromophenyl)benzyl]-5- imidazolylmethyl-2-piperazinone (150 mg, 0.326 mmol) and 4- chlorophenylboronic acid (102 mg, 0.652 mmol) were dissolved in dimethoxyethane (5 mL) under argon.
  • the reaction was cooled to room temperature, the layers separated, and the oraganic layer cooled to 0°C in an ice bath.
  • the title compound crystallized from the solution, and was collected by filtration, washed with cold isopropyl acetate, and dried under vacuum overnight.
  • Step B l-(4-Trifluoromethyl)-2-piperazinone hydrochloride
  • N-(4-Trifluoromethylphenyl) 2-(2-hydroxyethyl- amino)acetamide (2.3 g, 8.78 mmol) was dissolved in tetrahydrofuran (17 mL) under argon.
  • Tributylphosphine (3.5 mL, 14.0 mmol) was added, and the reaction cooled to 0°C.
  • Di- -butylazodicarboxylate (3.2 g, 14.0 mmol) was added, and the reaction stirred at 0°C for 30 min, and at room temperature for 4 h. The solvent was evaporated, and isopropanol added (20 mL).
  • Step C 5-Chloromethyl-l-[4-(trifluoromethylphenyl)-benzylimidazole hydrochloride
  • 5-Hydroxymethyl-l- [4-(trifluoromethylphenyl)- benzylimidazole 340 mg, 1.20 mmol
  • Thionyl chloride was added (0.16 mL, 2.15 mmol) and the reaction stirred for 1 h at 0°C and 1 h at room temperature.
  • Isopropanol (few drops) and ethyl acetate were added, and the precipitate stirred at 0°C for 1 h then filtered, giving the title compound.
  • Step D l-(4-Trifluoromethylphenyl)-4- [l- ⁇ 4-(4-trifluoromethyl- phenyl)benzyl ⁇ -5-imidazolylmethyl]-2-piperazinone dihydrochloride
  • the title compound was prepared according to the procedure described in Example 1, Step C, except using 3-chlorophenylboronic acid (102 mg, 0.652 mmol), l-(3-chlorophenyl)-4-[l-(4-bromobenzyl)-5- imidazolyl-methyl]-2-piperazinone (150 mg, 0.326 mmol), tetrakis(triphenylphosphine)palladium (75 mg), potassium carbonate (225 mg, 1.63 mmol) in dimethoxyethane (5 mL) and water (2 mL).
  • the title compound was prepared according to the procedure described in Example 1, Step C, except using 4-fluorophenylboronic acid (122 mg, 0.86 mmol), l-(3-chlorophenyl)-4-[l-(4-bromobenzyl)-5- imidazolylmethyl]-2-piperazinone (200 mg, 0.43 mmol), tetrakis(triphenylphosphine) palladium (100 mg), potassium carbonate (300 mg, 2.17 mmol) in dimethoxyethane (7 mL) and water (3 mL).
  • the title compound was prepared according to the procedure described in Example 1, Step C, except using 3,5-bis-trifluoromethyl- phenylboronic acid (224 mg, 0.87 mmol), l-(3-chlorophenyl)-4-[l-(4- bromobenzyl)-5-imidazolylmethyl]-2-piperazinone (200 mg, 0.43 mmol), tetrakis(triphenylphosphine)palladium (100 mg), potassium carbonate (300 mg, 2.17 mmol) in dimethoxyethane (7 mL) and water (3 mL).
  • Step B l-(3-Chlorophenyl)-4- [l- ⁇ 4-(2-methoxy-4-Trifluoromethyl- phenyl)benzyl ⁇ -5-imidazolylmethyl]-2-piperazinone- dihvdrochloride
  • the title compound was prepared according to the procedure described in Example 1, Step C, except using 2-methoxy-4-trifluoromethyl- phenyl boronic acid (150 mg, 1.60 mmol), l-(3-chlorophenyl)-4-[l-(4-bromo- benzyl)-5-imidazolylmethyl]-2-piperazinone (210 mg, 1.06 mmol), tetrakis(triphenylphosphine)palladium (105 mg), potassium carbonate (315 mg, 2.28 mmol) in dimethoxyethane (10 mL) and water (5 mL).
  • Step C l-(3-Chlorophenyl)-4-(l-triphenylmethyl-4-imidazolyl- methyl)-2-piperazinone
  • Step D l-(3-Chlorophenyl)-4-[l- ⁇ 2-(4-chlorophenyl)-5-pyridylmethyl ⁇ - 5-imidazolylmethyll -2-piperazinone trihydrochloride l-(3-Chlorophenyl)-4-(l-triphenylmethyl-4-imidazolyl- methyl)-2-piperazinone and 5-bromomethyl-2-(4-chlorophenyl)pyridine in acetonitrile (5 mL) were stirred together at room temperature overnight, then heated at 40°C for 6 h. The solution was cooled and the solvent removed under vacuum. The residue was dissolved in methanol and refluxed for 2 h.
  • Step B l-(3-Chlorophenyl)-4-[l-(2-bromo-5-pyridylmethyl)-5- imidazol ylmethyH -2-piperazinone hydrobromide l-(3-Chlorophenyl)-4-(l-triphenylmethyl-4-imidazolyl- methyl)-2-piperazinone and 2-bromo-5-bromomethylpyridine were heated together in ethyl acetate at 40°C for 4 h. The solution was cooled and the solvent removed under vacuum. The residue was dissolved in chloroform - acetonitrile and stirred at room temperature 48 h. The precipitate which formed was filtered from the reaction and determined to be the title compound.
  • Step C l-(3-Chlorophenyl)-4-[l- ⁇ 2-(4-trifluoromethoxyphenyl)-5- pyridylmethyl ⁇ -5-imidazolylmethyl] -2-piperazinone trihydrochloride
  • the title compound was prepared according to the procedure described in Example 1, Step C, except using l-(3-chlorophenyl)-4-[l-(2- bromo-5-pyridylmethyl)-5-imidazolylmethyl]-2-piperazinone hydrobromide (165 mg, 0.30 mmol) 4-trifluoro-methoxyphenylboronic acid (148 mg, 0.72 mmol), tetrakis-(triphenylphosphine)-palladium (183 mg), potassium carbonate (248 mg, 1.79 mmol) in dimethoxyethane (5 mL) and water (2 mL).
  • Step A l-Triphenylmethyl-4-(hvdroxymethyl)-imidazole
  • Step C l-(2-Bromopyridyl-5-methyl)-5-acetoxymethylimidazole hydrobromide
  • the filtrate was concentrated and refluxed for 2 h, the precipitate collected, and the process repeated 2 more times.
  • the combined collected precipitates was dissolved in methanol (100 mL) and refluxed for 1 h. The methanol was evaporated and the solid triturated with hexane and filtered. The collected solid was the title compound.
  • Step D l-(2-Bromo-5-pyridylmethyl)-5-hydroxymethylimidazole l-(2-Bromo-5-pyridylmethyl)-5-acetoxymethylimidazole hydrobromide (6.1 g, 19.7 mmol) was dissolved in tetrahydrofuran (30 mL) and water (10 mL). The solution was cooled to 0°C and lithium hydroxide monohydrate (1.65 g, 39.3 mmol) was added. After 1 h, the reaction was worked up with ethyl acetate. The ethyl acetate was washed with saturated sodium chloride solution, then dried over magnesium sulfate. Filtration and solvent evaporation gave the title compound.
  • Step E l-(2-Bromo-5-pyridylmethyl)-5-chloromethylimidazole hydrochloride l-(2-Bromo-5-pyridylmethyl)-5-hydroxymethylimidazole (1.5 g, 5.6 mmol) was dissolved in dimethylformamide (7 mL) and cooled to 0°C under argon. Thionyl chloride (0.82 mL, 11.2 mmol) was added and the reaction stirred for 1 h. After quenching with isopropanol (few drops) and ethyl acetate, the resulting precipitate was filtered and dried, giving the title compound.
  • Step F l-(3-Chlorophenyl)-4-[l-(2-bromo-5-pyridylmethyl)-5- imidazolylmethyll-2-piperazinone l-(2-Bromo-5-pyridylmethyl)-5-chloromethylimidazole hydrochloride (150 mg, 0.4 mmol) and l-(3-chlorophenyl)-2-piperazinone hydrochloride (100 mg, 0.4 mmol) was stirred in acetonitrile at room temperature under argon.
  • Step G l-(3-Chlorophenyl)-4-[l- ⁇ 2-(4-trifluoromethylphenyl)pyridyl-
  • the title compound was prepared according to the procedure described in Example 1, Step C, except using l-(3-chlorophenyl)-4-[l-(2- bromo-5-pyridylmethyl)-5-imidazolylmethyl] -2-piperazinone hydrobromide (200 mg, 0.34 mmol) 4-trifluoro-methylphenylboronic acid (90 mg, 0.48 mmol),tetrakis-(triphenylphosphine)palladium (100 mg), potassium carbonate (300 mg, 2.17 mmol) in dimethoxyethane (7 mL) and water (3 mL).
  • Step A Methyl 4-Amino-3-hydroxybenzoate A solution of 4-amino-3-hydroxybenzoic acid (10.0 g, 65.3 mmol) in methanol (50 mL) saturated with HCl was heated to reflux overnight. The solvent was removed in vacuo and the residue partitioned between methylene chloride and saturated sodium bicarbonate. The organic layer was separated, dried (Na 2 S0 ), filtered, and concentrated in vacuo to provide the titled product as a brown solid which was sufficiently pure for use in the next step.
  • Step C Methyl 4-Iodo-3-methoxybenzoate NaH (60 wt%, 361 mg, 9.02 mmol) was added to a solution of methyl 3-hydroxy-4-iodobenzoate (2.09 g. 7.52 mmol) in DMF (20 mL) at room temperature. After hydrogen evolution ceased (15 minutes), iodomethane (0.562 mL, 9.02 mmol) was added and the solution stirred at room temperature for 1 hour. The reaction mixture was poured onto water and extracted with ethyl acetate. The organic layer was dried (Na 2 S0 ), filtered, and concentrated in vacuo to provide the titled product as a brown oil which was sufficiently pure for use in the next step.
  • Methyl 4-iodo-3-methoxybenzoate (0.765 g, 2.62 mmol), 4-trifluoromethylbenzeneboronic acid (497 mg, 2.62 mmol), cesium carbonate (1.28 g, 3.93 mmol) and palladium tetrakistriphenylphosphine (61.0 mg, 0.0524 mmol) were dissolved in DMF (10 mL) and heated to 100 °C under argon overnight. The reaction mixture was poured onto brine and extracted with benzene. The organic layer was dried (Na 2 S0 ), filtered, and concentrated in vacuo to provide the titled product as a brown oil which was sufficiently pure for use in the next step.
  • Step E 4-Hydroxymethyl-2-methoxy- l-(4-trifluoromethyl- phenyl )benzene Lithium aluminum hydride (IM solution in THF, 4.83 mL,
  • Step F l-(3-Chlorophenyl)-4- [l- ⁇ 4-(4-trifluoromethylphenyl)-3- methoxy-benzyl ⁇ -5-imidazolylmethyl]-2-piperazinone dihydrochloride
  • Trifluoromethanesulfonic anhydride (0.0307 mL, 0.183 mmol) was added to a solution of l-(3-chlorophenyl)-4-(l-triphenylmethyl- 4-imidazolylmethyl)-2-piperazinone (see Example 10, Step C, 94.4 mg, 0.177 mmol), 4-hydroxymethyl-2-methoxy-l-(4-trifluoromethyl- phenyl)benzene (50.0 mg, 0.177 mmol), and diisopropylethylamine (0.0339 mL, 0.195 mmol) in methylene chloride (3 mL) at -78 °C. The solution was slowly warmed to room temperature overnight and then concentrated in vacuo.
  • Step A 4-(2-Trifluoroacetamido)ethyl-l-(triphenylmethyl)imidazole
  • Powdered histamine dihydrochloride (20.0 g, 109 mmol) was completely dissolved in methylene chloride (400 mL) and triethylamine (68.1 mL, 489 mmol) at 0 °C.
  • Trifluoroacetic anydride (15.7 mL, 111 mmol) was added dropwise and the solution was stirred overnight.
  • DMF (400 mL) and triphenylemthyl chloride (30.9 g, 111 mmol) were added sequentially, and the resulting solution was stirred overnight.
  • Water (100 mL) was added and aged for 1 hour at room temperature. The precipiate was filtered and rinsed with water to produce the title product as a white solid. A second crop of product was collected by cooling the mother liquor to 0 °C for several hours and then collecting the additional white precipitate.
  • Step B 4-(2-Aminoethyl)-l-(triphenylmethyl)imidazole
  • Step C N-(3-Chlorophenyl) 2 -chloro acetamide
  • Chloroacetyl chloride (4.38 mL, 55.0 mmol) was added to a solution of 3-chloroaniline in saturated sodium bicarboante (100 mL) and ethyl acetate (100 mL) at 0 °C.
  • the solution was vigorously stirred at room temperature overnight and then the layers were separated.
  • the organic layer was dried (Na 2 S0 4 ), filtered, and concentrated in vacuo to provide the titled product as a white solid which was sufficiently pure for use in the next step.
  • Step D N-(3-chlorophenyl) 2-[(l-triphenylmethyl-4-imidazolyl)-2- ethyl amino] acetamide N-(3-Chlorophenyl) 2-chloroacetamide (11.0 g, 53.9 mmol),
  • Step E N-(3-Chlorophenyl) N'-2-hydroxyethyl-2-[(l-triphenylmethyl-
  • Step F l-(3-Chlorophenyl)-4-( l-triphenylmethyl-4-imidazolyl-2- ethyl)-2-piperazinone

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des composés qui inhibent la prényl-protéine transférase et la prénylation de la protéine oncogène Ras. L'invention porte également sur des compositions chimiothérapeutiques contenant les composés de l'invention et sur des méthodes d'inhibition de la prényl-protéine transférase et de la prénylation de la protéine oncogène Ras.
PCT/US2000/015461 1999-06-09 2000-06-05 Inhibiteurs biaryliques de la prenyl-proteine transferase WO2000075135A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU54642/00A AU5464200A (en) 1999-06-09 2000-06-05 Biaryl inhibitors of prenyl-protein transferase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13883699P 1999-06-09 1999-06-09
US60/138,836 1999-06-09

Publications (1)

Publication Number Publication Date
WO2000075135A1 true WO2000075135A1 (fr) 2000-12-14

Family

ID=22483889

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/015461 WO2000075135A1 (fr) 1999-06-09 2000-06-05 Inhibiteurs biaryliques de la prenyl-proteine transferase

Country Status (2)

Country Link
AU (1) AU5464200A (fr)
WO (1) WO2000075135A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014009478A1 (fr) 2012-07-12 2014-01-16 L'oreal Dispositif de conditionnement et de distribution d'une composition cosmétique et procédé de distribution associé
US9045445B2 (en) 2010-06-04 2015-06-02 Albany Molecular Research, Inc. Glycine transporter-1 inhibitors, methods of making them, and uses thereof
US20160297792A1 (en) * 2013-11-12 2016-10-13 Merck Sharp & Dohme Corp. Piperidine or piperazine linked imidazole and triazole derivatives and methods of use thereof for improving the pharmacokinetics of a drug

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5141851A (en) * 1990-04-18 1992-08-25 Board Of Regents, The University Of Texas System Isolated farnesyl protein transferase enzyme
US5856326A (en) * 1995-03-29 1999-01-05 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5141851A (en) * 1990-04-18 1992-08-25 Board Of Regents, The University Of Texas System Isolated farnesyl protein transferase enzyme
US5856326A (en) * 1995-03-29 1999-01-05 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MOASSER ET AL.: "Farnesyl transferase inhibitors cause enhanced mitotic sensitivity to taxol and epothilones", PROC. NATL. ACAD. SCI. USA,, vol. 95, no. 4, 17 February 1998 (1998-02-17), pages 1369 - 1374, XP002930357 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9045445B2 (en) 2010-06-04 2015-06-02 Albany Molecular Research, Inc. Glycine transporter-1 inhibitors, methods of making them, and uses thereof
WO2014009478A1 (fr) 2012-07-12 2014-01-16 L'oreal Dispositif de conditionnement et de distribution d'une composition cosmétique et procédé de distribution associé
US20160297792A1 (en) * 2013-11-12 2016-10-13 Merck Sharp & Dohme Corp. Piperidine or piperazine linked imidazole and triazole derivatives and methods of use thereof for improving the pharmacokinetics of a drug
US10745377B2 (en) * 2013-11-12 2020-08-18 Merck Sharp & Dohme Corp. Piperidine or piperazine linked imidazole and triazole derivatives and methods of use

Also Published As

Publication number Publication date
AU5464200A (en) 2000-12-28

Similar Documents

Publication Publication Date Title
AU760027B2 (en) Inhibitors of prenyl-protein transferase
WO2001060369A1 (fr) Inhibiteurs de la prenyl-proteine transferase
WO2000051614A1 (fr) Inhibiteurs de prenyl-proteine transferases
EP1087770A1 (fr) Inhibiteurs de prenyl-proteine transferase
US6284755B1 (en) Inhibitors of prenyl-protein transferase
EP1014984A1 (fr) Inhibiteurs de prenyl-proteine-transferases
WO2001060815A1 (fr) Inhibiteurs de prenyle proteine transferases
US20020010184A1 (en) Inhibitors of prenyl-protein transferase
EP1090011A1 (fr) Inhibiteurs de prenyl-proteine transferase
US20020193283A1 (en) Inhibitors of prenyl-protein transferase
WO2001051128A1 (fr) Inhibiteurs de la prenyl-transferase
WO2001045707A1 (fr) Inhibiteurs de prenyl-proteine transferase
WO1999027933A1 (fr) Inhibiteurs de la farnesyl-proteine transferase
WO2000052134A2 (fr) Inhibiteurs de la prenyle-proteine transferase
WO2000075135A1 (fr) Inhibiteurs biaryliques de la prenyl-proteine transferase
US6333335B1 (en) Phenyl-protein transferase inhibitors
AU762440B2 (en) Inhibitors of prenyl-protein transferase
WO2001051127A1 (fr) Inhibiteurs de la transferase de proteine prenyle
EP1165013A2 (fr) Inhibiteurs de prenyle proteine transferase
WO2001045704A1 (fr) Inhibiteurs de la prenyl-proteine transferase
WO1999010329A1 (fr) Inhibiteurs de prenyl-proteine-transferase
WO2001051125A1 (fr) Inhibiteurs de la prenyl-proteine transferase
WO2002002108A1 (fr) Inhibiteurs de la prenyl-proteine transferase
EP1158983A1 (fr) Inhibiteurs de prenyl-proteine transferases
WO2001007051A1 (fr) Inhibiteurs de prenyl-proteine transferase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP