WO2000061780A1 - Compositions and methods for extending life span - Google Patents

Abstract

Specific inhibition of EF-2 kinase results in the significant extension of life span without any adverse effects on behavior, development, and reproduction. Moreover, inhibition of this enzyme decreases the rate of aging and results in a more than two-fold increase in the sexually-active period of the life span. Inhibition of the activity of the enzyme results in increased overall protein turnover, which is positively correlated with the decrease in rate of aging and increase in life span.

Description

COMPOSITIONS AND METHODS FOR EXTENDING LIFE SPAN

This application claims priority to U.S. Provisional Application No. 60/128,397, file April 8, 1999, the entirety of which is incorporated by reference herein.

FIELD OF THE INVENTION

The present invention relates to the field of the physiology of aging and the development of compositions and methods to extend longevity. In particular, the invention relates to the manipulation of enzymes involved in regulation of protein turnover, as a means to retard the aging process and increase life span.

BACKGROUND OF THE INVENTION

Various scientific and scholarly articles are referenced (by numbers or by authors' names and dates) in parentheses throughout the specification. These articles are incorporated by reference herein to describe the state of the art to which this invention pertains. Full citations of the references appear at the end of the specification.

Accumulation of damaged cellular proteins is postulated to be a major contributor to senescent decline.¹ Decreases in both protein synthesis and degradation rates may result in the persistence of defective or modified proteins and thus the overall rate of protein turnover can affect the rate of aging. Thus, factors that regulate protein turnover are likely to be important in the regulation of aging.

The prototype member of a recently discovered class of protein kinases (the alpha-kinases, as disclosed in United States patent application serial no. 08/914,999, filed August 20, 1997, incorporated herein by reference) is elongation factor-2 kinase (EF-2 kinase). Elongation factor-2 (EF-2) is an essential factor for translation. EF-2 kinase is a ubiquitous protein kinase that can phosphorylate and inactivate EF-2. It has been postulated that EF-2 phosphorylation may be involved in the regulation of protein synthesis. However, the exact physiological role of EF-2- kinase and EF-2 phosphorylation was heretofore unknown.

SUMMARY OF THE INVENTION

In accordance with the present invention, it has now been shown for the first time that a decrease in activity of EF-2 kinase causes an increase in overall protein turnover in cells, the result being a significant extension of life span without any adverse effects on behavior, development, and reproduction. Moreover, inhibition of this enzyme and the concomitant increase in protein turnover results in a more than two-fold increase in the sexually-active period of the life span in a standard nematode animal model system. Since the same enzyme is present in all animals, including humans, it is now clearly predictable that increasing protein turnover in cells, particularly through the inhibition of this enzyme, in human and animal subjects will retard the onset of aging, prolong the life span and increase the length of the sexually active period. The discoveries made in accordance with the present invention enable a variety of useful methods, kits and pharmaceutical formulations directed to slowing the rate of aging in a subject, thereby increasing its life span, particularly the sexually active period of its life span. According to one aspect of the invention, methods are provided to increase the life span of a subject, to retard the rate of aging of the subject, and to increase the sexually active period of a subject's life span. These methods comprise increasing protein turnover in the subject, the increase in protein turnover resulting in the increase in life span of the subject. Preferably, the protein turnover in the subject is accomplished by decreasing activity of EF-2 kinase in the subject. In one embodiment, the EF-2 kinase activity is decreased by decreasing the amount of functional EF-2 kinase produced by the subject. Specifically, the amount of functional EF-2 kinase is decreased by reducing expression of a gene encoding the EF-2 kinase. Alternatively, the amount of functional EF-2 kinase is decreased by altering a gene encoding the EF-2 kinase such that the gene encodes a dysfunctional or non-functional EF-2 kinase. According to another aspect of the invention, a genetically manipulated non-human organism is provided, in which an enzyme that negatively regulates protein synthesis is dysfunctional, non- functional or absent. Preferably, the organism is a rodent or a nematode and the enzyme is EF-2 kinase. In another aspect of the invention, a genetically manipulated non-human organism that over-expresses an enzyme that negatively regulates protein synthesis is provided. Again, the preferred enzyme is EF-2 kinase and the preferred organism is a rodent or a nematode. According to another aspect of the invention, a pharmaceutical formulation for increasing the life span or retarding the aging rate of a subject is provided. The formulation comprises an agent that increases cellular protein turnover in a biologically compatible medium. Preferably, the formulation comprises an inhibitor of EF-2 activity or gene expression.

Various diagnostic and prognostic assays and kits are also provided in accordance with the present invention, as described in greater detail below. Other features and advantages of the present invention will be understood by reference to the drawings, detailed description and examples that follow.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 A. A Tel insertion disrupts the C. elegans eEF-2 kinase catalytic domain in allele ev649. Solid grey rectangles denote eEF-2 exons with length, in nucleotides, of each exon included above in parentheses; positions of introns are indicated as solid lines with nucleotide lengths in parentheses. Exon IV is included in 50% of transcripts. Both rnRNAs are trans-spliced to three SL2 variants, one of which (5'GGTTTAAAACCCAGTTACCAAG3') (SEQ ID NO:l) has not been previously described. The catalytic domain of eEF-2 kinase is highlighted, with Tel insertion site indicated.

Fig. IB. Insertion of a Tel transposon into efk-1 exon II disrupts eEF-2 kinase activity. 1. Allele efk-1 (ev640) harbors a Tel insertion 304 bp from the start codon. PCR amplification using an efk-1 -specific primer and a Tel -specific primer produces a 515 bp fragment in the efk-1 mutant (lane 2) that is absent in wild- type (lane 1). Sequence analysis positions the transposon insertion site after EFK-1 codon 101, within the catalytic domain. 2. efk-1 (ev640) is deficient for eEF-2 kinase activity. Extracts prepared from wild type N2 (lane 1), efk-1 (ev640) (lane 2), efk- l(ev640) harboring an extrachromosomal multi-copy array of the efk-1 gene (lane 3) and wild type N2 harboring an extrachromosomal multi-copy array of the efk-1 gene (lane 4) were incubated with eEF-2 protein in the presence of ³²P-ATP.

Fig. 1C. Protein synthesis rate is increased in efk-l(ev640). Protein synthesis was measured by quantitating incorporation of ³H-leucine into TCA- precipitable protein (see Methods). Protein synthesis rates are calculated by the slope of the lines. Normalized rates as compared to N2 are: N2, 1; efk-1 (ev640), 1.64. Fig. ID. Protein degradation rate is increased in efk-1 (ev640).

Wild type and efk-1 (ev640) proteins were labeled with ³H-leucine for 5 hours and then chased with cold amino acids. Counts in TCA precipitable protein were measured at times indicated.

Fig.2A. efk-l(ev640) mutants exhibit generally slowed growth and altered timing for several rhythmic behaviors, efk-1 (ev640) Ex[pCefk-l] is a transgenic line of efk-1 (ev640) harboring an extrachromosomal multi-copy array of the efk-1 gene. Behaviors were assayed on at least 50 animals with each animal scored in 5-10 trials as described (Lakowski, 1996); scores indicated ± standard deviation. Note that although average scores indicate longer development and slowed rhythmic behaviors, like other elk mutants there is considerable variation among efk- l(ev640) individuals. Total numbers of eggs laid by efk-1 (ev640) are comparable to wild type, although ev640 is fertile for 10 days whereas wild type is fertile for 8 days.

Fig.2B. Inverse relation between efk-1 gene dose and life span. Mean life span in days as calculated from three independent experiments: N2, 18±2; efk-l(ev640), 25±3; clk-l(qm30), 31±2; clk-2(qm37), 28±4; N2 Ex pCefk-l pRF4] (wild type harboring a multicopy gene array of efk-1), 13±2. Maximum life span values were: N2, 32±3; efk-1 (ev640), 37±4; clk-l(qm30), 47±3; clk-2(qm37), 39±5; N2 Ex[pCe/fc-i pRF4], 23±5. Since the efk-1 over-expression line also includes transgene pRF4 (rol-6(sul006)) as a co-transformation marker, we also assayed life span of wild type animals harboring the pRF4 transgene alone, which proved similar to wild type: N2 Ex[pRF4] mean life span is 17±3; maximum life span, 31±4. P values for mean and maximum life span were <0.05 in all cases.

Fig. 3A. Protein synthesis rates are increased in clk-1 (qm30) and age-1 (Iιx546) mutants. Protein synthesis was measured by quantitating incorporation of ³H-leucine into TCA-precipitable protein. Fig. 3B. efk-l(ev640) does not further extend life spans of long- lived age-l(hx546) and clk-l(qm30) mutants. Mean life span values in days as calculated from three independent experiments: N2, 18±2; efk-1 (ev640), 25±3; age- l(hx546), 33±3; clk-l(qm30), 30±4; age-l(hx546);efk-l(ev640) double mutant, 32±3; clk-1 (qm30)efk-l (ev640) double mutant, 31±3. Maximum life span values were: N2, 31±3; efk-l(ev640), 35±3; age-l(hx546), 48±4; clk-l(qm30), 39±4; age-1 (hx546); efk- l(ev640) double mutant, 49±4; clk-1 (qm30)eβ-l(ev640) double mutant, 38±5. P values for mean and maximum life span were <0.05 in all cases.

Fig. 3C. Life span extension conferred by efk-l(ev640) requires daf-16. Mean life span values in days as calculated from three independent experiments: N2, 18±3; efk-l(ev640), 25±4; daf-16(mgDf50), 16±3; daf-

16(mgDf50);efk-l (ev640) double mutant, 17±4. Maximum life span values were: N2, 30±3; efk-l(ev640), 38±4; daf-16(mgDf50), 26±3; daf-16(mgDf50);eβ-l(ev640) double mutant, 28±4. P values for mean and maximum life span were <0.05 in all cases. Fig. 3D. Animals starved for 24 hours show a significant decrease in eEF-2 kinase activity. Extracts were prepared from well-fed (lane 1) and 24-hour starved (lane 2) synchronized early adult cultures as described in Methods. The band corresponding to phosphorylated eEF-2 is indicated by the arrowhead.

DETAILED DESCRIPTION OF THE INVENTION I. Definitions:

Various terms relating to the present invention are used hereinabove and also throughout the specifications and claims.

A "coding sequence" or "coding region" refers to a nucleic acid molecule having sequence information necessary to produce a gene product, when the sequence is expressed. The term "operably linked" or "operably inserted" means that the regulatory sequences necessary for expression of the coding sequence are placed in a nucleic acid molecule in the appropriate positions relative to the coding sequence so as to enable expression of the coding sequence. This same definition is sometimes applied to the arrangement other transcription control elements (e.g. enhancers) in an expression vector.

Transcriptional and translational control sequences are DNA expression regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.

The terms "promoter", "promoter region" or "promoter sequence" refer generally to transcriptional regulatory regions of a gene, which may be found at the 5' or 3' side of the coding region, or within the coding region, or within introns. Typically, a promoter is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. The typical 5' promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence is a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.

A "vector" is a replicon, such as plasmid, phage, cosmid, or virus to which another nucleic acid segment may be operably inserted so as to bring about the replication or expression of the segment.

The term "nucleic acid construct" or "DNA construct" is sometimes used to refer to a coding sequence or sequences operably linked to appropriate regulatory sequences and inserted into a vector for transforming a cell. This term may be used interchangeably with the term "transforming DNA" or "transgene". Such a nucleic acid construct may contain a coding sequence for a gene product of interest, along with a selectable marker gene and/or a reporter gene. The term "selectable marker gene" refers to a gene encoding a product that, when expressed, confers a selectable phenotype such as antibiotic resistance on a transformed cell.

The term "reporter gene" refers to a gene that encodes a product which is easily detectable by standard methods, either directly or indirectly.

A "heterologous" region of a nucleic acid construct is an identifiable segment (or segments) of the nucleic acid molecule within a larger molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. In another example, coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

A cell has been "transformed" or "transfected" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA (transgene) may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations. If germline cells are stably transformed, the transformation may be passed from one generation of animals arising from the germline cells, to the next generation. In this instance, the transgene is referred to as being inheritable.

The term "subject" or "patient" refers to a cell, a tissue or a living organism. The living organism may be any living organism, including humans and animals.

The term "protein turnover" is art-recognized and refers to the coordinated synthesis and degradation of proteins that occurs in living cells, tissues and organisms.

II. Description:

Using a Caenorhabditis elegans model system, the inventors have determined that loss of eEF-2 kinase activity increases protein synthesis and degradation rates and extends life span. Conversely, over-expression of eEF-2 kinase in transgenic nematodes shortens life span. Mutants lacking a functional eEF-2 kinase appear nearly normal in morphology, co-ordination and fertility but exhibit slowed development and altered rates of several rhythmic behaviors, reminiscent of the previously described elk life span extension mutants.³'⁴ Rates of protein synthesis are also increased in long-lived age-1 (hx546) and clk-1 (qm30) mutants, suggesting that both the age/daf ^'and elk mechanisms, thought to be distinct, could both act in part by affecting protein synthesis rates. Consistent with this possibility, double mutants of efk-1 and age-1 (hx546) or clk-1 (qm30) mutants live no longer than either single mutant. It has also been noted that eEF-2 kinase activity is also decreased in starved nematodes, indicating that up-regulation of protein synthesis via decreased eEF-2 kinase activity contributes to the extension of life span by caloric restriction.

The experimental results provided in accordance with the present invention are believed to be the first direct evidence that an increase in protein turnover can retard aging and extend life span. Based upon this evidence, but without intending to be limited by any particular mechanism of action, a model for the interrelationship between protein turnover (and enzymes affecting it) and longevity is as follows: eEF-2 kinase phosphorylates eEF-2 and downregulates protein turnover. Lower protein turnover accelerates the accumulation of damaged proteins and decreases life span. The downregulation of eEF-2 kinase during caloric restriction thus directly contributes to the increase in life span observed. Similarly, the increase in protein synthesis observed in both age-1 and clk-1 mutants of C. elegans may directly contribute to their increased longevity.

It is noteworthy that eEF-2 kinase is conserved from nematodes to humans⁸, is non-essential for viability in nematodes (Example 1) and mice (Example 2), and is highly specific for eEF-2.⁶- ⁷ These properties make eEF-2 kinase a useful target for the design of therapeutic reagents to circumvent some deleterious consequences of senescent decline. Improved protein maintenance is expected to significantly combat the aging process.

This invention can be used for the retardation of aging, generally, and further for postponing the onset of various age-related diseases such as Alzheimer's disease and Parkinson's disease. Accordingly, methods are provide to increase the life span of a subject, to retard the rate of aging of the subject, and to increase the sexually active period of a subject's life span. These methods comprise increasing protein turnover in the subject, the increase in protein turnover resulting in the increase in life span of the subject. For research purposes, the "subject" may be a cell, tissue, microorganism or animal. For clinical diagnostic and therapeutic purposes, the "subject" may be a human or animal.

Preferably, the increase of protein turnover in the subject is accomplished by decreasing activity of EF-2 kinase in the subject, based on the evidence set forth in accordance with the present invention. EF-2 kinase activity may be decreased in a variety of ways. For instance, the enzymatic activity of the EF-2 kinase may be decreased by exposing the enzyme to an inhibitor. Alternatively, methods may be used to decrease the amount of functional EF-2 kinase produced by the subject. Specifically, the amount of functional EF-2 kinase may be decreased by reducing expression of a gene encoding the EF-2 kinase. Alternatively, the amount of functional EF-2 kinase can be decreased by altering a gene encoding the EF-2 kinase such that the gene encodes a dysfunctional or non-functional EF-2 kinase. The genetic manipulation of EF-2 kinase gene expression can be used to advantage in germline transformation of non-human organisms, to genetically engineer organisms that are naturally longer-lived, and that can produce longer-lived progeny. Methods for genetically engineering non-human organisms, including mammals, are well known in the art. The present invention also provides EF-2 kinase over-expressing or under-expressing transgenic (or otherwise genetically manipulataed) animals, which are expected to be useful for a variety of purposes, as discussed in greater detail below. As exemplified by the EF-2 kinase knockout mice described in Example 2, these animals are expected to be altered in longevity (increased for under-expressing or knockout animals, decreased for over-expressing animals).

The term "animal" is used herein to include all vertebrate animals, except humans. It also includes an individual animal in all stages of development, including embryonic and fetal stages. Examples of animals preferred for use in the present invention include, but are not limited to, rodents, most preferably mice and rats, as well as cats, dogs, dolphins and primates.

A "transgenic animal" is any animal containing one or more cells bearing genetic information altered or received, directly or indirectly, by deliberate genetic manipulation at the subcellular level, such as by targeted recombination or microinjection or infection with recombinant virus. The term "transgenic animal" is not meant to encompass classical cross-breeding or in vitro fertilization, but rather is meant to encompass animals in which one or more cells are altered by or receive a recombinant DNA molecule, i.e., a "transgene". The term "transgene", as used herein, refers to any exogenous gene sequence which is introduced into both the somatic and germ cells or only some of the somatic cells of a mammal. This molecule may be specifically targeted to defined genetic locus, or be randomly integrated within a chromosome, or it may be extrachromosomally replicating DNA. The term "germline transgenic animal" refers to a transgenic animal in which the transgene was introduced into a germline cell, thereby conferring the ability to transfer the transgene to offspring. If such offspring in fact possess the transgene then they, too, are transgenic animals.

The transgene of the present invention includes without limitation, the entire coding region of an EF-2 kinase gene, or its complementary DNA (cDNA), or chimeric genes containing part or all of an EF-2 coding region. It is preferable, but not essential, that the coding sequence used in the transgene be of the same species origin as the transgenic animal to be created. For knockout animals, the coding sequence or a regulatory sequence is manipulated so that the encoded enzyme is dysfunctional or non-functional.

Methods to obtain transgenic, non-human mammals are known in the art. For general discussions, see, e.g., Joyner, "Gene Targeting," IRL Press, Oxford, 1993; Hogan et al. (Eds.), "Manipulating the Mouse Embryo - A Laboratory Manual," Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1994; and Wasserman & DePamphilis, "A Guide to Techniques in Mouse Development," Academic Press, San Diego CA, 1993. One method for introducing exogenous DNA into the germline is by microinjection of the gene construct into the pronucleus of an early stage embryo (e.g., before the four-cell stage) (Wagner et al., Proc. Natl. Acad. Sci. USA 78, 5016, 1981; Brinster et al.. Proc. Natl. Acad. Sci. USA 82, 4438, 1985). The detailed procedure to produce NR2B transgenic mice by this method has been described (Tsien et al., Cell 87, 1317-26, 1996).

Another method for producing germline transgenic mammals utilizes embryonic stem cells. The DNA construct may be introduced into embryonic stem cells by homologous recombination (Thomas et al., Cell 51, 503, 1987; Capecchi, Science 244, 1288, 1989; Joyner, et al., Nature 338, 153, 1989) in a transcriptionally active region of the genome. A suitable construct may also be introduced into the embryonic stem cells by DNA-mediated transfection, such as electroporation (Ausubel, et al., Current Protocols in Molecular Biology, John Wiley & Sons, 1999). Detailed procedures for culturing embryonic stem cells and methods of making transgenic mammals from embryonic stem cells may be found in Teratocarcinomas and Embryonic Stem Cells, A practical Approach, ed. E. J. Robertson (IRL Press, 1987). Other methods for producing germline transgenic animals are being developed currently. For instance, instead of eggs being the recipients of exogenous DNA, sperm are now being genetically manipulated.

In any of the foregoing methods of germline transformation, the construct may be introduced as a linear construct, as a circular plasmid, or as a viral vector which may be incorporated and inherited as a transgene integrated into the host genome. The transgene may also be constructed so as to permit it to be inherited as an extrachromosomal plasmid. The term "plasmid" generally refers to a DNA molecule that can replicate autonomously in a host cell.

Transgenic animals also may be obtained by infection of neurons either in vivo, ex vivo, or in vitro with a recombinant viral vector carrying an EF-2 kinase gene. Suitable viral vectors include retroviral vectors, adenoviral vectors and Herpes simplex viral vectors, to name a few. The selection and use of such vectors is well known in the art.

According to another aspect of the invention, a pharmaceutical formulation for increasing the life span or retarding the aging rate of a subject is provided. The formulation comprises an agent that increases cellular protein turnover in a biologically compatible medium. Preferably, the formulation comprises an inhibitor of EF-2 activity or gene expression. Pharmaceutical formulations are administered by a variety of appropriate routes, as known in the art, including, oral, intranasal, intraocular, intravenous, intramuscular and intraperitoneal, among others. The mode of administration will depend on the nature of the active agent and the pharmaceutical formulation in which it is contained.

The pharmaceutical formulations are conveniently formulated for administration with a acceptable medium such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents or suitable mixtures thereof. The concentration of a particular composition in the chosen medium will depend on the hydrophobic or hydrophilic nature of the medium, in combination with the specific properties of the delivery vehicle and active agents disposed therein. Solubility limits may be easily determined by one skilled in the art. As used herein, "biologically acceptable medium" includes any and all solvents, dispersion media and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation, as exemplified in the preceding paragraph. The use of such media for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the compositions to be administered, its use in the pharmaceutical preparation is contemplated. The pharmaceutical preparation is formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form, as used herein, refers to a physically discrete unit of the pharmaceutical preparation appropriate for the patient undergoing treatment. Each dosage should contain a quantity of the active ingredient calculated to produce the desired protective effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate dosage unit are well known to those skilled in the art. Dosage units may be proportionately increased or decreased based on the weight of the patient.

A variety of screening assays and diagnostic/prognostic assays and kits are also provided in accordance with the present invention. For instance, a method is provided for determining if a test compound increases life span or retards aging of a subject, which comprises: (a) providing a control sample and a test sample of cells; (b) exposing the test sample to the test compound; and (c) measuring protein turnover rate in the control sample and the test sample of cells, an increase in protein turnover rate in the test sample as compared to the control sample being indicative that the test compound increases life span or retards aging of a subject.

In another embodiment, a cell-free method is provided for determining if a test compound increases life-span or retards aging by decreasing EF-2 kinase activity in a subject, which comprises (a) providing a control sample and a test sample of active EF-2 kinase; (b) exposing the test sample to the test compound; and (c) measuring EF-2 kinase activity in the control sample and the test sample, a decrease in EF-2 kinase activity in the test sample as compared to the control sample being indicative that the test compound increases life span or retards aging of a subject by decreasing EF-2 kinase activity in the subject. As an alternative, a cell-based method is provided for determining if a test compound increases life-span or retards aging by decreasing EF-2 kinase activity in a subject. The method comprises: (a) providing a control sample and a test sample of cells containing active EF-2 kinase; (b) exposing the test sample to the test compound; and (c) measuring EF-2 kinase activity in the control sample and the test sample, a decrease in EF-2 kinase activity in the test sample as compared to the control sample being indicative that the test compound increases life span or retards aging of a subject by decreasing EF-2 kinase activity in the subject.

In addition, a method is provided for determining if a test compound increases life-span or retards aging by decreasing expression of a gene encoding EF-2 kinase in a subject. This method comprises: (a) providing an expression system comprising a DNA construct having a reporter coding sequence operably linked to one or more expression regulatory elements from a gene encoding EF-2 kinase, the expression system further comprising components enabling expression of the reporter coding sequence to produce a reporter gene product; (b) providing a control sample and a test sample of the expression system; (c) exposing the test sample to the test compound; and (d) measuring the amount of reporter gene product in the control sample and the test sample, a decrease in amount of reporter gene product in the test sample as compared to the control sample being indicative that the test compound increases life span or retards aging of a subject by decreasing EF-2 kinase activity in the subject. In a preferred embodiment, the expression system is a cell transformed with the DNA construct. In another preferred embodiment, the EF-2 gene expression regulatory element is a promoter.

According to another aspect of the invention, a prognostic method for determining longevity of a subject is provided. The method comprises: (a) in an animal model system, establishing a standard curve displaying a positive correlative relationship between protein turnover and longevity of the animal; (b) measuring protein turnover in the subject; (c) comparing the protein turnover in the subject with the protein turnover in the animal model as displayed in the standard curve; and (d) making a prognostic determination of the longevity of the subject. An alternative prognostic method for determining longevity of a subject comprises the steps of: (a) in an animal model system, establishing a standard curve displaying a negative correlative relationship between EF-2 kinase activity and longevity of the animal; (b) measuring EF-2 kinase activity in the subject; (c) comparing the EF-2 kinase activity in the subject with the EF-2 kinase activity in the animal model as displayed in the standard curve; and (d) making a prognostic determination of the longevity of the subject. Kits are provided for practicing each of the methods set forth above. These kits contain the biological molecules, cells, systems and/or reagents for practicing one or more of the methods, and instructions for using the kits to practice the methods. The assembly and use of such kits are well known to persons of skill in the art.

The following examples are set forth to describe the invention in greater detail. They are intended to illustrate, not to limit, the invention.

EXAMPLE 1

Elongation Factor-2 Kinase Affects Caenorhabditis elegans Life Span by Regulating Protein Turnover

To investigate the in vivo function of eEF-2 phosphorylation, we undertook a molecular genetic analysis of C. elegans efk-1 gene which encodes eEF-2 kinase.

Materials and Methods

Strains and genetic manipulations: C. elegans strains were grown at 20 C and maintained as described.²⁵ Strains utilized in this study were: wild type N2, daf-16(mgDf50), age-l(hx546), clk-l(qm30), eβ-l(ev640), clk-2(qm37), daf- 16(mgDf50);eβ-l(ev640), age-l(hx546);eβ-l(ev640), clk-1 (qm30)eβ-l(ev640), N2 Ex[pCeβ-lpRF4(rol-6(sul 006)], 2 Ex[p_{e W}EFK-1::GFP pRF4], N2 Ex[F42A10 pRF4] (BC4909 (sExl34) kindly provided by David Baillie, Simon Fraser University) and efk-1 (ev640) Ex[pCe/£ pRF4] . eβ-l(ev640) is a Tc 1 insertion allele of eβ-1 generated by Joseph Culotti and Lijia Zhang, U. Toronto. Germline transformation was performed as described.²⁶ 50 μg/ml of plasmid DNAs were co-injected with 50 μg/ml of co-transformation marker pRF4 DNA for all the transgenic lines tested. Cosmids were injected at a concentration of 10 μg/ml. Molecular manipulations. The site of the Tel insertion within the eβ-1 locus was determined by automated sequence analysis of PCR amplified products. Nested primers specific for eβ-1 were used in combination with Tel specific primers (Ll-2 and Rl-2.²⁷ eβ-1 primers used were: CEFK1 : 5'GCTTCCAACTCATCGAGCACC3' (SEQ ID NO:2) CEFK2: 5TAGTCCAACTAACTCACCAGG3' (SEQ ID NO:3) CEFK3: 5ΑATCTCGTGACGAGTCAGTGG3' (SEQ ID NO:4) CEFK4: 5'CATTGAGGATTGAAGAAAGGG3'. (SEQ ID NO:5) Cosmid F42A10 contains the eβ-1 gene and was obtained from the Sanger Center clone collection, maintained by the C. elegans Genome Sequencing Consortium. Plasmid constructions employed standard molecular biology methods. A rescuing genomic clone of the gene (pCeβ-1) was constructed by subcloning a 9.5Kb Hindlll fragment from cosmid F42A10 encompassing the eβ-1 gene (positions 9,920 to 19,376 on the cosmid), into the pUC19 vector. This fragment contains the coding region for EFK-1, which spans positions 10,885 to 14,126 on F42A10, 5 Kb of upstream sequence that includes the eβ-1 promoter and approximately 1 Kb of downstream sequence with transcription termination signals. Since eβ-1 transcripts are spliced to SL2, it is possible that an upstream gene is housed on this plasmid although protein prediction programs fail to identify a candidate coding region, there are frequent stop codons in all frames and no ESTs for the region have been identified. dsRNAi directed against eβ-1 phenocopies the loss-of- function pheno types oϊeβ-l(ev640)}^% A GFP reporter fusion (p^EFK-l ::GFP) was generated by removing a 1 Kb Mlul fragment from clone pCeβ-1 located at the carboxy terminus of EFK-1 and replacing with a 0.7Kb fragment containing the GFP coding region derived from a GFP vector subclone. This substitution generated an in-frame translational fusion of GFP that removes the last 86 amino acids of eEF-2 kinase. In situ hybridization. We analyzed the pattern of eEF-2 kinase mRNA expression during early development using whole-mount embryo in situ hybridization to C. elegans transgenic strain BC4909 (sExl34) harboring the cosmid F42A10 (including eβ-1). Elevated gene dosage of eβ-1 was required to obtain hybridization signals. Hybridization using eβ-1 probes was performed according to the method of Seydoux and Fire.²⁹ eβ-1 antisense probes labeled with digoxigenin- 11-UTP (Boehringer Mannheim) were prepared using the plasmid pCefk-1. After hybridization, the probes were visualized using an anti-digoxigenin antibody conjugated to alkaline phosphatase using NBT/X-phosphate as substrate.

Life span analysis. Life span assays were conducted at 20°C as previously described.^{3 9"17} Strains were grown at 20°C for at least two generations before life span determination. Life span assays were performed in at least 3 independent trials for each strain examined. Each assay was initiated with 100 animals with egg laying as t = 0 for life span analysis. Animals were scored as dead when they did not move, pump, or respond to prodding. Animals that had crawled off the plate, had an "exploded" phenotype such that their gonad extruded out of the body through the vulva, or were egg-laying defective such that they accumulated eggs that hatched inside the body, were eliminated from scoring. We used Excel 2000 (Microsoft) software to carry out statistical analysis.³⁰ eEF-2 kinase assays. Analysis of eEF-2 kinase activity in of wild- type and various mutant C. elegans extracts was performed as follows: well-fed nematodes were washed from plates with M9 medium, the final volume of medium was adjusted to 50 ml and tubes were stored at -80°C. To prepare extracts, 50 μl of buffer consisting of 100 mM Hepes-KOH (pH 7.4), 300 mM NaCl, 7 mM b-ME, 2 tablets/10ml of Complete protease inhibitor cocktail (Boehringer Mannheim) was added to the 50 μl of M9 medium containing the nematodes. Worms were sonicated 8x using a Branson Sonifier set at a power level of 3, and duty cycle of 20%. Debris was pelleted by centrifugation for 30 seconds at 16,000 x g, 4^°C. Extracts were then adjusted to contain equivalent protein concentrations and used in eEF-2 kinase assays. The reaction mixture contained 5 μl of extract and 0.5 μg of purified rabbit reticulocyte eEF-2 in a buffer consisting of 50 mM Hepes-KOH (pH 6.6), 10 mM magnesium acetate, 5 mM DTT, 100 μM CaCl₂, 0.5 μg calmodulin, 60 μM ATP, and 2 μCi of [g-³³P]-ATP (Easytides, NEN; specific activity equal to 2000 Ci/mmol) in a total reaction volume of 40 μl. The reaction was carried out at 30°C for 5 minutes, and terminated by incubation in an ice-water bath. 5x Laemmli sample buffer was added, and the reaction mixture was heated for 5 minutes. Samples were analyzed by 7.5% SDS-PAGE and autoradiography. Gels were exposed to film (Kodak Bio-Max MR-1) for 3 days. Protein synthesis and degradation assays. For protein synthesis assays, nematodes were initially grown on NGM plates seeded with E. coli (strain OP- 50) at 20°C.²⁵ Nematodes were then labeled 20^°C in NP media supplemented with amino acids, ³H-leucine and heat-killed OP-50 bacteria. Animals were harvested by centrifugation at the times indicated, washed three times in M9 buffer containing lOOmg/ml cyclohexamide and lysed in 25mM Tris-HCl, 150 mM NaCl, 1% SDS (pH=7.4) at 100°C for 10 minutes. Insoluble debris was removed by centrifugation in a microcentrifuge at 14,000 rpm for 5 minutes at 4°C. Unincorporated ³H-leucine was removed by spin dialysis followed by TCA precipitation. TCA precipitated proteins were redissolved in 20mM NaOH. Protein concentrations were determined by

BioRad Coomassie Blue dye binding assay. The amount of ³H-leucine incorporated per microgram protein was determined by liquid scintillation counting. For protein degradation assays, nematodes were grown and labeled for 5 hours with ³H-leucine as described above. Worms were then washed three times with M9, resuspended in NP media supplemented with amino acids and heat-killed OP-50 bacteria, and incubated at 20°C. Worms were harvested at the times indicated and the amount of ³H-leucine incorporated per microgram protein was determined as described above.

Results and Discussion In situ hybridization indicates that eβ-1 is expressed in body wall muscle precursors during early development. In adults, a fusion protein expressed from a p_ej__/ΕFK-l ::GFP transgene appears to be cytoplasmic and ubiquitously expressed throughout the nematode. The EFK-1 ::GFP reporter protein is detectable late into the life span (at least 25 days). We isolated a Tel transposon insertion in the C. elegans eEF-2 kinase gene (allele ev640) that disrupts an exon encoding the catalytic domain and eliminates all detectable eEF-2 kinase activity (Fig. 1A, B). The overall rate of protein synthesis is elevated in the eβ-1 mutant, as would be predicted for the loss of a negative regulator of translation (Fig. 1C). We also found an increase in the rate of protein degradation in the eβ-1 mutant, consistent with the tight coupling between synthesis and degradation (Fig. ID). The increase in overall protein turnover rate in the eβ-1 mutant did not affect general morphology, co-ordination or fertility. Loss of eEF-2 kinase activity, however, moderately slowed development and slightly altered rates of locomotion, pharyngeal pumping, swimming and defecation (Fig. 2A), phenotypes characteristic of previously described elk mutants.^{3, 4} Unlike elk mutants, however, the eβ-1 (ev640) mutant is not maternally rescued. An extrachromosomal array harboring the eβ-1 gene rescues growth rate and all behavioral phenotypes that can be assayed in a transgenic roller background, establishing that these phenotypes are conferred by the eβ-l(ev640) mutation (Fig 2A).

Life span extension is another phenotype characteristic of elk mutants³' ⁴, and therefore we assayed viability of eβ-1 over time. The eβ-1 mutant does exhibit a long-lived phenotype, with a mean life span 39% longer than wild type as averaged in three independent trials (Fig. 2B). Interestingly, wild-type nematodes harboring extrachromosomal arrays that increase the dose of the eβ-1 gene exhibit shortened life spans (Fig. 2B). Two groups of C. elegans genes, the elk genes that affect rhythmic behavior³' ⁴ and the age/daf genes that affect the dauer formation program^9"15, are thought to influence life span via different mechanisms. We measured the rate of protein synthesis in representative mutants of both classes, clk-1 (qm30) and age- l(hx546) respectively. We find that protein synthesis rates are elevated in both mutants (Fig. 3 A). It was noted that age-1 (hx546) has both the greatest extension of life span and the highest rate of protein synthesis of the mutants tested (Fig. 3A). The increase in protein synthesis observed in age-1 (hx546) and clk-1 (qm30) suggests that elevation of the rate of protein turnover is a common mechanism for life span extension in both classes of mutants. This is further supported by life span analysis of age-1 ;eβ-\ and clk-1 ;eβ-l double mutants, eβ-1 does not extend the life span of either age-1 or clk-1 mutants, genetically implicating eβ-1 in the life extension mechanism of both age-1 and clk-1 (Fig. 3B). The age-1 clk-1 double mutant, however, lives significantly longer than either single mutant. Therefore, the increased life span observed in both age-1 and clk-1 mutants cannot be solely due to increased protein turnover. We also find that daf-16, which encodes a forkhead family transcription factor^{16, 17} required for life span extension conferred by age-1 and possibly by clk-1 mutations¹⁸, prevents the life span extension conferred by eβ-1 (Fig. 3C).

Caloric restriction, a decrease in caloric intake without nutrient deprivation, has been shown to increase life span in various organisms.^{19, 20} In rodents, such dietary restriction has also been observed to increase the rate of protein turnover.^{20, 21} Although the exact mechanism is unclear, it has been suggested that the increase in protein turnover is the primary mechanism of life span extension by dietary restriction.²⁰ It was noted in the aforementioned experiments that eEF-2 kinase activity is significantly decreased in C. elegans reared without food for 24 hours (Fig. 3D), suggesting that an increase in protein turnover during dietary restriction may be mediated by downregulation of eEF-2 kinase. A similar mechanism may function in mammals. Indeed, the level of eEF-2 kinase in liver extracts from calorie-restricted 22-month old rats was found to be lower than in age- matched ad libitum-fed rats.²²

EXAMPLE 2 Generation of eEF-2 Knockout Mice

To produce eEF-2 kinase knockout mice, standard techniques were used (Mansour, S.L. et al. (1988) Nature 336: 348-352; Lee, E.Y. et al. (1992) Nature 359: 288-294; Jacks, T. et al. (1992) Nature 359: 295-300). Briefly, a targeting vector was prepared in which the portion of the mouse eEF-2 kinase catalytic domain was replaced with a neomycin selection marker. This targeting vector was transfected into embryonic stem cells, and a cell line with a disruption of one eEF-2 kinase allele has been identified. These cells were injected into blastocysts, and the blastocysts were implanted into the oviducts of pseudopregnant mice. Heterozygous chimeric mice were confirmed by Southern analysis. The homozygous knockout was produced by breeding the chimerae. Thus far, we have obtained several male and female homozygous knockout mice. Progeny from two homozygous parents were obtained. Preliminary analyses have not revealed any abnormality in the eEF-2 kinase knockout mice or their progeny. They have a normal morphology indistinguishable from wild-type mice. When a homozygous eEF-2 kinase knockout male is mated with a homozygous eEF-2 kinase knockout female, a normal sized litter often pups was observed. From these observations, we conclude that, similar to the situation in nematodes, eEF-2 kinase is not essential for survival, development or reproduction in mice.

References

1. Stadtman, E.R. Protein oxidation and aging. Science 257, 1220-1222 (1992).

2. Ryazanov, A.G., Shestakova, E.A. & Natapov, P.G. Phosphorylation of elongation factor 2 by EF-2 kinase affects rate of translation. Nature 334, 170-173 (1988). 3. Lakowski, B. & Hekimi, S. Determination of life span in Caenorhabditis elegans by four clock genes. Science 272, 1010-1013 (1996).

4. Branicky, R, Benard, C. & Hekimi, S. clk-1, mitochondria, and physiological rates. Bioessays 22, 48-56 (2000).

5. Spirin, A.S. Ribosomes, Plenum Press, New York (in press). 6. Ryazanov, A.G. & Spirin, A.S. Phosphorylation of elongation factor 2: a mechanism to shut off protein synthesis for reprogramming gene expression, in Translational regulation of gene expression II, J. Ilan, ed., Plenum Press, New York (1993) pp.433-455.

7. Nairn, A.C. & Palfrey, H.C. Regulation of protein synthesis by calcium, in Translational Control, Cold Spring Harbor Laboratory Press, Plainview, New York (1996) pp. 295-318.

8. Ryazanov, A.G. et al. Identification of a new class of protein kinases represented by eukaryotic elongation factor-2 kinase. Proc. Natl. Acad. Sci. USA 94, 4884-4889 (1997).

9. Friedman DB. & Johnson, T.E. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility. Genetics 118, 75-86

(1988).

10. Kenyon, C, Chang, J., Gensch, E., Rudner, A. & Tabtiang, R. A C. elegans mutant that lives twice as long as wild type. Nature 366, 461-464 (1993).

11. Dorman, J.B., Albinder, B., Shroyer, T. & Kenyon, C. The age-1 and daf-2 genes function in a common pathway to control the life span of Caenorhabditis elegans.

Genetics 142, 1399-1406 (1995). 12. Morris, J.Z., Tissenbaum, H.A. & Ruvkun, G. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382, 536-539 (1996).

13. Kimura, K.D., Tissenbaum, H.A., Liu, Y. & Ruvkun, G. daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science 277, 942-946 (1997).

14. Larsen, P.L., Alber, P.S. & Riddle, D.L. Genes that regulate both development and longevity in Caenorhabditis elegans, Genetics 139, 1567-1583 (1995).

15. Apfeld, J. & Kenyon, C. Cell nonautonomy of C. elegans daf-2 function in the regulation of diapause and life span. Cell 95, 199-210 (1998).

16. Ogg, S. et al. The Forkhead transcription factor DAF-16 transduces insulin- like metabolic and longevity signals in C. elegans. Nature 389, 994-999 (1997). 17.Lin, L., Dorman, J.B., Roda, A. & Kenyon, C. daf-16: An HNF-3/forkhead family member that can function to double the life span of Caenorhabditis elegans. Science 278, 1319-1322 (1997).

18. Vanfleteren, J.R. & Braekman, B.P. Mechanisms of life span determination in Caenorhabditis elegans. Neurobiol. Agmg. 20, 487-502 (1999).

19. Weidruch, R. & Walfore, R.L. The retardation of aging and disease by dietary restriction. Charles Thomas, Publisher, Springfield, Illinois (1988). 20. Holehan, A.M. & Merry, B.J. The experimental manipulation of aging by diet.

Biol. Rev. 61, 329-368 (1986).

21. Lewis, S.E.M., Goldspink, D.F., Phillips, J.G., Merry, B.J. & Holehan, A.M. The effects of aging and chronic dietary restriction on whole body growth and protein turnover in the rat. Exp. Geron. 20, 253-263 (1985). 22. Riis, B., Rattan, S.L, Palmquist, K., Nilsson, A., Nygard, O. & Clark, B.F.

Elongation factor 2-specific calcium and calmodulin dependent protein kinase III activity in rat livers varies with age and calorie restriction. Biochem. Biophys. Res.

Comm. 192, 1210-1216 (1993).

23. Van Remmen, H., Ward, W.F., Sabia, R.V. & Richardson, A. Gene expression and protein degradation, in Handbook of Physiology, Section 11: Aging, E.J. Masoro, ed., Oxford Univ. Press, New York, N.Y. (1995) pp. 171-234. 24. Rattan, S.I. & Clark, B.F. Intracellular protein synthesis, modifications and aging. Biochem. Soc. Trans. 24, 1043-1049 (1996).

25. Brenner, S. The genetics of Caenorhabditis elegans. Genetics 11, 71-94 (1974).

26. Mello, C. & Fire, A. DNA Transformation. Methods Cell. Biol. 48, 451-482 (1995).

27. Zwaal, R.R., Broeks, A. & Plasterk, R.H. Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA 90, 7431-7435 (1993).

28. Tavernarakis, N., Wang, S.L., Dorovkov, M., Ryazanov, A. & Driscoll, M. Inheritable and inducible genetic interference by double-stranded RNA encoded by transgenes. Nature Genet. 24, 180-183 (2000).

29. Seydoux, G., & Fire, A. Whole-mount in situ hybridization for the detection of RΝA in Caenorhabditis elegans embryos. Methods Cell Biol. 48, 323-337 (1995).

30. Lawless, J.F. Models and Methods for Lifetime Data, Wiley, New York, N.Y. (1982).

The present invention is not limited to the embodiments described and exemplified above, but is capable of variation and modification without departure from the scope of the appended claims.

Claims

We claim:

1. A method of increasing the life span of a subject, the method comprising increasing protein turnover in the subject, the increase in protein turnover resulting in the increase in life span of the subject.

2. The method of claim 1. wherein the increasing protein turnover in the subject is accomplished by decreasing activity of EF-2 kinase in the subject.

3. The method of claim 2. wherein the EF-2 kinase activity is decreased by decreasing the amount of functional EF-2 kinase produced by the subject.

4. The method of claim 3. wherein the amount of functional EF-2 kinase is decreased by reducing expression of a gene encoding the EF-2 kinase.

5. The method of claim 3. wherein the amount of functional EF-2 kinase is decreased by altering a gene encoding the EF-2 kinase such that the gene encodes a dysfunctional or non-functional EF-2 kinase.

6. A method of increasing the length of the sexually active portion of the life of a subject,the method comprising increasing protein turnover in the subject, the increase in protein turnover resulting in the increase in life span of the subject.

7. The method of claim 6, wherein the increasing protein turnover in the subject is accomplished by decreasing activity of EF-2 kinase in the subject.

8. The method of claim 7, wherein the EF-2 kinase activity is decreased by decreasing the amount of functional EF-2 kinase produced by the subject.

9. The method of claim 8, wherein the amount of functional EF-2 kinase is decreased by reducing expression of a gene encoding the EF-2 kinase.

10. The method of claim 8, wherein the amount of functional EF-2 kinase is decreased by altering a gene encoding the EF-2 kinase such that the gene encodes a dysfunctional or non-functional EF-2 kinase.

11. A method of decreasing the rate of aging of a subj ect,t he method comprising increasing protein turnover in the subject, the increase in protein turnover resulting in the increase in life span of the subject.

12. The method of claim 11 , wherein the increasing protein turnover in the subject is accomplished by decreasing activity of EF-2 kinase in the subject.

13. The method of claim 12, wherein the EF-2 kinase activity is decreased by decreasing the amount of functional EF-2 kinase produced by the subject.

14. The method of claim 13, wherein the amount of functional EF-2 kinase is decreased by reducing expression of a gene encoding the EF-2 kinase.

15. The method of claim 13, wherein the amount of functional EF-2 kinase is decreased by altering a gene encoding the EF-2 kinase such that the gene encodes a dysfunctional or non-functional EF-2 kinase.

16. A method of determining if a test compound increases life span or retards aging of a subject, the method comprising: a) providing a control sample and a test sample of cells; b) exposing the test sample to the test compound; and c) measuring protein turnover rate in the control sample and the test sample of cells, an increase in protein turnover rate in the test sample as compared to the control sample being indicative that the test compound increases life span or retards aging of a subject.

17. A kit for performing an assay to determine if a test compound increases life span or retards aging of a subject, the kit comprising reagents for determining protein turnover rate in a cell and instructions for using the kit components on cells to perform the assay and, optionally, cultured cells for performing the assay.

18. A cell-free method of determining if a test compound increases life-span or retards aging by decreasing EF-2 kinase activity in a subject, the method comprising: a) providing a control sample and a test sample of active EF-2 kinase; b) exposing the test sample to the test compound; and c) measuring EF-2 kinase activity in the control sample and the test sample, a decrease in EF-2 kinase activity in the test sample as compared to the control sample being indicative that the test compound increases life span or retards aging of a subject by decreasing EF-2 kinase activity in the subject.

19. A kit for performing an assay to determine if a test compound increases life-span or retards aging by decreasing EF-2 kinase activity in a subject, the kit comprising the EF-2 kinase and instructions for using the EF-2 kinase to perform the assay.

20. A cell-based method of determining if a test compound increases life-span or retards aging by decreasing EF-2 kinase activity in a subject, the method comprising: a) providing a control sample and a test sample of cells containing active EF-2 kinase; b) exposing the test sample to the test compound; and c) measuring EF-2 kinase activity in the control sample and the test sample, a decrease in EF-2 kinase activity in the test sample as compared to the control sample being indicative that the test compound increases life span or retards aging of a subject by decreasing EF-2 kinase activity in the subject.

21. A kit for performing an assay to determine if a test compound increases life-span or retards aging by decreasing EF-2 kinase activity in a subject, the kit comprising the cells containing the active EF-2 kinase and instructions for using the cells to perform the assay

22. A method of determining if a test compound increases life-span or retards aging by decreasing expression of a gene encoding EF-2 kinase in a subject, the method comprising: a) providing an expression system comprising a DNA construct having a reporter coding sequence operably linked to one or more expression regulatory elements from a gene encoding EF-2 kinase, the expression system further comprising components enabling expression of the reporter coding sequence to produce a reporter gene product; b) providing a control sample and a test sample of the expression system; c) exposing the test sample to the test compound; and d) measuring the amount of reporter gene product in the control sample and the test sample, a decrease in amount of reporter gene product in the test sample as compared to the control sample being indicative that the test compound increases life span or retards aging of a subject by decreasing EF-2 kinase activity in the subject.

23. The method of claim 22, wherein the expression system is a cell transformed with the DNA construct.

24. The method of claim 22, wherein the EF-2 gene expression regulatory element is a promoter.

25. A kit for performing an assay to determine if a test compound increases life-span or retards aging by decreasing expression of a gene encoding EF-2 kinase in a subject, the kit comprising the DNA construct and, optionally, the expression system, of claim 24 and instructions for performing the assay.

26. A prognostic method for determining longevity of a subject, the method comprising: a) in an animal model system, establishing a standard curve displaying a positive correlative relationship between protein turnover and longevity of the animal; b) measuring protein turnover in the subject; c) comparing the protein turnover in the subject with the protein turnover in the animal model as displayed in the standard curve; and d) making a prognostic determination of the longevity of the subject.

27. A prognostic method for determining longevity of a subject, the method comprising: a) in an animal model system, establishing a standard curve displaying a negative correlative relationship between EF-2 kinase activity and longevity of the animal; b) measuring EF-2 kinase activity in the subject; c) comparing the EF-2 kinase activity in the subject with the EF-2 kinase activity in the animal model as displayed in the standard curve; and d) making a prognostic determination of the longevity of the subject.

28. A pharmaceutical formulation for increasing the life span or retarding the aging rate of a subject, comprising an agent that increases cellular protein turnover in a biologically compatible medium.

29. The pharmaceutical formulation of claim 28, wherein the agent is an inhibitor of EF-2 kinase activity.

30. The pharmaceutical formulation of claim 28, wherein the agent is an inhibitor of EF-2 kinase gene expression.

31. A genetically manipulated non-human organism in which an enzyme that negatively regulates protein synthesis is dysfunctional, non-functional or absent.

32. The organism of claim 31, wherein the enzyme is EF-2 kinase.

33. The organism of claim 31, which is selected from the group consisting of rodent and nematode.

34. A genetically manipulated non-human organism that over- expresses an enzyme that negatively regulates protein synthesis.

35. The organism of claim 34, wherein the enzyme is EF-2 kinase.

36. The organism of claim 34, which is selected from the group consisting of rodent and nematode.