WO2009104181A1 - Plants having genetically modified lignin content and methods of producing same - Google Patents

Abstract

The present invention relates to plants genetically modified to have reduced or increased content of lignin by modifying the expression or activity of at least one small GTPase, particularly to plants in which the expression of at least one small Rho GTPase, more particularly ROP (RAC) GTPase is modified.

Description

PLANTS HAVING GENETICALLY MODIFIED LIGNIN CONTENT AND METHODS OF PRODUCING SAME

FHCLD OF THE INVENTION The present invention relates to plants genetically modified to have a reduced or increased content of lignin, and to means and methods of producing same.

BACKGROUND OF THE INVENTION

Lignin in Plants Plants provide the major source of organic substances on our planet. The principal cell wall polysaccharide is cellulose, which is composed of hydrogen bonded chains of β-1,4- linked glucose. Cellulose is coated with a class of polysaccharides called hemicellulose. The most abundant type of hemicellulose is xylan, a polymer of β-1,4- linked xylose. The major sugars available for bioethanol production are glucose and xylose but many other sugars are also found (Somerville C, 2007 Curr Biol. 17:R115- 9).

Plant cell wall lignins (from Latin lignum: wood) occur exclusively in higher plants. Lignins represent the second most abundant organic compound on the earth's surface after cellulose, accounting for about 25% of plant biomass. Cell wall lignification involves the deposition of phenolic polymers (lignins) on the extracellular polysaccharide matrix. Lignin is a complex polymer produced by the phenylpropanoid pathway in which phenylalanine or tyrosine are converted to p-coumaryl alcohol, coniferyl alcohol and in angiosperms also to sinapyl alcohol monolignols, that are polymerized to form p-hydroxyphenyl (H), guaiacyl (G) and syringyl (S) lignin, respectively (Anterola AM and Lewis NG, 2002 Phytochemistry 61 :221-94). The lignin present in the cell walls of vascular tissues is chemically linked to the polysaccharide matrix. Fermentation of cell wall polysaccharides requires their separation from lignin to make them more amenable to degradation by cellulases and glycolases.

The main function of lignins is to strengthen the plant vascular body, and the rigidity and structural support provided by lignification are thought to have had an important role in the successful land colonization of plants.

An important difference between cell walls of trees and those of herbaceous plants is that tree cell walls have more complex xylem layers. The xylem types in cell walls of trees vary depending on the age of the tree and the position of the xylem in the tree. For example, young trees (e.g., less than eight years old for pine) or the upper parts of a tree (with fewer than 6-8 growth rings) produce so-called juvenile wood xylem. Older parts of the tree produce so-called late wood xylem. Xylem cells have additional cellulose- rich secondary wall layers incorporated into the primary wall, which may become thickened and develop an increased tensile strength and resistance to pressure. The secondary cell wall comprises three additional layers, namely the Sl, S2 and S3 layers. In mature wood and late wood (wood formed in autumn) the S2 layers are thicker and the cellulose fibrils have higher angles (both of which are commercially desirable traits), when compared to juvenile or early wood.

The secondary walls may comprise a considerable amount of lignin in addition to cellulose, pectin and hemicelluloses. The Sl and S3 layers are generally highly lignified, while the S2 layer is lightly lignifϊed. In general, the higher the lignin content, the more rigid the plant. For example, tree species synthesize large quantities of lignin, with lignin constituting about 20% to 30% of the dry weight of wood. The lignin content of grasses ranges from 2-8% of dry weight and changes during the growing season. In addition to providing rigidity, lignin aids in water transport within plants by rendering cell walls hydrophobic and water impermeable. Lignin also plays a role in disease resistance of plants by impeding the penetration and propagation of pathogenic agents. In addition, lignins also provide resistance to abiotic stresses including, for example, extreme temperatures.

The presence and composition of lignin in plant cell walls is desirable for some applications and undesirable for others. Lignin resistance to degradation has a negative impact on certain agricultural and industrial uses of plants. Animals lack the enzymes for degrading the plant's cell wall polysaccharides and depend on microbial fermentation to break down plant fibers. High lignin concentration and methoxyl content reduce the digestibility of forage crops, such as alfalfa, by cattle, with cattle able to digest only 40-50% of legume fibers and 60-70% of grass fibers. Lignins are believed to limit forage digestibility by interfering with microbial degradation of fiber polysaccharides. Minor decrease in lignin content is predicted to have a significant positive impact on forage digestibility. Lignin is, however, an essential component of cell walls and provides structural support for the plant. Two major goals for the forestry industry are reduced rotation times and reduced costs of extracting pulp from wood. To reduce rotation times, young trees need to have enhanced growth characteristics, and have the wood characteristics of older trees. To reduce the costs of extracting pulp from wood, young trees need to have reduced lignin content. Reduced lignin content for the pulp and paper industry is also of high significance from environmental point of view, as the chemical treatments necessary to remove lignins from plant cell walls generate pollutants.

Today's economies are based on carbon resources of fossil origin. The use of these fossil-based resources as fuels causes increased CO₂ emissions leading to global warming. Moreover, the fossil resources are dwindling and their global distribution makes them unreliable. Thus, the present high dependence on fossil fuels is not sustainable, requiring development of alternative energy resources, including bio- ethanol production. By reducing the lignin content in plants suitable for the production of bio-fuel, for example switchgrass (Panicum virgatum), the ability to utilize the cell wall cellulose for conversion to ethanol will be greatly enhanced.

Small Guanosine Triphosphatases (GTPases)

Signaling small GTPases are small (20-25 kDa) proteins that bind and hydrolyze guanosine triphosphate (GTP). GTPases cycle between two conformations — an activated or inactivated form. Small GTPases serve as molecular switches for a wide variety of signal pathways, regulating a wide variety of process in the cell including growth, cellular differentiation, cell movement and lipid vesicle transport. Small GTPases include large number of proteins, divided to families and sub-families according to their structure, sequence and function, including Ras, Rho, Rab, Rap, Arf, Ran, Rheb, Rad and Rit.

Rho GTPases regulate the actin cytoskeleton, exocytosis, endocytosis, and other signaling cascades. Rhos are subdivided into four major subfamilies designated Rho, Racs, Cdc42, and a plant-specific group designated ROPs (Rho Of Plants), also referred to as RACs. ROPs make a highly conserved plant-unique subfamily and is considered as the only group of signaling small GTPases in plants (see, for example, Yang Z and Fu Y, 2007 Curr Opin Plant Biol 10:490-494; Yalovsky S et al., 2008 Plant Physiol 147:1527- 1543). Detailed sequence and functional analyses have demonstrated that ROPs are structurally and functionally conserved between monocot, dicot, gymnosperms, ferns and moss. Similar to other small GTPases, ROPs function as molecular switches that exist in either a GTP-bound "on" or a GDP-bound "off states. Several proteins are known to regulate ROP/RAC function. Guanyl nucleotide

Exchange Factors (GEFs) facilitate GDP/GTP exchange and activate ROPs (Berken A et al., 2005 Nature. 436:1176-80; Shichrur K and Yalovsky S, 2006 Trends Plant Sci. 11:57-9). GTPase activating Protein (GAPs) enhance GTP hydrolysis and down regulate ROP activity (Baxter-Burrell A et al., 2002 Science. 296:2026-8; Wu G et al., 2000 Plant Physiol. 124:1625-36). RhoGDIs (Rho GDP Dissociation Inhibitors) likely facilitate membrane targeting of ROPs (Carol RJ et al., 2005 Nature. 438:1013-6; Lin Q et al., 2003 Curr Biol. 13:1469-79). Thus ROP/RAC function can be modulated by either up or down regulation of ROP:GEFs, ROP:GAPs or RhoGDIs.

Conserved point mutations that convert either glycine¹⁵ (G¹⁵) to valine (V) or glutamine⁶⁴ (Q⁶⁴) to leucine (L) prevent GTP hydrolysis and create dominant constitutive active (CA) mutants that have been very useful for studying ROPs in different plant species (Nibau C. et al., 2006, 2006 Trends in Plant Science 11:309-15

Yang and Fu, 2007, ibid; Yalovsky et al., 2008 ibid), as well as in Arabidopsis (Bloch

D et al., 2005 MoI Biol Cell 16:1913-27; Lavy M et al., 2007 Curr Biol 17:947-52; Sorek N et al., 2007 MoI Cell Biol 27:2144-54).

The inventors of the present invention have previously shown that: 1) ROPs function at the plasma membrane by virtue of posttranslational lipid modifications (Lavy M et al., 2002 Plant Cell 14:2431-50; Lavy M and Yalovsky S, 2006 Plant J. 46:934-47; Sorek et al., 2007, ibid); 2) ROPs determine cell structure via regulation of actin cytoskeleton and vesicle trafficking (Bloch et al., 2005, ibid); 3) A ROP- interacting scaffold protein designated ICRl (Interactor of Constitutive active ROP 1) regulates cell and tissue polarity and structure and root development (Lavy et al., 2007, ibid); and 4) ROPs can be activated by treating plants with small molecules such GTPγS (Sorek et al., 2007, ibid). Regulation of Lignin Production

Key enzymes of the phenylpropanoid (monolignol) pathway have been subjected to manipulation for reducing lignin levels in plant cells. For example, approximately 40% reduction of lignin levels was achieved by overexpressing GA2-oxidase that converts active GA into a non-active form. Interestingly, the expression levels of monolignol biosynthesis genes were not reduced, suggesting that GA affects monolignols polymerization rather than their synthesis (Biemelt S et al., 2004 Plant Physiol 135:254-65). The major problem with this approach is that altering GA levels dramatically affects plant development.

Boudent AM et al. (U.S. Patent Nos. 5,451,514; 6,015,943; and 6,066,780) disclose the use of recombinant gene construct encoding an enzyme critical to the synthesis of a lignin precursor, to produce transgenic plants in which the synthesis of lignin is controlled. The modified gene may be in antisense orientation so that it is transcribed to mRNA having a sequence complementary to the equivalent mRNA transcribed from the endogenous gene thus leading to suppression of lignin synthesis. If the recombinant gene has the lignin enzyme gene in normal, or "sense" orientation, increased production of the enzyme may occur when the insert is the full length DNA but suppression may occur if only a partial sequence is employed.

U.S. Patent No. 6,204,434 discloses isolated DNA sequences associated with the lignin biosynthetic pathway, together with DNA constructs including such sequences. Methods for the modulation of lignin content and structure in plants and methods for producing plants having altered lignin content and structure, are also disclosed, the methods comprising incorporating one or more of the polynucleotides disclosed therein into the genome of a plant.

U.S. Patent No. 6,489,538 discloses plants transformed with a gene encoding an active F5H gene. The expression of the F5H gene results in increased levels of syringyl monomer providing a lignin composition more easily degraded with chemicals and enzymes.

U.S. Patent No. 6,410,826 discloses methods of selectively controlling lignin biosynthesis in plants such that lignification is reduced or enhanced, as desired, by ectopically expressing a nucleic acid molecule encoding a transcription factor, particularly AGL8, AGLl, AGL5 and R-like bHLH gene product or mutant thereof in the plant, whereby lignification is modulated due to ectopic expression of the nucleic acid molecule.

U.S. Patent No. 7,317,136 discloses methods for modulating cellulose, hemicellulose and lignin composition and deposition in secondary cell wall layers of plants to improve plant traits that are commercially desirable (e.g., enhanced digestibility of forage crops by animals, increased post-harvest processing of wood and crops for energy production and pulping, increase mechanical strength of plants, and others). That patent also provides methods for identifying genes encoding transcription factors that regulate the formation of secondary cell walls, polynucleotide sequences that encode key components of secondary cell walls, and transgenic plants comprising these sequences.

Modulating the lignin content in a plant cell may have a negative effect on plant growth. Thus, there is an unmet need for, and it would be highly advantageous to have means and methods for regulating lignification and for genetically modifying cultivated vascular plants to reduce or increase their lignin content, without negatively affecting the plant growth, to allow the more efficient use of plant biomass.

SUMMARY OF THE INVENTION

The present invention relates to plants genetically modified to contain reduced or increased lignin content, and to methods of producing same. The present invention discloses that lignin content in a vascular plant can be reduced without negatively affecting the plant phenotype by expressing a guanosine triphosphate (GTP)-non hydrolyzing mutant (designated constitutive active mutant) of Rho-GTPase, particularly a mutant of ROP/RAC GTPase.

The present invention further discloses that the xylem lignin content can be increased by silencing ROP gene expression, particularly by micro RNA (miR) or by inhibiting the function of Rho-GTPase, particularly ROP by expression of a dominant negative ROP mutant (ROP^DN). The increase in lignin content in the xylem resulted in substantial increases in the size of the vascular system and stem diameter.

The present invention is based in part on the unexpected finding that ROP mutants can be used to manipulate the content and size of the vascular system in plants. Accordingly, ectopic expression of constitutive active (CA) mutant forms of any one of the two ROPs, AtROPό (also designated AtRAC3) and AtROPIl (also designated AtRAClO) in transgenic Arahidopsis plants resulted in significant reduction in lignin levels in the xylem. Arabidopsis plants transformed with synthetic miR designed to silence most ROP genes (designated pan-ROP-miR) or with dominant negative ROPIl mutant (Atropl l^DN) showed increase in lignin content. In both cases, the growth habit of the transgenic plants was not negatively affected.

Thus, according to one aspect, the present invention provides a genetically modified plant having altered small GTPase expression, wherein the plant is characterized by reduced or increased lignin content compared to a corresponding unmodified plant.

According to certain embodiments, the present invention provides a genetically modified plant comprising at least one cell expressing constitutive active GTP-non hydrolyzing form of a signaling small GTPase, wherein the genetically modified plant is characterized by reduced lignin content compared to a corresponding unmodified plant.

According to certain embodiments, the signaling small GTPase is selected from the group consisting of non-plant Rho-GTPases and plant GTPases. According to typical embodiments, the plant GTPases are ROP (also referred to as RAC) GTPases. According to certain embodiments, the ROP GTPases are Arabidopsis ROPs. According to typical embodiments, the Arabidopsis ROPs are selected from the group consisting of AtROPό having the amino acid sequence set forth in SEQ ID NO:1 and AtROPl 1 having the amino acid sequence set forth in SEQ ID N0:2.

It is to be understood that modifying the expression of small signaling GTPases to non-hydrolyzing (constitutive active) form may be achieved by various means, all of which are explicitly encompassed within the scope of present invention.

According to certain embodiments, the present invention provides a genetically modified plant comprising at least one cell expressing constitutive active GTP-non hydrolyzing mutant of a small signaling GTPase. Any mutation and mutation number which would result in a constitutive active GTPase form can be employed according to the teachings of the present invention. According to some embodiments, the constitutive active GTPase mutant contains at least one point mutation selected from the group consisting of glycine to valine (G to V) and glutamine to leucine (Q to L). According to typical embodiments, the small signaling GTPase is ROP GTPase and the mutation is selected from glycine at positions 15 or 17 to valine (denoted Gl 5 V or Gl 7V), glutamine at positions 64 or 66 to leucine (denoted Q64L or Q66L) and combinations thereof. According to one embodiment, the constitutive active GTPase mutant is selected from the group consisting of AtROPό containing the point mutation Gl 5 V, having am amino acid sequence as set forth in SEQ ID NO: 5 and AtROPIl containing the point mutation Gl 7 V, having an amino acid sequence as set forth in SEQ ID NO: 6 or an ortholog thereof Any method as is well known in the art can be used for genetically modifying a plant to express constitutive active GTPase.

According to certain embodiments, the genetically modified plant is a transgenic plant comprising at least one cell transformed with a polynucleotide encoding ROP GTPase mutant. According to one embodiment, the polynucleotide comprises a nucleic acid sequence at least 70% homologous, at least 75% homologous, at least 80% homologous, at least 85% homologous, at least 90%, or at least 95% or more homologous to any one of SEQ ID NO:3 and SEQ ID NO:4 (corresponding to wild type AtROPό and AtROPl 1). According to another embodiment, the polynucleotide encodes a ROP GTPase containing at least one point mutation selected from the group consisting of G15Vor Gl 7V, Q64L or Q66L and combinations thereof. According to typical embodiments, the polynucleotide encodes a ROP GTPase mutant having an amino acid sequence as set forth in any one of SEQ ID NO:5 and SEQ ID NO:6. According to other typical embodiments, the polynucleotide comprises a nucleic acid sequence as set forth in any one of SEQ ID NO:7 and SEQ ID NO:8. It is to be understood that the origin of the polynucleotide encoding a constitutively active GTPase mutant can be endogenous (i.e. from the same plant species) as well as exogenous (i.e. from a non-plant or a different plant species) wild type polynucleotide.

Without wishing to be bound by any specific theory or mechanism of action, expression of constitutive active GTP-non hydrolyzing form may be achieved via modifying the expression of ROP regulating proteins. According to some embodiments, the activity of at least one GTPase activating protein (GAP) in the plant is inhibited, such that said plant expresses constitutive active ROP. According to other embodiments, the expression of at least one Rho GDP Dissociation Inhibitors (RhoGDI) is modulated such that constitutive active ROP is expressed. According to yet other embodiments, overexpression of Guanyl nucleotide Exchange Factor (GEF), particularly ROP:GEF facilitates constitutive activation of ROP. According to other embodiments, the present invention provides a genetically modified plant in which the expression or function of at least one endogenous ROP is inhibited, characterized by increased lignin content.

According to certain embodiments, the present invention provides a genetically modified plant comprising at least one cell expressing micro RNA (miR) designed to silence at least one ROP gene, wherein the genetically modified plant is characterized by increased lignin content compared to a corresponding unmodified plant. According to one embodiment, the ROP gene comprises a nucleic acids sequence set for in SEQ ID N0:13. According to typical embodiments, the genetically modified plant is a transgenic plant comprising at least one cell transformed with a polynucleotide comprising miR having the nucleic acid sequence set forth in SEQ ID NO: 14.

According to other embodiments, the present invention provides a genetically modified plant comprising at least one cell expressing a dominant negative small GTPase mutant, wherein the genetically modified plant is characterized by increased lignin content compared to a corresponding unmodified plant. Any mutation and mutation number which would result in a dominant negative GTPase form can be employed according to the teachings of the present invention. According to typical embodiments, the dominant negative mutant comprises at least one point mutation selected from the group consisting of threonine (T) to asparagine (N), aspartic acid (D) to alanine (A) and a combination thereof. According to additional typical embodiments, the GTPase is a plant ROP GTPase and the point mutation is threonine at position 20, 22 Or 32 to asparagine (denoted T20N, T22N and T32N, respectively) and/or aspartic acid at position 121 to alanine (denoted D 121A). According to one embodiment, the dominant negative ROP mutant is AtROPl 1 containing the point mutation T22N having the amino acid sequence as set forth in SEQ ID NO: 15 or an ortholog thereof.

Genetically modified plant expressing a dominant negative ROP may be produced by any method as is known to a person skilled in the art. According to certain embodiments, the genetically modified plant is a transgenic plant comprising at least one cell transformed with a polynucleotide encoding ROPIl mutant having an amino acid sequence as set forth in SEQ ID NO: 15, wherein the transgenic plant is characterized by increased lignin content compared to a non-transgenic plant. According to one embodiment, the polynucleotide has the nucleic acid sequence set forth in SEQ ID NO: 16.

The origin of the polynucleotide encoding a dominant negative GTPase mutant can be endogenous (i.e. from the same plant species) as well as exogenous (i.e. from a non-plant or a different plant species) wild type polynucleotide.

Without wishing to be bound by any specific theory or mechanism of action, the increase in lignin content may be due to inhibition of the activation and function of additional ROP proteins other then ROPI l. The threonine to asparagine and aspartic acid to alanine mutations are known to reduce the affinity of small G-proteins to guanyl nucleotide, particularly to GTP. This change inhibits the dissociation of the ROP from its Guanyl nucleotide Exchange Factor (GEF). The inhibition of dissociation sequesters ROP:GEFS leads to inhibition of the activation and function of other ROP proteins.

Any vascular plant may be modified according to the teachings of the present invention, including monocots, dicots, gymnosperms, ferns and mosses. According to certain embodiments, the plant is selected from the group consisting of Tobacco

(Nicotiand), Aspen (Populus), Alfalfa (Medicago sativa), Switchgrass (Panicum virgatum), Misacantum and Kenaf (Hibiscus cannahinus).

According to some embodiments, the polynucleotides of the present invention are incorporated in a DNA construct enabling their expression in the plant cell. According to one embodiment, the DNA construct comprises at least one expression regulating element selected from the group consisting of a promoter, an enhancer, an origin of replication, a transcription termination sequence, a polyadenylation signal and the like.

According to certain embodiments, the DNA construct comprises a promoter. The promoter can be constitutive, induced or tissue specific promoter as is known in the art. According to certain embodiments, the promoter is a tissue specific promoter operable in a plant cell. According to typical embodiment, the promoter is a tissue-specific promoter selected from the group consisting of stem- and vascular tissue-specific promoter. According to other typical embodiments, the promoter is inducible promoter. According to certain embodiments, the inducible promoter is selected from the group consisting heat shock induced, glucocorticoid induced and alcohol induced promoters. According to other embodiments, the DNA construct further comprises transcription termination and polyadenylation sequence signals. Optionally, the DNA construct further comprises a selectable marker, enabling a convenient selection of the transformed cell/plant. Additionally or alternatively, a reporter gene can be incorporated into the construct, as to enable selection of transformed cells or plants expressing the reporter gene. According to one embodiment, the selection marker is a gene inducing antibiotic resistance within the plant. According to typical embodiments, the gene is neomycin phosphor-transferase, conferring resistance to kanamycin. According to another embodiment, the selection marker is a gene conferring herbicide resistance to the plant. According to typical embodiments, the gene is the Bar gene, conferring resistance to the herbicide BASTA. According to yet other embodiments, the selection is performed using a reporter gene selected from the group consisting of β-Glucoronidase (GUS) and GFP variants, typically YFP. According to typical embodiments, the reporter gene is YFP-ER (GFP-ER)₅ which retains the reporter in the endoplasmic reticulum (ER) thus preventing intercellular movement. The polynucleotides of the present invention and/or the DNA constructs comprising same can be incorporated into a plant transformation vector.

The present invention also encompasses seeds of the transgenic plant. According to certain embodiments, plants grown from the seeds comprise at least one cell transformed with a polynucleotide encoding ROP GTPase mutant. According to one embodiment, the ROP GTPase mutant is constitutive active mutant thereby the plants are characterized by reduced lignifϊcation compared to a corresponding unmodified plant. According to another embodiment, the ROP GTPase mutant is dominant negative mutant, thereby the plants are characterized by increased lignifϊcation compared to a corresponding unmodified plant. According to other embodiments, plant grown from the seeds comprise at least one cell expressing miR targeted to at least one ROP gene, thereby the plants are characterized by increased lignification compared to a corresponding unmodified plant.

The present invention further encompasses fruit, leaves or any part of the transgenic plant, as well as tissue cultures derived thereof and plants regenerated therefrom.

The present invention also relates to methods of producing the genetically modified plants of the invention, characterized by reduced or increased lignification compared to a corresponding unmodified plant.

According to certain aspects, the plant is genetically modified by mutating at least one endogenous signaling small GTPase, particularly ROP GTPase. According to certain embodiments, the mutated ROP is a constitutive active mutant. According to other embodiments, the mutated ROP is a dominant negative mutant. Endogenous mutations can be induced by any method as is known to a person skilled in the art (see for example, Weigel D and Glazebrook, J 2002 Arabidopsis a Laboratory Manual, Cold Spring Harbor Laboratory Press, NY).

According to other aspects, the genetically modified plant is a transgenic plant. According to these aspects of the invention, the present invention provides a method of producing a transgenic plant characterized in increased lignin content comprising (a) transforming a plant cell with a polynucleotide encoding a constitutive active signaling small GTPase mutant; and (b) regenerating the transformed cell into a plant characterized by reduced lignification as compared to a corresponding non- transgenic plant.

The present invention further provides a method of producing a transgenic plant characterized by increased lignin content comprising (a) transforming a plant cell with a polynucleotide encoding micro RNA targeted to silence at least one endogenous ROP gene; and (b) regenerating the transformed cell into a plant characterized by increased lignification as compared to a corresponding non- transgenic plant. According to certain typical embodiments, the micro RNA is a synthetic micro RNA.

Alternative method of producing a transgenic plant characterized by increased lignin content comprises (a) transforming a plant cell with a polynucleotide encoding a dominant negative small GTPase mutant; and (b) regenerating the transformed cell into a plant characterized by increased lignification as compared to a corresponding non- transgenic plant.

The polynucleotide(s) encoding constitutive active GTPase mutant, dominant negative GTPase mutant or micro RNA according to the teachings of the present invention can be introduced into a DNA construct to include the entire elements necessary for transcription and translation as described above, such that the polypeptides are expressed within the plant cell.

Transformation of plants with a DNA construct may be performed by various means, as is known to one skilled in the art. Common methods are exemplified by, but are not restricted to, Agrobacterium-mQdiatQd transformation, microprojectile bombardment, pollen mediated transfer, plant RNA virus mediated transformation, liposome mediated transformation, direct gene transfer (e.g. by microinjection) and electroporation of compact embryogenic calli. According to one embodiment, the transgenic plants of the present invention are produced using Agrobacterium mediated transformation.

Transgenic plants comprising the construct of the present invention may be selected employing standard methods of molecular genetics, as are known to a person of ordinary skill in the art. According to one embodiment, the transgenic plants are selected according to their resistance to an antibiotic. Additionally or alternatively, the transgenic plant of the present invention can be selected according to the lignin content found in the plant tissues

According to another aspect the present invention relates to the transgenic plants generated by the methods of the present invention as well as to their seeds, fruits, roots and other organs or isolated parts thereof.

According to yet further aspect, the present invention provides a method of conferring to a plant reduced lignin production, comprising administering to the plant a compound capable of activating in said plant at least one signaling small GTPase to a constitutive active form.

According to certain embodiments, the compound is selected from the group consisting of non-hydrolysable GTP analog and GDP. According to one embodiment, the non-hydrolysable GTP analog is selected from the group consisting of GTPγS, GTPaS, GpCpp, GppCp and GppNHp. It is to be understood explicitly that the scope of the present invention encompasses homologues, analogs, variants and derivatives, including shorter and longer polypeptides, proteins and polynucleotides, as well as polypeptide, protein and polynucleotide analogs with one or more amino acid or nucleic acid substitution, as well as amino acid or nucleic acid derivatives, non-natural amino or nucleic acids and synthetic amino or nucleic acids as are known in the art, with the stipulation that these variants and modifications must preserve the constitutive active GTP non-hydrolyzing activity of GTPase or the dominant negative activity of the GTPase, such that the genetically modified plants are characterized by reduced or increased lignification, respectively. Specifically, any active fragments of the polypeptide or protein as well as extensions, conjugates and mixtures are disclosed according to the principles of the present invention. Other objects, features and advantages of the present invention will become clear from the following description and drawings.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows phenotype of wild type plant (FIG. IA) and constitutive active ROP (35S::GFP-Atrop^^A) transgenic plant (FIG. IB).

FIG. 2 shows phenotype of wild type plant (FIG. 2A) and constitutive active ROP (35S::Atropll^CA) transgenic plant (FIG. 2B).

FIG. 3 shows a comparison of stem cross-sections of wild type (CoI-O) and constitutive active ROP transgenic (Atrop(f^A) plants. FIG. 3A and 3C: Cross sections in CoI-O stems. FIG. 3B and 3D: Cross sections through 35S::GFP:Atrop^^A stems. Sections were stained with fast green to stain cellulose and safranin to stain lignin. Vascular bundles of the Atrop(f^A plants are narrower (FIG. 3B) compared to CoI-O plants (FIG.3A). Strong safranin (black line) staining of lignin was observed in CoI-O metaxylem (MX) and beginnings of lignification in secondary xylem cells were observed (FIG. 3C). Ln comparison, weak safranin staining (gray line) was observed in Atrop(f^A metaxylem cells (FIG. 3D). MX: Metaxylem; SX: Secondary xylem; C: vascular cambium; P: Phloem. Bars are 100 μm in FIG. 3A and 3B; 20 μm in FIG. 3C and 3D.

FIG. 4 shows stem cross-sections of wild type and constitutive active ROP 35S::GFP- Atropll^CA plants. Cross-sections in the inflorescence stem of wild type (FIG. 4A and

4C) and 35S::GFP-Atropll^CA (FIG. 4B and 4D). x: xylem; p - phloem; vb - vascular bundle; ic - interfasicular cells. Scale bars 50μM in FIG. 4A and 4B and 20μM, in FIG.

4C and 4D. Lignin staining is represented by black line.

FIG. 5 shows sequence alignment of all Arabidopsis ROPs (taken from: Lavy et al. 2002, ibid).

FIG. 6 demonstrates silencing of six ROP genes as a result of a pan-ROP-miR expression. FIG. 6A shows the ROP target sequence of the pan-ROP-miR and in the context of the miR 164b template (grey letters). FIG. 6B shows relative expression levels of 6 ROP genes in the pan-ROP-miR plants. The expression of each ROP gene is compared to its level in WT (CoI-O) plants which was taken as 1. The results represent an average of 5 technical replicates. Bars are SE. A total of 3 independent pan-ROP- miR lines were analyzed and three biological replicates were carried out on each line.

FlG. 7 shows stem cross sections of wild type (CoI-O, FIG. 7A)₅ ROP silenced (pan- ROP-miR, FIG. 7B) and dominant negative mutant (ropll^DN, FIG. 7C) plants. FIG. 7D-F show corresponding cross-sections of individual vascular bundles differentially stained with safranin and fast green. AU sections were taken 0.5 cm above stem base of 5-weeks old plants. All the plants flowered at the same time and thus the stems are of the same age. Bars are 200 μ A-C and 50 μ D-F.

DETAILED DESCRIPTION OF THE INVENTION

The present invention discloses plants genetically modified to obtain reduced or increased lignin content. Particularly, the present invention provides plants selected from the group consisting of plants in which the expression of at least one signaling small GTPase is modified to constitutive active expression, thereby the plants have reduced lignin content; plants in which the expression of at least one signaling small GTPase is modified to dominant negative expression, thereby the plants have reduced lignin content; and plants in which at least one signaling small GTPase gene is silenced, such pants also have reduced lignin content.

The present invention makes a significant contribution to the art by providing genetically modified plants with reduced or increased lignin content and normal growth habit as compared to a corresponding unmodified plant. Plants with reduced lignifications are highly desired as animal feed, for the paper industry and as a source for non-polluting energy. Plants with increased lignin content are highly desired in the wood industry. Increased lignin content is also significant in protecting plants from external aggravations, including extreme temperatures, drought, and pathogens.

Definitions As used herein the term "lignin" refers to amorphous heteropolymers that are produced by the oxidative coupling of three cinnamyl alcohols, p-coumaryl, coniferyl, and sinapyl alcohol, producing, respectively, H (hydroxyphenyl), G (guaiacyl) and S (syringyl) units in the lignin polymer The three cinnamyl alcohols are oxidatively coupled to form a hydrophobic network of phenylpropanoid units. Phenylpropane units are interconnected in lignins by a series of ether and carbon-carbon linkages, in various bonding patterns, leading to several main substructures; guaiacylglycerol-β-aryl-ether, phenylcoumaran, diarylpropane, resinol, biphenyl, and diphenyl ether. Lignin exhibits a high degree of structural variability, which is dependent upon the species of origin and the tissue and cell types. This heterogeneity is principally reflected in the relative proportion of the three constituent monomers, the different types of inter-unit linkages and the occurrence of non-conventional phenolic units within the polymer. Distinctive variation in lignin content is found between the gymnosperms and angiosperms. In gymnosperms, lignins are typically composed of G units with a minor proportion of H units, while in angiosperms lignin is mainly composed of G-S units.

As used herein, the term "lignifϊcation" refers to an increase in the amount of a polymer containing one or more of the H (hydroxyphenyl), G (guaiacyl) or S (syringyl) units. The H- G- and S-units can be coupled by an ether, carbon-carbon, or other linkage; can be linear or branched; and can vary in the extent of their methylation. In addition, the term "lignification," as used herein, refers to the presence of relatively small lignins such as lignans and neolignans, which are products that generally result from the oxidative coupling of two cinnamyl alcohols (or cinnamic acids) although other oligomeric forms can exist. Lignans are phenylpropanoid units interconnected via β-β-carbon-carbon linkages and, in this bonding pattern, differ from neolignans, which are interconnected via linkages other than β-β-linkages. Thus, the term "lignification" is used herein to refer to the presence of naturally occurring and non-naturally occurring lignins as well as lignans, neo-lignans and other lignin-like compounds. The term "reduced," as used herein in reference to reduced lignin content or reduced lignification in a genetically modified plant of the invention, means a significantly decreased extent of lignification in one or more tissues as compared to the extent of lignification in a corresponding wild type, unmodified plant. Thus, the term "reduced" is used broadly to encompass both lignifϊcation that is significantly reduced as compared to the lignification in a corresponding unmodified plant as well as the absence of lignification. The term "reduced" also encompasses lignification that is significantly decreased in one or more tissues while wild type levels of lignification persist elsewhere in the plant. One skilled in the art understands that the term "reduced" refers to a steady state level of lignification and encompasses both decreased synthesis or polymerization and increased degradation of lignins. Natural variation in the extent of lignin content within a particular plant species or variety is well recognized to the skilled artisan. However, "reduced" lignin content in a genetically modified plant of the invention readily can be identified by sampling a population of the modified plants and determining that the extent of lignification is significantly decreased, on average, as compared to the normal distribution of lignification in a population of the corresponding wild type plant species or variety.

The term "increased," as used herein in reference to increased lignin content or increased lignification in a genetically modified plant of the invention, means a significantly increased extent of lignification in one or more tissues as compared to the extent of lignification in a corresponding wild type, unmodified plant. Thus, the term "increased" is used broadly to encompass both lignification that is significantly elevated as compared to the lignification in a corresponding unmodified. The term "increased" also encompasses lignification that is significantly increased in one or more tissues while wild type levels of lignification persist elsewhere in the plant. One skilled in the art understands that the term "increased" refers to a steady state level of lignification and encompasses both increased synthesis or polymerization and decreased degradation of lignins. Natural variation in the extent of lignin content within a particular plant species or variety is well recognized to the skilled artisan. However, "increased" lignin content in a genetically modified plant of the invention readily can be identified by sampling a population of the modified plants and determining that the extent of lignification is significantly increased, on average, as compared to the normal distribution of lignification in a population of the corresponding wild type plant species or variety. Determining the extent of ligniiϊcations may be performed by any method as is known to a person skilled in the art. According to certain embodiments, significant increase or reduction in lignin content refers to at least 5% increased/decreased lignin content in genetically modified plant compared to corresponding unmodified plant.

As used herein, the term "signaling small GTPase" refers to small (20-25 kDa) protein that binds and hydrolyzes guanosine triphosphate (GTP). GTPases cycle between two conformations - an activated or inactivated form. Small GTPases serve as molecular switches for a wide variety of signal pathways, regulating a wide variety of process in the cell including growth, cellular differentiation, cell movement and lipid vesicle transport. Small GTPases include large number of proteins, divided to families and sub-families according to their structure, sequence and function, including Ras, Rho, Rab, Rap, Arf, Ran, Rheb, Rad and Rit. The terms "ROP" and RAC" are used herein interchangeably and refer to plant-unique sub-family of the Rho GTPase. In Arabidopsis, ROPs/RACs were divided into either two groups designated type-I and type-II or into four groups designated I, II, III and IV, based upon their sequences. As used herein, the terms "ROP" and RAC" refer to any plant GTPase, regardless to its origin or classification, unless otherwise is specifically indicated.

As used herein, the term "Constitutive active" GTPase refers to GTP non- hydrolyzing form of the protein that is kept in its active conformation.

As used herein, the term "dominant negative" GTPase refers to either nucleotide- free or GDP bound forms of the protein that irreversibly bind GEFs.

As used herein, the term "genetically modified plant" refers to a plant comprising at least one cell genetically modified by man. The genetic modification includes modification of an endogenous gene(s), for example by introducing mutation(s) deletions, insertions, transposable element(s) and the like into an endogenous polynucleotide or gene of interest. Additionally or alternatively, the genetic modification includes transforming the plant cell with heterologous polynucleotide.

The terms "transformants" or "transformed cells" include the primary transformed cell and cultures derived from that cell without regard to the number of transfers. All progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same functionality as screened for in the originally transformed cell are included in the definition of transformants.

Transformation of a cell may be stable or transient. The term "transient transformation" or "transiently transformed" refers to the introduction of one or more exogenous polynucleotides into a cell in the absence of integration of the exogenous polynucleotide into the host cell's genome. Transient transformation may be detected by, for example, enzyme-linked immunosorbent assay (ELISA), which detects the presence of a polypeptide encoded by one or more of the exogenous polynucleotides. Alternatively, transient transformation may be detected by detecting the activity of the protein (e.g. β-glucuronidase) encoded by the exogenous polynucleotide. PCR, RT-PCR and protein immunoblot can also be used. The term "transient transformant" refers to a cell which has transiently incorporated one or more exogenous polynucleotides. In contrast, the term "stable transformation" or "stably transformed" refers to the introduction and integration of one or more exogenous polynucleotides into the genome of a cell. Stable transformation of a cell may be detected by Southern blot hybridization of genomic DNA of the cell with nucleic acid sequences which are capable of binding to one or more of the exogenous polynucleotides. Identification of plant harboring the transformed polynucleotide can be also performed by employing PCR techniques, using transgene-specifϊc oligonucleotide primers. Alternatively, stable transformation of a cell may also be detected by enzyme activity of an integrated gene in growing tissue or by the polymerase chain reaction of genomic DNA of the cell to amplify exogenous polynucleotide sequences. The term "stable transformant" refers to a cell which has stably integrated one or more exogenous polynucleotides into the genomic or organellar DNA (chloroplast and/or mitochondria). It is to be understood that a plant or a plant cell transformed with the nucleic acids, constructs and/or vectors of the present invention can be transiently as well as stably transformed.

The term "transgenic" when used in reference to a plant or seed (i.e., a "transgenic plant" or a "transgenic seed") refers to a plant or seed that contains at least one heterologous gene in one or more of its cells. The term "transgenic plant material" refers broadly to a plant, a plant structure, a plant tissue, a plant seed or a plant cell that contains at least one heterologous gene in at least one of its cells.

The terms "heterologous gene" or "exogenous genes" refer to a gene encoding a factor that is not in its natural environment (i.e., has been altered by the hand of man). For example, a heterologous gene includes a gene from one species introduced into another species. A heterologous gene also includes a gene native to an organism that has been altered in some way (e. g., mutated, added in multiple copies, linked to a non- native promoter or enhancer sequence, etc.). Heterologous genes may comprise plant gene sequences that comprise cDNA forms of a plant gene; the cDNA sequences may be expressed in either a sense (to produce mRNA) or anti-sense orientation (to produce an anti-sense RNA transcript that is complementary to the mRNA transcript). Heterologous plant genes or synthetic micro RNAs are distinguished from endogenous plant genes in that the heterologous or synthetic sequences are typically joined to nucleotide sequences comprising regulatory elements such as promoters that are not found naturally associated with the gene for the protein encoded by the heterologous gene or with plant gene sequences in the chromosome, or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed). A plant gene endogenous to a particular plant species (endogenous plant gene) is a gene which is naturally found in that plant species or which can be introduced in that plant species by conventional breeding.

The term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises non-coding (introns) and coding sequences (exons) necessary for the production of RNfA or a polypeptide. A polypeptide can be encoded by a full-length coding sequence or by any part thereof. The term "parts thereof when used in reference to a gene refers to fragments of that gene, particularly fragment encoding a constitutive active GTPase or a factor regulating its expression. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, "a nucleic acid sequence comprising at least a part of a gene" may comprise fragments of the gene or the entire gene. The term "gene" also encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5' of the coding region and which are present on the mRNA are referred to as 5' non-translated (or untranslated) sequences (5¹ UTR). The sequences which are located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' non-translated (or untranslated) sequences (3' UTR).

The term "nucleic acid" as used herein refers to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof. The term also encompasses RNA/DNA hybrids.

The term "construct" as used herein refers to an artificially assembled or isolated nucleic acid molecule which includes the gene of interest. In general a construct may include the gene or genes of interest, a marker gene which in some cases can also be the gene of interest and appropriate regulatory sequences. It should be appreciated that the inclusion of regulatory sequences in a construct is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used. The term construct includes vectors but should not be seen as being limited thereto.

The term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation. In another example, the complementary RNA regions of the invention can be operably linked, either directly or indirectly, 5' to the target mRNA, or 3' to the target mRNA, or within the target mRNA, or a first complementary region is 5' and its complement is 3' to the target mRNA.

The terms "promoter element", "promoter" or "promoter sequence" as used herein, refer to a DNA sequence that is located at the 5' end (i.e. precedes) the protein coding region of a DNA polymer. The location of most promoters known in nature precedes the transcribed region, although transcription regulatory sequences are also found in introns. The promoter functions as a switch, activating the expression of a gene. If the gene is activated, it is said to be transcribed, or participating in transcription. Transcription involves the synthesis of mRNA from the gene. The promoter, therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the gene into mRNA. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". Promoters that derive gene expression in a specific tissue are called "tissue specific promoters. Tissue specific promoters can be expressed constitutively or their expression may require a specific induction. New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro JK and Goldberg RB 1989 In: Marcus A Ed. The Biochemistry of Plants: A comprehensive Treatise. Vol. 15 Molecular Biology Academic Press 1-82 (see also Shahmuradov, IA et al. 2003 Nucleic Acids Research 31:114-17).

As used herein, the term an "enhancer" refers to a DNA sequence which can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter.

The term "expression", as used herein, refers to the production of a functional end-product e.g., an mRNA or a protein.

The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.

The term "homology", as used herein, refers to a degree of sequence similarity in terms of shared amino acid or nucleotide sequences. There may be partial homology or complete homology (i.e., identity). For amino acid sequence homology amino acid similarity matrices may be used as are known in different bioinformatics programs (e.g. BLAST, FASTA, Smith Waterman). Different results may be obtained when performing a particular search with a different matrix. Degrees of homology for nucleotide sequences are based upon identity matches with penalties made for gaps or insertions required to optimize the alignment, as is well known in the art (e.g. Altschul SF et al., 1990, J MoI Biol 215(3): 403-10; Altschul SF et al., 1997, Nucleic Acids Res. 25: 3389-3402).

The term "ortholog" as used herein refers to a homologous sequence of another species. Orthologous genes evolved from a common ancestral gene, and normally, retain the same function in the course of evolution.

Preferred modes for carrying out the invention

The present invention now shows that modifying the expression of plants small GTPases ROP genes modulate the lignin content of the plant cells.

Unexpectedly, the present invention now shows that expression of constitutive- active GTPase mutant in a plant cell results in reduced lignin content in the plant, particularly in the vascular tissues of the plant. The present invention further shows that interrupting the normal expression or activity of ROP gene by silencing or by the expression of dominant negative mutants result in increased lignin content in the plant, particularly in its vascular tissues.

Thus, according to one aspect, the present invention provides a genetically modified plant expressing constitutive active GTP-non hydrolyzing form of a signaling small GTPase, wherein the genetically modified plant is characterized by reduced lignification compared to a corresponding unmodified plant.

According to additional aspect, the present invention provides a genetically modified plant expressing dominant negative signaling small GTPase, wherein the genetically modified plant is characterized by increased lignification compared to a corresponding unmodified plant.

According to certain embodiments, the signaling small GTPase is selected from the group consisting of non-plant Rho-GTPases and plant GTPases. According to typical embodiments, the plant GTPase is ROP (Rho Of Plants) (also referred to as RAC) GTPase.

According to typical embodiments, the Arabidopsis ROP is AtROPό having the amino acid sequence set forth in SEQ ID NO:1, encoded by a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NO:3.

According to other typical embodiments, Arabidopsis ROP is AtROPIl having the amino acid sequence set forth in SEQ ID NO:2, encoded by a polynucleotide having an amino acid sequence as set forth in SEQ ID NO: 4.

In Arabidopsis, ROPs constitute a family of 11 members. The family is divided into two major subgroups designated ROP type-I and type-II. The type-I and type-II ROPs differ in their hypervariable C-terminal ends, undergo different posttranslational modifications and are conserved in all higher plants (Lavy et al., 2002 ibid; Lavy and Yalovsky, 2006 ibid; Sorek et al., 2007 ibid). According to other nomenclature, the family is divided into four groups designated I, II, III and IV.

According to certain embodiments, the present invention provides a genetically modified plant comprising at least one cell expressing constitutive active GTP-non hydrolyzing mutant of a small signaling GTPase, wherein the plant is characterized by reduced lignin content. A constitutive-active (CA) mutant of Arabidopsis ROP type I AtROP(f^A was expressed in transgenic Arabidopsis plants. As a result, significant reduction in lignin levels in the xylem was observed (Figure 3). Comparison between transgenic and wild type untransformed plants showed that growth of the AtROP6°^A transgenic plants was not affected (Figure 1).

To examine whether type-II ROPs have similar effect on lignin content a constitutive active form of AtROPIl (Atropll^CA) was expressed in Arabidopsis under regulation of the 35S promoter (Figure 2). As can be seen, the growth, size and stem stature of 35S::Atropll^CA transgenic plants (Figure 2B) were unaffected compared to wild type plants (Figure 2A). Cross sections in the stems of transgenic plants of both types showed a significant reduction in the xylem lignin level compared to wild type, non-transgenic plants (Figures 3 and 4).

According to other embodiments, the present invention provides a genetically modified plant comprising at least one cell expressing dominant negative mutant of a small signaling GTPase, wherein the plant is characterized by increased lignin content.

Expression of a dominant-negative (DN) mutant of type II AtROPIl (Atropll^m) in a transgenic plant comprising a polynucleotide encoding the mutant resulted in significant increase in the stem diameter of the transgenic plant compared to a non- transgenic plant (Figure 7 A and D₅ respectively). Furthermore, cross sections in the stems of wild type and transgenic plants showed increase in the lignin content in the transgenic plant.

The comparable activity of the CA mutants originated from two different ROP families is in agreement with prior data showing that ROPs are highly conserved family of proteins throughout the plant kingdom. Therefore, ROPs of different origin may be used to produces plants with reduced or increased lignin content according to the teachings of the present invention. Namely, ROP isolated from one species, for example Arabidopsis, may be mutated and used to produce ROP^CA or ROP^DN expressing plant of a different species, for example woody plant used in the paper industry like poplar, or a plant used as an animal feed and biofuel production, e.g. alfalfa and switchgrass, respectively. Moreover, non-plant small GTPases may be also used according to the teachings of the present invention.

Constitutive active mutants of small signaling GTPase were first discovered in mammalian Ras proteins, wherein substituting the unique glycine residue at position 12 with valine prevents GTP hydrolysis, thereby maintaining the protein in a constitutive active conformation. Same effect was obtained when the unique Ras glutamine at position 61 was substituted with leucine. As in the mammalian Ras, there is only a single glycine and a single glutamine in ROP sequences. However, due to sequence variation in different ROPs from different plants species the position of the conserved glycine and glutamine residues might vary in a range of several amino acids.

The dominant negative ROPl 1 Atropl 1^DN was produced by mutating a conserved threonine residue at position 22 (T22) to asparagine (N). This mutation, as well as the mutation of aspartic acid at position 121 to alanine (D 121 A), are known to reduce the affinity of small G-proteins to guanyl nucleotide, especially to GTP. This change inhibits the dissociation of the ROP from its Guanyl nucleotide Exchange Factor (GEF).

The present invention discloses that expression of Arabidopsis ROP in which a glycine at position 15 is substituted to valine or a glutamine at position 64 is substituted to leucine results in a constitutive active non-hydrolyzing form GTPase, leading to reduction in the lignin content in the transgenic plant. The present invention further discloses that expressing of Arabidopsis ROPIl in which threonine at position 20 is replaced with asparagines or aspartic acid at position 121 is replaced with alanine (A) results in a dominant negative form of ROP, leading to enlargement of the stem diameter and an increase in the lignin content of the transgenic plant compared to the wild type plant. However, the present invention explicitly encompasses genetically modified plants expressing signaling small GTPases containing additional/different mutations, as long as the mutated protein preserves the constitutive-active or dominant negative GTPase activity. One or more point mutations can be introduced into a nucleic acid molecule encoding small GTPase, particularly ROP (RAC) GTPase, to yield a modified nucleic acid molecule using, for example, site-directed mutagenesis (see, e.g. Wu Ed., 1993 Meth. In Enzymol. Vol. 217, San Diego: Academic Press; Higuchi, "Recombinant PCR" in Innis et al. Eds., 1990 PCR Protocols, San Diego: Academic Press, Inc). Such mutagenesis can be used to introduce a specific, desired amino acid insertion, deletion or substitution; alternatively, a nucleic acid sequence can be synthesized having random nucleotides at one or more predetermined positions to generate random amino acid substituting. Scanning mutagenesis also can be useful in generating a modified nucleic acid molecule encoding substantially the amino acid sequence of a ROP GTPase.

Without wishing to be bound by any specific mechanism or theory, expression of constitutive active small GTPase, particularly ROP^CA, or dominant negative small GTPase, particularly ROP^DN, may be obtained by expressing ROP mutant, or by modulating the regulation of ROP expression.

ROPs (RACs) are regulated via various routes, including ROP:GEFs, which catalyze GDP/GTP exchange; ROP:GAPs, which catalyze GTP hydrolysis; and RhoGDIs, which are likely required for ROP targeting. Modifying the ROP:GEFs by mutation resulting in an enhanced/decreased expression or activity of ROPrGEFs and thereby increasing/reducing the levels of activated ROPs. Currently, there are two known kinds of ROPrGEFs in plants: the PRONE domain ROP:GEFs and SPIKEl ROP:GEF. These and other ROPrGEFs, as well as non-plant GTPaserGEFs (for example Rho: GEFs) may be modulated, as long as the modulation results in the expression of constitutive-active or dominant negative GTPase. Particularly, the present invention makes use of the known mutations of threonine to asparagine and/or aspartic acid to alanine in ROP which result in inhibition of the dissociation of ROP from its Guanyl nucleotide Exchange Factor (GEF). The inhibition of dissociation sequesters ROPrGEFs leading to inhibition of the activation and function of other ROP proteins. The position of theronine in ROP varies in different ROPs. hi R0P8 threonine is in position 32. In ROPlO and ROPl 1 threonine is in position 22 and in all the other ROPs in position 20.

Down-regulation of ROPrGAPs should increase the levels of activated ROPs, while up-regulation of ROPrGAPs activity should result in inhibition of ROP activation Down regulation could be achieved for example by expressing a non-active mutant of ROPrGAP or by silencing the encoding gene via RNAi, antisense, microRNAs or oligonucleotide expression. Plants have conserve ROPrGAPs. Mutant, Antisense RNA, RNAi or microRNA can be used to down regulate the expression of ROPrGAPs thereby increasing the level of constitutive active GTPases. On the other hand, up-regulation of ROPrGAPs may be achieved by overexpression of the encoding genes, thereby inhibiting GTPase activity according to the teachings of the present invention.

Either enhancing or decreasing RhoGDI expression or activity would result in increased levels of constitutive active ROPs, leading to reduction in the lignin content. As is known to a person skilled in the art and as described hereinabove, modulation of RhoGDI expression can be obtained by various routs, all of which are encompassed within the teachings of the present invention. According to yet further aspect, the present invention provides a genetically modified plant comprising at least one cell expressing micro RNA (miR) designed to silence at least one ROP gene, wherein the genetically modified plant is characterized by increased lignin content compared to a corresponding unmodified plant. According to certain embodiments, the miR is targeted to a consensus sequence shared by all ROP genes, having the nucleic acid sequence as set forth in SEQ ID NO: 13.

The present invention now shows that silencing at least part of the ROP genes results in increased stem diameter, larger vascular bundles and increased lignin content (Figure 7B and E), the same phenomena shown by the expression of a dominant negative form of ROP. These results substantiate the finding that ROPs are involved in the regulation of lignin content in vascular plants, such that the lignin content can be manipulated by regulating ROP gene expression and by expression of certain ROP mutant as disclosed herein.

Producing the genetically modified plants

Cloning of a polynucleotide encoding constitutive active or dominant negative GTPase mutants, or rop miR can be performed by any method as is known to a person skilled in the art. Various DNA constructs may be used to express the mutant in a desired plant.

The present invention provides a DNA construct or an expression vector comprising a polynucleotide encoding a small GTPase mutant, particularly ROP mutant, which may further comprise a plant promoter.

A number of promoters which are active in plant cells have been described in the literature. These include the nopaline synthase (NOS) promoter (Ebert PR et al., Proc. Natl. Acad. Sci. U.S.A. 84:5745-49, 1987), the octopine synthase (OCS) promoter, the caulimovirus promoters such as the cauliflower mosaic virus (CaMV) 19S promoter (Lawton MA et al., Plant MoI Biol 9:315-24, 1987) and the CaMV 35S promoter (Odell JT et al., Nature 313:810-12, 1985), the figwort mosaic virus 35S-ρromoter; the light- inducible promoter from the small subunit of ribulose-l,5-bis-phosphate carboxylase (ssRUBISCO), the Adh promoter (Walker JC et al., 1987 Proc Natl Acad Sci USA 84:6624-28), the sucrose synthase promoter (Yang NS et al., 1990 Proc Natl Acad Sci USA. 87:4144-48), the R gene complex promoter (Chandler VL et al., 1989 The Plant Cell 1:1175-83), and the chlorophyll_αβ binding protein gene promoter, and the like. These promoters have been used to create DNA constructs which have been expressed in plants.

For the purpose of expression in certain tissues of the plant, such as the leaf, seed, root or stem, particularly in the stem, more particularly in vascular tissues, it is preferred that the promoters utilized according to the teachings of the present invention have relatively high expression in these specific tissues. For this purpose, one may choose from a number of promoters for genes with tissue- or cell-specific or enhanced expression.

The DNA constructs or vectors may also include with the coding region of interest a nucleic acid sequence that acts, in whole or in part, to terminate transcription of that region. For example, such sequences have been isolated including the Tr7 3' sequence and the NOS 3' sequence (Ingelbrecht ILW et al., 1989 The Plant Cell 1:671-

80; Bevan M, et al., 1983 Nucleic Acids Res 11:369-85), or the like.

The DNA constructs or vectors may also include a selectable marker. Selectable markers may be used to select for plants or plant cells that contain the exogenous genetic material. Examples of such include a neo gene (Potrykus I et al., 1985 MoI.

Gen. Genet 199:183-88) which codes for kanamycin resistance, such that cells/plants expressing same can grow on a kanamycin-containing medium; a bar gene which codes for bialaphos resistance; a mutant EPSP synthase gene which encodes glyphosate resistance; a nitrilase gene which confers resistance to bromoxynil (Stalker DM et al.,

1988 J Biol Chem 263:6310-14); and a methotrexate resistant DHFR gene (Thillet J et al., 1988 J Biol Chem. 263:12500-508).

Selection of transgenic plants of the invention can be also performed by screening the lignin content of the transformed plants, for example by microscopic analyses of stained tissues. Specific staining for lignin includes, for example, safranin, which stain lignified tissues in red.

The DNA construct or expression vector may also include translational enhancers. DNA constructs could contain one or more 5' non-translated leader sequences which may serve to enhance expression of the gene products from the resulting mRNA transcripts. Such sequences may be obtained from viral RNAs₅ from suitable eukaryotic genes, or from a synthetic gene sequence, and the like. The DNA constructs or vectors of the present invention can be utilized to stably or transiently transform plant cells. Li stable transformation, the nucleic acid molecule is integrated into the plant genome, and as such it represents a stable and inherited trait. In transient transformation, the nucleic acid molecule is expressed by the cell transformed but is not integrated into the genome, and as such represents a transient trait. The principal methods of the stable integration of exogenous DNA into plant genomic DNA include: (i) Agrobacterium-mediated gene transfer (see for example Klee H et al., 1987 Annu Rev Plant Physiol 38:467-86; and Gatenby AA₃ 1989 Plant Biotechnology, pp. 93-112 S Kung and C J Arntzen, Eds., Butterworth Publishers, Boston, Mass); and (ii) Direct DNA transfer including microinjection, electroporation, and microprojectile bombardment (e.g. U.S. 6,723,897 and references therein).

Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. The Agrobαcterium-vαedx^'&tQd system includes the use of plasmid vectors that contain defined DNA segments which integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobαcterium delivery system. A widely used approach is the leaf-disc procedure, which can be performed with any tissue explant that provides a good source for initiation of whole-plant differentiation. A supplementary approach employs the Agrobαcterium delivery system in combination with vacuum infiltration. The Agrobαcterium system is especially useful for in the creation of transgenic dicotyledonous plants.

In electroporation, the protoplasts are briefly exposed to a strong electric field, opening up mini-pores to allow DNA to enter. In microinjection, the DNA is mechanically injected directly into the cells using micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as gold or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues. Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.

Viruses that have been shown to be useful for the transformation of plant hosts include cauliflower mosaic virus (CaMV), tobacco mosaic virus (TMV)₃ and baculovirus (BV). Transformation of plants using plant viruses is described in, for example, Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor

Laboratory, New York, pp. 172-189.

Construction of plant RNA viruses for the introduction and expression of non- viral exogenous nucleic acid sequences in plants is known in the art and demonstrated by the above references as well as by Dawson WO et al., 1989 Virology 172:285-92.

If the transforming virus is a DNA virus, one skilled in the art may make suitable modifications to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of the DNA will produce the coat protein, which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the plant genetic constructs. The RNA virus is then transcribed from the viral sequence of the plasmid, followed by translation of the viral genes to produce the coat proteins which encapsidate the viral RNA.

Transformation of plant protoplasts has been reported using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see, for example, Marcotte WR et al., Nature 335:454-57, 1988).

The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art. This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil. Following stable transformation, plant propagation then occurs. The most common method of plant propagation is by seed. The disadvantage of regeneration by seed propagation, however, is the lack of uniformity in the crop due to heterozygosity, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. In other words, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the regeneration be effected such that the regenerated plant has identical traits and characteristics to those of the parent transgenic plant. The preferred method of regenerating a transformed plant is by micropropagation, which provides a rapid, consistent reproduction of the transformed plants.

Micropropagation is a process of growing second-generation plants from a single tissue sample excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue and expressing the desired trait. The newly generated plants are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows for mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars with preservation of the characteristics of the original transgenic or transformed plant. The advantages of this method of plant cloning include the speed of plant multiplication and the quality and uniformity of the plants produced. Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages. The micropropagation process involves four basic stages: stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, the tissue culture is established and certified contaminant-free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the newly grown tissue samples are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that they can continue to grow in the natural environment.

Additionally or alternatively, since the transgenic plants regenerated from tissue culture ("T₀" generation) are usually heterozygous for the desired trait, the plants are selfed and their progeny ("T₁" generation) is tested for homozygosity. Production of homozygous plants that do not segregate for the desired trait or gene, may requires 2-4 cycles of progeny selling.

As non-limiting examples, the present invention discloses the production of transgenic Arabidopsis plants expressing constitutive active mutant of ROP GTPase, particularly AtROP6^CA and AtROPl 1^CA, having a reduced content of lignin in their vascular tissues; and production of transgenic Arabidopsis plants, expressing dominant negative mutant of ROP GTPase, particularly AtROPl 1^DN having a increased content of lignin in their vascular tissues. The plants of the invention can be also produced by modifying endogenous genes expressing or regulating the expression of ROPs. Certain plant species, for example Maize (corn) or snapdragon have natural transposons. These transposons are either autonomous, i.e. the transposas is located within the transposon sequence or non- autonomous, without a transposas. A skilled person can cause transposons to "jump" and create mutations. Additional methods relays on introgression of genes form natural populations. Cultured and wild types species are crossed repetitively such that a plant comprising a given segment of the wild genome is isolated. There are also methods to select out a transgene while leaving a foot print in the insertion site. These methods usually relay on site specific recombination systems such as the phage Crellox (introducing lox site in a transgene and then excising out the insert between the lox sites by crossing with a plant expressing Cre or by inducing Cre expression). Alternatively, chemical mutagenesis using an agent such as Ethyl Methyl Sulfonate (EMS) can be employed to obtain a population of point mutations and screen for mutants of the ROP genes that may become constitutive active, dominant negative or null. Alteration of small GTPase expression can be also achieved by gene silencing utilizing any method known in the art, including, but not limited to, sense suppression/co suppression, antisense suppression, double-stranded RNA (dsRNA) interference, hairpin RNA interference and intron-containing hairpin RNA interference, amplicon-mediated interference, ribozymes, and small interfering RNA (RNAi) or natural or synthetic micro RNA (miR). Posttranscriptional gene silencing is brought about by a sequence-specific RNA degradation process that results in the rapid degradation of transcripts of sequence-related genes. Studies have provided evidence that double-stranded RNA may act as a mediator of sequence-specific gene silencing (see, e.g., review by Montgomery MK and Fire F, Trends in Genetics, 1998 14: 255- 258). Gene constructs that produce transcripts with self-complementary regions are particularly efficient at gene silencing. A unique feature of this posttranscriptional gene silencing pathway is that silencing is not limited to the cells where it is initiated. The gene-silencing effects may be disseminated to other parts of an organism and even transmitted through the germ line to several generations.

In some embodiments of the invention, as a further non-limiting example, inhibition of a ROP gene expression is obtained by RNA interference, particularly by synthetic micro RNA (miR). miRs are regulatory agents consisting of about 22 ribonucleotides, which are highly efficient at inhibiting the expression of endogenous genes (see, for example Javier FP et al., 2003 Nature 425: 257-263). According to typical embodiments, an expression cassette is designed to express an RNA molecule that is modeled on an endogenous Arabidopsis miR gene. Particularly a pre-miR sequence contains approximately 150 nucleotides is designed within Arabidopsis miR 164b. Once inserted into the cells the pre-miR is cleaved by the DICER to form the miRs that will eventually hybridize with endogenous RNAs and these duplexes are then digested by the RISC complex. The synthetic miR gene encodes an RNA that forms a hairpin structure containing a 21 -nucleotide sequence that is complementary to a ROP consensus sequence comprising 21 nucleotides (SEQ ID NO: 13).

The following non-limiting examples hereinbelow describe the means and methods for producing the transgenic plants of the present invention. Unless stated otherwise in the Examples, all recombinant DNA and RNA techniques, as well as horticultural methods, are carried out according to standard protocols as known to a person with an ordinary skill in the art.

EXAMPLES Materials and Methods

Mutagenesis A constitutively active mutant version of AtROPIl (AtropllCA) and AtROP6

(AtropόCA) was created by substituting glycine at position 15 with valine (QuikChange kit; Stratagene, La Jolla, CA). Reactions were carried out on pSYl 19 plasmid and pSY811 respectively by using the following primers:

Atropll^CA:

SYPSOO-GTGTGACTGTTGGTGATGTTGCTGTTGGTAAAACCTG (SEQ ID NO:9);

SYPSOl-CAGGTTTTACCAACAGCAACATCACCAACAGTCACAC (SEQ ID NO: 10).

Atrop6^CA:

SYPl89- CACTGTCGGCGACGTTGCTGTTGGAAAGAC (SEQ ID NO:11) SYP190- GTCTTTCCAACAGCAACGTCGCCGACAGTG (SEQ IDNO:12)

The dominant negative ROPl 1 Atropl 1^DN was produced by mutating a conserved threonine residue at position 20 (T20) to asparagine (N).

Plasmid pSYl 19 was used as template with primers SYP502 and SYP503:

SYP502: GATGGTGCTGTTGGTAAAAACTGTATGCTCATCTGC (SEQ ID NO:17)

SYP 503: GCAGATGAGCATACAGTTTTTACCAACAGCACCATC (SEQ ID NO:18)

Plasmid Construction

The mutated plasmids Atropl 1^CA, Atrop6^CΛ and Atropl 1^DN were designated pSY507, ρSY812 and pSY508, respectively. For expression in plants, ρSY507, pSY812 and pSY508 were digested with HindΩl to isolate a cassette comprised of the 35S promoter of Cauliflower mosaic virus (CaMV), Atropl 1^CA, Atrop6^CA or Atropl 1^DN fused to the 3' end of green fluorescent protein (GFP), and the nitric-oxide synthase

(NOS) transcriptional terminator. This cassette was sub-cloned into pCAMBIA3300 (GAMBIA) to obtain pSY509, pSY814 and pSY510, respectively.

Silencing of multiple ROP genes bv a synthetic miR

Multiple sequence alignment was used to select a short sequence of 21 nucleotides specific to most ROP genes in Arabidopsis. This sequence was inserted into a template of Hhe Arabidopsis miR 164b to create a.pre-pan-ROP-miR (Figure 6A). The pan-ROP- miR was transformed into Arabidopsis plants using Agrobacterium tumefaciens and expressed under regulation of the constitutive cauliflower mosaic virus 35 S promoter.

Plant transformation

Wild-type CoI-O Arabidopsis plants were transformed using the floral dip method with Agrobacterium tumerfaciens strain GV3101/pMp90. Analysis was carried out on two independent transgenic lines for AtROPl 1^CA and AtROP6^CA that displayed the same phenotypes; on 3 independent pan-ROP-miR lines; and on 3 independent transgenic lines for AtROPl 1^DN.

Plant Growth Conditions Seeds of wild-type and transgenic Arabidopsis plants were grown on soil under long-day conditions (16-h light/8-h dark cycle) as described previously by Lavy et al. (2002, ibid). The light intensity was 100 μE m^"2 s^"1.

Tissue sectioning and staining

Tissues were fixed with alcohol 70%:acetic-acid:formaldehyde (18:1:1), dehydrated in graded ethanol series (see table 1), and embedded in paraffin blocks by using standard procedures. Embedded tissues were sectioned with a rotary microtome

(Shandon Scientific, Cheshire, England) to slices of 10^"18μm thickness. Prior to staining paraffin was removed from paraffin embedding matrix by application of xylol solvent.

Then, tissue sections were rehydrated by passing through graded alcohol series (see table 2) and stained with safranin/fast-green according to standard procedures. Safranin stains nucleus and lignified walls in red color. Fast-green stains cytoplasm and polysaccharides in blue-green color.

Table 1 : Tissue fixation schedule

Example 1: Phenotype of ROP^CA transgenic plants Comparison of wild type and transgenic plant harboring the 35S::Atop(f^A plasmid produced as described hereinabove showed that neither organ size nor organ number were changed in the transgenic plant aerial as well as root parts, indicating that size of shoot and root apical meristems have not been altered. Furthermore, stem structure and erectness were also unaffected (Figure 1). Transgenic plants harboring plasmid 35S::AtROPll^CΛ, expressing a constitutive active mutant of Arabidopsis type II ROPl 1, showed also unaffected phenotype compared to wild type plants (Figure 2).

Example 2: Lignin content of ROP^CA transgenic plants

To examine the structure of the vascular tissue and lignin content, cross-sections taken from stem of 7 weeks old 35S::rop(f^A plants, 0.5 cm above the base, were prepared (Figure 3). The cross-sections were stained with a mixture of safranin and fast green, which stain lignin in red (thick black line) and cellulose in blue-green (gray lines), respectively. The vascular bundles of the 35S::Atrop6°^A plants contained an average of 4 enlarged metaxylem cells compared to an average of 8 cells in bundles of wild type plants. Lignified metaxylem cells were visible in the vascular bundles of wild type plants (Figure 3 A and C, black line). In contrast, very little lignification of metaxylem was visible in vascular bundles of 35S::Atrop(f^A plants (Figure 3B and D). These results show that constitutive active Atrop6^CA could be used to reduce the lignin content in xylem tissue and attenuate the differentiation of the xylem. Figure 1 demonstrates that although lignin level and xylem differentiation were inhibited, the growth of the transgenic plants and erectness of the stem were not affected. To dissect the effect of Atropl l^CA on vascular differentiation in the stem, cross- sections from 7 weeks old 35S::Atropll^CA transgenic plants, taken 0.5 cm above the base of the stem, were also prepared. The cross-sections were stained with safranin/fast green, which stain lignin in red (black line) and cellulose in blue-green (gray line), respectively. In wild type Arabidopsis inflorescence stems vascular tissues are divided into strands - the vascular bundles separated by the interfascicular regions, occupied by parenchymatic ground tissues (Figure 4A). The vascular bundles are of collateral type, in which primary phloem occurs at one side of the primary xylem toward the outer surface of the stem (Figure 4C). At this developmental stage, the cell walls of parenchimatic cells in interfasicular region and in the xylem become thickened and lignified, as can be seen by the thick lines (Figure 4C). Vascular bundles of 35S::GFP- Atropll^CΛ stems were reduced compared to those of wild type (Figure 4B). The number of tracheary elements in each bundle was reduced and the cell walls thickening and lignification could not be observed in xylem and interfasicular regions (Figure 4D).

Example 3; Silencing of ROP gene expression by a synthetic pan-ROP-miR Expression of the pan-ROP-miR resulted in complete or partial silencing of six out the eleven ROP genes in Arabidopsis (Figure 6B). ROP6 and ROP7 were completely silenced. ROP2 was expressed at about 30% of its level in wild type plants. ROP3 and ROP4 were expressed at about 60% of their level in wilt type plants.

Example 4; The phenotype of the pan-ROP-miR and ROP11^PN plants Figure 7 shows cross sections of stems of 5-weeks old pan-ROP-miR and ropll^DN plants taken 0.5 cm above the base of the stem. The stem diameter of the transgenic plants significantly increased compared to the wild type (Col-0) plants. The average diameter of wild type stem was around 0.5 mm (Figure 7A). The diameter of the pan- rop-miR and ropll^DN stems was about 0.75 and 0.9 mm, respectively (Figure 7B and 7C). Examination of the vascular bundles showed that they are significantly larger in the pan-rop-miR and ropll^DN plants compared to the wild type (CoI-O) plants (Figure 7D-F). Each vascular bundle in the pan-ROP-miR and the ropll^DN plants contains more secondary xylem (SX) and phloem (Ph) cells. In the pan-rop-miR stem several layers of vascular cambium (C) were seen (Figure 7E). In both the pan-ROP-miR and the ropll^DN stems the lignin content in the xylem cells increased compared to the wild type plants, particularly in the pan-ROP-miR plants (Figure 7E). These results clearly show that lignin content in a plant can be modified by modulating the expression of ROP encoding genes.

The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.

Claims

1. A genetically modified plant having altered small GTPase expression, wherein the plant is characterized by reduced or increased lignin content compared to a corresponding unmodified plant.

2. The genetically modified plant of claim I₃ comprising at least one cell expressing constitutive active GTP-non hydrolyzing form of a signaling small GTPase, wherein the genetically modified plant is characterized by reduced lignin content compared to a corresponding unmodified plant.

3. The genetically modified plant of claim 1, comprising at least one cell expressing a dominant negative form of a signaling small GTPase, wherein the genetically modified plant is characterized by increased lignin content compared to a corresponding unmodified plant.

4. The genetically modified plant of any one of claims 2 or 3, wherein the signaling small GTPase is selected from the group consisting of non-plant Rho- GTPases and plant Rho-GTPases (ROPs).

5. The genetically modified plant of claim 4, wherein the plant GTPase is a ROP (RAC) GTPase.

6. The genetically modified plant of claim 5, wherein the ROP GTPase is Arabidopsis ROP.

7. The genetically modified plant of claim 6, wherein the Arabidopsis ROP is selected from the group consisting of AtROPβ having the amino acid sequence set forth in SEQ ID NO:1 and AtROPIl having the amino acid sequence set forth in SEQ ID NO:2.

8. The genetically modified plant of claim 2, comprising at least one cell expressing constitutive active GTP-non hydrolyzing mutant of a small signaling GTPase.

9. The genetically modified plant of claim 8, wherein the constitutive active GTPase mutant contains at least one point mutation selected from the group consisting of glycine to valine (G to V), glutamine to leucine (Q to L) and a combination thereof.

10. The genetically modified plant of claim 9, wherein the small signaling GTPase is ROP GTPase and the mutation is selected from glycine at position 15 or 17 to valine (Gl 5 V or Gl 7V), glutamine at positions 64 or 66 to leucine (Q64L or Q66L) and combinations thereof.

11. The genetically modified plant of claim 10, wherein the constitutive active GTPase mutant is any one of AtROP6^CA having the amino acid sequence set forth in SEQ ID NO: 5 and AtROPl 1^CA having the amino acid sequence as set forth in SEQ ID NO:6.

12. The genetically modified plant of claim 3, comprising at least one cell expressing dominant negative mutant of a small signaling GTPase.

13. The genetically modified plant of claim 12, wherein the dominant negative GTPase mutant contains at least one point mutation selected from the group consisting of threonine to asparagine (T to N)₅ aspartic acid to alanine (D to A) and a combination thereof.

14. The genetically modified plant of claim 13, wherein the small signaling GTPase is ROP GTPase and the mutation is selected from the group consisting of threonine at position 20, 22 or 32 to asparagines (T20N, T22N or T32N, respectively), aspartic acid at position 121 to alanine (D121A) and a combination thereof.

15. The genetically modified plant of claim 14, wherein the dominant negative GTPase mutant is AtROPl 1^DN having the amino acid sequence as set forth in SEQ ID NO: 15.

16. The genetically modified plant of any one of claims 8 or 12, comprising at least one plant cell transformed with a polynucleotide encoding ROP GTPase mutant.

17. The genetically modified plant of claim 16, wherein the polynucleotide comprises a nucleic acid sequence at least 70% homologous, at least 75% homologous, at least 80% homologous, at least 85% homologous, at least 90%, or at least 95% or more homologous to any one of SEQ ID NO:3 and SEQ ID NO:4.

18. The genetically modified plant of claim 17, wherein the polynucleotide encodes a constitutive active ROP GTPase mutant containing at least one point mutation selected from the group consisting of Gl 5 V or Gl 7V, Q64L or Q66L and combinations thereof, wherein said plant is characterized by reduced lignin content.

19. The genetically modified plant of claim 18, wherein the polynucleotide encodes a constitutive active ROP GTPase mutant having an amino acid sequence as set forth in any one of SEQ ID NO:5 and SEQ ID NO:6.

20. The genetically modified plant of claim 19, wherein the polynucleotide comprises a nucleic acid sequence as set forth in any one of SEQ ID NO:7 and SEQ ID NO:8.

21. The genetically modified plant of claim 17, wherein the polynucleotide encodes a dominant negative ROP GTPase mutant containing at least one point mutation selected from the group consisting of T20N, T22N or T32N, D121A, and a combination thereof, wherein said plant is characterized by increased lignin content.

22. The genetically modified plant of claim 21, wherein the polynucleotide encodes a dominant active ROP GTPase mutant having an amino acid sequence as set forth in SEQ ID NO: 15.

23. The genetically modified plant of claim 22, wherein the polynucleotide comprises a nucleic acid sequence as set forth in SEQ ID NO: 16.

24. The genetically modified plant of claim 5, wherein the activity of at least one GTPase activating protein (GAP) in the plant is inhibited, thereby said plant expresses constitutive active ROP.

25. The genetically modified plant of claim 5, wherein the expression of at least one Rho GDP Dissociation Inhibitors (RhoGDI) is modulated, thereby said plant expresses constitutive active ROP.

26. The genetically modified plant of claim 5, wherein Guanyl nucleotide Exchange Factor (GEF) is overexpressed, thereby said plant expresses constitutive active ROP.

27. The genetically modified plant of claim 1, wherein the small GTPase is endogenous ROP and wherein the expression of at least one ROP is inhibited, said plant is characterized by increased lignin content compared to a corresponding unmodified plant.

28. The genetically modified plant pf claim 27, wherein said plant is a transgenic plant comprising at least one cell expressing micro RNA (miR) designed to silence at least one ROP gene.

29. The genetically modified plant of claim 28, wherein the ROP gene comprises a nucleic acids sequence set for in SEQ ID NO: 13.

30. The genetically modified plant of claim 28, wherein the miR comprises a nucleic acid sequence as set forth in SEQ ID NO: 14.

31. The plant of claim 1, said plant is of a plant group selected from monocots, dicots, gymnosperms, ferns and mosses.

32. A plant seed produced by the genetically modified plant of claim 1.

33. The plant seed of claim 32, wherein said seed is used for breeding a genetically modified plant having a reduced or increased lignin content compared to an unmodified plant.

34. A tissue culture comprising at least one genetically modified cell of claim 1 or a protoplast derived therefrom.

35. The tissue culture of claim 34, wherein said tissue culture regenerates plants having reduced or increased lignin content compared to an unmodified plant.

36. A plant regenerated from the tissue culture of claim 34.

37. A method of producing a transgenic plant characterized by decreased lignin content comprising (a) transforming a plant cell with a polynucleotide encoding a constitutive active signaling small GTPase mutant; and (b) regenerating the transformed cell into a plant characterized by reduced lignin content as compared to a corresponding non-transgenic plant.

38. The method of claim 37, wherein the constitutive active GTPase mutant contains at least one point mutation selected from the group consisting of glycine to valine (G to V), glutamine to leucine (Q to L) and a combination thereof.

39. The method of claim 38, wherein the small signaling GTPase is ROP GTPase and the mutation is selected from glycine at position 15 or 17 to valine (G15V/G17V), glutamine at position 64 or 66 to leucine (Q64L/Q66L) and combinations thereof.

40. The method of claim 39, wherein the constitutive active ROP GTPase 5 mutant comprises an amino acid sequence as set forth in any one of SEQ ID

NO:5 and SEQ ID NO:6.

41. The method of claim 40, wherein the polynucleotide comprises a nucleic acid sequence as set forth in any one of SEA ID NO: 7 and SEQ ID NO:8.

42. A method of producing a transgenic plant characterized by increased 10. lignin content comprising (a) transforming a plant cell with a polynucleotide encoding a dominant negative signaling small GTPase mutant; and (b) regenerating the transformed cell into a plant characterized by increased lignin content as compared to a corresponding non-transgenic plant.

43. The method of claim 42, wherein the dominant negative GTPase mutant 15 contains at least one point mutation selected from the group consisting of threonine to asparagine (T to N), aspartic acid to alanine (D to A) and a combination thereof.

44. The method of claim 43, wherein the small signaling GTPase is ROP GTPase and the mutation is selected from the group consisting of threonine at

20 position 20, 22 or 32 to asparagine (T20N, T22N or T32N), aspartic acids at position 121 to alanine (D121A) and a combination thereof.

45. The method of claim 44, wherein the dominant negative GTPase mutant comprises an amino acid sequence as set forth in SEQ ID NO: 15.

46. The method of claim 45 wherein the polynucleotide comprises a nucleic 25 acid sequence as set forth in SEQ ID NO: 16.

47. A method of producing a transgenic plant characterized in increased lignin content comprising (a) transforming a plant cell with a polynucleotide encoding a micro RNA targeted to silence at least one endogenous ROP gene; and (b) regenerating the transformed cell into a plant characterized by

30 increased lignin content as compared to a corresponding non-transgenic plant.

48. The method of claim 47 wherein the at least one ROP gene comprises a nucleic acid sequence as set forth in SEQ ID NO: 13.

49. The method of claim 48 wherein the polynucleotide encoding the nicro RNA comprises a nucleic acid sequence as set forth in SEQ ID NO: 14.

50. The method of any one of claims 37-49, wherein the polynucleotide further comprises a regulatory element selected from the group consisting of an enhancer, a promoter, and a transcription termination sequence.

51. The method of claim 50, wherein the promoter is selected from the group consisting of a constitutive prompter, an induced promoter and a tissue-specific promoter.

52. The method of claim 51, wherein the promoter is a tissue specific promoter selected from the group consisting of stem specific promoter and vascular tissue specific promoter.

53. A plant produced by the method of any one of claims 37-49.

54. A method of conferring to a plant reduced lignin production, comprising administering to the plant a compound capable of activating in said plant at least one signaling small GTPase to a constitutive active form.

55. The method of claim 54, wherein the compound a non-hydrolyzable GTP analog.