WO2001045704A1 - Inhibiteurs de la prenyl-proteine transferase - Google Patents

Inhibiteurs de la prenyl-proteine transferase Download PDF

Info

Publication number
WO2001045704A1
WO2001045704A1 PCT/US2000/034325 US0034325W WO0145704A1 WO 2001045704 A1 WO2001045704 A1 WO 2001045704A1 US 0034325 W US0034325 W US 0034325W WO 0145704 A1 WO0145704 A1 WO 0145704A1
Authority
WO
WIPO (PCT)
Prior art keywords
substituted
unsubstituted
heterocycle
aryl
alkyl
Prior art date
Application number
PCT/US2000/034325
Other languages
English (en)
Inventor
Jacob M. Hoffman
Original Assignee
Merck & Co., Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck & Co., Inc. filed Critical Merck & Co., Inc.
Priority to AU24363/01A priority Critical patent/AU2436301A/en
Publication of WO2001045704A1 publication Critical patent/WO2001045704A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D235/00Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings
    • C07D235/02Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings condensed with carbocyclic rings or ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/06Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D491/00Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/10Spiro-condensed systems

Definitions

  • Ras proteins are part of a signalling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein.
  • Ras In the inactive state, Ras is bound to GDP.
  • Ras Upon growth factor receptor activation Ras is induced to exchange GDP for GTP and undergoes a conformational change.
  • the GTP-bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and DM.
  • Mutated ras genes (Ha-ras, Ki4a-ra,s, Ki4b-ras and N-r s) are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
  • Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras.
  • the Ras C-terminus contains a sequence motif termed a "CAAX” or "Cys-Aaa- ⁇ - Aaa -Xaa” box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al, Nature 310:583-586 (1984)).
  • this motif serves v as a signal sequence for the enzymes farnesyl-protein transferase or geranylgeranyl-protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C 15 or C20 isoprenoid, respectively.
  • Ras protein transferases Such enzymes may be generally termed prenyl-protein transferases.
  • the Ras protein is one of several proteins that are known to undergo post-translational famesylation.
  • Other famesylated proteins include the Ras- related GTP-binding proteins such as Rho, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin.
  • James, et al., J. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also famesylated.
  • James, et al. have also suggested that there are famesylated proteins of unknown structure and function in addition to those listed above.
  • Farnesyl-protein transferase utilizes farnesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss et al, Cell, (52:81-88 (1990); Schaber et al, J. Biol. Chem., 265:14701-14704 (1990); Schafer et al, Science, 249:1133-1139 (1990); Manne et al, Proc. Natl Acad. Sci USA, 87:7541-7545 (1990)).
  • FPTase farnesyl-protein transferase
  • FPP farnesyl diphosphate
  • Ras protein substrates
  • the peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation.
  • Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the farnesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al, Science, 260:1934-1937 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)).
  • deletion of the thiol from a CAAX derivative has been shown to dramatically reduce the inhibitory potency of the compound.
  • the thiol group potentially places limitations on the therapeutic application of FPTase inhibitors with respect to pharmacokinetics, pharmacodynamics and toxicity. Therefore, a functional replacement for the thiol is desirable.
  • farnesyl-protein transferase inhibitors are inhibitors of proliferation of vascular smooth muscle cells and are therefore useful in the prevention and therapy of arteriosclerosis and diabetic disturbance of blood vessels (JP H7-112930).
  • an object of this invention to develop compounds that will inhibit prenyl-protein transferase and thus, the post-translational isoprenylation of proteins. It is a further object of this invention to develop chemotherapeutic compositions containing the compounds of this invention and methods for producing the compounds of this invention.
  • the present invention comprises structurally-constrained compounds which inhibit prenyl-protein transf erases. Further contained in this invention are chemotherapeutic compositions containing these prenyl-protein transferase inhibitors and methods for their production.
  • the compounds of this invention are useful in the inhibition of prenyl- protein transferase and the prenylation of the oncogene protein Ras.
  • the inhibitors of a prenyl-protein transferase are illustrated by the formula A-1:
  • X 1 is (CR ⁇ A ⁇ CR 1 ⁇ ;
  • R la and R lb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, ) 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, ) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -,
  • R >2 is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) ⁇ ⁇ C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) -C cycloalkyl, unsubstituted or substituted,
  • R 3 is independently selected from: a) hydrogen, b) halo, c) C 1-C6, alkyl, unsubstituted or substituted. d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted h) ORio, i) R 6a S(O) m , j) ⁇ ⁇ C c y c l°alkyl, unsubstituted or substituted, k) C "C alkenyl, unsubstituted or substituted,
  • R is independently selected from: a) hydrogen, b) C ⁇ C fi alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
  • R and R are independently selected from:
  • R andR may be joined in a ring
  • R 6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from: a) hydrogen, b) unsubstituted or substituted C 2 -C 6 alkenyl, c) unsubstituted or substituted C 2 -C 6 alkynyl, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) unsubstituted or substituted C C perfluoroalkyl, f) halo, g) R 10 o-, h) CN, i) R 6a S(O) -, j) -C(O)NR°R / , k) R 10 C(O)N R 10 -,
  • R 10 is independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 8 alkyl, c) C 3 -C 6 cycloalkyl, d) Ci-C 6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • G 1 and G 2 are independently selected from CH 2 or oxygen, provided at least one is oxygen;
  • J is CH 2 , NH or oxygen
  • M is CH 2 , NH, S(O) m , or oxygen
  • V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) C j -C ⁇ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O) m , and N, and e) C 2 -C 20 alkenyl, provided that V is not hydrogen if A 1 is S(O) m and n is 0;
  • W is a heterocycle
  • Z is C(O) or CH 2 ;
  • n 0,1,2, 3,4, 5 or 6; is 0,1,2, 3,4, 5 or 6; ris 0 to 5, provided that r is 0 when V is hydrogen sis 0,1,2, 3 or 4; tis 0,1,2, 3, or 4; vis 0, 1, 2, or 3; wis 0, 1, or 2; and Z Oorl;
  • X 2 is (CR lb 2 ) p A 2 (CR lb 2 ) p ;
  • R la and R lb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -,
  • R 2 is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C ⁇ C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) C 3 -C c y c l oa lkyl ; unsubstituted or substituted,
  • R > 3 j i.s independently selected from: a) hydrogen, b) halo, c) C ⁇ C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 ,
  • R 6 and R 7 are independently selected from:
  • R and R may be joined in a ring
  • R 6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from: a) hydrogen, b) unsubstituted or substituted C 2 -C 6 alkenyl, c) unsubstituted or substituted C 2 -C 8 alkynyl, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) unsubstituted or substituted C C 4 perfluoroalkyl, f) halo, g) R 10 O-, h) CN, i) R 6a S(O) m -, j) -C(O)NR 6 R 7 , k) R 10 C(O)N R 10 -,
  • R • ⁇ o is independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 8 alkyl, c) C 3 -C 6 cycloalkyl, d) -C ⁇ perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected, from a) unsubstituted or substituted C j -C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • G 1 and G 2 are independently selected from CH 2 or oxygen, provided at least one is oxygen;
  • J is CH , NH or oxygen
  • M is CH 2 , NH, S(O) m , or oxygen
  • V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) j -C ⁇ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O) m , and N, and e) C 2 -C 20 alkenyl, provided that V is not hydrogen if A 1 is S(O) and n is 0;
  • W is a heterocycle
  • n 0, 1, 2, 3, 4, 5 or 6; pis 0, 1,2, 3, 4, 5 or 6; ris 0 to 5, provided that r is 0 when V is hydrogen; sis 0,1, 2, 3 or 4; tis 0, 1,2, 3, or 4; vis 0,1,2, or 3; wis 0, 1, or 2; and Z Oorl;
  • X 1 is (CR la 2 ) n A 1 (CR la 2)n;
  • X 2 is(CR lb 2 ) p A 2 (CR l 2 ) ] P'
  • R la and R lb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -, 1) R 10 C(O)-, m) -N(R 10 ) 2 , n) R 10 OC(O)-, o) R 10 OC(O)NR 10 -, p) unsubstituted or substituted -
  • R 2 is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) C ⁇ C cycloalkyl, unsubstituted or substituted,
  • R 3 is independently selected from: a) hydrogen, b) halo, c) C ⁇ C fi alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) C -C cycloalkyl, unsubstituted or substituted, k) C ⁇ C alkenyl, unsubstituted or substituted, 1) C ⁇ C alkynyl, unsubstituted or substituted, m) (R 10 ) 2 NC(O)NR 10 - n) R 10 C(O)-, and o) R 10 C(O)NR 10 -;
  • R 4 is independently selected from: a) hydrogen, b) C "C alkyl, unsubstituted or substituted, c
  • R 6 and R 7 are independently selected from:
  • R and R may be joined in a ring
  • R 6a is independently selected from: a) C3_6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C 4 perfluoroalkyl, c) halo,
  • R ⁇ 10 i. s independently selected from: a) hydrogen, b) unsubstituted or substituted C ⁇ -C 6 alkyl, c) C 3 -C 6 cycloalkyl, d) Ci-C 6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • G 1 and G 2 are independently selected from CH 2 or oxygen, provided at least one is oxygen;
  • J is NH or oxygen
  • M is CH 2 , S(O) m or oxygen
  • V is selected from: a) heterocycle, b) aryl, and c) j -C ⁇ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O) m , and N;
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl; mis 0, 1 or 2; nis 0, 1,2, 3, 4, 5 or 6; pis 0, 1, 2, 3, 4, 5 or 6; ris 0to5; sis 0, 1,2, 3 or 4; tis 0,1, 2, 3, or 4; vis 0, 1,2, or 3; w is 0, 1, or 2; and si Oorl;
  • X 2 is(CR l 2 ) p A 2 (CR lb 2 ) ] p>
  • R l and R lb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -, 1) R 10 C(O)-, m) -N(R 10 ) 2 , n) R 10 OC(O)-, o) R 10 OC(O)NR 10 -, p) unsubstituted or substituted
  • R 2 is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) ⁇ "C ycloalkyl, unsubstituted or substituted,
  • R 3 is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) C -C cycloalkyl, unsubstituted or substituted, k) C ⁇ C a lk e nyl, unsubstituted or substituted,
  • R 4 is independently selected from: a) hydrogen, b) C ⁇ C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
  • R and R are independently selected from:
  • R 6 . 7 R and R may be joined in a ring
  • R 6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R 8 is independently selected from: a) hydrogen, b) unsubstituted or substituted - . perfluoroalkyl, c) halo,
  • R 10 OC(O)NR 10 -;
  • R 10 is independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 8 alkyl, c) C 3 -C 6 cycloalkyl, d) -C ⁇ perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • G 1 and G 2 are independently selected from CH or oxygen, provided at least one is oxygen;
  • J is CH 2 or oxygen
  • M is CH 2 , S(O) m or oxygen
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
  • n 0, 1, 2, 3, 4, 5 or 6
  • p 0, 1, 2, 3, 4, 5 or 6
  • r 0 to 5
  • s is 0, 1, 2, 3 or 4
  • t is 0, 1, 2, or 3
  • w is 0, 1, or 2
  • z is O or l;
  • R la and R l are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, f) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -, 1) R 10 C(O)-, m) -N(R 10 ) 2 , n) R 10 OC(O)-, o) R 10 OC(O)NR 10 -, p) unsubstituted or substituted - al
  • R 2 is indep ⁇ ⁇ ndently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3' j) R 6a S(O) m , k) cycloalkyl, unsubstituted or substituted,
  • R is independently selected from: a) hydrogen, b) halo, c) C ⁇ C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) OR 10 , i) R 6a S(O) m , j) C ⁇ C n cycloalkyl, unsubstituted or substituted, k) C ⁇ C alkenyl, unsubstituted or substituted,
  • R 4 is independently selected from: a) hydrogen, b) C -C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted; R and R are independently selected from:
  • R and R may be; joined in a ring
  • R 6 is independently selected from: a) C3- cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R 8 is independently selected from: a) hydrogen, b) unsubstituted or substituted C C perfluoroalkyl, c) halo,
  • R 10 is independently selected from: a) hydrogen, b) unsubstituted or substituted C ⁇ -C alkyl, c) C 3 -C 6 cycloalkyl, d) Ci-C 6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • G 1 and G 2 are independently selected from CH 2 or oxygen, provided at least one is oxygen;
  • J is CH 2 or oxygen
  • M is CH 2 , S(O) m or oxygen
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, and thiazolyl;
  • X 2 is (CR lb 2 ) p A 2 (CR lb 2 ) p ;
  • R la and R lb are independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted C 3 -C 10 cycloalkyl, e) R 10 O-, ) R 6a S(O) m -, g) unsubstituted or substituted C 2 -C 6 alkenyl, h) unsubstituted or substituted C 2 -C 6 alkynyl, i) -C(O)NR 6 R 7 , j) R 10 C(O)NR 10 -, k) (R 10 ) 2 NC(O)NR 10 -,
  • R is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C -C alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 ,
  • R oa S(O) k) C -C cycloalkyl, unsubstituted or substituted, 1) ⁇ ⁇ C alkenyl, unsubstituted or substituted, m) C -C alkynyl, unsubstituted or substituted, n) (R 10 ) 2 NC(O)NR 10 - o) R 10 C(O)-, p) R 10 C(O)NR 10 -, q) R 10 OC(O)-, r) -N(R 10 ) 2 , and s) R 10 OC(O)NR 10 -;
  • R 3 is independently selected from: a) hydrogen, b) halo, c) C -C alkyl, unsubstituted or substituted, d) CN, e) NO 2 , f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted,
  • R 4 is independently selected from: a) hydrogen, b) C ⁇ C alkyl, unsubstituted or substituted, c) aryl, unsubstituted or substituted, d) heterocycle, unsubstituted or substituted, and c) aralkyl, unsubstituted or substituted;
  • R 6 and R 7 are independently selected from:
  • R and R may be joined in a ring
  • R 6a is independently selected from: a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) Ci-4 alkoxy, 2) aryl or heterocycle,
  • R is independently selected from: a) hydrogen, b) unsubstituted or substituted C C perfluoroalkyl, c) halo,
  • R 10 is independently selected from: a) hydrogen, b) unsubstituted or substituted C j -C 8 alkyl, c) 3 -C 8 cycloalkyl, d) Ci-C 6 perfluoroalkyl, e) trifluoromethyl, f) 2,2,2-trifluoroethyl, g) unsubstituted or substituted heteroaryl, h) unsubstituted or substituted aryl, i) unsubstituted or substituted aralkyl, and j) unsubstituted or substituted heteroaralkyl;
  • R is independently selected from a) unsubstituted or substituted C ⁇ -C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heteroaralkyl;
  • G 1 and G 2 are independently selected from CH 2 or oxygen, provided at least one is oxygen;
  • J is CH 2 or oxygen
  • M is CH 2 , S(O) m or oxygen; mis 0, 1 or 2; nis 0,1,2, 3,4, 5 or 6; pis 0, 1, 2, 3, 4, 5 or 6; ris 0to5; sis 0,1,2, 3 or 4; tis 0,1,2, or 3; wis 0, 1, or 2; and z is Oorl;
  • the compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention.
  • any variable, term or substituent e.g. aryl, heterocycle, n, Rla_ etc.
  • substituents/or variables are permissible only if such combinations result in stable compounds.
  • alkyl is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having 1 to 6 carbon atoms, unless otherwise specified; "alkoxy” represents an alkyl group having 1 to 4 carbon atoms, unless otherwise indicated, attached through an oxygen bridge.
  • Halogen or “halo” as used herein means fluoro, chloro, bromo and iodo.
  • Cycloalkyl as used herein is intended to include non-aromatic cyclic hydrocarbon groups, having the specified number of carbon atoms, which may or may not be bridged or structurally constrained.
  • cycloalkyls examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, adamantyl, cyclooctyl, cycloheptyl, and the like.
  • alkenyl refers to a non-aromatic hydrocarbon, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. Preferably one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present.
  • C 2 -C6 alkenyl means an alkenyl radical having from 2 to 6 carbon atoms.
  • alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl and cyclohexenyl.
  • the straight, branched or cyclic portion of the alkenyl group may contain double bonds and may be substituted if a substituted alkenyl group is indicated.
  • alkynyl refers to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon-carbon triple bonds may be present.
  • C -C6 alkynyl means an alkynyl radical having from 2 to 6 carbon atoms. Examples of such alkynyl groups include, but are not limited to, ethynyl, propynyl and butynyl.
  • the straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated.
  • aryl is intended to mean any stable monocyclic, bicyclic or tricyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic.
  • aryl elements include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, indanonyl, biphenyl, tetralinyl, tetralonyl, fluorenonyl, phenanthryl, anthryl or acenaphthyl.
  • aralkyl is intended to mean an aryl moiety, as defined above, attached through a C -C alkyl linker, where alkyl is defined above.
  • aralkyls include, but are not limited to, benzyl, naphthylmethyl and phenylbutyl.
  • heterocycle or heterocyclic represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic heterocyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring.
  • the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure.
  • heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, benzopyrazolyl, benzotriazolyl, chromanyl, cinnolinyl, dibenzofuranyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, furanyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl,
  • heterocycle or heterocyclic is not tetrazolyl.
  • heteroaryl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, O, and S.
  • heteroaryl elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzopyrazolyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzotriazolyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furanyl, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl, oxadiazolyl, pyrazinyl, pyrazolyl, pyri
  • heteroaralkyl is intended to mean a heteroaryl moiety, as defined above, attached through a Cj-Cg alkyl linker, where alkyl is defined above.
  • heteroaralkyls include, but are not limited to,
  • substituted alkyl As used herein, the terms "substituted alkyl”, “substituted alkenyl”,
  • substituted alkynyl and “substituted alkoxy” are intended to include the branch or straight-chain alkyl group of the specified number of carbon atoms, wherein the carbon atoms may be substituted with F, Cl, Br, I, CF3, OCF 3 , N3, NO 2 , NH 2; oxo, OH, -O(C r C 6 alkyl), S(O) 0 _ 2 , (C r C 6 alkyl)S(O) 0 _ 2 -, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, -(C r C 6 alkyl)S(O) 0.2 (C r C 6 alkyl), C 3 -C 20 cycloalkyl, C 2 -C 6 alkenyl,
  • substituted aryl As used herein, the terms “substituted aryl”, “substituted heterocycle”, “substituted heteroaryl”, “substituted cycloalkyl”, “substituted benzyl”, “substituted aralkyl” and “substituted heteroaralkyl” are intended to include the cyclic group containing from 1 to 3 substitutents in addition to the point of attachment to the rest of the compound. Such substitutents are preferably selected from the group which includes but is not limited to F, Cl, Br, I, CF3, OCF 3 , NH 2 , N(C j -C 6 alkyl) 2 , NO ,
  • C3 - C 2 o cycloalkyl may include, but are not limited to:
  • R la and R lb are independently selected from H, unsubstituted or substituted -C ⁇ alkyl, R 10 O-, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle. More preferably R la and R lb are independently selected from H, unsubstituted or substituted - alkyl or R 10 O-.
  • R 2 is independently selected from hydrogen, -OR 10 , CN, unsubstituted or substituted aryl and halogen. Most preferably, r is 1 to 3 and at least one R 2 is CN.
  • R 3 is independently selected from H, halo, unsubstituted or substituted Ci-C ⁇ alkyl.
  • R 4 is independently selected from H, unsubstituted or substituted Ci-C 6 alkyl, unsubstituted or substituted aralkyl.
  • R 8 is independently selected from H or unsubstituted or substituted Ci-C 6 alkyl.
  • J is NH or oxygen.
  • M is CH 2 , S(O) m or oxygen.
  • V is aryl, heterocycle or Ci-C 2 o alkyl. More preferably, V is aryl. Most preferably, V is phenyl.
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, 2-oxopiperidinyl, quinolinyl, isoquinolinyl, and thienyl. More preferably, W is imidazolyl or pyridinyl. Most preferably, W is imidazolyl.
  • any substituent or variable e.g., Rla_ R2 ; m> p ; etc.
  • -C(Rl a ) 2 can represent -CH 2 , -CHCH3, -CHC 2 H5, etc.
  • substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
  • the pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids.
  • such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
  • the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • DMAP 4-Dimethylaminopyridine
  • DME 1,2-Dimethoxyethane
  • PYBOP Benzotriazole- 1 -yl-oxy-trispyrrolidinophosphonium hexafluorophosphate; t-Bu tert-Butyl;
  • Scheme 1 describes the preparation of compounds wherein the spiroimidazolidine-2,5-dione precursor can be prepared from the corresponding benzo-substituted cyclic ketone by heating the ketone with cyanide and ammonium carbonate in wet DMF or aqueous ethanol.
  • the ketones are either commercially available or can be prepared by a standard Friedel-Krafts intramolecular cyclization of the appropriate carboxylic acid by heating with an acid such as polyp- hosphoric acid.
  • the spiroimidazolinedione precursor can then be alkylated at the N-3 nitrogen with a suitable haloalkylheterocycle (i.e. l-(4-cyanobenzyl)-4-chloromethyl- imidazole) by stirring in the presence of a suitable base (i.e. sodium hydride) in dry
  • Another approach which can be utilized involves incorporation of the desired compatible substituted N-3 nitrogen component during a standard stepwise construction of the spiroimidazolidine-2,5-dione ring from an aminoacid precursor as illustrated in Scheme 2.
  • a standard barium hydroxide hydrolysis of the unsubstituted spiroimidazolidine-2,5-dione gives the required corresponding aminoacid precursor.
  • Scheme 3 describes a preparation of compounds wherein the spirooxazolidin-2-one precursor can be prepared by reduction of a cyanohydrin precursor with, for example, lithium aluminum hydride to obtain the corresponding aminoalcohol which is cyclized with phosgene in the presence of a base (i.e. triethyl amine).
  • the spirooxazolidinone precursor can then be alkylated at the nitrogen with a suitable haloalkylheterocycle (i.e. l-(4-cyanobenzyl)-4-chloromethyl-imidazole) by stirring in the presence of a suitable base (i.e. sodium hydride) in dry DMF to provide the compound of the invention.
  • a suitable haloalkylheterocycle i.e. l-(4-cyanobenzyl)-4-chloromethyl-imidazole
  • R' independently represents R ⁇ or a protected precursor thereof.
  • the compounds of the invention are selective inhibitors of farnesyl-protein transferase.
  • a compound is considered a selective inhibitor of farnesyl-protein transferase, for example, when its in vitro farnesyl-protein transferase inhibitory activity, as assessed by the assay described in Example 6, is at least 100 times greater than the in vitro activity of the same compound against geranylgeranyl-protein transferase-type I in the assay described in Example 7.
  • a selective compound exhibits at least 1000 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl-protein transferase inhibition.
  • the selective inhibitor of farnesyl-protein transferase is further characterized by: a) an IC 50 (a measure of in vitro inhibitory activity) for inhibition of the prenylation of newly synthesized K-Ras protein more than about 100-fold higher than the EC 50 for the inhibition of the famesylation of hDJ protein.
  • the assays described in Example 11 may be utilized. It is also preferred that the selective inhibitor of farnesyl-protein transferase is further characterized by: b) an IC50 (a measurement of in vitro inhibitory activity) for inhibition of K4B-
  • the selective inhibitor of farnesyl-protein transferase is further characterized by: c) an IC 0 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells at least 1000 fold lower than the inhibitory activity (IC50) against K-ras-CY (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells.
  • the assays described in Example 10 may be utilized.
  • the compounds of the invention are dual inhibitors of farnesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • Such a dual inhibitor may be termed a Class II prenyl-protein transferase inhibitor and will exhibit certain characteristics when assessed in in vitro assays, which are dependent on the type of assay employed.
  • the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 12 ⁇ M against K4B-Ras dependent activation of MAP kinases in cells.
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells between 0.1 and 100 times the IC50 for inhibiting the famesylation of the protein hDJ in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMN-SEAP plasmid that constitutively expresses the SEAP protein.
  • IC50 a measurement of in vitro inhibitory activity
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 2 fold lower but less than 20,000 fold lower than the inhibitory activity (IC50) against H-ras-
  • CNLL SEQ.ID.NO.: 1 dependent activation of MAP kinases in cells
  • IC50 a measurement of in vitro inhibitory activity against H-ras-CV L dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the
  • the Class ⁇ prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 10-fold lower but less than 2,500 fold lower than the inhibitory activity (IC50) against ⁇ L-ras-
  • CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) against H-ras-CNLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
  • IC50 a measurement of in vitro inhibitory activity against H-ras-CNLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
  • Example 10 A method for measuring the activity of the inhibitors of prenyl-protein transferase, as well as the instant combination compositions, utilized in the instant methods against Ras dependent activation of MAP kinases in cells is described in Example 10.
  • a compound of the instant invention may be a more potent inhibitor of geranylgeranyl-protein transferase-type I than it is an inhibitor of farnesyl-protein transferase.
  • the instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer.
  • Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors. Such tumors may arise by mutations in the ras genes themselves, mutations in the proteins that can regulate Ras activity (i.e., neurofibromin ( ⁇ F-1), neu, src, abl, lck, fyn) or by other mechanisms.
  • Ras activity i.e., neurofibromin ( ⁇ F-1), neu, src, abl, lck, fyn
  • the compounds of the instant invention inhibit farnesyl-protein transferase and the famesylation of the oncogene protein Ras.
  • the instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575-4580 (1995)).
  • Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization.
  • the compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment.
  • the composition is useful in the treatment of neurofibromatosis, which is a benign proliferative disorder.
  • the instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S. Glenn et al. Science, 256:1331-1333 (1992).
  • the compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal. formation (C. Indolfi et al. Nature medicine, 1:541-545(1995).
  • the instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of Pathology, 142:1051-1060 (1993) and B. Cowley, Jr. et al.FASEB Journal, 2:A3160 (1988)).
  • the instant compounds may also be useful for the treatment of fungal infections.
  • the instant compounds may also be useful as inhibitors of proliferation of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologies.
  • the compounds of the instant invention may also be useful in the prevention and treatment of endometriosis, uterine fibroids, dysfunctional uterine bleeding and endometrial hyperplasia.
  • the prenyl-protein transferase inhibitors of the instant invention may also be co- administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the prenyl-protein transferase inhibitor may be useful in further combination with drugs known to supress the activity of the ovaries and slow the growth of the endometrial tissue.
  • drugs include but are not limited to oral contraceptives, progestins, danazol and GnRH (gonadotropin-releasing hormone) agonists.
  • Administration of the prenyl-protein transferase inhibitor may also be combined with surgical treatment of endometriosis (such as surgical removal of misplaced endometrial tissue) where appropriate.
  • the instant compounds may also be useful as inhibitors of corneal inflammation. These compounds may improve the treatment of corneal opacity which results from cauterization-induced corneal inflammation. The instant compounds may also be useful in reducing corneal edema and neovascularization. (K. Sonoda et al., Invest. Ophthalmol. Vis. Sci, 1998, vol. 39, p 2245-2251).
  • the compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice.
  • the compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
  • the compounds of the instant invention may be administered to a mammal in need thereof using a gel extrusion mechanism (GEM) device, such as that described in USSN 60/144,643, filed on July 20, 1999, which is hereby incorporated by reference.
  • GEM gel extrusion mechanism
  • the compounds of the instant invention may also be administered to a mammal in need thereof using an osmotic controlled release drug delivery device, such as those described in USSN 60/162,589 and USSN 60/162,719, co-filed on October 29, 1999, and herein incorporated by reference.
  • an osmotic controlled release drug delivery device such as those described in USSN 60/162,589 and USSN 60/162,719, co-filed on October 29, 1999, and herein incorporated by reference.
  • composition is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts.
  • compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
  • Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc.
  • the tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a water soluble taste masking material such as hydroxypropyl-methylcellulose or hydroxypropyl- cellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
  • water soluble carrier such as polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene- oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan
  • the aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • the pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions.
  • the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
  • Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants.
  • Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • sweetening agents for example glycerol, propylene glycol, sorbitol or sucrose.
  • Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous solutions.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • the sterile injectable preparation may also be a sterile injectable oil-in- water microemulsion where the active ingredient is dissolved in the oily phase.
  • the active ingredient may be first dissolved in a mixture of soybean oil and lecithin.
  • the oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
  • the injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection.
  • a continuous intravenous delivery device may be utilized.
  • An example of such a device is the Deltec CADD-PLUSTM model 5400 intravenous pump.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration.
  • This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • Compounds of Formula A-1 may also be administered in the form of a suppositories for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • a suitable non-irritating excipient include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A-1 are employed. (For purposes of this application, topical application shall include mouth washes and gargles.)
  • the compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art.
  • the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • Compounds of the present invention may also be delivered as a suppository employing bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • a suitable amount of compound is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
  • the compounds of the instant invention may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant farnesyl-protein transferase inhibitors and an antineoplastic agent. It is also understood that such a combination of antineoplastic agent and inhibitor of farnesyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery. It is further understood that any of the therapeutic agents described herein may also be used in combination with a compound of the instant invention and an antineoplastic agent.
  • antineoplastic agent examples include, in general, microtubule- stabilizing agents (such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), epothilone A, epothilone B, desoxyepothilone A, desoxyepothilone B or their derivatives); microtubule-dismptor agents; alkylating agents, for example, nitrogen mustards, ethyleneimine compounds, alkyl sulfonates and other compounds with an alkylating action such as nitrosoureas, cisplatin, and dacarbazine; anti- metabolites, for example, folic acid, purine or pyrimidine antagonists; epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes; biological response modifiers and growth inhibitors; mitotic inhibitors, for example, vinca alkaloids and
  • Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drags, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine family of drugs, diynenes and the podophyllotoxins.
  • Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunorubicin, aminopterin, methotrexate, methopterin, dichloro-methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like.
  • antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carmustine (BCNU), lomustine (CCNU), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, bleomycin, chlorambucil, camptothecin, CPT-11, topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins
  • antineoplastic, or chemotherapeutic, agents are described, for example, by D. J. Stewart in “Nausea and Vomiting: Recent Research and Clinical Advances", Eds. J. Kucharczyk, et al., CRC Press Inc., Boca Raton, Florida, USA (1991), pages 177-203, especially page 188. See also, R. J. Gralla, et al., Cancer Treatment Reports, 68(1), 163-172 (1984).
  • the preferred class of antineoplastic agents is the taxanes and the preferred antineoplastic agent is paclitaxel.
  • the compounds of the instant invention may also be co-administered with antisense oligonucleotides which are specifically hybridizable with RNA or DNA deriving from human ras gene. Such antisense oligonucleotides are described in U.S. Pat. No. 5,576,208 and PCT Publ. No. WO 99/22772.
  • the instant compounds are particularly usefule when co-administered with the antisense oligonucleotide comprising the amino acid sequence of SEQ.ID.NO: 2 of U.S. Pat. No. 5,576,208.
  • Certain compounds of the instant invention may exhibit very low plasma concentrations and significant inter-individual variation in the plasma levels of the compound. It is believed that very low plasma concentrations and high intersubject variability achieved following administration of certain prenyl-protein transferase inhibitors to mammals may be due to extensive metabolism by cytochrome P450 enzymes prior to entry of drug into the systemic circulation. Prenyl-protein transferase inhibitors may be metabolized by cytochrome P450 enzyme systems, such as CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other cytochrome P450 isoform.
  • a compound of the instant invention demonstrates an affinity for one or more of the cytochrome P450 enzyme systems
  • another compound with a higher affinity for the P450 enzyme(s) involved in metabolism should be administered concomitantly.
  • compounds that have a comparatively very high affinity for CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other P450 isoform include, but are not limited to, piperonyl butoxide, troleandomycin, erythromycin, proadifen, isoniazid, allylisopropylacetamide, ethinylestradiol, chloramphenicol, 2- ethynylnaphthalene and the like.
  • Such a high affinity compound when employed in combination with a compound of formula A-1, may reduce the inter-individual variation and increase the plasma concentration of a compound of formula A-1 to a level having substantial therapeutic activity by inhibiting the metabolism of the compound of formula A-1. Additionally, inhibiting the metabolism of a compound of the instant invention prolongs the pharmacokinetic half-life, and thus the pharmacodynamic effect, of the compound.
  • a compound of the present invention may be employed in conjunction with antiemetic agents to treat nausea or emesis, including acute, delayed, late-phase, and anticipatory emesis, which may result from the use of a compound of the present invention, alone or with radiation therapy.
  • a compound of the present invention may be used in conjunction with other antiemetic agents, especially neurokinin-1 receptor antagonists, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, or a corticosteroid such as Decadron (dexa- methasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.S. Patent Nos. 2,789,118, 2,990,401, 3,048,581, 3,126,375, 3,929,768, 3,996,359, 3,928,326 and 3,749,712.
  • conjunctive therapy with a neurokinin-1 receptor antagonist, a 5HT3 receptor antagonist and a corticosteroid is preferred.
  • Neurokinin-1 receptor antagonists of use in conjunction with the compounds of the present invention are fully described, for example, in U.S. Patent Nos. 5,162,339, 5,232,929, 5,242,930, 5,373,003, 5,387,595, 5,459,270, 5,494,926, 5,496,833, 5,637,699, 5,719,147; European Patent Publication Nos.
  • a particularly preferred neurokinin-1 receptor antagonist for use in conjunction with the compounds of the present invention is 2-(R)-(l-(R)-(3,5-bis (trifluoromethyl)phenyl)ethoxy)-3-(S)-(4-fluorophenyl)-4-(3-(5-oxo-lH,4H-l,2,4- triazolo)methyl)morpholine, or a pharmaceutically acceptable salt thereof, which is described in U.S. Patent No. 5,719,147.
  • a compound of the present invention for the treatment of cancer, it may be desirable to employ a compound of the present invention in conjunction with another pharmacologically active agent(s).
  • a compound of the present invention and the other pharmacologically active agent(s) may be administered to a patient simultaneously, sequentially or in combination.
  • the present compound may employed directly in combination with the other active agent(s), or it may be administered prior, concurrent or subsequent to the administration of the other active agent(s).
  • the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.
  • a compound of the present invention may be presented together with another therapeutic agent in a combined preparation, such as with an antiemetic agent for simultaneous, separate, or sequential use in the relief of emesis associated with employing a compound of the present invention and radiation therapy.
  • a combined preparation may be, for example, in the form of a twin pack.
  • a preferred combination comprises a compound of the present invention with antiemetic agents, as described above.
  • Radiation therapy including x-rays or gamma rays which are delivered from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with the instant inhibitor of prenyl-protein transferase alone to treat cancer.
  • compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, and herein incorporated by reference.
  • the instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • the instant compounds may be utilized in combination with farnesyl pyrophosphate competitive inhibitors of the activity of farnesyl-protein transferase or in combination with a compound which has Raf antagonist activity.
  • the instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase.
  • co-administration with a compound(s) that is a selective inhibitor of geranylgeranyl protein transferase may provide an improved therapeutic effect.
  • such administration can be orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously.
  • the protein substrate-competitive inhibitor and farnesyl pyrophosphate-competitive inhibitor are administered sequentially, the administration of each can be by the same method or by different methods.
  • the instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U.S. Ser. No.
  • an integrin antagonist refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin(s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells.
  • the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ⁇ v ⁇ 3 integrin, which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ⁇ v ⁇ 5 integrin, which antagonize, inhibit or counteract binding of a physiological ligand to both the ⁇ v ⁇ 3 integrin and the ⁇ v ⁇ 5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells.
  • the term also refers to antagonists of the ⁇ l ⁇ l, ⁇ 2 ⁇ l, ⁇ 5 ⁇ l, ⁇ 6 ⁇ l and ⁇ 6 ⁇ 4 integrins.
  • the term also refers to antagonists of any combination of ⁇ v ⁇ 3 integrin, ⁇ v ⁇ 5 integrin, ⁇ l ⁇ l, ⁇ 2 ⁇ l, ⁇ 5 ⁇ l, ⁇ 6 ⁇ l and ⁇ 6 ⁇ 4 integrins.
  • the instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin.
  • HMG-CoA reductase 3-hydroxy-3-methylglutaryl-CoA reductase
  • HMG-CoA reductase 3-hydroxy-3-methylglutaryl-CoA reductase
  • Compounds which have inhibitory activity for HMG-CoA reductase can be readily identified by using assays well-known in the art. For example, see the assays described or cited in U.S. Patent 4,231,938 at col. 6, and WO 84/02131 at pp. 30-33.
  • the terms "HMG-CoA reductase inhibitor” and "inhibitor of HMG-CoA reductase” have the same meaning when used herein.
  • HMG-CoA reductase inhibitors examples include but are not limited to lovastatin (MENACOR®; see US Patent No. 4,231,938; 4,294,926; 4,319,039), simvastatin (ZOCOR®; see US Patent No. 4,444,784; 4,820,850; 4,916,239), pravastatin (PRAVACHOL®; see US Patent Nos. 4,346,227; 4,537,859; 4,410,629; 5,030,447 and 5,180,589), fluvastatin (LESCOL®; see US Patent Nos.
  • HMG-CoA reductase inhibitor as used herein includes all pharmaceutically acceptable lactone and open-acid forms (i.e., where the lactone ring is opened to form the free acid) as well as salt and ester forms of compounds which have HMG-CoA reductase inhibitory activity, and therefor the use of such salts, esters, open-acid and lactone forms is included within the scope of this invention.
  • An illustration of the lactone portion and its corresponding open-acid form is shown below as stractures I and ⁇ .
  • HMG-CoA reductase inhibitors where an open-acid form can exist, salt and ester forms may preferably be formed from the open-acid, and all such forms are included within the meaning of the term "HMG-CoA reductase inhibitor" as used herein.
  • the HMG-CoA reductase inhibitor is selected from lovastatin and simvastatin, and most preferably simvastatin.
  • the term "pharmaceutically acceptable salts" with respect to the HMG-CoA reductase inhibitor shall mean non- toxic salts of the compounds employed in this invention which are generally prepared by reacting the free acid with a suitable organic or inorganic base, particularly those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc and tetramethylammonium, as well as those salts formed from amines such as ammonia, ethylenediamine, N-methylglucamine, lysine, arginine, omithine, choline, N,N' -dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, l-p-chlorobenzyl-2-pyrrolidine-l'-yl- methylbenzimidazole, diethylamine, piperazine, and tris(hydroxymethyl)- aminomethane.
  • a suitable organic or inorganic base particularly those formed from
  • salt forms of HMG-CoA reductase inhibitors may include, but are not limited to, acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, calcium edetate, camsylate, carbonate, chloride, clavulanate, citrate, dihydrochloride, edetate, edisylate, estolate, esylate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroxynapthoate, iodide, isothionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylsulfate, mucate, napsylate, nitrate, oleate, oxalate, pamao
  • Ester derivatives of the described HMG-CoA reductase inhibitor compounds may act as prodrugs which, when absorbed into the bloodstream of a warm-blooded animal, may cleave in such a manner as to release the drag form and permit the drag to afford improved therapeutic efficacy.
  • the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restenosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections. If formulated as a fixed dose, such combination products employ the combinations of this invention within the dosage range described above and the other pharmaceutically active agent(s) within its approved dosage range. Combinations of the instant invention may alternatively be used sequentially with known pharma- ceutically acceptable agent(s) when a multiple combination formulation is inappropriate.
  • the instant compounds may also be useful in combination with prodrugs of antineoplastic agents.
  • the instant compounds may be co-administered either concurrently or sequentially with a conjugate (termed a "PSA conjugate") which comprises an ohgopeptide, that is selectively cleaved by enzymatically active prostate specific antigen (PSA), and an antineoplastic agent.
  • a conjugate termed a "PSA conjugate”
  • PSA conjugate which comprises an ohgopeptide, that is selectively cleaved by enzymatically active prostate specific antigen (PSA), and an antineoplastic agent.
  • PSA conjugate conjugate
  • PSA prostate specific antigen
  • the compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl-protein transferase (FPTase) in a composition.
  • FPTase farnesyl-protein transferase
  • the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate and, in one of the mixtures, a compound of the instant invention.
  • the chemical content of the assay mixtures may be determined by well known immunological, radiochemical or chromatographic techniques. Because the compounds of the instant invention are selective inhibitors of FPTase, absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of FPTase in the composition to be tested.
  • potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample.
  • a series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl- protein transferase, an excess amount of a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention.
  • concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
  • concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
  • Propionic acid was added to the mixture and the mixture was heated and maintained at a temperature of about 50°C to about 55°C.
  • Phosphoric acid was gradually added over about 5 min to about 10 min, maintaining the reaction mixture below about 65°C to form a precipitate-containing mixture.
  • the mixture was gradually warmed to about 65°C to about 70°C over about 30 min and aged at about 65°C to about 70°C for about 30 min.
  • the mixture was then gradually cooled to about 20-25°C over about 1 hour and aged at about 20-25°C for about 1 hour.
  • the reaction slurry was then filtered.
  • the filter cake was washed four times with EtOH, using the following sequence, 2.5 L each time.
  • the filter cake was then washed with water five times, using 300 mL each time.
  • the filter cake was washed twice with MeCN (1.0 L each time) and the above identified compound was obtained.
  • Step B 4-Cyanobenzylamine Hydrochloride via Hexamethylene- tetrammonium salt
  • a 72 liter vessel was charged with 190 proof ethanol (14.4 L) followed by the addition of 4-cyanobenzylbromide (2.98 kg) and HMTA (2.18 kg) at ambient temperature. The mixture was heated to about 72-75°C over about 60 min. On warming, the solution thickens and additional ethanol (1.0 liter) was added to facilitate stirring. The batch was aged at about 72-75°C for about 30 min.
  • the mixture was allowed to cool to about 20°C over about 60 min, and HCl gas (2.20 kg) was sparged into the slurry over about 4 hours during which time the temperature rose to about 65°C.
  • the mixture was heated to about 70-72°C and aged for about 1 hour.
  • the slurry was cooled to about 30°C and ethyl acetate (22.3 L) added over about 30 min.
  • the slurry was cooled to about -5°C over about 40 min and aged at about -3 to about -5°C for about 30 min.
  • the mixture was filtered and the crystalline solid was washed with chilled ethyl acetate (3 x 3 L).
  • the solid was dried under a N2 stream for about 1 hour before charging to a 50 liter vessel containing water (5.5 L).
  • the pH was adjusted to about 10-10.5 with 50% NaOH (4.0 kg) maintaining the internal temperature below about 30°C.
  • methylene chloride 2.8 L was added and stirring continued for about 15 min.
  • the layers were allowed to settle and the lower organic layer was removed.
  • the aqueous layer was extracted with methylene chloride (2 x 2.2 L).
  • the combined organic layers were dried over potassium carbonate (650 g). The carbonate was removed via filtration and the filtrate concentrated in vacuo at about 25°C to give a free base as a yellow oil.
  • the oil was transferred to a 50 liter vessel with the aid of ethanol (1.8 L).
  • Ethyl acetate (4.1 L) was added at about 25°C.
  • the solution was cooled to about 15°C and HCl gas (600 g) was sparged in over about 3 hours, while keeping batch temperature below about 40°C.
  • ethyl acetate (5.8 L) was added to the slurry, followed by cooling to about -5°C over about 1 hour.
  • the slurry was aged at about -5°C for about 1 hour and the solids isolated via filtration.
  • the cake was washed with a chilled mixture of EtOAc/EtOH (9:1 v/v) (1 x 3.8 L), then the cake was washed with chilled EtOAc (2 x 3.8 L).
  • the solids were dried in vacuo at about 25°C to provide the above-titled compound.
  • Step C l-(4-Cyanobenzyl -2-Mercapto-5-Hydroxymethyl-imidazole
  • the mixture was heated to 70°C, and aged for 2 hours. The temperature of the mixture was then cooled to room temperature and was aged overnight.
  • the thioimidazole product was obtained by vacuum filtration.
  • the filter cake was washed four times acetonitrile (25 mL each time) until the filtrates became nearly colorless. Then the filter cake was washed three times with water (approximately 25-50 mL each time) and dried in vacuo to obtain the above-identified compound.
  • Step D l-(4-Cyanobenzyl)-5-Hydroxymethylimidazole
  • a IL flask with cooling/heating jacket and glass stirrer (Lab-Max) was charged with water (200 mL) at 25°C.
  • the reaction was warmed to 40°C over 10 minutes.
  • Hydrogen peroxide (90.0 g) was added slowly over 2 hours by automatic pump maintaining a temperature of 35-45°C. The temperature was lowered to 25°C and the solution aged for 1 hour.
  • the solution was cooled to 20°C and quenched by slowly adding 20% aqueous Na2SO3 (25 mL) maintaining the temperature at less than 25°C.
  • the solution was filtered through a bed of DARCO G-60 (9.0 g) over a bed of SolkaFlok (1.9 g) in a sintered glass funnel. The bed was washed with 25 mL of 10% acetic acid in water.
  • the combined filtrates were cooled to 15°C and a 25% aqueous ammonia was added over a 30 minute period, maintaining the temperature below 25°C, to a pH of 9.3.
  • the yellowish slurry was aged overnight at 23°C (room temperature).
  • the solids were isolated via vacuum filtration.
  • the cake (100 mL wet volume) was washed with 2 x 250 mL 5% ammonia (25%) in water, followed by 100 mL of ethyl acetate.
  • the wet cake was dried with vacuum/N2 flow and the above- titled compound was obtained.
  • Step F l-(4-Cyanobenzyl)-5-Chloromethyl Imidazole HCl salt via addition of Hydroxymethylimidazole to NilsmeierReagent
  • the mixture was filtered, then washed with dry acetonitrile (400 mL displacement wash, 550 mL slurry wash, and a 400 mL displacement wash).
  • the solid was maintained under an N2 atmosphere during the filtration and washing to prevent hydrolysis of the chloride by adventitious H2O. This yielded the crystalline form of the chloromethylimidazole hydrochloride.
  • Step G l-(4-Cyanobenzyl)-5-Chloromethyl Imidazole HCl salt via addition of Nilsmeier Reagent to Hydroxymethylimidazole
  • Step A Preparation of (+/-)-5'-fluoro-spiro[irmdazolidine ⁇ 4,rindan]-2,5- dione
  • the enantiomers can be separated by preparative HPLC on a chiral Chiralpak AD column eluting with 20% ethanol and 80% hexane containing 0.1% diethylamine.
  • the first enantiomer to elute is the (+)-enantiomer and the second the (-)-enantiomer.
  • Step B Preparation of (+/-)- 4- ⁇ 4-(5'-fluoro-spiro[imidazolidine ⁇ 4,r ⁇ indan]-
  • (+/-)-5 '-Fluoro-spiro[imidazolidine-4, 1 ' -indan]-2,5-dione (80 mg. ,0.36 mmol) was dissolved in dry dimethylformamide (1 mL) and 60% sodium hydride in mineral oil (35 mg., 0.9 mmol) was added. The mixture was warmed at 50° C for 20 minutes to give a clear solution. After cooling the reaction to room temperature l-(4- cyanobenzyl)-5-chloromethylimidazole hydrochloride salt, as described in Example 1,
  • Step B Preparation of (+/-)-7-chloro-2,3-dihydro-spiro[4H-l-benzopyran-4,4'- imidazolidinel-2' .5 ' -dione
  • Step C Preparation of (+/-)- 4- ⁇ 4-(7-chloro-2,3-dihydro-spiro[4H-l- benzopyran-4,4'-imidazolidine]-2',5'-dion-3-ylmethyl)imidazol-l- ylmethyl) benzonitrile Hydrochloride (+/-)-7-chloro-2,3-dihydro-spiro[4H-l-benzopyran-4,4'- imidazolidine]-2',5'-dione (128 mg.,0.50 mmol) was dissolved in dry dimethyl- formamide (1.5 mL) and 60% sodium hydride in mineral oil (55 mg., 1.38 mmol) was added.
  • Step B Preparation of l-(4-cyanobenzyl)-4-(2-aminoethyl)imidazole dihydrochloride
  • Nf-Pivaloyloxymethyl-N a -phthaloylhistamine (4.55 g, 12.8 mmol) was prepared as previously described (J. C. Emmett, F. H. Holloway, and J. L. Turner, J. Chem. Soc, Perkin Trans. 1, 1341, (1979)).
  • -Bromo-p-tolunitrile (3.77 g, 19.2 mmol) was dissolved in acetonitrile (70 mL). The solution was heated at 55°C for 4 h, cooled to room temperature, and filtered to remove the white solid. The acetonitrile (30 mL) was concentrated to 1/2 its volume under reduced pressure and the solution was heated at 55°C overnight.
  • Step C Preparation of l-(4-cyanobenzyl)-2-methyl-4-(2-aminoethyl)imidazole dihydrochloride
  • Step D Preparation of (+/-)-N- ⁇ 2-[l-(4-cyanobenzyl)-2-methylimidazol-4- yl]ethyl ⁇ -7-chloro-4-amino-2,3-dihydro-4H-benzopyran-4- carboxamide
  • (+/-)-7-chloro-4-tert-butoxycarbonyl- amino-2,3-dihydro-4H-benzopyran-4-carboxylic acid 210 mg.,0.64 mmol
  • l-(4-cyanobenzyl)-2-methyl-4-(2-aminoethyl)imidazole dihydrochloride 200 mg
  • Step E Preparation of (+/-)-4- ⁇ 4- ⁇ 2-(7-chloro-2,3-dihydro-spiro[4H-l-benzo- pyran-4,4'-imidazolidine]-2',5'-dion-3-yl)ethyl ⁇ -2-methylimidazol-l- ylmethyl Ibenzonitrile
  • Step A Preparation of (+/- -5'-chloro-spirorindan-1.5'-oxazolidinel-2-one
  • This mixture was diluted with more tetrahydro- furan and anhydrous sodium sulfate powder and filtered to remove the salts.
  • the organic filtrate was evaporated to give l-hydroxy-l-aminomethyl-5-chloroindane as an oil.
  • This material was partially dissolved in acetonitrile (15 mL) containing tirethylamine (1.4 mL, 10 mmol) and cooled in an ice bath. A solution of 20% phosgene/toluene ( ⁇ 2 mL) was added dropwise. After stirring for one hour the reaction was diluted with ethyl acetate and washed with water and aqueous sodium carbonate.
  • Step B Preparation of (+/-)-4- ⁇ 4-(5'-chloro-spiro[indan-l,5'-oxazolidine]-2- on-3-ylmethyl imidazol-l-ylmethyllbenzonitrile hydrochloride
  • Isoprenyl-protein transferase activity assays are carried out at 30°C unless noted otherwise.
  • a typical reaction contains (in a final volume of 50 ⁇ L): [ 3 H]farnesyl diphosphate, Ras protein , 50 mM HEPES, pH 7.5, 5 mM MgCl 2 , 5 mM dithiothreitol, 10 ⁇ M ZnCl 2 , 0.1% polyethyleneglycol (PEG)
  • the FPTase employed in the assay is prepared by recombinant expression as described in Omer, C.A., Krai, A.M., Diehl, R.E., Prendergast, GC, Powers, S., Allen, CM., Gibbs, J.B. and Kohl, N.E. (1993) Biochemistry 32:5167-5176. After thermally pre-equilibrating the assay mixture in the absence of enzyme, reactions are initiated by the addition of isoprenyl- protein transferase and stopped at timed intervals (typically 15 min) by the addition of 1 M HCl in ethanol (1 mL).
  • the quenched reactions are allowed to stand for 15 m (to complete the precipitation process). After adding 2 mL of 100% ethanol, the reactions are vacuum-filtered through Whatman GF/C filters. Filters are washed four times with 2 mL aliquots of 100% ethanol, mixed with scintillation fluid (10 mL) and then counted in a Beckman LS3801 scintillation counter.
  • inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 20 fold into the enzyme assay mixture.
  • Substrate concentrations for inhibitor IC50 determinations are as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 1),
  • the modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature.
  • a typical reaction contains (in a final volume of 50 ⁇ L): [ 3 H] geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgCl 2 , 10 ⁇ M ZnCl 2 , 0.1% PEG (15,000-20,000 mw), 2 mM dithiothreitol, and geranylgeranyl-protein transferase type I(GGTase).
  • the GGTase-type I enzyme employed in the assay is prepared as described in U.S. Pat. No. 5,470,832, incorporated by reference.
  • the Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCNIM (single amino acid code) (SEQ. ID. ⁇ O.: 2).
  • Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 ⁇ L of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter.
  • streptavidin SPA beads Scintillation Proximity Assay beads
  • IC50 values are determined with Ras peptide near K [ concentrations. Enzyme and substrate concentrations for inhibitor IC 50 determinations are as follows: 75 pM GGTase-I, 1.6 ⁇ M Ras peptide, 100 ⁇ M geranylgeranyl diphosphate.
  • the compounds of the instant invention are tested for inhibitory activity against human GGTase type I by the assay described above.
  • the cell line used in this assay is a v-ras line derived from either Ratl or ⁇ IH3T3 cells, which expressed viral Ha-ras p21.
  • the assay is performed essentially as described in DeClue, J.E. et al., Cancer Research 51:712-717, (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound (final concentration of solvent, methanol or dimethyl sulfoxide, is 0.1%).
  • the cells are labeled in 3 ml methionine-free DMEM supple-mented with 10% regular DMEM, 2% fetal bovine serum and 400 ⁇ Ci[35s]methionine (1000 Ci/mmol).
  • the cells are lysed in 1 ml lysis buffer (1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2/l M DTT/10 mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml antipain/0.5 mM PMSF) and the lysates cleared by centrifugation at 100,000 x g for 45 min.
  • the immunoprecipitates are washed four times with IP buffer (20 nM HEPES, pH 7.5/1 mM EDTA/1% Triton X-100.0.5% deoxycholate/0.1%/SDS/ 0.1 M NaCl) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands corresponding to famesylated and nonfamesylated ras proteins are compared to determine the percent inhibition of farnesyl transfer to protein.
  • IP buffer (20 nM HEPES, pH 7.5/1 mM EDTA/1% Triton X-100.0.5% deoxycholate/0.1%/SDS/ 0.1 M NaCl
  • Rat 1 cells transformed with either v-ras, v-raf, or v-mos are seeded at a density of 1 x 10 4 cells per plate (35 mm in diameter) in a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum) over a bottom agarose layer (0.6%). Both layers contain 0.1% methanol or an appropriate concentration of the compound (dissolved in methanol at 1000 times the final concentration used in the assay).
  • the cells are fed twice weekly with 0.5 ml of medium A containing 0.1% methanol or the concentration of the instant compound. Photomicrographs are taken 16 days after the cultures are seeded and comparisons are made.
  • the SEAP reporter plasmid, pDSElOO was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMN- RE-AKI.
  • the SEAP gene is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA).
  • the plasmid pCMN-RE-AKI contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegaloviras immediate early promoter.
  • the plasmid also contains a bovine growth hormone poly-A sequence.
  • the plasmid, pDSElOO was constructed as follows. A restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2- Basic using the restriction enzymes EcoRI and Hpal. The ends of the linear D ⁇ A fragments were filled in with the Klenow fragment of E. coli D ⁇ A Polymerase I. The "blunt ended" D ⁇ A containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment. The vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-II and the ends filled in with Klenow D ⁇ A Polymerase I.
  • the SEAP D ⁇ A fragment was blunt end ligated into the pCMN-RE-AKI vector and the ligation products were transformed into DH5-alpha E. coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
  • the SEAP repotrer plasmid, pDSElOl is also constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMN- RE-AKI.
  • the SEAP gene is derived from plasmid pGEM7zf(-)/SEAP.
  • the plasmid pDSElOl was constructed as follows: A restriction fragment containing part of the SEAP gene coding sequence was cut out of the plasmid pGEM7zf(-)/SEAP using the restriction enzymes Apa I and Kpnl. The ends of the linear D ⁇ A fragments were chewed back with the Klenow fragment of E. coli D ⁇ A Polymerase I. The "blunt ended" D ⁇ A containing the trancated SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1910 base pair fragment. This 1910 base pair fragment was ligated into the plasmid pCMN-RE-AKI which had been cut with Bgl-II and filled in with E.
  • the plasmid pCMN-RE-AKI is derived from plasmid pCMNEE-AKI-DHFR (Whang, Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Nirol., 61, 1796- 1807) by removing an EcoRI fragment containing the DHFR and Neomycin markers.
  • the plasmid pGEM7zf(-)/SEAP was constructed as follows.
  • the SEAP gene was PCRed, in two segments from a human placenta cD ⁇ A library (Clontech) using the following oligos.
  • Sense strand ⁇ -terminal SEAP 5' GAGAGGGAATTCGGGCCCTTCCTGCAT GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID. ⁇ O.:3)
  • Antisense strand N-terminal SEAP 5' GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO.: 4)
  • Sense strand C-terminal SEAP 5' GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3' (SEQ.ID.NO.: 5)
  • Antisense strand C-terminal SEAP 5' GAAGAGGAAGCTTGGTACCGCCACTG GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO.: 6)
  • the N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and Hpal restriction sites at the ends.
  • the Antisense N-terminal oligo (SEQ.ID.NO.: 4) introduces an internal translation STOP codon within the SEAP gene along with the Hpal site.
  • the C- terminal oligos (SEQ.ID.NO.: 5 and SEQ.ID.NO.: 6) were used to amplify a 412 bp C-terminal PCR product containing Hpal and HindDI restriction sites.
  • the sense strand C-terminal oligo introduces the internal STOP codon as well as the Hpal site.
  • the N-terminal amplicon was digested with EcoRI and Hpal while the C-terminal amplicon was digested with Hpal and Hindlll.
  • the two fragments comprising each end of the SEAP gene were isolated by electrophoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments. These two fragments were then co-ligated into the vector pGEM7zf(-) (Promega) which had been restriction digested with EcoRI and Hmdi ⁇ and isolated on an agarose gel.
  • the resulting clone, pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene from amino acids.
  • An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a trancated SEAP gene downstream of the cytomegaloviras (CMN) IE-1 promoter.
  • the expression plasmid also includes the CMN intron A region 5' to the SEAP gene as well as the 3' untranslated region of the bovine growth hormone gene 3' to the SEAP gene.
  • the plasmid pCMVTE-AKI-DHFR (Whang et al, 1987) containing the CMN immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV-AKI.
  • the cytomegaloviras intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV- AKI.
  • the intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid pl6T-286.
  • the intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer, R.M., Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979-3986) to remove a Sad restriction site using site directed mutagenesis.
  • the mutated intron A sequence was PCRed from the plasmid pl6T-287 using the following oligos.
  • Sense strand 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 7)
  • Antisense strand 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.ID.NO.: 8)
  • oligos generate a 991 base pair fragment with a Sad site incorporated by the sense oligo and a Bgl-II fragment incorporated by the antisense oligo.
  • the PCR fragment is trimmed with Sad and Bgl-II and isolated on an agarose gel.
  • the vector pCMV-AKI is cut with Sacl and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis.
  • the two gel isolated fragments are ligated at their respective Sad and Bgl-II sites to create plasmid pCMN-AKI-InA.
  • the D ⁇ A sequence encoding the trancated SEAP gene is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector.
  • the SEAP gene is cut out of plasmid pGEM7zf (-)/SEAP (described above) using EcoRI and HindDI. The fragment is filled in with Klenow D ⁇ A polymerase and the 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis.
  • the pCMV-AKI- InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow D ⁇ A polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the pCMV-AKI-InA vector.
  • Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence.
  • the resulting plasmid named pCMN-SEAP, contains a modified SEAP sequence downstream of the cytomegaloviras immediately early promoter IE-1 and intron A sequence and upstream of the bovine growth hormone poly-A sequence.
  • the plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells.
  • a D ⁇ A fragment containing viral-H-r ⁇ s can be PCRed from plasmid
  • the sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5' to the ATG start site.
  • cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo.
  • the PCR primer oligos introduce an Xhol site at the 5' end and a Xbal site at the 3 'end.
  • the Xhol-Xbal fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with Xhol and Xbal. This results in a plasmid in which the recombinant myr-viral-H-ras gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • a viral-H-r s clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid "H-l” (Ellis R. et al., J. Virol. 36, 408, 1980) or "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) by PCR using the following oligos.
  • Sense strand
  • Antisense strand 5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3' (SEQ.ID.NO.:
  • the sense strand oligo optimizes the 'Kozak' sequence and adds an Xhol site.
  • the antisense strand mutates serine 189 to leucine and adds an Xbal site.
  • the PCR fragment can be trimmed with Xhol and Xbal and ligated into the Xhol- Xbal cut vector pCI (Promega). This results in a plasmid in which the mutated viral- H-r s-CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • the human c-H-r s gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-H-ras encoding DNA fragment with the primers contributing an optimized "Kozak" translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
  • the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-H-ras-Leu61 can be excised from the p Alter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-H-ras-Leu61 from the CMV promoter of the pCI vector.
  • the human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand 5'-GAGAGTCGACTTGTTACATCACCACACATGGC-3' (SEQ.ID.NO.: 17)
  • the primers will amplify a c-N-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
  • the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glycine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-N-ras- Val-12 can be excised from the pAlter-1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-N-ras-Val-12 from the CMV promoter of the pCI vector.
  • the human c-K-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand 5'-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3' (SEQ.ID.NO.: 19) Antisense strand:
  • the primers will amplify a c-K-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a Kpnl site at the N-terminus and a Sal I site at the C-terminal end.
  • the c-K-ras fragment can be ligated into a Kpnl - Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of cysteine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-K-ras- Val-12 can be excised from the pAlter-1 vector, using Kpnl and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with Kpnl and Sal I.
  • the new recombinant plasmid will constitutively transcribe c-K-ras-Val-12 from the CMV promoter of the pCI vector.
  • the cells are washed with PBS and trypsinized with 1ml of 0.05% trypsin.
  • the 1 ml of trypsinized cells is diluted into 10ml of phenol red free DMEM + 0.2% charcoal stripped calf serum + IX (Pen/Strep, Glutamine and NEAA ).
  • Transfected cells are plated in a 96 well microtiter plate (lOOml/well) to which drag, diluted in media, has already been added in a volume of 100ml. The final volume per well is 200ml with each drug concentration repeated in triplicate over a range of half -log steps.
  • Luminescence reflects the level of activation of the fos reporter constract stimulated by the transiently expressed protein.
  • Assay Buffer Add 0.05M Na 2 CO 3 to 0.05M NaHCO 3 to obtain pH 9.5.
  • PSN-1 human pancreatic carcinoma cells are used for analysis of protein processing.
  • Subconfluent cells in 100 mm dishes are fed with 3.5 val of media (methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine- free/methionine-free DMEM supplemented with 0.035 ml of 200 mM glutamine (Gibco), 2% fetal bovine serum, respectively) containing the desired concentration of test compound, lovastatin or solvent alone.
  • media methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine- free/methionine-free DMEM supplemented with 0.035 ml of 200 mM glutamine (Gibco), 2% fetal bovine serum, respectively
  • lovastatin 5-10 ⁇ M
  • a compound that blocks Ras processing in cells by inhibiting a rate-limiting step in the isoprenoid biosynthetic pathway serve as a positive control.
  • Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%. Following incubation at 37°C for two hours 204 ⁇ Ci/ml [35s]Pro-Mix (Amersham, cell labeling grade) is added. After introducing the label amino acid mixture, the cells are incubated at 37°C for an additional period of time (typically 6 to 24 hours). The media is then removed and the cells are washed once with cold PBS.
  • the cells are scraped into 1 ml of cold PBS, collected by centrifugation (10,000 x g for 10 sec at room temperature), and lysed by vortexing in 1 ml of lysis buffer (1% Nonidet P-40, 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, 10 ⁇ g/ml AEBSF, 10 ⁇ g/ml aprotinin, 2 ⁇ g/ml leupeptin and 2 ⁇ g/ml antipain). The lysate is then centrifuged at 15,000 x g for 10 min at 4°C and the supernatant saved.
  • lysis buffer 1% Nonidet P-40, 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, 10 ⁇ g/m
  • Ki4B-Ras For immunoprecipitation of Ki4B-Ras, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 8 ⁇ g of the pan Ras monoclonal antibody, Yl 3-259, added. The protein/antibody mixture is incubated on ice at 4°C for 24 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 4°C for 45 minutes.
  • pansorbin Calbiochem
  • the pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS).
  • the Ras is eluted from the beads by heating at 95 °C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
  • the supernatant is added to 1 ml of Dilution Buffer 0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 mg Kirsten-ras specific monoclonal antibody, c-K-ras Ab-1 (Calbiochem).
  • the second protein/ antibody mixture is incubated on ice at 4°C for 1-2 hours.
  • the immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiseram to rat IgG (Cappel) by tumbling at 4°C for 45 minutes.
  • the pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer.
  • the Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS- PAGE on a 12% acrylamide gel (bis-acrylamide: acrylamide, 1:100), and the Ras visualized by fluorography.
  • hDJ processing inhibition assay PSN-1 cells are seeded in 24-well assay plates. For each compound to be tested, the cells are treated with a minimum of seven concentrations in half -log steps. The final solvent (DMSO) concentration is 0.1%. A vehicle-only control is included on each assay plate. The cells are treated for 24 hours at 37°C / 5% CO 2 .
  • the growth media is then aspirated and the samples are washed with PBS.
  • the cells are lysed with SDS-PAGE sample buffer containing 5% 2-mercaptoethanol and heated to 95 °C for 5 minutes. After cooling on ice for 10 minutes, a mixture of nucleases is added to reduce viscosity of the samples.
  • the plates are incubated on ice for another 10 minutes.
  • the samples are loaded onto pre-cast 8% acrylamide gels and electrophoresed at 15 mA gel for 3-4 hours.
  • the samples are then transferred from the gels to PVDF membranes by Western blotting.
  • the membranes are blocked for at least 1 hour in buffer containing 2% nonfat dry milk.
  • the membranes are then treated with a monoclonal antibody to HDJ-2 (Neomarkers Cat. # MS-225), washed, and treated with an alkaline phosphatase-conjugated secondary antibody.
  • the membranes are then treated with a fluorescent detection reagent and scanned on a phosphorimager.
  • the percent of total signal corresponding to the unprenylated species of HDJ is calculated by densitometry.
  • Dose-response curves and IC50 values are generated using 4-parameter curve fits in SigmaPlot software.
  • K4B-Ras processing inhibition assay PSN-1 human pancreatic carcinoma cells are used for analysis of protein processing.
  • Subconfluent cells in 150 mm dishes are fed with 20 ml of media (RPMI supplemented with 15% fetal bovine serum) containing the desired concentration of prenyl-protein transferase inhibitor or solvent alone.
  • Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%.
  • the cells are incubated at 37°C for 24 hours, the media is then removed and the cells are washed twice with cold PBS. The cells are scraped into 2 ml of cold PBS, collected by centrifugation (10,000 x g for 5 min at 4°C) and frozen at -70°C. Cells are lysed by thawing and addition of lysis buffer (50 mM HEPES, pH 7.2, 50 mM NaCl, 1% CHAPS, 0.7 ⁇ g/ml aprotinin, 0.7 ⁇ g/ml leupeptin 300 ⁇ g/ml pefabloc, and 0.3 mM EDTA). The lysate is then centrifuged at 100,000 x g for 60 min at 4°C and the supernatant saved. The supernatant may be subjected to SDS- PAGE, HPLC analysis, and/or chemical cleavage techniques.
  • lysis buffer 50 mM HEPES, pH 7.2, 50 mM NaC
  • the lysate is applied to a HiTrap-SP (Pharmacia Biotech) column in buffer A (50 mM HEPES pH 7.2) and resolved by gradient in buffer A plus 1 M NaCl. Peak fractions containing Ki4B-Ras are pooled, diluted with an equal volume of water and immunoprecipitated with the pan Ras monoclonal antibody, Y13-259 linked to agarose.
  • the protein/antibody mixture is incubated at 4°C for 12 hours.
  • the immune complex is washed 3 times with PBS, followed by 3 times with water.
  • the Ras is eluted from the beads by either high pH conditions (pH>10) or by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation.
  • the supernatant may be subjected to SDS-PAGE, HPLC analysis, and/or chemical cleavage techniques.
  • the pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS).
  • the Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
  • the supernatant is added to 1 ml of Dilution Buffer (0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 mg Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech).
  • the second protein/antibody mixture is incubated on ice at 4°C for 1-2 hours.
  • the immune complex is collected on pansorbin (Calbiochem) by tumbling at 4°C for 45 minutes.
  • the pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer.
  • Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis-acrylamide:acrylamide, 1:100), and the Rapl visualized by fluorography. Protocol B:
  • PSN-1 cells are passaged every 3-4 days in 10cm plates, splitting near- confluent plates 1:20 and 1:40. The day before the assay is set up, 5x 10 cells are plated on 15cm plates to ensure the same stage of confluency in each assay.
  • the media for these cells is RPMI 1640 (Gibco), with 15% fetal bovine serum and lx Pen/Strep antibiotic mix.
  • the day of the assay cells are collected from the 15cm plates by trypsinization and diluted to 400,000 cells/ml in media. 0.5ml of these diluted cells are added to each well of 24-well plates, for a final cell number of 200,000 per well. The cells are then grown at 37°C overnight.
  • the compounds to be assayed are diluted in DMSO in 1/2-log dilutions. The range of final concentrations to be assayed is generally 0.1-100 ⁇ M. Four concentrations per compound is typical. The compounds are diluted so that each concentration is lOOOx of the final concentration (i.e., for a lO ⁇ M data point, a lOmM stock of the compound is needed).
  • each lOOOx compound stock is diluted into 1ml media to produce a 2X stock of compound.
  • a vehicle control solution (2 ⁇ L DMSO to 1ml media), is utilized.
  • 0.5 ml of the 2X stocks of compound are added to the cells.
  • RNAse/DNase mix is added per well. This mix is lmg/ml DNasel (Worthington Enzymes), 0.25 mg/ml RNAse A (Worthington Enzymes), 0.5M Tris-HCl pH8.0 and 50mM MgCl 2 . The plate is left on ice for 10 minutes. Samples are then either loaded on the gel, or stored at -70°C until use.
  • Each assay plate (usually 3 compounds, each in 4-point titrations, plus controls) requires one 15-well 14% Novex gel. 25 ⁇ l of each sample is loaded onto the gel. The gel is ran at 15mA for about 3.5 hours. It is important to ran the gel far enough so that there will be adequate separation between 21kd (Rapl) and 29kd
  • the gels are then transferred to Novex pre-cut PVDF membranes for
  • the blocking solution is discarded and 20ml fresh blocking solution containing the anti Rapla antibody (Santa Cruz Biochemical SC1482) at 1:1000
  • the membranes are incubated at room temperature for 1 hour with mild rocking.
  • each of two alkaline phosphatase conjugated antibodies (Alkaline phosphatase conjugated Anti-goat IgG and Alkaline phosphatase conjugated anti-rabbit IgG [Santa Cruz Biochemical]) is then added.
  • the membrane is incubated for one hour and washed 3x as above.
  • ECF detection reagent About 2ml per gel of the Amersham ECF detection reagent is placed on an overhead transparency (ECF) and the PVDF membranes are placed face down onto the detection reagent. This is incubated for one minute, then the membrane is placed onto a fresh transparency sheet.
  • ECF overhead transparency
  • the developed transparency sheet is scanned on a phosphorimager and the Rapla Minimum Inhibitory Concentration is determined from the lowest concentration of compound that produces a detectable Rapla Western signal.
  • the Rapla antibody used recognizes only unprenylated unprocessed Rapla, so that the precence of a detectable Rapla Western signal is indicative of inhibition of Rapla prenylation.
  • This protocol allows the determination of an EC50 for inhibition of processing of Rapla.
  • the assay is ran as described in Protocol B with the following modifications. 20 ⁇ l of sample is ran on pre-cast 10-20% gradient acrylamide mini gels (Novex Inc.) at 15 mA/gel for 2.5-3 hours. Prenylated and unprenylated forms of Rapla are detected by blotting with a polyclonal antibody (Rapl/Krev-1 Ab#121;
  • Unprenylated Rapla is distinguished from prenylated protein by virtue of the greater apparent molecular weight of the prenylated protein. Dose-response curves and EC50 values are generated using 4-parameter curve fits in SigmaPlot software.
  • Rodent fibroblasts transformed with oncogenically mutated human Ha- ras or Ki-ras (10 cells/animal in 1 ml of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0.
  • the mice in each oncogene group are randomly assigned to a vehicle or compound treatment group. Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment.
  • the prenyl-protein transferase inhibitor may be administered by a continuous infusion pump.
  • Compound or vehicle is delivered in a total volume of 0.1 ml. Tumors are excised and weighed when all of the vehicle- treated animals exhibited lesions of 0.5 - 1.0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des composés qui inhibent la prényl-protéine transférase et la prénylation de la protéine oncogène Ras. Elle concerne également des compositions chimiothérapeutiques contenant les composés de l'invention, et des méthodes pour inhiber la prényl-protéine transférase et la prénylation de la protéine oncogène Ras.
PCT/US2000/034325 1999-12-21 2000-12-18 Inhibiteurs de la prenyl-proteine transferase WO2001045704A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU24363/01A AU2436301A (en) 1999-12-21 2000-12-18 Inhibitors of prenyl-protein transferase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US17292599P 1999-12-21 1999-12-21
US60/172,925 1999-12-21

Publications (1)

Publication Number Publication Date
WO2001045704A1 true WO2001045704A1 (fr) 2001-06-28

Family

ID=22629780

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/034325 WO2001045704A1 (fr) 1999-12-21 2000-12-18 Inhibiteurs de la prenyl-proteine transferase

Country Status (2)

Country Link
AU (1) AU2436301A (fr)
WO (1) WO2001045704A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1501790A2 (fr) * 2002-04-18 2005-02-02 University Of Virginia Patent Foundation Nouveaux bloqueurs de canaux sodiques
US7199125B2 (en) 2003-10-02 2007-04-03 Bristol-Myers Squibb Company Spiro-cyclic compounds useful as anti-inflammatory agents
US8410144B2 (en) 2009-03-31 2013-04-02 Arqule, Inc. Substituted indolo-pyridinone compounds
CN103342700A (zh) * 2012-01-19 2013-10-09 通化济达医药有限公司 11β-羟基类固醇脱氢酶1型抑制剂

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3507881A (en) * 1965-09-17 1970-04-21 Astra Ab Spiro-tetraline succinimide compounds
US4925841A (en) * 1985-07-22 1990-05-15 Temple University Of The Commonwealth System Of Higher Education Mannich bases of spirosuccinimides

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3507881A (en) * 1965-09-17 1970-04-21 Astra Ab Spiro-tetraline succinimide compounds
US4925841A (en) * 1985-07-22 1990-05-15 Temple University Of The Commonwealth System Of Higher Education Mannich bases of spirosuccinimides

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ARZNEIM.-FORSCH. ZH., vol. 44, no. 6, 1994, (ENG), pages 702 - 706 *
BORENSTEIN ET AL.: "Anticonvulsant activity of indanylspirosuccinimide Mannich bases", J. PHARM. SCI., vol. 76, no. 4, April 1987 (1987-04-01), pages 300 - 302, XP002939656 *
CHEMICAL ABSTRACTS, vol. 109, no. 12, 19 September 1988, Columbus, Ohio, US; abstract no. 103859K, HERMANSSON J.: "Relationship between enantioselectivity and solute structure on a chiral .alpha 1.- acid glycoprotein column" page 749; column 2; XP002939657 *
CHEMICAL ABSTRACTS, vol. 121, no. 21, 21 November 1994, Columbus, Ohio, US; abstract no. 255570V, SOTIROPOULOU E.: "Synthesis and pharmacochemistry of some new amino ketones with local anesthetic activity" page 1149; column 2; XP002939660 *
CHROMATOGRAPHIA, vol. 24, 1987, (ENG), pages 520 - 526 *
NEW ET AL.: "Buspirone analogs. 2. Structure-activity releationships of aromatic imide derivatives", J. MED. CHEM., vol. 29, no. 8, August 1986 (1986-08-01), pages 1476 - 1482, XP002939655 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1501790A2 (fr) * 2002-04-18 2005-02-02 University Of Virginia Patent Foundation Nouveaux bloqueurs de canaux sodiques
EP1501790A4 (fr) * 2002-04-18 2006-03-29 Univ Virginia Nouveaux bloqueurs de canaux sodiques
US7439383B2 (en) 2002-04-18 2008-10-21 University Of Virginia Patent Foundation Sodium channel blockers
US8350076B2 (en) 2002-04-18 2013-01-08 University Of Virginia Patent Foundation Sodium channel blockers
US7199125B2 (en) 2003-10-02 2007-04-03 Bristol-Myers Squibb Company Spiro-cyclic compounds useful as anti-inflammatory agents
US8410144B2 (en) 2009-03-31 2013-04-02 Arqule, Inc. Substituted indolo-pyridinone compounds
CN103342700A (zh) * 2012-01-19 2013-10-09 通化济达医药有限公司 11β-羟基类固醇脱氢酶1型抑制剂
CN103342700B (zh) * 2012-01-19 2016-04-20 通化济达医药有限公司 11β-羟基类固醇脱氢酶1型抑制剂

Also Published As

Publication number Publication date
AU2436301A (en) 2001-07-03

Similar Documents

Publication Publication Date Title
US6358985B1 (en) Inhibitors of prenyl-protein transferase
AU2002211828A1 (en) Inhibitors of prenyl-protein transferase
US6284755B1 (en) Inhibitors of prenyl-protein transferase
US20020052380A1 (en) Inhibitors of prenyl-protein transferase
US20020010184A1 (en) Inhibitors of prenyl-protein transferase
WO2001017992A1 (fr) Inhibiteurs de la prenyl-proteine transferase
US6350755B1 (en) Inhibitors of prenyl-protein transferase
US6329376B1 (en) Inhibitors of prenyl-protein transferase
WO2001045707A1 (fr) Inhibiteurs de prenyl-proteine transferase
US6632818B2 (en) Inhibitors of prenyl-protein transferase
WO2002060868A2 (fr) Inhibiteurs de la prenyl-proteine transferase
US20020049217A1 (en) Inhibitors of prenyl-protein transferase
US6316436B1 (en) Inhibitors of prenyl-protein transferase
US6566385B2 (en) Inhibitors of prenyl-protein transferase
WO2001045704A1 (fr) Inhibiteurs de la prenyl-proteine transferase
AU762440B2 (en) Inhibitors of prenyl-protein transferase
US6413964B1 (en) Inhibitors of prenyl-protein transferase
WO2002079147A2 (fr) Inhibiteurs de la prenyl-proteine-transferase
US20040110764A1 (en) Inhibitors of prenyl-protein transferase
WO2002078702A1 (fr) Inhibiteurs de la prenyl-proteine transferase
US20020022633A1 (en) Inhibitors of prenyl-protein transferase
US6534506B2 (en) Inhibitors of prenyl-protein transferase
US6380228B1 (en) Inhibitors of prenyl-protein transferase
WO2002020015A1 (fr) Inhibiteurs de prenyle-proteine transferase
WO2001007051A1 (fr) Inhibiteurs de prenyl-proteine transferase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP