WO2000070058A2 - Plant cellulose synthase genes - Google Patents

Abstract

The present invention relates to an isolated nucleic acid molecule comprising a cellulose synthase gene specifically expressed during deposition of secondary cell walls in lignin containing cells and the use of such a gene or its promoter to modulate the expression of enzymes involved in the synthesis of plant cell walls, to produce transgenic plants.

Description

PLANT CELLULOSE SYNTHASE GENES

The present invention relates to plant cellulose synthase genes and their use in modifying plant phenotypes.

The invention also relates to constructs containing the cellulose synthase gene or a promoter thereof and the use of such constructs to regulate the expression of genes specifically duπng secondary cell wall deposition in lignm containing cells.

Cellulose forms the structural framework of plant cell walls and is probably the world's most abundant biopolymer. Cellulose is made up of crystalline β-l ,4-glucan micro fibrils. These crystalline microfibπls are extremely strong and resist enzymic and mechanical degradation. For many plant cells, the cell wall is synthesised m two distinct stages. During the initial phase of cellular growth, a primary cell wall is laid down and continuously expanded by processes that include relaxation of interchain linkages and addition of new polymers and matrix mateπals. Cellulose usually compπses about 20 to 30% of the dry weight of the pnmary wall (Fry, 1988). Following the cessation of expansion and division, a secondary cell wall is synthesised within the bounds of the pnmary wall. Cellulose accounts for roughly 40 to 90% of the secondary cell wall, depending upon the cell type.

The deposition of secondary wall mateπal often results in a very thick wall and is responsible for many of the structural properties associated with plants. In some heavily thickened cells, such as xylem cells, the secondary wall may also contain a high proportion of lignm that contributes to the mechanical strength. Consequently, the many industrial processes that utilise plant material, which are as diverse as paper manufacturing and food processing depend heavily on the properties of plant secondary cell walls. It would therefore be advantageous to modify the structure and cellulose content of plant secondary cell walls to produce altered plant phenotypes specific to the needs of a particular industry, for example reducing the lignin content of wood pulp for paper manufacturing.

The mechanisms involved in the synthesis of secondary cell walls are not understood m detail (Emons and Mulder, 1998) It is generally accepted that the cellulose component of both primary and secondary cell walls is synthesised by enzyme complexes situated at the plasma membrane. Many freeze-fracture studies have identified plasma membrane particles known as rosettes that appear to be associated with the ends of microfibπls (Brown 1996). The spacing of these rosettes also correlates with the distribution of the microfibnls (Giddings et al., 1980) It has been suggested that each rosette consists of a hexameπc complex, which result m the synthesis of 36 β-glucan chains that are thought to be present m a primary microfibπl (Delmer and Amor. 1995). The differences m physical properties of pnmary and secondary plant cell walls are partly due to differences in the number of individual cellulose chains in the microfibnl unit. In contrast to the approximately 36 individual chains in pnmary microfibnls (Delmer and Amor, 1995), the secondary cell walls of some algae contain fibnls containing up to 12000 individual β-l,4-glucan chains (Brown et al., 1996). In addition, individual cellulose chains from the secondary wall typically contain about 14,000 β-l,4-lιnked glucose molecules, whereas in the pnmary wall about half of the cellulose molecules contain less than about 500 glucose moieties and half contain about 2500-4500 monomers (Blaschek et al . 1982).

The enzyme complex which catalyses the synthesis of cellulose in plants is termed cellulose synthase Cellulose synthase from higher plants is assumed to be a multi-enzyme complex (Delmer and Amor, 1995). Consistent with this concept, a four-gene operon responsible for cellulose synthesis has been cloned from Acetobacter xyhnum (Saxena et al., 1990), and five genes have been shown to be essential for cellulose synthesis in Agrobacteπum (Matthese et al., 1995). Only one of these genes shows sequence similarity between Agrobactenum and A. xyhnum and this gene has been identified as encoding the cellulose synthase catalytic subunit. Amino acid sequences of bacteπal cellulose synthases along with other enzymes requiring nucleotide sugars were found to contain four regions of high conservation thought to be critical for UDP-glucose binding and catalysis (Saxena et al., 1995).

Recently, cDNA clones for two cellulose synthase homologues containing all four conserved regions were identified from a cotton cDNA library prepared from fibres at the onset of secondary cell wall synthesis (Pear et al., 1996). These genes, which are termed CELA genes, exhibit sequence similarity to at least 31 distinct expressed sequence tag (EST) or genomic sequences in the Arabidopsis sequence databases (Cutler and Somerville, 1997). However, it is unlikely that all of these cellulose synthase-hke (CSL) genes actually catalyse cellulose synthesis (Cutler and Somerville, 1997, Delmer, 1998) Rather, it has been proposed that some of the CSL genes encode other glycan synthases, such as those responsible for the synthesis of xyloglucan. xylan, callose and other polysacchandes. The biological function of one of the CEZ -related genes was recently established by the characterisation of a mutant of Arabidopsis deficient in crystalline cellulose deposition. The radial swelling 1 (rswl) mutant exhibits temperature sensitive radial swelling of its root tip due to a deficiency m cellulose deposition at elevated temperature (Baskm et al., 1992). The RSWl gene encodes a polypeptide with a high degree of sequence similanty to the cotton CELA genes (Aπoli et al., 1998a) The RWS1 gene appears to affect cellulose synthesis in pnmary cell walls, in that plants with the

mutation are not viable and do not grow past the seedling stage.

International patent application number PCT US97/19529 to Calgene states that one of the cotton fibre CELA genes, CELA1 is expressed in developing cotton fibres when secondary cell wall synthesis is initiated. The application shows how the CELA genes were used to screen the dBEST databank of rice and Arabidopsis ESTs to identify cDNA clones with homologous sequences from these plants. There is no teaching that any of these homologous sequences encode a protein having cellulose synthase activity or that any of the homologous genes are expressed at a particular time duπng plant development or in specific tissues.

PCT/US97/19529 descnbes how the cotton fibre CELA1 promoter may be used m a promoter construct and postulates that the constructs may be used in conjunction with plant regeneration systems to obtain plant cells and plants, and allow the phenotype of fibre cells to be modified to provide cotton fibres which are coloured as a result of genetic engmeenng. PCT/US97/19529 further postulates that the gene described therein may be used in a construct to transform woody tissues so that they produce excess cellulose, thereby reducing lignm production.

There is no disclosure in PCT US97/ 19529 as to what construct would be used to transform forest tree species so as to modify the wood quality phenotype, and to suppress lignm production. As the secondary cell wall of a developing cotton fibre is almost pure cellulose and does not contain lignm it would appear unlikely that the CELA1 gene would be expressed in woody tissue and thus its promoter would not be expected to be useful in a construct for transforming forest tree species.

For many applications it is desirable to be able to control gene expression at a particular stage in the growth of a plant or in a particular tissue. For this purpose regulatory sequences are required to turn on transcription at a particular time in a plant's development or m a particular tissue without effecting expression of other genes As it is the composition of secondary cell walls that is generally important for the paper, pulp and food processing industries it is desirable to provide a gene which affects synthesis of cell wall components specifically in secondary cell walls of woody plants. Furthermore it is desirable to provider control of expression of genes duπng secondary cell wall deposition so as to be able to alter the phenotype of woody plants.

Accordingly, the first aspect of the invention provides an isolated nucleic acid molecule compπsmg a cellulose synthase gene specifically expressed duπng deposition of secondary cell walls m lignin containing cells.

The invention is based on the inventors' w ork on mutants of Arabidopsis carrying mutations in one of the three irx (for irregular xylem) loci These genes are charactensed by collapsed xylem in stems (Turner and Somerville 1997). The xylem vessels are thought to collapse due to a lack of resistance to the negative pressure exerted by water transport. The deposition of cell walls in these plants is abnormal and results m the stems being weaker and less ngid. In one of these mutants, ιrx3, the increased flexibility of the stems results m an inability to support an upnght growth habit. Analysis of these mutants showed a specific reduction or complete loss of cellulose deposition in the secondary cell wall (Turner and Somerville, 1997).

The inventors have isolated and charactensed of a member of the Arabidopsis CELA gene family that corresponds to the IRX3 gene The discovery that IRX3 is a component of the cellulose synthases involved in secondary wall synthesis created several expeπmental opportunities for studies of the factors that regulate secondary wall synthesis and lead to the present invention

Preferably, the cellulose synthase gene according to the first aspect of the invention is specifically expressed during deposition of secondary cell walls in vascular tissue such as xylem. This is evidenced by the collapsed xylem in ιrx3 mutants which do not express the IRX3 gene.

The preferred cellulose synthase gene is that isolated from Arabidopsis. The preferred sequence of the cellulose synthase gene according to the first aspect of the invention is that comprising the sequence shown as SEQ ID No 1, the complement of the sequence shown as SEQ ID No. 1, the reverse complement of the sequence shown as SEQ ID No. 1, the reverse of the sequence shown as SEQ ID No. 1 or a sequence having at least 80 % sequence identity with the nucleic acid molecule sequences of any one of the aforementioned sequences.

By use of the term "at least 80% identity" it is therefore understood that the invention also encompasses more than the specific exemplary nucleotide sequences. Modifications to the sequence, such as deletions, insertions, or substitutions in the sequence which produce "silent" changes which do not substantially affect the functional properties of the resulting protein molecule are also contemplated. For example, alterations m the nucleotide sequence which reflect the degeneracy of the genetic code or which result in the production of a chemically equivalent ammo acid at a given site are contemplated.

Nucleotide changes which result m an alteration of the N-termmal and C-termmal portions of the protein molecule would also not be expected to alter the activity of the protein.

A nucleic acid sequence with a greater identity than 80 % to SEQ ID No. 1 is also envisaged. Preferably, the nucleic acid sequence has 85 % identity with SEQ ID No.l, more preferably 90 % identity, even more preferably 95 % identity and most preferably 98% identity with SEQ ID No. 1.

The cellulose synthase gene according to the first aspect of the invention compnses the cellulose synthase promoter and the cellulose synthase coding region. The promoter is time and tissue specific in that it turns on expression of the cellulose synthase gene only during secondary cell wall synthesis and only in cells containing lignin, such as vascular tissue. The promoter thus provides an important second aspect of the invention.

According to a second aspect of the invention an isolated nucleic acid molecule containing a promoter of an isolated nucleic acid molecule compnsmg a cellulose synthase gene specifically expressed during deposition of secondary cell walls m lignm containing cells is provided.

Preferably, the cellulose synthase promoter regulates expression of the cellulose synthase gene so that it is expressed only duπng deposition of secondary cell walls in vascular tissue such as xylem. As with the cellulose synthase gene descπbed in accordance with the first aspect of the invention the preferred cellulose synthase promoter is that isolated from Arabidopsis. The preferred sequence of the cellulose synthase promoter according to the second aspect of the invention is that comprising the sequence shown as SEQ ID No. 3 or SEQ ID NO 4, the complement of the sequence shown as SEQ LD No. 3 or SEQ LD NO 4, the reverse complement of the sequence shown as SEQ ID No 3 or SEQ ID NO 4, the reverse of the sequence shown as SEQ ID No. 3 or SEQ ID NO 4 or a sequence having at least 60 % sequence identity with the nucleic acid molecule sequences of any one of the aforementioned sequences.

As with the gene sequence, base changes may be present in a promoter sequence without substantially affecting its functionality Such modifications are within the scope of the invention.

A nucleic acid sequence with a greater identity than 60 % to SEQ ID No. 3 or SEQ ID NO 4 is also envisaged. Preferably, the nucleic acid sequence has 70 % identity with SEQ ID No.3 or 4, more preferably 80 % identity, even more preferably 90 % identity and most preferably 95% identity with SEQ ID No. 3 or SEQ LD NO 4.

Suitable nucleic acid sequences selected according to the invention may be obtained, for example, by cloning techniques using cDNA libraries corresponding to a wide vanety of plant species expressing lignin. Suitable nucleotide sequences may be isolated from DNA hbranes obtained from a wide vanety of species by means of nucleic acid hybndisation or PCR, using as hybridisation probes or pπmers nucleotide sequences selected in accordance with the invention, such as SEQ ID No 1 or SEQ ID NO 3 or specific fragments thereof.

Since the promoter according to the second aspect of the invention is both developmentally and tissue specific it may advantageously be linked to an exogenous gene and used to transform a plant, such that that gene is only expressed in the transformed plant duπng secondary cell wall synthesis and only m tissues containing lignm.

According to the third aspect of the invention there is provided a nucleic acid construct suitable for transforming a plant cell, the construct compnsmg, in the 5'-3' direction:

(a) a cellulose synthase promoter according to the second aspect of the invention, and (b) a nucleotide sequence of an exogenous gene; the construct being arranged such that expression of the exogenous gene is under the control of the promoter

The constructs may be used to provide for transcπption of a nucleotide sequence of interest in cells of a plant host that produces lignm. only duπng secondary cell wall synthesis. The constructs may take several forms depending on the intended use of the construct. The constructs include vectors, transcnptional cassettes, plasmids and expression cassettes.

In one embodiment the nucleic acid construct includes a coding sequence for at least a functional part of an enzyme involved in synthesis of plant cell wall components. Generally, the enzyme may be involved in synthesis of cell wall polysacchaπde biosynthesis or cell wall protein biosynthesis More particularly it is preferred that the construct compπses a nucleotide sequence encoding at least a functional part of an enzyme involved m cellulose biosynthesis or lignin biosynthesis.

For applications where amplification of a particular protein is desired, the nucleotide sequence is inserted in the construct in a sense orientation, such that transformation of the target plant with the construct will lead to an increase in the number of copies of the gene and therefore an increase in an amount of enzyme.

When down regulation of a particular protein is desired the nucleotide sequence is inserted in the construct in an antisense onentation such that RNA produced by the transcnption of the nucleotide sequence is complementary to the endogenous mRNA sequence. This, in turn, will result in a decrease in the number of copies of the gene and therefore a decrease m the amount of enzyme.

As an alternative the nucleic acid construct may compnse a nucleotide sequence including a non-coding region of an exogenous gene or a sequence complementary to such a sequence. As used here the term "non-codmg region" includes both transcribed sequences which are not translated and non-transcπbed sequences within about 1000 base pairs 5' or 3' of the translated sequences or open reading frames Examples of non-coding regions which could be useful according to the third aspect of the invention include introns and 5' non-coding leader sequences Transformation of a target plant with such a DNA construct may lead to the reduction in the amount of a particular protein or polysacchande synthesised by the plant by the process of co-suppression.

According to a preferred embodiment the construct comprises the anttsense of nucleotide sequence encoding an enzyme involved in hgnin biosynthesis

The constructs of the present invention may be used to transform a vanety of plants, both monocotyledonous (e.g. corn, grains, grasses, oil seed rape, barley, πce, forage grasses, wheat and oat), dicotyledonous (e.g. Arabidopsis, tobacco, legumes, alfalfa, oaks, maple, poplar and eucalyptus) and gymnosperms (e.g. Scots pine, white spruce and larch). In a preferred embodiment the constructs are used to transform woody plants, herein defined as a tree or shrub whose stem lives for a number of years and increases diameter each year by the addition of woody tissue.

Techniques for stably incorporating the constructs into the genome of target plants are well known m the art and include Agrobacteπum tumefaciens mediated introduction, electroporation, protoplast fusion, injection into reproductive organs, high velocity projectile introduction an similar methods.

Transformed transgenic plant cells are then placed m an appropriate selective medium for selection of transgenic cells which are then grown to callus, shoots grown and plantlets generated from the shoot by growing in rooting media.

To confirm the presence of transformed cells a Southern blot analysis may be performed using methods familiar to those skilled in the art. The plants may be harvested and/or the seeds collected. The seed may serve as a source for growing additional plants having the desired characteπstics.

Of particular importance in the use of the constructs according to the third aspect of the invention is the ability to obtain plants whose phenotype is altered m a tissue specific and developmentally specific manner. By using the cellulose synthase gene which is only expressed during secondary cell wall synthesis and only m cells containing lignm or vascular tissue it is possible to produce a plant which is normal during it primary growth phase and only exhibits and altered phenotype during the secondary growth phase. A particularly preferred method of use of the construct is to reduce the amount of lignin m woody tissues, although the pnnciple is equally applicable to other secondary cell wall components.

Lignin is a major problem for the pulp and paper industry and considerable effort is used in removing lignm from paper pulp. Many groups have used an antisense approach, which involves expressing a lignm biosynthesis gene in reverse orientation and expressing it m cells making lignm (i.e. secondary cell walls in some plants) in order to reduce the lignm content of trees. In order to express these antisense genes, the correct promoter is required to direct expression m secondary cell walls. To date the promoters of lignm biosynthesis genes or other promoters have been used. The promoter descnbed according to the second aspect of the invention may be useful for such a purpose It is postulated that because the cellulose synthase promoter may be activated before the lignin biosynthesis genes that it may be a better promoter than those known in the art for altenng lignm m secondary cell walls.

The invention will now be descnbed, by way of example only, with reference to the following figures, m which:

Figure 1 illustrates the localisation of the ιrx3 mutation on chromosome V.

The positions of YAC clones spanning this region are shown below (from Schmidt et al.,

1996). The YAC clones containing the IRX3 gene filled. The filled vertical bar indicates the region of the chromosome V containing the IRX3 gene. The positions of genetic markers are taken from the map generated from recombinant mbred lines (Lister and Dean 1993).

Figure 2 lllustates a map of genomic clones containing the IRX3 gene. Introns are represented by solid blocks and triangles indicate the position of Hmdlll sites. Boxes represent the positions of the 3.1 kb (hatched), 7.5 kb (open), and 3.2 kb (filled) Hmdlll fragments referred to in the text. Two additional Hmdlll sites not shown occur between the 7.5 kb and 3.2 kb Hmdlll fragments.

(A) clone used to subclone the IRX3 gene and lntron/exon map of the IRX3 gene.

(B) Cosmid clones used for complementation.

Figure 3 illustrates alignment of the amino acid sequences of plant cellulose synthase genes. Solid boxes indicate regions in which more that half the residues are identical, and grey boxes indicate conserved residues. The positions of the three aspartic acid (D) residues and QxxRW motifs are indicated by asteπsks Positions of the presumed membrane-spanning helices are indicated by solid bars. Vanable regions referred to m the text are also indicated (VR1 and NR2) Dots were introduced to optimise alignment

Figure 4 shows toluidine stained sections of Arabidopsis vascular bundles from wild-type, ιrx3, and ιrx3 plants transformed with cosmids LI, L10, L3 and L5. Co, cortex; ph, phloem; xe, xylem elements

Figure 5 illustrates cellulose measurements showing complementation of the ιrx3 cellulose deficient phenotype using cosmid clones

Cellulose content of stem sections from individual wild-type (WT) and ιrx3 plants together with individual ιrx3 plants transformed with cosmids (LI, L3, L4, L5, and L10) containing the IRX3 gene. Details of the cosmids are provided in Figure 2

Figure 6 shows RΝA gel blots showing expression of the IRX3 gene.

Blots containing RΝA from developing stems and leaves from wild-type (wt) and ιrx3 plants were probed with 75G11, COMT and rRΝA

Figure 7 illustrates a phylogenetic tree of bacterial and plant cellulose synthases and homologues. Alignment data were bootstrap sampled 100 times and used to construct the consensus tree shown. Numbers are bootstrap values and indicate the number of trees in which the sequences to the nght of a bootstrap value clustered together. Shown to the πght of Csa, Csb or Csc gene names are the GenBank accession numbers for each gene. Agrobactenum refers to A tumefacians, Acetobacter for A xyhnum, and Aquifex for A. aeolicus.

Fig 8 A and B show transverse sections through the base of immature inflorescence stems of Arabidopsis plants transformed with the IRX3 promoter-uidA construct White boxes indicate the extent of the xylem and the black box the extent of the mterfasicular region, co - cortex; ph - phloem; pi - pith.

C and D show whole root mounts of IRX3-uιdA transgenic seedlings. Root hairs are seen radiating from the main root.

Fig 9 shows Gus staining of tobacco stems transformed with pp8GUS Staining is localised to areas of developing xylem, such as the xylem of a developing side shoot (top), or on the inner side of the vascular cylinder where new primary xylem is forming (bottom) EXAMPLES

Library Screening

Standard molecular techniques were earned out as descnbed in Sambrook et al., (1989). A Landsberg erecta library constructed in lambda FIX (Voytas et al., 1990) was screened with a 1.4 kb Sail -Xbal fragment from expressed sequence tag (EST) clone 75G11, labelled nonradioactively with the Gene Images random pπme labelling module (Amersham Life Science, Little Chalfont, Buckinghamshire. UK) probed and developed with the Gene Images CDP-Star detection module (Amersham Life Science) according to the manufacturer's instructions before visualisation of signal on BioMax MR1 film (Eastman Kodak, Rochester, New York) Two rounds of screening were earned out to identify hybridising clones.

Cosmids carrying IRREGULAR XYLEM 3 (IRX3) were isolated from a Landsberg erecta library constructed in pBIC20 (Meyer et al , 1994). Filters carrying 120,000 library clones were hybndised with a random pnmed dιgoxιgenm-11-2' -deoxyundιne-5 ' -phosphate- labeled 200 bp polymerase chain reaction (PCR) fragment, amplified by using pπmers 75G11F and 75G1 1R (see Results), and developed, and the positive clones were detected coloπmetncally as described by the kit manufacturer (Boehrmger Mannheim, Germany). Two rounds of screening were earned out to identify cosmid clones harbouring 75G11 genomic DNA.

RNA Gel Blot Analysis

Total RNA was isolated from 6-week-old plants using an RNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany) After transfer of 5 μg electrophoresed RNA to Hybond N+ membranes (Amersham Life Science) they were probed with 75G11 (1 4 kb Sail / Xbal fragment), COMT (Arabidopsis Biological Resource Center, Columbus,OH, stock center clone 115N5, EcoRI / Hmdlll 1 5 kb fragment), or rRNA (O'Donnell et al , 1998; 300 bp EcoRI fragment) probes labelled as given above and developed according to the manufacturer's instructions before visualisation as above.

PCR and Reverse Transcription PCR

PCR was carried out using Taq polymerase (Immunogen International. Sunderland, UK) according to manufacturer's recommendations m a PTC 100 thermal cycler (MJ Research Inc, Watertown, MA). Yeast artificial chromosomes (YAC) template DNA was isolated using an IGi Yeast Yl-3 kit (Immunogen International) Oligonucleotide primers were synthesised either by Gibco BRL Life Technologies UK Ltd (Paisley, UK) or MWG Biotech UK Ltd. (Milton Keynes, UK). Pnmer sequences for polymerase chain reaction (PCR) of 75G11 from YAC clones are as follows: 75G1 IF. 5'-AAGGTGATAAGGAGCATTTGA-3' (SEQ ID NO. 5) and 75G11R 5'-TCCCCACTCAGTCTTGTCTT-3 ' (SEQ ID NO. 6). The PCR conditions were as follows. 94°C for 60 sec followed by 10 cycles of 94°C for 45sec, 65°C for 60sec (reducing by 0.5°C per cycle), and 72°C for 60 sec followed by 25 cycles at 94°C for 45 sec, at 55°C for 60 sec and 72°C for 60 sec followed by 5 mm at 72°C.

For RT-PCR, first-strand cDNA was synthesised using 500 ng of mature stem total RNA in a reaction with a Ready To Go RT-PCR Bead (Pharmacia Biotech, Uppsala, Sweden) with 500 ng poly (dT) pnmer at 42°C for 60 min. Gene specific pπmers IRX3F (5'- CCTATGGAAGCTAGCGCCGGTCTT-3') (SEQ ID NO. 7) and IRX312 (5'- GTGTTTCTGTTGGCGTAACGA-3') (SEQ ID NO. 8) were added for the 5' end of the cDNA, and IRX3R (5'-GCTTCAGCAGTTGATGCCACACTT-3') (SEQ ID NO. 9) and IRX315 (5'-CGTTGAAAGTTGATTATCTCC-3 ') (SEQ ID NO. 10) were added for the 3' end. PCR conditions were as follows. 95°C for 5 mm followed by 30 cycles at 94°C for 60sec, at 55°C for 60sec and 72°C for 2 min. RT-PCR products were gel puπfied before cloning into the vector pGEM-T Easy (Promega) for sequencing.

For PCR amplification from plant genomic DNA to ensure presence of the A-to-G nucleotide substitution, DNA was prepared from leaf tissue using a Phytopure plant DNA extraction kit (Scotlab, Lanarkshire, UK). Pnmers IRX33 (5'-TGCCTGCAACAACGCCAACAA-3') (SEQ ID NO. 11) and IRX317 (5'- TTGGGCACTTGGATCGGTTGA-3') (SEQ ID NO. 12) were used to amplify this fragment under the following conditions: 94°C for 60 sec followed by 30 cycles at 94°C for 60 sec, at 55°C for 60 sec and 72°C for 60 sec Again, the products were gel punfied and cloned into pGEM-T Easy for sequencing.

DNA Sequencing

Templates were generated by restriction fragment cloning or exonuclease Ill-generated deletions and primed with oligonucleotides annealing either to universal pnmmg sites or gene specific regions. Sequencing pπmers were synthesised and HPLC or high puπty salt free (HPSF) purified by MWG Biotech or PE Applied Biosystems. Plasmid templates were prepared using a Qiagen QIAprep Spin Mimprep Kit and sequenced automatically using ABI PRISM Big Dye Terminators (PE Applied Biosy stems, Foster City, CA). DNA sequence was analysed using the Genetics Computer Group suite of programs (Program Manual for the Wisconsin Package, Version 8, August 1994. Genetics Computer Group, Madison, WI) and programs available for use on the Internet

Complementation of irx3 irxl mutant plants were transformed by Agrobacterium tumefaciens (GV3101) carrying the appropnate Landsberg erecta binary cosmids according to Bent and Clough (1998). Pnmary transformants (T,) were selected by plating sten sed T,-seeds on Murashige-Skoog 0.8% agar plates containing 50 μg/ml kanamycm sulphate. After 3 weeks, the kanamycin-resistant plants were transplanted into pots containing a commercial soil/peat/perhte mixture. Stems from mature T_rplants together with stems from same-aged Landsberg erecta wild-type and ιrx > mutant plants were sectioned and stained with toluidine blue, and the cellulose content was then measured as described (Turner and Somerville, 1997).

Phylogenetic Analysis

Trees were built using PROTPARS, a maximum parsimony algoπthm included in the PHYLIP version 3.5 software package (Felsenstein, 1993) Robustness of tree topology was estimated using 100 bootstrapped data sets (Felsenstein, 1985). These are generated by randomly sampling input alignment data until a new data set equivalent in size to the original is generated. Topologies observed in a large percentage of trees are believed to be robust (i.e., supported by multiple characters in the alignment data)

Sequences used for alignments were identified by BLAST searches of GenBank. Several expressed sequence tags (ESTs) with significant similarity to IRX3 were excluded from our alignments. ESTs typically represent a small fraction of coding sequence, consequently we felt they did not posses enough useful (or reliable) sequence information to warrant inclusion in our data set.

Alignments were made using CLUSTALW (Thompson et al , 1994). Initially, CLUSTALW failed to align the bacterial domain B residues (as defined by Saxena et al., 1995) with the plant domain B residues. This was presumably due to the large insertion present within the plant domain B block This problem was rectified by manually aligning the bactenal and plant domain B sequences by inserting gaps into the bacterial sequences. This alignment was refined with a second CLUSTALW alignment Trees made with the initial and refined alignment data sets were largely in agreement, both identified three deep branches separating the CSA, CSB and CSC gene families (data not shown). Not all residues of the alignment were used to build the tree shown in Figure 7, only sequence blocks conserved among the majonty of sequences were used These blocks include domains A, B, and other conserved regions visible in our alignment. With reference to the IRX3 sequence, the following sequence blocks were used: 320-359, 376-390, 497-512, 518-574, 581-606, 715-744, 750- 781, 784-868, 883-907, 924-980.

Isolation of 3.2kb Promoter Hindlll Fragment

The 7.5kb Hzndlll fragment isolated that earned the IRX3 gene (Taylor et al., 1999) was found to contain only 90bp of sequence upstream from the start codon. This made it necessary to isolate the 3.2 kb Hmdlll fragment that lay upstream of the 7.5kb Hmdlll fragment. DNA was isolated from cosmid L6 (Taylor et al., 1999) and digested with Hmdlll. The 3.2kb fragment was then gel isolated before being ligated into pBluescπpt (Stratagene, La Jolla, CA, USA) before being completely sequenced on both strands. Oligonucleotide pnmers were designed in order to sequence across the junction with the 7.5kb Hmdlll fragment to ensure continuity.

Construction Of Promoter - GUS Fusions.

In order to determine the expression pattern of the IRX3 promoter, it was decided to make a promoter GUS fusion. A number of vectors are available that allow the creation of a transcπptional fusion with the uidA gene that encodes β-glucuronidase, including the vector pCB1381Z (Jefferson, 1997). To clone a fragment of the IRX3 promoter, PCR pnmers PI (⁵ GCGTCGACAGGGACGGCCGGAGATTAGCA^{3 (SEQ ID N0 13)}, sequences complementary to IRX3 promoter bases (1729-1749) underlined, Sail site in bold) and PI 7 (^5'GCAATCCTCGAGAGCCCGAG^{3 (SEQ ,D 0 14)}, entire sequence complementary to IRX3 promoter (bases 1-14), Xhol site in bold) were used m a standard PCR reaction with cosmid L6 as template, and the resulting 1.75kb PCR product gel punfied. This was then digested wιfh Λ7ιoI and Sail and ligated into pCB1381Z digested with Sail, and the orientation of the insert confirmed with restriction digests, to create pP17GUS. This then consists of a 1749 bp IRX3 promoter fragment controlling expression of the uidA gene This plasmid was then transformed in Agrobacteπum strain GV3101 in order that transgenic plants may be generated.

Transformation Of Arabidopsis. Arabidopsis was transformed by vacuum infiltration (Bent and Clough 1998) with Agrobactenum carrying pP17GUS. Seeds from these plants were collected and ttansformants selected by plating on media containing 20mgl ' Hygromycm. Transformed seedlings were then transfered to soil.

Analysis Of GUS Expression.

Staining of transgenic plants was earned out by immersing tissue m GUS histochemical buffer (Rodπgues-Pousada et al, 1993. The Plant Cell 5:897-911.) before cleanng in 80% ethanol and viewing Whole seedlings were stained and mounted whole, and lengths of stem were stained before hand-cut sections were cut and mounted.

RESULTS

Identification of a Cellulose Synthase EST Linked to irx3

Because of the specific defect in secondary wall cellulose deposition in the ιrx3 mutant, we tested the possibility that one of the CSL or CELA sequences present in the Arabidopsis database corresponded to the irx3 locus. ιrx3 maps to the middle of chromosome V and is close to the marker ngal06 (Turner and Somerville 1997). In a cross between the ιrx3 mutant and wild type, no recombinants were observed between ιrx3 and ngalOό in an analysis of 200 F₂ mutants (data not shown). Figure 1 shows that ιrx3 is placed between markers ngal51 and R89998. This region is represented by the seven CIC yeast artificial chromosome (YAC) clones CIC8E12, CIC9H7, CIC9F1, CIC6H3, CIC9E10, CIC11C4, and CIC6B10 (Creusot et al., 1995, Schmidt et al., 1997). Consequently the ιrx3 gene must be contained on one of these YACs.

Polymerase chain reaction (PCR) primer pairs were designed for each of the individual Arabidopsis CELA and CSL genes in GenBank, and each primer pair was tested to determine whether they amplified a fragment from the YAC clones spanning the region containing irx3 Only one of these primer pairs amplified a product, (75G1 IF and 75G11R), corresponding to the EST clone 75G11 , amplifying a 200 bp fragment (data not shown). Analysis of the individual YACs in the region demonstrated that the 75G11 gene is contained on YACs CIC9H7, CIC9F1, and CIC6H3, but not on YACs CIC8E12, CIC11C4, CIC6B10, and CIC9E10 (Figure. 1) Based on the estimated relationship between physical and genetic map distance (Schmidt et al., 1997), this information localised EST 75G11 to an approximately 150 kb region between markers ngal06 and mι438 (Fig 1) Because the ιrx3 mutation also maps between these two markers (results not presented), this information placed the EST 75G11 gene on a region of the chromosome, which was tightly linked to ιrx3.

Isolation of Genomic Clones Corresponding to EST 75G11

To obtain the full-length sequence of the gene corresponding to EST 75G11, the EST clone was used as a hybndisation probe to isolate genomic clones. A Landsberg erecta genomic library was screened and yielded two clones that were retained for charactensation. Figure 2A shows that one of these clones (pCSl) contains a Hmdlll fragment of 7.5 kb that was found to encode the entire coding sequence of the gene corresponding to EST 75G11. The nucleotide sequence of this fragment and the deduced ammo acid sequence of the gene product has GenBank accession number AF091713. The cDNA sequence of the gene corresponding to EST 75G11 was determined by reverse transcπption PCR (RT-PCR). To achieve this, primer pairs corresponding to the presumptive coding sequence, designed to amplify both the 3' and 5' halves of the gene, ere used to amplify first strand cDNA. The fragments were cloned prior to sequencing To negate the possible effects of incorporation of incorrect nucleotides by Taq polymerase, two independent clones isolated from individual RT-PCR reactions were sequenced and found to be identical (GenBank accession number AF088917).

Comparison of the cDNA and genomic sequences identified the presence of 11 mtrons and 12 exons in the genomic sequence. The cDNA sequence encodes a predicted protein of 1025 ammo acids with a molecular mass of 1 16 kD Figure 3 shows there is a high degree of sequence between the 75G11 gene product and several other cellulose synthase gene products, notably the Arabidopsis RSW1 and Ath-A genes (Aπoli et al., 1998a) and the cotton CELA1 gene (Pear et al., 1996). It is clear that there are significant regions of very high conservation. The only areas with no notable homology are in a region (VR2) that has been described previously as a plant hyper vanable region (HVR, Pear et al , 1996) and a region close to the N terminus (VR1) (Figure. 3) In common with other cellulose synthase genes that have been identified (Pear et al., 1996. Aπoli et al., 1998a), the 75G11 gene product contains a cysteine-πch region at its N terminus, which has been suggested to form a LIM- like Zinc finger motif which may be involved m protein-protein interactions (Delmer 1998). As expected, the 75G11 gene product also contams the four motifs that have been identified as being conserved in cellulose synthase genes The first three of these are centred around aspartate residues, and the fourth consists of a QxxRW motif (where x represents any ammo acid), which m this case, as in several other cases contains the sequence QVLRW (Figure. 3) In common with cotton CELA and Arabidopsis RSWl (Pear et al., 1996; Aπoh et al, 1998a), the 75G11 gene product shares a predicted transmembrane topology consisting of two transmembrane domains at the N terminus followed by a cytoplasmic central domain containing the four conserved motifs descπbed. Six putative transmembrane segments at the C terminus follow this domain (Figure. 3).

Isolation of a Mutant Allele of irx3

To test the hypothesis that the 75G11 and IRX3 genes are identical, the sequence of the 75G11 gene m the ιrx3 mutant was determined RT-PCR was used to isolate cDNA clones of the mutant allele. The cDNA was amplified in two halves, with two independent reactions carried out to control for the possibility of nucleotide misincorporation by Taq polymerase. Both clones showed a G-to-A nucleotide substitution, which resulted m the introduction of a stop codon in place of Trp-859. The region of genomic DNA containing this mutation was amplified by PCR and two independent products sequenced to confirm the presence of this mutation. Both products contained the G-to-A nucleotide substitution. This mutation causes premature termination of translation immediately after the second of the six carboxy terminal putative trans-membrane domains, and results m a protein lacking 168 C terminal amino acids. The identification of a mutation in the 75G11 gene in the ιrx3 mutant strongly suggested that 75G11 is identical to IRX3.

Complementation of irx3 with the Wild-Type Gene

To test whether the ιrx3 mutation could be complemented with the wild-type gene, several cosmid clones containing the 75G11 gene were isolated and used to transform ιrx3 plants. All of the cosmids contained a 7.5 kb Hmdlll fragment identified as carrying the coding region of the gene in its entirety (Figure. 2B). In addition, the clone contains 90 bp of sequence at the 5' end and 2603 bp at the 3' end of the gene.

Figures 4 and 5 show that cosmids LI, L4 and L10 (as well as L2, L6, and L8; data not shown) complemented the ιrx3 mutation. Each of these contained the 7.5 kb Hmdlll fragment, an adjacent 3.2 kb Hmdlll fragment at the 5' end, and a 3.1 kb Hmdlll fragment at the 3' end of the IRX3 gene (Figure. 2B). The 3.1 kb fragment carπes no part of the IRX3 coding region, and the nucleotide sequence of this fragment had no significant sequence similarity to any known genes as determined by BLASTX searches (Altschul et al., 1990) against the Swiss Prot database. It can be seen from the transverse stem sections stained with toluidine blue that in ιrx3 plants, there is considerable collapse of the xylem vessels, whereas wild-type plants have clear, open xylem vessels (Figure 4) In plants transformed with cosmids LI and L10, this collapse is not evident and these plants have xylem elements that are visually indistinguishable from those of the wild type. Cosmids L3 and L5, which did not carry the 3.2 kb fragment, failed to complement the mutation (Figure 4) In all plants transformed with L3, the xylem vessels exhibit the collapsed phenotype evident m the mutant, whereas in some of the plants transformed with cosmid L5 there was partial complementation of the mutant phenotype (Figure 4). This suggests that the requirement for the 3.2 kb 5' Hmdlll fragment is not absolute The presence of this fragment is presumably necessary to direct correct expression of the gene. Because the 7.5 kb fragment carπes only 90 nucleotides upstream of the coding sequence of the gene, the 3.2 kb fragment presumably contains the promoter required for normal correct expression of the gene. These promoter sequences are presumably found in the first 1 5 kb of this fragment, because the 5' end of this fragment appears to encode for part of a gene, which exhibits weak homology (BLASTX score 68, smallest sum probability 2e ³³) to an APATELA2 domain-containing protein.

Measurements of the cellulose content of the pnmary transgenics (Figure 5) confirmed the results from qualitative analyses of xylem sections. Plants transformed with the cosmids LI, L4 and L10 contained cellulose levels that were indistinguishable from the wild type, whereas cosmid L3 had no effect on cellulose content. Thus, only cosmids that contained the 3.2 kb Hmdlll fragment effectively complemented the irx3 mutation. Cosmids lacking this fragment (L3 and L5) did not complement, or only partially complemented the mutation.

Expression Patterns of the IRX3 gene

RNA was isolated from leaves and from four discrete stem sections - the tip, upper middle part, lower middle part, and base of the stem of mature wild type and ιrx3 plants. Figure 6 shows the results of probing this RNA with EST 75G11. In the wild type, there was an increase in the amount of IRX3 mRNA as the stem matured (i.e., toward the base of the stem). There was no detectable transcript in leaves. These expression patterns correspond with secondary cell wall development. In companson with the wild type, IRX3 transcπpt levels were severely decreased in the ιrx3 mutant, to approximately 10% of wild type levels in the most mature stem tissue (Figure 6) An identical blot probed with a gene encoding for caffeic acid 0-methyltransferase (COMT), which is a component of the lignin biosynthesis pathway, showed that the ιrx3 mutation had little effect on the expression of a typical gene in the lignm biosynthetic pathway (Figure 6) Minor differences in COMT transcript levels are thought to be due to the difficulty in accurately staging the sections obtained from the different plants, because ιrx3 plants have been shown to grow slightly more slowly than wild type (Turner and Somerville, 1997) Two possibilities exist as to the residual signal seen m ιrx3 plants It has been shown previously that the introduction of a premature stop codon into a transcπpt (as is the case with ιrx3) can lead to its degradation (Abler and Green 1996). Thus it would not be surpπsing if the message levels in ιrx3 plants are reduced. It is not inconceivable that due to the close relationship between CelA like genes that there is some cross reaction with another member of the family, but the fact that the message level is decreased 90% m ιrx3 shows that the large majoπty of the signal seen is deπved from the correct message

IRX3 is Part of a Large Family of Plant Cellulose Synthase Homologues

Analysis of current genomic sequence data indicates that Arabidopsis contains nine anonymous open reading frames with significant similarity to IRX3. Three other homologs have previously been described (Arioh et al., 1998a). Thus, 13 Arabidopsis genes with significant similarity to IRX3 are present m public databases. Because only about 30% of the Arabidopsis genome sequence is available, the size of this gene family is likely much larger. Proteins which share a common ancestor often share similar biochemical functions; understanding the evolutionary history of this gene family may help in future predictions of gene function.

To infer the evolutionary history of this gene family, a multiple alignment of plant and bacterial sequences similar to known cellulose synthases was constructed. The alignment data was bootstrap resampled and used to generate a maximum parsimony tree utilizing the PROTPARS algorithm (Felsenstein, 1993). The phylogenetic tree generated was rooted using a cellulose synthase homologue identified in the deeply branching prokaryote Aquifex aeohcus (Deckert et al., 1998) Figure 7 shows the consensus tree generated by this analysis.

The phylogenetic tree reveals three deep branches, which divide the plant genes into three sub-families These branches are supported by high bootstrap values and are unlikely to be spurious Based on this data, we suggest that the higher plant family of sequences similar to IRX3 can be broken into three sub-families To conform with Arabidopsis genetic nomenclature, we suggest these families be called CSA, CSB, and CSC (Figure 7) We intend for the CS prefix to indicate 'cellulose synthase homologue' The CSA gene family includes RSWl. IRX3, CELAl and CELAL These genes are likely to be cellulose synthases based on either mutational analysis or expression data. Thus, the known plant cellulose synthase form a distinct sub-family withm the gene family as a whole, and are not distributed throughout the family The functions of the other branches remain to be determined However, we believe they could function in the synthesis of one of many plant beta-linked polysacchaπdes (Cutler and Somerville, 1997)

After histochemical staining of IRX3 promoter-zzz transgenic plants, staining was seen only in those cells that contain a thick secondary cell wall. Figs 8A and 8B show transverse sections from the base of the stem of IRX3-uιdA transgenic plants, and it can be clearly seen that the GUS expression is localised to cells in the xylem (the clear cells being those cells which have undergone cell lysis and all that remains is a cell wall). There is also staining specific to cells in the interfascicular region, which show uniform staining in all cells, as there are no conducting elements in this region It is clear that there is no GUS expression in the cortex, phloem or the pith, cell types which do not possess a heavily thickened secondary cell wall. Expression of GUS as directed by the IRX3 promoter roots is also very specific (Figs 8C and 8D), with expression being seen only in the central vascular cylinder but not the surrounding cortical and epidermal cells , nor m root hairs. It is clear that this expression is localised to cells in vascular cylinder where the xylem cells are found. Fig 8D also shows the expression of GUS in the development of new xylem cells in the formation of a lateral root.

Sequences.

Genomic sequence consisting of 7 5kb Hindlll fragment: Genbank AF091713. cDNA sequence : Genbank AF088917, SEQ ID NO. 1

Cellulose synthase encoded by 7.5kb Hindlll fragment; SEQ ID NO. 2.

1750bp promoter sequence; SEQ ID NO 3

500 bp promoter sequence; SEQ ID NO 4

DISCUSSION

Stems of the ιrx3 mutant contain approximately 20 - 30% of the amount of cellulose m mature stem tissue of wild type (Turner and Somerville, 1997). This results m an alteration of the physical properties of the stem and also leads to collapse of the xylem vessels due to an inability to withstand the negativ e pressure generated by water transport (Turner and Somerville, 1997) Because of the specific defect m cellulose deposition in the mutant, we hypothesised that the ιrx3 mutation may cause a defect in a subunit of cellulose synthase. To test this hypothesis, we first identified all of the EST and genomic sequences with sequence similanty to the Arabidopsis CSL genes and the CELA genes from cotton that were present in public databases. We then tested whether each of these sequences was present on the seven YAC clones that span the region of the genome where the ιrx3 mutation had been genetically mapped. One EST (75G11) was found to be present on three of the relevant YACs and was, therefore, deemed a candidate clone for the IRX3 gene. The observation that the 75G11 gene carnes a nonsense mutation in the ιrx3 background and complementation of the irx3 mutation with cosmids carrying 75G1 1 confirmed the coidentity of 75G11 and IRX3.

IRX3 likely encodes a cellulose synthase catalytic subunit similar to other plant and bacteπal cellulose synthase genes (Aπoli et al , 1998a, Pear et al., 1996). It contains all of the conserved motifs that have been proposed to be essential for cellulose synthase activity (Anoh et al., 1998a; Pear et al., 1996) The expression pattern of the IRX3 gene m Arabidopsis is consistent with the expectation for a gene involved m the synthesis of cellulose to be deposited in heavily thickened secondary cell walls. The increased levels of accumulation of IRX3 mRNA m more mature stem tissue is consistent with the observation that the cellulose content increases towards the base of the stem. This expression pattern of the IRX3 gene also correlates well with the zr i-conferred phenotype, which exhibits a large difference in cellulose content in mature stems compared to wild type, but little difference m leaves (Turner and Somerville 1997).

Further evidence that IRX3 is not involved in cellulose synthesis in pnmary walls deπves from observations that IRX3 does not exhibit any of the radial swelling phenotype or other phenotypes characteristic of the rswl mutant, despite the very severe nature of the ιrx3 mutation, which suggests it is probably a null mutation In addition, whilst rswl mutants plants exhibit a decrease in crystalline cellulose there is an increase in non-crystalline β-1-4 linked glucose (Anoh et al., 1988a). ιrx3 plants apparently show no increase m this non- crystalline β-1-4 linked glucose, since despite the very large decrease in crystalline cellulose observed in ιrx3, no increase has been observ ed in the proportion of glucose in the non- crystalline (soluble in 2M sulphunc acid) cell wall fraction (Turner and Somerville 1997). Until the definitive confirmation that recombinant proteins produced from these genes actually have cellulose synthase activity, it is still possible that these genes may encode, for example, a protein that primes rather than extends the cellulose chain. The work presented here, however, adds to the growing body of evidence (Pear et al., 1996, Anoh et al., 1998a) that these genes do in fact encode for the catalytic subunit of the higher plant cellulose synthase complex.

The relatively large number of cellulose synthase like (CSL) sequences from Arabidopsis that are present m public databases have raised questions as to the function of these sequences (Cutler and Somerville, 1997). The results presented here indicate that the function of at least some of the genes may be accounted for by cell-type specific gene expression. Similarly, in the rswl mutant, epidermal cells are misshapen (Anoh et al., 1998a), and it is possible that only this cell type is affected. It has been suggested that of the -40 cell types present m plants, almost all can be identified by unique features of their cell walls (Carpita and Vergara, 1998). In light of this, it may not be surpnsmg that different cell types may utilise individual sets of genes for their cell wall synthesis.

The inferred phylogenetic relationship between the cellulose synthase genes aligned in Figure 3 and some genes that have been suggested to be more weakly related (Anoh et al., 1998b) is shown m Figure 7. It is clear that IRX3 belongs to a small subfamily of cellulose synthase genes, including RSWl and cotton CELAl, but shows distant relationships to a large number of other cellulose synthase-related genes. This supports the idea that only the CSA subfamily of genes is involved in cellulose synthesis, whereas the function of other cellulose- synthase related genes remains unknown (Anoh et al., 1998a and b). It can be seen that IRX3 is closely related to Ath-B, an Arabidopsis cDNA of unknown function isolated by screening a cDNA library with a portion of the RSWl transcript (Anoh et al., 1998a) and to a gene, which we have provisionally named CSA1, that is evident in the currently available Arabidopsis genomic DNA sequence. IRX also appears to be more closely related to the CELAl and CELAl genes from cotton (Pear et al., 1996) than it does to the Arabidopsis RSWl gene (Anoh et al., 1998a), based upon the results of PILEUP analysis (data not shown). Thus, it seems possible that IRX3. CELA, CSA1 and Ath-B are all involved in secondary wall synthesis, whereas RSWl and Ath-A define the class of enzymes involved in pnmary wall synthesis.

Companson of these sequences may make it possible to identify features that identify what type of cell wall is produced by a particular cellulose synthase. Do cellulose synthases involved in secondary cell wall synthesis contain some sequences, which allow them to form rosette structures that cluster, to produce larger cellulose microfibnls? It is clear that there are two regions of variability between plant cellulose synthase genes. One of these lies close to the amino-terminal region that is predicted to be cytoplasmic and also contains a putative cyste e-πch LIM-hke protein binding domain (Delmer, 1998). We speculate that this is a region of the protein involved in interactions with other proteins that may make up the enzyme complex found in the membrane and possibly with other regulatory proteins as well. It should be noted, however, that there is another region of variability that has been called an HVR (Pear et al., 1996). This region lies between the second and third conserved motifs, and as such could be involved in the catalytic process itself. It is clear that there is still much to be learned about the synthesis of cellulose, with many important questions to be answered concerning the number of genes actually encoding cellulose synthases, and their possible differences in laying down cellulose. The catalytic mode of action of cellulose synthase is also an area m which advances need to be made to further our understanding. The cloning of IRX3, a gene involved m the synthesis of cellulose m secondary cell walls, will allow us to investigate some of these matters. For instance, it will be instructive to test whether RSWl or any of the other CELA- ke genes will functionally complement the ιrx3 mutation.

The mutation m the irx3 mutant leads to the loss of the last 168 ammo acids of the mature protein. This portion contains four membrane -spanning domains and several other features conserved in RSWl and CELAl. Its is very unlikely that such a gene would retain catalytic function and, therefore, the ιrx3 mutation appears to be a null mutation. In support of this conclusion, electron microscopy of sections of stems from ιrx3 plants show little if any cellulose in the secondary cell wall of xylem cells (Turner and Somerville, 1997). Nevertheless, under laboratory conditions, ιrx3 plants can grow and produce relatively normal plants in the absence of a normal secondary cell wall. Thus, it should be possible to recover any mutation that inactivates the cellulose synthase specifically required for secondary wall synthesis. However, if the same genes are used for components of both the pnmary and secondary walls, it may not be possible to identify nonconditional mutations in these genes. In this respect, the charactensation of the irxl and ιrx2 mutations (Turner and Somerville, 1997) may provide additional insights into the process of cellulose synthesis and deposition.

The identification of the IRX3 gene was greatly facilitated by analysis of publicly available sequence data In the near future, this sequencing initiative is likely to be an area of plant research that will revolutionise the way in which gene functions are assigned. The only other report involving the cloning of a cellulose synthase gene from Arabidopsis involved a long chromosome walk to the gene (Anoh et al., 1998a). The increasing number of ESTs that are easily mapped using PCR-based methodology and the completion of Arabidopsis genome sequencing, should soon supersede the need for such chromosome walks and will greatly accelerate the identification of genes responsible for mutations.

ADDITIONAL EXAMPLE

The ppl7GUS construct (now termed ppδGUS) comprising a 1749 bp IRX3 promoter fragment controlling expression of the uidA gene was used for the transformation of tobacco to show that the IRX3 promoter can work in species other than Arabidopsis. Transformations were performed on tobacco leaves using Agrobactenum according to standard procedures. Staining of free hand sections was performed by incubating sections of developing stems from primary tobacco ttansformants in X-gluc as described previously for Arabidopsis. Presence of the reporter gene and hence pp8 promoter activity is indicated by the presence of a blue colour m those tissue in which the promoter is active as shown m Figure 9.

Further expeπments were performed to hook up a lignm biosynthesis gene for work m co- suppression experiments in Arabidopsis to show that the cellulose synthase promoter can modulate the expression of a lignin biosynthesis gene.

Arabidopsis plants were stably transformed with the pp8 promoter m front of cDNA for the lignin biosynthesis gene courmaryl CoA reductase (CCR) using Agrobactenum, using stand techniques. The effect on cell wall properties was measured using an Instron universal testing machine exactly as described by Turner and Somerville 1997. A randomly selected sample of 14 T2 transformed plants gave an mean bending modulus (measure of ngidity) of 539 KPa and stress at yield (measure of cell wall strength) of 6.013 MPa. Comparable expeπments for wild type plants give a bending modulus of 2028 MPa and stress at yield of 15.55 MPa.

These data indicated that the strength of the stem and its rigidity are greatly reduced by pp8CCR construct. Since properties are determined by the properties of the cell wall (Turner and Somerville 1997), this is the result of the pp8 promoter being active in cell synthesising secondary cell walls most likely by reducing lignin content. REFERENCES

Abler, M.L., and Green, P.J. (1996). Control of mRNA stability m higher plants. Plant

Mol. Biol. 32, 63-78.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990). Basic local alignment sequence tool. J. Mol. Biol. 215, 403-410.

Arioli, T., Peng, L., Betzner, A.S., Burn, J., Wittke, W., Herth, W., Camilleri, C, Hofte,

H., Plazinski, J., Birch, R., Cork, A., Glover, J., Redmond, J., and Williamson, R.E.

(1998a). Molecular analysis of cellulose biosynthesis in Arabidopsis. Science 279, 717-720.

Arioli, T., Burn, J.E., Betzner, A.S., and Williamson, R.E. (1998b). Response: How many cellulose synthase-hke gene products actually make cellulose? Trends Plant Sci. 3, 165-166.

Baskin, T.I., Betzner, A.S., Hoggart, R., Cork. A., and Williamson, R.E. (1992). Root morphology mutants in Arabidopsis thahana. Aust. J. Plant Phys. 19, 427-437.

Bent, A.F., and Clough, S.J. (1998). Agrobactenum germ-line transformation:

Transformation of Arabidopsis without tissue culture. In Plant Molecular Biology Manual

(Second Edition), S.B. Gelvin and R.A. Schilperoot, eds (Kluwer Academic Pub., Dordrecht,

The Netherlands). Section B7 pages 1-14.

Blaschek, W., Koehler, H., Semler, U., and Franz, G. (1982) Molecular weight distribution of cellulose in primary cell walls. Investigations with regenerating protoplasts, suspension cultured cells and mesophyll of tobacco. Planta 154, 550-555.

Brown, R.M. (1996). The biosynthesis of cellulose. J. Macromol. Sci.- Pure and Appl.

Chem. A33, 1345-1373.

Brown, R.M., Saxena, I.M., and Kudlicka, K. (1996). Cellulose biosynthesis in higher plants. Trends Plant Sci. 1, 149-156.

Carpita, N., and Vergara, C. (1998). A recipe for cellulose. Science 279, 672-673.

Creusot, F., Fouilloux, E., Dron, M., Lafleuriel, J., Picard, G., Billault, A., Le Paslier,

D., Cohen, D., Chaboute, M.E., Durr, A., Fleck, J., Gigot, C, Camilleri, C, Bellini, C,

Caboche, M., and Bouchez, D. (1995) The CIC library: A large insect YAC library for genome mapping m Arabidopsis thahana. Plant J. 8, 763-770.

Cutler, S., and Somerville, C.R. (1997). Cellulose synthesis: Cloning in sihco. Current

Biology 7, R108-R111.

Deckert, G., Warren, P.V., Gaasterland, T., Young, W.G., Lenox, A.L.,Graham, D.E.,

Overbeek, R., Snead, M.A., Keller, M., Aujay, M., Huber, R., Feldman, R.A., Short, J.M.,

Olson, G.J., and Swanson, R.V. (1998). The complete genome of the hyperthermophilic bacteπum

Aquifex aeo cus. Nature 392, 353-358. Delmer, D.P. (1998). A hot mutant for cellulose synthesis. Trends Plant Sci. 3, 164-165. Delmer, D.P., and Amor, Y. (1995). Cellulose biosynthesis. Plant Cell 7, 987-1000. Emons, A.M.C., and Mulder, B.M. (1998) The making of the architecture of the plant cell wall: How cells exploit geometry. Proc. Natl. Acad. Sci. USA 95, 7215-7219. Felsenstein J. (1985) Confidence limits on phylogemes: an approach using the bootstrap. Evolution 39, 783-791.

Felsenstein J. (1993) PHYLIP (phylgeny inference package) version 3.5. Distnbuted by the author. Department of Genetics, University of Washmgton,Seattle.

Fry, S.C. (1988) The Growing Plant Cell Wall: Chemical and Metabolic Analysis. Longman, Harlow, U.K. pp. 333-340.

Giddings, T.H., Brower, D.L., and Staehelin, A. (1980). Plasma membrane of Micrastrias denticulata associated with the formation of cellulose microfibnls in pnmary and secondary cell walls. J. Cell Biol. 84, 327-339.

Jefferson, RA. 1997. A comprehensive set of modular vectors for advanced manipulations and efficient transformation of plants. Rockefeller Foundation Meeting of the International Program on Rice Biotechnology, 15-19 Sep 1997, Malacca, Malaysia. Lister, C, and Dean, C (1993). Recombinant mbred lines for mapping RFLP and phenotypic markers in Arabidopsis thahana. Plant J. 4, 745-750.

Matthysse, A.G., White, S., and Lightfoot, R. (1995). Genes required for cellulose synthesis m Agrobactenum tumefaciens. J. Bactenol. 177, 1069-1075. Meyer, K., Leube, M.P., and Grill, E. (1994) A protein phosphates 2C involved in ABA signal transduction in Arabidopsis thahana. Science 264, 1452-1455.

Newman, T., de Bruijn, F.J., Green, P., Keegstra, K., Kende, H., Mclntosh, L., Ohlrogge, J., Raikhel, N., Somerville, S., Thomashow, M., Retzel, E., and Somerville, C.R. (1994). Genes galore: A summary of methods for accessing results from large-scale partial sequencing of anonymous Arabidopsis cDNA clones. Plant Physiol. 106, 1241-1255. O'Donnell, P.J., Truesdale, M.R., Calvert, CM., Dorans, A., Roberts, M.R., and Bowles, D.J. (1998). A novel tomato gene that rapidly responds to wound- and pathogen- related signals. Plant J. 14, 137-142.

Pear, J.P., Kawagoe,Y., Schreckengost, W.E., Delmer. D.P., and Stalker, D.M. (1996). Higher plants contain homologs of the bactenal celA genes encoding the catalytic subunit of cellulose synthase. Proc. Nat. Acad. Sci. USA. 93, 12637-12642.

RodriguesPousada, R.A., Derycke, R., Dedonder, A., Vancaeneghem, W., Engler, G., Van Montagu, M., and Vanderstraeten, D. 1993. The Arabidopsis 1 -aminocyclopropane- 1-carboxylate synthase gene 1 is expressed dunng early development. The Plant Cell 5:897-

911.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory

Manual. Second edition Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Saxena, I.M., Lin, F.C., and Brown, R.M. (1990) Cloning and sequencing of the catalytic subunit of cellulose synthase from A cetobacter xyhnum. Plant Mol. Biol. 15, 673-683.

Saxena, I.M., Brown, R.M., Fevre, M., Geremia, R.A., and Henrissat, B. (1995).

Multidomam architecture of -glycosyl transferases: Implications for mechanism of action. J.

Bacteπol. 177, 1419-1424

Schmidt, R., Love, K., West, J., Lenehan, Z., and Dean, C. (1997) Descnptton of 31 YAC contigs spanning the majority of Arabidopsis thahana chromosome 5. Plant J. 11, 563-572.

Taylor, N.G., Scheible, W-R., Cutler, S., Somerville, C.R., and Turner, S.R. 1999. The irregular xylem Locus of Arabidopsis Encodes a Cellulose Synthase Required for Secondary

Cell Wall Synthesis. The Plant Cell 11:1-12.

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matnx choice. Nucleic Acids Research 22, 4673-4680.

Turner, S.R., and Somerville, C.R. (1997) Collapsed xylem phenotype of Arabidopsis identifies mutants deficient in cellulose deposition in the secondary cell wall. Plant Cell 9,

689-701.

Voytas, D.F., Konieczny, A., Cummings, M.P., and Ausubel, F.M. (1990). The structure, distribution and evolution of the TA1 retrotransposable element family of Arabidopsis thahana. Genetics 126, 713-721.

SEQUENCES

SEQ ID NO. 1

AAGCTTTTCACACATAAAAACCAAACTTATTCGTCTCTCATTGATCACCGTTTTGT

TCTCTCAAGATCGCTGCTAATCTCCGGCCGTCCCTATGGAAGCTAGCGCCGGTCTT

GTCGCCGGTTCTCATAACCGTAATGAACTAGTCGTCATTCACAACCATGAAGAGG

AAAATATTATTGCATTTTTTCGTTTTATTTGGTTACTATTTCTTAAAAAT^^

TTTTGGGAATAAAAATATGATCATTTTTTTAAATCATCTTCTTATTATGAGACAAA

AATTTATAATCTGTATTCTGTAGTTGCAATAATGTTGTAGAAAATTCATATCTTTG

TTAGCAAACATAATAATTTTGTTGGTAATATTAAGTTGAGAAGTCAGGTTTAACC

ATTTTAATCGCTGTCATTTTTTTTATTATCTTTACTTC

ATTAGAAATTTCAGGTTTTATTTCGTCTTTAAGGAACTTAAACTTTTGTGTAATTA

TAACAGCCAAAGCCTCTGAAGAATCTAGATGGACAATTCTGTGAGATATGTGGAG

ATCAGATTGGTTTAACAGTAGAAGGAGACCTCTTCGTAGCTTGCAATGAGTGTGG

TTTTCCGGCGTGTAGACCTTGCTATGAGTACGAGAGAAGAGAAGGAACACAAAA

CTGTCCTCAGTGTAAGACTCGTTACAAGCGTCTCAGAGGTAAGTTATTTATTAATC

TCCCTCTGCTCTTGTGTTGTTCGACGAAATGCCTCTATGAAAATTTAAAAAGGCTG

TTCCTTTTTTTAGTTTGAACTTGGAGAGTAATGATCTGTTTTTTGGTTTCTGAAGGA

AGCCCAAGAGTGGAGGGAGATGAAGACGAAGAAGATATTGATGATATTGAGTAT

GAATTTAATATCGAACATGAACAAGATAAGCATAAGCATTCTGCTGAGGCTATGC

TTTATGGGAAAATGAGCTATGGAAGAGGTCCTGAGGATGATGAGAATGGGAGAT

TCCCACCTGTTATAGCTGGTGGTCATAGTGGAGAATTTCCAGTTGGAGGAGGTTA

TGGTAATGGAGAACATGGGCTTCATAAGCGTGTGCACCCATATCCATCATCTGAA

GCTGGTGAGTCTCATGGAAATGTTAACTTACATATAGATTTAAGAATGTCTCACA

GTGATGATTAGTTAGGGTCATGCATATCTCCATATGTGCAAATAACATAAGTATG

AGGCCTTCCAGCTTAATAGTAGATAGGGACATAGTTTCATAAACATGGACTTTGG

TCCTTTTTGTTTATGTGTGTAATTTTAATGTGGTAGGGAGTGAGGGAGGATGGCGG

GAAAGAATGGATGACTGGAAGCTCCAGCATGGAAATCTTGGGCCAGAACCAGAT

GATGATCCTGAGATGGGACTGTAATGCCTCCACAAACATTTATCTAAGACATCAG

TTTTGTATGATTTGGATTCATGCTTACAAAATTTTGGATTTGACTGGAAATGGCTG

TAGGATCGACGAGGCACGGCAGCCACTCTCGCGGAAAGTTCCCATTGCCTCAAGC

AAGATCAATCCATATCGGATGGTCATCGTTGCTAGGCTTGTGATTCTAGCAGTTTT

TCTGCGGTATAGGCTCTTGAATCCAGTGCATGATGCTCTGGGATTATGGCTGACCT

CTGTGATCTGTGAAATCTGGTTCGCTGTCTCTTGGATTCTTGATCAGTTCCCCAAG

TGGTTCCCTATTGAACGTGAGACCTATCTAGATCGGCTTTCCCTCAGGTAAAAT

CCACAGATTCTCAAGTAGAAGTCTTAAAATCTATGACGTTGGAGTTTGGATGTAA

ATATTTTTTGTTTATACAGGTACGAGAGAGAAGGTGAACCAAATATGCTTGCCCC

TGTAGATGTCTTTGTCAGTACGGTGGACCCATTGAAGGAGCCTCCCCTCGTCACAT

CCAACACTGTGCTGTCAATCTTGGCCATGGACTACCCAGTTGAGAAAATCTCCTG

CTATGTCTCTGACGACGGTGCTTCAATGCTTACATTCGAATCTCTCTCGGAAACTG

CTGAGTTTGCAAGAAAATGGGTTCCCTTCTGTAAGAAATTCTCCATAGAGCCACG

GGCACCGGAGATGTACTTCACGTTGAAAGTTGATTATCTCCAGGACAAAGTCCAC

CCAACATTTGTTAAGGAACGTCGAGCCATGAAGGTCAGTGTATATCACCTGATCT

AGTTATACCACCACCCATCTTTTCACTATAATCTAAACTTCATAAGTGAAATTGAC

ATATGACAGAGAGAATATGAGGAGTTCAAGGTCAGGATCAACGCTCAAGTGGCG

AAGGCCTCAAAGGTTCCTCTAGAAGGTTGGATCATGCAAGATGGAACACCGTGGC

CAGGGAACAACACCAAGGACCACCCCGGTATGATCCAAGTCTTCCTCGGCCACAG

CGGAGGATTTGATGTCGAAGGGCATGAGCTTCCTCGGCTTGTGTACGTGTCCCGT

GAGAAGCGTCCTGGTTTTCAACACCACAAGAAAGCTGGCGCCATGAATGCCCTGG TAATTTTCTTGATCTGCCTTGGACCAAACAAGAAACTGATCTCCGTGTCTTGGACC

TAACCTGATACTTCTGTCAGGTTCGAGTGGCAGGCGTACTCACAAATGCTCCTTTC

ATGCTGAACTTGGACTGTGATCACTATGTAAACAACAGCAAGGCCGTGAGGGAA

GCAATGTGTTTTTTGATGGATCCTCAGATTGGAAAGAAGGTCTGCTATGTTCAGTT

CCCTCAAAGGTTTGATGGCATTGACACAAACGATCGTTACGCCAACAGAAACACA

GTCTTCTTTGATGTAAGACTCAATTCATATTTTTCCAACTTCTGGTCTAAATGAAA

ATGTACCCTCTTGCTTACACTCTTGTTTGCTACAGATCAATATGAAAGGTCTAGAT

GGAATCCAAGGTCCAGTTTACGTTGGTACTGGTTGTGTTTTCAAACGACAAGCTCT

GTATGGTTATGAACCACCAAAGGGTCCTAAACGTCCAAAGATGATAAGCTGTGGT

TGTTGTCCTTGCTTTGGGCGCCGGAGAAAGAATAAGAAATTTTCCAAGAATGACA

TGAATGGTGACGTAGCAGCCCTTGGAGGTAAATTATCCCAACAACCTTATAATAT

CAGTCCATTCTTGCAGTAGATTTCGTTTATGTTGGAATCTTGCGGATCTGATAGTG

TTTTTTGGCAGGAGCAGAAGGTGATAAGGAGCATTTGATGTCTGAAATGAACTTT

GAGAAAACATTTGGGCAATCATCCATCTTTGTAACCTCAACTTTGATGGAAGAAG

GTGGTGTTCCTCCGTCATCAAGTCCTGCAGTGCTCCTTAAAGAGGCAATCCATGTC

ATAAGCTGCGGTTATGAAGACAAGACTGAGTGGGGAACTGAGGTAATAATACTG

AATCGTAGAAATCACCTTCTTATTTGTGATTTAGTAGCTGGCCATTGTAAAAAACG

TTTGTGTATCTCGAAATTGCAGCTGGGTTGGATCTATGGCTCTATCACAGAGGATA

TTTTGACGGGATTCAAGATGCATTGCCGTGGATGGAGGTCTATTTACTGCATGCCT

AAGAGGCCTGCATTCAAAGGTTCAGCTCCTATTAATCTATCAGACAGGTTAAACC

AGGTTTTGCGTTGGGCACTTGGATCGGTTGAGATATTTTTCAGCCGGCACAGTCCT

CTCTGGTATGGCTACAAAGGAGGCAAACTCAAGTGGCTTGAGCGTTTTGCTTATG

CCAACACAACAATCTACCCCTTCACATCTATACCACTTCTTGCCTACTGTATCCTT

CCAGCCATCTGTCTCCTTACTGACAAATTCATCATGCCACCGGTTAGTAAAATTAT

CAGAGAAAAGCACTTAGAAGCTGCATCAAATGTGCTAACTATCTGTTTTCCCAAT

TTTTCTTTCAGATAAGCACATTTGCTAGTCTCTTCTTCATCTCACTGTTTATGTCGA

TCATTGTAACGGGAATCTTGGAATTGAGATGGAGCGGAGTTAGCATTGAGGAATG

GTGGAGAAACGAGCAATTCTGGGTCATTGGAGGAATCTCAGCTCATCTCTTTGCG

GTTGTCCAAGGTCTCCTCAAAATCTTAGCAGGCATTGACACAAACTTCACCGTCA

CATCAAAGGCAACAGATGATGATGACTTTGGAGAACTTTACGCATTCAAATGGAC

AACACTGCTGATCCCTCCAACAACTGTCTTAATCATAAACATTGTTGGCGTTGTTG

CAGGCATCTCAGATGCCATTAACAATGGATATCAGTCTTGGGGACCTCTATTTGG

TAAACTCTTCTTCTCCTTTTGGGTCATTGTTCATCTCTACCCATTCCTCAAAGGTCT

GATGGGTAGACAGAACAGAACACCAACCATTGTGGTGATTTGGTCAGTGTTATTG

GCATCTATCTTCTCTTTGCTTTGGGTAAGAATTGATCCTTTTGTGCTCAAGACCAA

AGGACCTGACACTTCCAAGTGTGGCATCAACTGCTGAAGCAAAATCTTTTTCGTC

TTCTGAAACTTTTTCTGTACTTTGTCGAGAGTGTTTTCACTTCTCTCTTTGGATTGC

ATAATTGGATTTTGTTTATTGTATATTAGCCAGTAAAACAGATGGATCTGGGTTTA

TTGTGAGCGAGTAATGCATTGTAAGAAAATTTGAACAAAACTACTTTTTAGTTAC

ACAGTAAAAGATTCACAGATACTTCCCTCAAGAGACATGTAGTTGCAGTGAAAAC

CCACAAATCTTGAATGCAAATTTTTAACAGAGAGCCTGAGACTTGTTCTTATATCG

TGGAGTTCACAAACAAAATAAAGAAACGACAACAAAAGCCTAAACACACGCACA

CATCTCATAACAACTTCTCAAGCTGAATATCATTTGATAACATTAAAAAACAAAT

TGAATTGCCTGAGTTTGTTTAGTTAAAGTCTCACCTCTTATTCTTTCGAAACACCA

AGGATCCACTGGGAGAGATGAGTCAAGTATGGCTCAGCCTGGGAGCCTTTGCTCA

AGACTGGTCCTAAGCTCTGCAACTCCGAGTTGAACTCCCTTTCGAAATTGCTGGTA

GAACACGTAACAGACATATTAGAACAATACCGTGATAATGAAGTTCAAAAATTCT

AACAGCAACGGCTTTTGTAGAGATAGTGTAGCCATTAGTTTGAAAAACAATTCCT

TGTTACTACTTACAATATGGACTCTGTAACGGTTGAGTCTCTTATCATTGTCTTCT

GTGGATGAGACTGGCTATTGATGTCGATAGACGATGATATCAACCACTGTGTGGC

TGCAGCATATTGCAGACACACTGATTTCAACTTCTCCATTTTCTGCACCATCA GTAAATATGAGTGTAAAATATTGATAAACATTACACTATTATTAGTGCGTTCAGA

ATTTTTGCTCTTGTTGCACGAAAGAGAAGCACATCACACTGTTACATCTGTCCTGA

GAAAACATAACATTTAGTGGAACAGCGACAAACCTTAAGGACGTCAGGTAAAAG

AAGCAAGCATCCTCTCAGACATTTATCAAGAAAAAAGTCGTGATGTTGTATCACC

TGCAAGATGATGGCACATTGTTCAATGAAGAATGTTTTCCCTGCAAACCAAAACA

AAGCAGGTCTCTACACTTACCTCATCTACACTCCTTGTGGATTGTAGTCTATCGTG

CATTACATGCCAATTTGGTTCGAGAACCTGAAGAGACATCCCACATAAAGACAAG

CAAAAACAACATTAGAAAAACTTAGAGAGGCAATAGTTGCTAAAATAAACACCA

AATCATCTCATAAAGAATTATGTCTTTATATACTTCTGGTGTGATTTCTCTCCTCTG

TTCATTGATAGTGTACTTATTTCTCCAGAATCACGTTTTCAAGAATGTATTTCTCG

AAAAACACAGTTGCAAGAAGTGCCTACATTTGTAAGTATGGTTTTTACGACTACA

GAGATATCTGGATTCAATATACAGAGTGTATGTCAGCAATTCTAGAAGTTAGTTT

TCCAGAGACTTACACCGCAAAATCACAATGGAAAACAGGATCTATGAATAGACA

ATCAGAATCTTTAAAAAACAAAAAAATATTCAGATTCCATTCTATTAGCAAAAAA

AAATGTTTTAAAAAACAAACAAAACAAAACAAAAAGAACATTCAGACTTGCCTC

GAATGTAAGATAATGTAGAAGGCTACTGATGAATTTAAGCATGCTACGGCAGAG

AAGCGATGATCTAAGAATTGCTGTACCCTTAGAGTTCATAGACCGAATCCCCTGT

AGAATTTTCACAGCAGTTTGTTAGCGAAGCAAAATGATTAAAATGGTTTTAGAAG

AAACCAAAACTGAAACAAATTACAAGCTACACAATATTATATCAGTCCTTACTTG

ATGTATCTGCCAAGCACCACAAAGCTGGCGTTCCACATGTTTGCAATGAAAAAGA

AAGCGGAAAATTAACTGGTACTTTGACAATGCTTTCTTTGATATGACAATAG

ATAGTGGCCATTGAACCTGAAACACAAAGCCACAACCAACAATCAAACAATTGA

GTAGCCAATCGAATATGCATTTGTCGATTACTTATATAAGTATGAATGATGACTCT

AGAAATGCATTAGTAGTTATATATAACAACCATTAATAGCCATTAAGCTGTGTTA

TTACTTATATATATCTCGACGAACAAAATAGTTCGAATCCAGATACAAACAGGTA

GTTGCAGACAAGGCAAGAAAGGAGCAGACCTTGTAGCTCAAGGAAAATGTCTCT

AGACCAGTGATGCTCATTGGGTCCTCAATACTATTGCTATCAGTGTCCTTGTGCAT

TCCCAAAGTCGTAAGCAATGAAGCTCGATCCTAAGATATGAATACAAAGTGAGA

ACATATAATGTACAAACTCTGTAAATTCATCACATCCAGGAAAAGACAAATTAAC

TGCTCACCACACAACAAGTCAAGTCTTCGTGGCGAGGATCTGCTGCAGCCGCTGT

GGTACGTAGAGCAAGATCTAGCAAAGACTAAATAATACACATCCATTTAGATTCC

AGCAAAGAAGTAGAGGCCATAACGATTTAATAATGGTAAGAAGCTT

SEQ ID NO. 3.

CTCGAGAGCCCGAGTCTACCTATTGGTAGTTCTGCGAAACGTCTCAAGGACGTTA

ACAATCCGGTTCCAGCTATGATGATTAGTAATAACGTTTCAGAGAGTGCAAATAA

TGTTAGCGGTTGGCAAAACACTGCGTTTCAGCATCAGGGAATGGATTTGAGCTTA

TTGCAGCAACAGCAGGAGAGGTACGTTGGTTATTACAATGGAGGAAACTTGTCTA

CCGAGAGTACTAGGGTTTGTTTCAAACAAGAGGAGGAACAACAACACTTCTTGAG

AAACTCGCCGAGTCACATGACTAATGTTGATCATCATAGCTCTACCTCTGATGATT

CTGTTACCGTTTGTGGAAATGTTGTTAGTTATGGTGGTTATCAAGGATTCGCAATC

CCTGTTGGAACATCGGTTAATTACGATCCCTTTACTGCTGCTGAGATTGCTTACAA

CGCAAGAAATCATTATTACTATGCTCAGCATCAGCAACAACAGCAGATTCAGCAG

TCGCCGGGAGGAGATTTTCCGGTGGCAATTTCGAATAACCATAGCTCTAACATGT

ACTTTCACGGGGAAGGTGGTGGAGAAGGGGCTCCAACGTTTTCAGTTTGGAACGA

CACTTAGAAAAATAAGTAAAAGATCTTTTAGTTGTTTGCTTTGTATGTTGCGAACA

GTTTGATTCTGTTTTTCTTTTTCCTTTTTTTGGGTAATTTTCT^

AGTTTCGATTATTTGGATAAAATTTTCAGATTGAGGATCATTTTATTTATTTATTA

GTGTAGTCTAATTTAGTTGTATAACTATAAAATTGTTGTTTGTTTCCGAATCATAA

GTTTTTTTTTTTTTTGGTTTTGTATTGATAGGTGCA^

CGATGTTAACAGAATTCAAATAGCTGCCCACTTGATTCGATTTGTTTTGTATTTGG AAACAACCATGGCTGGTCAAGGCCCAGCCCGTTGTGCTTCTGAACCTGCCTAGTC

CCATGGACTAGATCTTTATCCGCAGACTCCAAAAGAAAAAGGATTGGAGCAGAG

GAATTGTCATGGAAACAGAATGAACAAGAAAGGGTGAAGAAGATCAAAGGCATA

TATGATCTTTACATTCTCTTTAGCTTATGTATGCAGAAAATTCACCTAATTAAGGA

CAGGGAACGTAACTTGGCTTGCACTCCTCTCACCAAACCTTACCCCCTAACTAATT

TTAATTCAAAATTACTAGTATTTTGGCGGATCACTTTATATAATAAGATACCAGAT

TTATTATATTTACGAATTATCAGCATGCATATACTGTATATAGTTTTTTTTTTGTTA

AAGGGTAAAATAATAGGATCCTTTTGAATAAAATGAACATATATAATTAGTATAA

TGAAAACAGAAGGAAATGAGATTAGGACAGTAAGTAAAATGAGAGAGACCTGCA

AAGGATAAAAAAGAGAAGCTTAAGGAAACCGCGACGATGAAAGAAAGACATGT

CATCAGCTGATGGATGTGAGTGATGAGTTTGTTGCAGTTGTGTAGAAATTTTTACT

GGCAATGGAGACTCTACAACAAACTATGTACCATACAGAGAGAGAAACTAAAAG

CTTTTCACACATAAAAACCAAACTTATTCGTCTCTCATTGATCACCGTTTTGTTCTC

TCAAGATCGCTGCTAATCTCCGGCCGTCCCT

SEQ ID NO. 4

GATCACTTTATATAATAAGATACCAGATTTATTATATTTACGAATTATCAGCATGC

ATATACTGTATATAGTTTTTTTTTTGTTAAAGGGTAAAATAATAGGATCCTTTTGA

ATAAAATGAACATATATAATTAGTATAATGAAAACAGAAGGAAATGAGATTAGG

ACAGTAAGTAAAATGAGAGAGACCTGCAAAGGATAAAAAAGAGAAGCTTAAGG

AAACCGCGACGATGAAAGAAAGACATGTCATCAGCTGATGGATGTGAGTGATGA

GTTTGTTGCAGTTGTGTAGAAATTTTTACTAAAACAGTTGTTTTTACAAAAAAGAA

ATAATATAAAACGAAAGCTTAGCTTGAAGGCAATGGAGACTCTACAACAAACTA

TGTACCATACAGAGAGAGAAACTAAAAGCTTTTCACACATAAAAACCAAACTTAT

TCGTCTCTCATTGATCACCGTTTTGTTCTCTCAAGATCGCTGCTAATCTCCGGCCGT

CCCT

Claims

CLAIMS:

1 An isolated nucleic acid molecule comprising a cellulose synthase gene specifically expressed dunng deposition of secondary cell walls in lignm containing cells.

2 An isolated nucleic acid molecule compnsmg a cellulose synthase gene specifically expressed dunng deposition of secondary cell walls in Arabidopsis.

3 An isolated nucleic acid molecule according to claim 1 or claim 2 compnsmg the sequence shown as SEQ ID No. 1.

4 An isolated nucleic acid molecule according to claim 1 or claim 2 compnsmg the complement of the sequence shown as SEQ ID No. 1.

5 An isolated nucleic acid molecule according to claim 1 or claim 2 compnsmg the reverse complement of the sequence shown as SEQ ID No. 1.

6 An isolated nucleic acid molecule according to claim 1 or claim 2 compnsmg the reverse of the sequence shown as SEQ ID No. 1.

7 An isolated nucleic acid molecule comprising a sequence having at least 80 % sequence identity with the nucleic acid molecule sequences of any one of claims 3 to 6.

8 An isolated nucleic acid molecule containing a promoter of an isolated cellulose synthase gene specifically expressed duπng deposition of secondary cell walls in lignm containing cells.

9 An isolated nucleic acid molecule containing a promoter of an isolated cellulose synthase gene specifically expressed duπng deposition of secondary cell walls in Arabidopsis.

10 A promoter according to claim 8 or claim 9 compnsmg the sequence shown as SEQ ID No. 3.

11 A promoter according to claim 8 or claim 9 compnsmg the complement of the sequence shown as SEQ ID No. 3.

12 A promoter according to claim 8 or claim 9 compnsmg the reverse complement of the sequence shown as SEQ ID No. 3

13 A promoter according to claim 8 or claim 9 compnsmg the reverse of the sequence shown as SEQ ID No. 3.

14 A promoter according to claim 8 or claim 9 comprising the sequence shown as SEQ ID No. 4.

15 A promoter according to claim 8 or claim 9 comprising the complement of the sequence shown as SEQ ID No. 4.

16 A promoter according to claim 8 or claim 9 comprising the reverse complement of the sequence shown as SEQ ID No. 4.

17 A promoter according to claim 8 or claim 9 compnsmg the reverse of the sequence shown as SEQ ID No. 4.

18 A promoter comprising a sequence having at least 60 % sequence identity with the nucleic acid molecule sequences of any one of claims 10 to 17

19 A nucleic acid construct suitable for transforming a plant cell, the construct comprising, m the 5 '-3' direction:

(a) a cellulose synthase promoter according to any one of claims 8 to 18, and

(b) a nucleotide sequence of an exogenous gene; the construct being arranged such that expression of the exogenous gene is under the control of the promoter.

20. A nucleic acid construct according to claim 19 in which the nucleotide sequence is in a sense orientation.

21 A nucleic acid construct according to claim 19 in which the nucleotide sequence is in an anti-sense orientation.

22. A nucleic acid construct according to any one of claims 19 to 21 in which the nucleotide sequence codes for an enzyme involved m synthesis of plant cell wall components.

23. A nucleic acid construct according to claim 22 m which the enzyme is involved in cell wall polysacchande biosynthesis.

24. A nucleic acid construct according to claim 22 in which the enzyme is involved in cell wall protein biosynthesis.

25. A nucleic acid construct according to claim 22 m which the enzyme is involved in cellulose biosynthesis.

26. A nucleic acid construct according to claim 22 in which the enzyme is involved in lignm biosynthesis.

27. A nucleic acid construct according to claim 26 in which the nucleotide sequence encoding the enzyme involved in lignm biosynthesis is in an antisense onentation.

28. A transgenic plant cell transformed with a nucleic acid construct according to any one of claims 19 to 27.

29. A plant comprising a transgenic plant cell according to claim 28, or fruit or seeds thereof.

30 A plant according to claim 29 wherein the plant is a woody plant.

31. A plant according to claim 29 selected from the group consisting of alfalfa, πce, maize, oil seed rape, forage grasses, eucalyptus, pine, spruce, poplar. Arabidopsis and tobacco species.

32. A method for altenng the cell wall of a plant by altenng the activity of an enzyme involved in synthesis of plant cell wall components, the method compnsmg stably incorporating into the genome of the plant a nucleic acid construct according to any one of claims 19 to 27.

33. A method for producing a plant having altered lignm structure compnsmg

(a) stably transforming a plant with a nucleic acid construct according to claim 26 or claim 27 to produce a transgenic cell; and

(b) cultivating the transgenic cell under conditions suitable to produce a mature plant.