WO2000061728A2 - Human elastase i - Google Patents

Abstract

The present invention provides an isolated or recombinant polynucleotide which comprises a nucleic acid sequence encoding a mutant of human elastase I. The mutant elastase I has a frame shift mutation in any one of codons (207 to 225), preferably codon (208) and may be a contributory factor in hyperproliferative skin diseases, such as psoriasis, eczema, lupus erythmatosus, erythema, and possibly cancer.

Description

Enzyme

The present invention relates to elastase, nucleic acids coding therefor and uses of these in medicine.

Elastase (EC 3.4.21.36.) is a member of a group of enzymes termed "serine proteases" which are characterised by the reactivity of a serine residue in the active site of the enzyme. Elastase breaks down elastin, the specific protein of elastic fibres, and digests other proteins such as fibrin, haemoglobin and albumin. Three structurally related types of elastase, named elastases I, II and III (or protease E), have been identified, with several isoforms being secreted by the mammalian exocrine pancreas (MacDonald et al, 1982; Kawashima et al, DNA 6:163-172, 1987; Tani et al, JBiol Chem 263:1231-1239, 1988; Shirasu et al, JBiochem (Tokyo) 104:259-264, 1988).

The gene coding for human elastase I (ELA1) maps to chromosome 12ql3 (Davies et al, Genomics 29:766-768, 1995). Despite the apparent structural integrity of the ELA1 gene, it is reported to be transcriptionally silent (Tani et al, JBiochem (Tokyo) 101:591-599, 1987; Kawashima et al, DNA Seq 2:303 -312, 1992). The evolutionary silencing of the human elastase I gene in pancreatic acinar cells appears to be due to mutations that inactivate enhancer and promoter elements (Rose et al, Hum Mol Genet 6:897-903, 1997) which are crucial for pancreas specific transcription (Roux et al, Genes Dev 3:1613-1624, 1989; Swift et al, Genes Dev 3:687-696, 1989; Swift et al, J Biol Chem 269:12809-12815, 1994; Rose et al, Mol CellBiol 14:2048-2057, 1994; Kruse et al, Mol Cell Biol 15:4385-4394, 1995). Dot blotting of human tissue mRNAs from kidney, heart, liver, aortic intima and peripheral blood lymphocytes has failed to

32 detect hybridisation to P- labelled human elastase I DNA probe. Elastase I rnRNA was also not detected in the human kidney, liver or heart by the more sensitive RT- PCR technique (Kawashima et al, DNA Seq 2:303 -312, 1992). It should be noted that when in the literature human elastase I activity in the pancreas is described, it is in fact elastase IIA. The nucleotide sequence of the mature mRNA for human elastase I has not yet been reported and only a synthetic putative mRNA sequence (Accession: E01447) predicted from genomic sequence, and its comparison with the nucleotide sequence of the rat elastase I gene and rat cDNA, is available (Kawashima et al, DNA Seq 2:303 -312, 1992) (and partial cDNA 142 bp fragment Accession: D00159).

The inventors have now demonstrated using immunohistochemistry that an elastase is localised in the basal cell layer of the mammalian skin. The inventors have also found that mRNA coding for elastase I is expressed in cultured keratinocytes, and have obtained from this a cDNA sequence which differed from the sequence predicted from the genomic sequence (Kawashima et al, DNA Seq 2:303 -312, 1992) by two base substitutions. Sequencing and analysis of genomic DNA from a number of individuals surprisingly revealed a sequence variant which results in the truncation of elastase I protein. Secondary structure analysis of the truncated variant showed that it would not necessarily lead to the disruption of the active site, although the truncation may result in the disruption of the normal function of the protein, possibly by affecting the formation of the substrate/enzyme complex. While the inventors do not wish to be bound by theory, it is possible that the mutant protein can no longer digest proteins such as elastin and BPAG2. This means that cells may not become detached on differentiation, resulting in a thickening of the skin. Thus, carriers of this variant may be at greater risk of developing hyperproliferative skin conditions, such as eczema, psoriasis, lupus erythmatosus and erythema. Such uncontrolled cell division may also implicate the variant as a risk factor for cancer.

According to a first aspect of the present invention, there is provided an isolated or recombinant polynucleotide comprising a nucleic acid sequence encoding a mutant of human elastase I, the nucleic acid sequence comprising the sequence of Figure 3 with a frame shift mutation in any one of codons 207 to 225.

The frame shift mutation results in the disruption of the C-terminal end of the protein, possibly affecting substrate binding. Preferably, the frame shift mutation is a single base insertion in codon 208. This single base insertion results in truncation of the wild type protein by 26 amino acids at the C-terminal end thereof. The nucleic acid is preferably a cDNA and the single base inserted is preferably a cytosine nucleotide.

According to a second aspect of the present invention, there is provided an isolated polypeptide comprising a mutant of human elastase I which comprises the amino acid sequence shown in Figure 5 (ELAl var) or has substantial sequence identity with that sequence.

Because of the disruption caused by the mutation, the variant protein may be a contributory factor in hypeφroliferative skin diseases, such as psoriasis, eczema, lupus erythmatosus, erythema, and possibly cancer. Therefore, detection of the variant will provide an indication of the predisposition of a subject to such conditions.

Thus, according to a third aspect of the present invention, there is provided a method of determining the predisposition of a subject to a hypeφroliferative skin condition or cancer, the method comprising detecting in the subject the presence of an allele of ELA1, wherein said allele encodes a mutant of human elastase I and has a frame shift mutation in any one of codons 207 to 225 of the nucleic acid sequence of Figure 3.

The frame shift mutation may be a single base insertion in codon 208, and the single base inserted may be a cytosine nucleotide.

The allele may be detected by sequencing a genomic DNA segment from chromosome 12ql3 of the subject.

Alternatively, detection of the allele may be by (i) mixing a nucleic acid sample from the subject with one or more polynucleotide probes capable of hybridising selectively to an ELA1 allele in a reaction and (ii) monitoring the reaction to determine the presence of the gene allele in the sample, thereby indicating whether the subject is at risk for a hypeφroliferative skin condition or cancer.

There are several methodologies available from recombinant DNA technology which may be used for detecting and identifying a genetic mutation responsible for the disruption of elastase I. These include direct probing, polymerase chain reaction (PCR) methodology and single strand conformational analysis (SSCA).

Detection of point mutations using direct probing involves the use of oligonucleotide probes which may be prepared synthetically or by nick translation. The DNA probes may be suitably labelled using, for example, a radiolabel, enzyme label, fluorescent label, biotin-avidin label and the like for subsequent visualisation in for example a Southern blot hybridization procedure. The labelled probe is reacted with the sample DNA bound to a nitrocellulose or Nylon 66 substrate. The areas that carry DNA sequences complementary to the labelled DNA probe become labelled themselves as a consequence of the reannealling reaction. The areas of the filter that exhibit such labelling may then be visualized, for example, by autoradiography.

Alternative probing techniques, such as ligase chain reaction (LCR) involve the use of mismatch probes, i.e., probes which have full complementarity with the target except at the point of the mutation. The target sequence is then allowed to hybridize both with oligonucleotides having full complementarity and oligonucleotides containing a mismatch, under conditions which will distinguish between the two. By manipulating the reaction conditions it is possible to obtain hybridization only where there is full complementarity. If a mismatch is present then there is significantly reduced hybridization.

The polymerase chain reaction (PCR) is a technique that amplifies specific DNA sequences with remarkable efficiency. Repeated cycles of denaturation, primer annealing and extension carried out with a heat stable enzyme Taq polymerase leads to exponential increases in the concentration of desired DNA sequences. Given a knowledge of the nucleotide sequence encoding elastase I, it is possible to prepare synthetic oligonucleotides complementary to sequences which flank the DNA of interest. Each oligonucleotide is complementary to one of the two strands. The DNA is then denatured at high temperatures (e.g., 95°C) and then reannealed in the presence of a large molar excess of oligonucleotides. The oligonucleotides, oriented with their 3' ends pointing towards each other, hybridize to opposite strands of the target sequence and prime enzymatic extension along the nucleic acid template in the presence of the four deoxyribonucleotide triphosphates. The end product is then denatured again for another cycle. After this three-step cycle has been repeated several times, amplification of a DNA segment by more than one million fold can be achieved. The resulting DNA may then be directly sequenced in order to locate any genetic alteration. Alternatively, it may be possible to prepare oligonucleotides that will only bind to altered DNA, so that PCR will only result in multiplication of the DNA if the mutation is present. Following PCR, allele-specific oligonucleotide hybridization (Dihella et al. (1988) Lancet 1:497) may be used to detect the mutation. Alternatively an adaptation of PCR called amplification of specific alleles (PAS A) can be employed; this uses differential amplification for rapid and reliable distinction between alleles that differ at a single base pair.

In yet another method, PCR may be followed by restriction endonuclease digestion with subsequent analysis of the resultant products.

Single strand conformational analysis (SSCA) (Orita et al. (1989) Genomics 5:874 and Orita et al. (1990) Genomics 6:271) offers a relatively quick method of detecting sequence changes which may be appropriate in at least some instances.

PCR amplification of specific alleles (PAS A) is a rapid method of detecting single- base mutations or polymoφhisms (Newton et al. (1989) Nucleic Acids Res. 17:2503; Nichols et al. (1989) Genomics 5:535; Okayama et al. (1989) J. Lab. Clin. Med,

114:105; Sarkar et al. (1990) Anal. Biochem. 186:64; Sommer et al. (1989) Mayo Clin. Proc. 64:1361; Wu (1989) Proc. Natl. Acad. Sci. U.S.A 86:2757; and Dutton et al. (1991) Biotechniques 11:700). PASA (also known as allele specific amplification) involves amplification with two oligonucleotide primers such that one is allele- specific. The desired allele is efficiently amplified, while the other allele(s) is poorly amplified because it mismatches with a base at or near the 3' end of the allele-specific primer.

Similarly, a method known a ligase chain reaction (LCR) has been used successfully to detect a single-base substitution in a haemoglobin allele that causes sickle cell anaemia (Barany et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88:189; Weiss (1991)

Science 254: 1292). LCR probes may be combined, or multiplexed for simultaneously screening for multiple different mutations.

The method disclosed in WO98/14616 may be used to detect the polymoφhism. In this method, the nucleic acid sample to be analysed is separated into single strands, one of which is a target strand. A primer sequence is prepared which is complementary to the target strand up to and including the base adjacent the single nucleotide polymoφhism and is annealed to the target strand. Then, each of the possible complementary bases in the form of dideoxynucleotides together with a DNA polymerase is added to the target-primer complex. The dideoxynucleotide base which is complementary to the polymoφhism is incoφorated into the primer sequence and causes no further bases to be added. The extended primer sequence can then be analysed by mass spectroscopy to determine the complementary base added thereto and hence the identity of the base at the site of the polymoφhism.

Alternatively, the method disclosed in WO92/15712 can be used to determine which allele of ELA1 is present. This method is similar to the method of WO98/14616 in that a primer is prepared and annealed to the target sequence and the primer is extended and terminated by a single dideoxynucleotide base. However, in this method, the added dideoxynucleotide base is detected by way of a specific label, such as a fluorophore, attached thereto. Another method for detecting the different alleles utilises the fact that the respective alleles differ by one nucleotide in length. Thus, PCR can be carried out using two sets of PCR primers, one set specific for one allele and the other set specific for the other allele. The respective products of the PCR reaction can then be separated on a sequencing gel and detected either by radiation or fluorescent nucleotide detection.

Detection of the allele may comprise (i) mixing in an ------munological assay a human elastase I protein sample from the subject with an antibody reagent specific for the allele and (ii) monitoring the assay to determine specific binding between the antibody reagent and the protein sample, thereby indicating whether the subject is at risk for a hypeφroliferative skin condition or cancer.

The antibody reagent may be a monoclonal antibody specifically reactive with an antigenic determinant specific for an allele, preferably with a polypeptide in accordance with the second aspect of the invention. Such a monoclonal antibody forms a fifth aspect of the invention.

Monoclonal antibodies can be produced from hybridomas. These can be formed by fusing myeloma cells and spleen cells which produce the desired antibody in order to form an immortal cell line. This is the well known Kohler & Milstein technique (Nature 256 52-55 (1975)).

Techniques for producing monoclonal and polyclonal antibodies which bind to a particular protein are well developed in the art. They are discussed in standard immunology textbooks, for example in Roitt et al Jmmunology second edition (1989), Churchill Livingstone, London.

In addition to whole antibodies, the present invention includes derivatives thereof which are capable of binding to the polypeptide of the second aspect of the present invention. Thus, the present invention includes antibody fragments and synthetic constructs. Examples of antibody fragments and synthetic constructs are given by Dougall et al in Tibtech 12 372-379 (September 1994).

Antibody fragments include, for example, Fab, F(ab')2 and Fv fragments (see Roitt et al [supra]). Fv fragments can be modified to produce a synthetic construct known as a single chain Fv (scFv) molecule. This includes a peptide linker covalently joining Nh and Ni regions which contribute to the stability of the molecule.

Other synthetic constructs include CDR peptides. These are synthetic peptides comprising antigen binding determinants. Peptide mimetics may also be used. These molecules are usually conformationally restricted organic rings which mimic the structure of a CDR loop and which include antigen-interactive side chains.

Synthetic constructs include chimaeric molecules. Thus, for example, humanised (or primatised) antibodies or derivatives thereof are within the scope of the present invention. An example of a humanised antibody is an antibody having human framework regions, but rodent hypervariable regions. Synthetic constructs also include molecules comprising a covalently linked moiety which provides the molecule with some desirable property in addition to antigen binding. For example the moiety may be a label (e.g. a fluorescent or radioactive label) or a pharmaceutically active agent.

The antibodies or derivatives thereof of the present invention have a wide variety of uses. They can be used in purification and/or identification of the polypeptide in accordance with the second aspect of the present invention. They can be provided in the form of a kit for screening for the polypeptide of the present invention. According to a sixth aspect of the present invention, there is provided a method for genetic analysis of a human subject which comprises detecting the presence or absence of at least one polymoφhism at codon 208 of the ELA1 gene.

In a further aspect, the invention provides a method of screening for an agent useful in the treatment of a hypeφroliferative skin condition or cancer, comprising screening test compounds for activity in inhibiting or potentiating the activity of the polypeptide of the second aspect of the invention. Also included within the scope of the invention are agents detected by this screening method; the use of such agents in the manufacture of a medicament for the treatment of hypeφroliferative skin disease or cancer; a pharmaceutical composition comprising such agents and a pharmaceutically acceptable carrier; a kit comprising such agents, optionally including instructions for the use of said agents; and a method of treatment of a hypeφroliferative skin disease or cancer comprising administering to a patient a pharmaceutically effective amount of one or more said agents or a pharmaceutical composition including one or more of said agents.

The invention also provides an isolated or recombinant polynucleotide comprising the nucleic acid sequence of Figure 3 of the accompanying drawings.

The invention also provides an isolated or recombinant polynucleotide comprising the nucleic acid sequence of Figure 5 of the accompanying drawings.

Polynucleotides in accordance with the present invention can be inserted into vectors and cloned to provide large amounts of DNA or RNA for further study. Suitable vectors may be introduced into host cells to enable the expression of polypeptides of the present invention using techniques known to the person skilled in the art.

Techniques for cloning, expressing and purifying proteins and polypeptides are well known to the skilled person. Various such techniques are disclosed, for example, in

Sambrook et al [Molecular Cloning 2nd Edition, Cold Spring Harbor Laboratory Press (1989)]; in Old & Primrose [Principles of Gene Manipulation 5th Edition, Blackwell Scientific Publications (1994); and in Stryer [Biochemistry 4th Edition, W H Freeman and Company (1995)]. By using appropriate expression systems, polypeptides in accordance with the present invention may be expressed in glycosylated or non- glycosylated form. Non-glycosylated forms can be produced by expression in prokaryotic hosts, such as E. coli.

Polypeptides comprising N-terminal methionine may be produced using certain expression systems, whilst in others the mature polypeptide will lack this residue.

Thus, the invention also provides a vector comprising a polynucleotide in accordance with the first aspect of the invention, and a host comprising such a vector. A polypeptide in accordance with the second aspect of the invention may be obtained by a method comprising incubating such a host under conditions causing expression of the polypeptide and then purifying the polypeptide.

It will be appreciated by those skilled in the art that the polynucleotides and polypeptides in accordance with the invention can vary from the sequences shown in the Figures.

Thus, the amino acid sequences given in Figure 5 A may have an additional N-terminal and/or an additional C-terminal amino acid sequence, which may be provided for various reasons. Techniques for providing such additional sequences are well known in the art.

Additional sequences may be provided in order to alter the characteristics of a particular polypeptide. This can be useful in improving expression or regulation of expression in particular expression systems. For example, an additional sequence may provide some protection against proteolytic cleavage. Additional sequences can also be useful in altering the properties of a polypeptide to aid in identification or purification. For example, a fusion protein may be provided in which a polypeptide is linked to a moiety capable of being isolated by affinity chromatography. The moiety may be an antigen or an epitope and the affinity column may comprise immobilised antibodies or immobilised antibody fragments which bind to said antigen or epitope (desirably with a high degree of specificity). The fusion protein can usually be eluted from the column by addition of an appropriate buffer.

Additional N- or C-terminal sequences may, however, be present simply as a result of a particular technique used to obtain a substance of the present invention and need not provide any particular advantageous characteristic.

Furthermore, the skilled person will appreciate that various changes can often be made to the amino acid sequence of a protein to produce variants (sometimes known as "muteins"). An example of a variant of the present invention is a polypeptide in accordance with the second aspect of the invention, or encoded by the polynucleotide of Figures 3 or 5, apart from the substitution of one or more amino acids with one or more other amino acids. The skilled person is aware that various amino acids have similar properties. One or more such amino acids of a substance can often be substituted by one or more other such amino acids without eliminating a desired activity of that substance. Thus, the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains). Of these possible substitutions it is preferred that glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine and isoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic). Other amino acids which can often be substituted for one another include: phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains); lysine, arginine and histidine (amino acids having basic side chains); aspartate and glutamate (amino acids having acidic side chains); asparagine and glutamine (amino acids having amide side chains); and cysteine and methionine (amino acids having sulphur containing side chains). Substitutions of this nature are often referred to as "conservative" or "semi- conservative" amino acid substitutions. Amino acid deletions or insertions may also be made relative to the amino acid sequence. Amino acid insertions can also be made to alter the properties of a substance (e.g. to assist in identification, purification or expression, as explained above in relation to fusion proteins).

Amino acid changes can be made using any suitable technique e.g. by using site-directed mutagenesis. Amino acid substitutions or insertions can be made using naturally occurring or non-naturally occurring amino acids. Whether or not natural or synthetic amino acids are used, it is preferred that only L- amino acids are present.

The degree of amino acid sequence identity can be calculated using a program such as "bestfit" (Smith and Waterman, Advances in Applied Mathematics, 482-489 (1981)) to find the best segment of similarity between any two sequences. The alignment is based on maximising the score achieved using a matrix of amino acid similarities, such as that described by Schwarz and Dayhof ( 1979) Atlas of Protein Sequence and Structure,

Dayhof, M.O., Ed pp 353-358.

It will be appreciated by those skilled in the art that the isolated or recombinant polynucleotides in accordance with the present invention need not have a sequence identical to that shown in the accompanying drawings, owing to the degeneracy of the genetic code.

The present invention also includes nucleic acid molecules complementary to the polynucleotides discussed above. Thus, for example, both strands of a double stranded nucleic acid molecule are included within the scope of the present invention (whether or not they are associated with one another). Also included are mRNA molecules and complementary DNA molecules (eg.cDNA molecules).

Nucleic acid molecules which can hybridise to any of the nucleic acid molecules discussed above are also covered by the present invention. Such nucleic acid molecules are referred to herein as "hybridising" nucleic acid molecules. Hybridising nucleic acid molecules can be useful as probes or primers, for example, particularly when they can hybridise specifically. Desirably such hybridising molecules are at least 10 nucleotides in length and preferably are at least 25 or at least 50 nucleotides in length.

Desirably the hybridising molecules will hybridise to such molecules under stringent hybridisation conditions. One example of stringent hybridisation conditions is where attempted hybridisation is carried out at a temperature of from about 35°C to about 65°C using a salt solution which is about 0.9 molar. However, the skilled person will be able to vary such conditions as appropriate in order to take into account variables such as probe length, base composition, type of ions present, etc.

An elastase inhibitor Skin-derived Anti-LeukoProteinase (SKALP: Schalkwijk et al, BrJ Dermatol 122:631-641, 1990, Schalkwijk et al, Biochim Biophys Acta 1096:148- 154, 1991), also referred to as elafin (Wiedow et al, JBiol Chem 265:14791-14795, 1990), has been isolated from the skin of patients with scaling skin disorders (Chang,

A. et al, 1990). SKALP has been shown to be a potent and specific inhibitor of porcine pancreatic elastase and human leukocyte elastase (Wiedow et al, JBiol Chem 265:14791-14795, 1990) as well as proteinase 3, an elastin degrading enzyme of neutrophils (Wiedow et al, Biochem Biophys Res Commun 174:6-10, 1991). The crystal structure and inhibitory mechanism of SKALP/elafin was determined from its complex with porcine pancreatic elastase (Tsunemi et al, Biochem 35:11570-11576, 1996) - the porcine homologue of human elastase I. This suggests that SKALP inhibits elastase I.

SKALP is expressed by epidermal keratinocytes under hypeφroliferative conditions such as psoriasis (Chang, A. et al, 1990; Schalkwijk et al, BrJ Dermatol 122:631-641, 1990, Schalkwijk et al, Biochim Biophys Acta 1096:148-154, 1991; Wiedow et al, J Invest Dermatol 101:305-309, 1993; Nonomura et al, J Invest Dermatol 103:88-91, 1994) and wound healing (van Bergen et al, Arch Dermatol Res 288:458-562, 1996). It has also been reported to be present in many other adult epithelia that are exposed to environmental stimuli: tongue, plate, lingual tonsils, gingiva, pharynx, epiglottis, vocal fold, esophagus, uterine cervix, vagina, hair follicle (Pfundt et al, J Clin Invest 98:1389-1399, 1996). In all of these tissues, the presence of inflammatory cells is physiological and SKALP expression is believed to protect against leukocyte proteases, thereby helping to maintain epithelial integrity.

The inventors have shown that elastase I is mainly restricted to the basal, less differentiated layer of the epidermis. SKALP on the contrary has never been found in the basal layer in any type of epithelial tissue. Indeed, SKALP is virtually absent in normal human epidermis. This suggests that SKALP does not interfere with the normal physiological role of elastase I in skin. However, it is possible that the truncated variant of elastase I may in some way disrupt this normal physiological role, causing carriers of the variant to be at greater risk of developing hypeφroliferative skin diseases or cancer.

The inventors have cloned and sequenced a full length transcript of pancreatic elastase

I from cultured human skin keratinocytes. They have also found a nucleotide polymoφhism in the coding region of the ELA1 gene, which would lead to truncation of the protein and potentially destabilisation of the elastase-SKALP complex. The prior art documents mentioned in this specification are hereby incoφorated by reference to the extent allowable by the relevant jurisdiction.

The present invention will now be described further in the following non-limiting examples. Reference is made to the accompanying drawings in which:

Figure 1 is a photograph of a cryosection, showing of the results of immunostaining of normal human sole skin for pancreatic elastase-like proteins in which a) shows a non-stained control section (secondary AB only) and b) shows a section stained with anti-PPE rabbit monoclonal antibody; Figure 2 is a photograph of an agarose gel showing the results of RT-PCR of the known human pancreatic elastases I, II and III from total RNA preparations from keratinocytes (K) and pancreas (P);

Figure 3 shows the sequence of human elastase I cDNA as obtained from primary keratinocytes and the amino acid translation of the coding region;

Figure 4 is a comparison of the sequencing traces of a polymoφhic locus found in exon 7 of ELAl, the top shows a wild type individual for the variant, the middle shows a heterozygous individual for the variant, and the bottom shows a homozygous individual for the variant;

Figure 5 shows the sequence of the variant human elastase I cDNA as obtained from primary keratinocytes; and

Figure 6A shows a comparison of the amino acid sequence of the porcine pancreatic elastase (EL1 PIG), human elastase I (ELAl hum) and the human elastase I truncated variant (ELAl var), and Figure 6B shows the protein secondary structure predictions for the ELAl hum (top) and ELAl_var (bottom) using SOPM software.

Materials and Methods

Immunohistochemistry

Immunostaining was performed on 4-5 μm frozen skin sections on Superfrost® Plus ('BDH' Laboratory Supplies, Merck) microscope slides. Fresh skin was snap frozen in liquid nitrogen and stored at -70°C. The material was cryosectioned, the sections air dried and stained by standard immunohistochemistry protocols. The sections were stained using DAKO EnNision™ + System HRP (DAB) (DAKO Coφoration, Caφinteria, CA, USA) following the manufacturers instructions. The tissue sections were blocked with normal swine serum (diluted 1 :5 in PBS A) before incubation with the primary antibody. Anti-porcine pancreatic elastase rabbit monoclonal antibody (Chemicon International Inc., Temecula, CA, USA) was diluted 1 :5000 in PBSA with 0.1% BSA. Control sections were incubated with phosphate buffered saline (PBSA), 0.1% bovine serum albumin (BSA) instead of the primary antibody. Anti-human leukocyte elastase mouse monoclonal antibody from DAKO was used in dilutions 1:50 and 1:100.

RNA isolation

Human skin primary keratinocytes were cultured with irradiated mouse 3T3 feeders as described in Navsaria et al, Keratinocyte methods. (Leigh, IM, Watt, FM eds; Cambridge University Press), pp 5-12, 1994. Total RNA from confluent keratinocyte cultures and snap frozen tissue samples was isolated with RNAzolTM β (Tel-Test Inc., Friendswood, TX, USA) in a single-step procedure according to manufacturers instructions. The quality and integrity of the extracted total RNA were checked by visual inspection of the 18S and 28S rRNA in ethidium-bromide-stained agarose gels (not shown).

RT-PCR and cDNA cloning

For RT-PCR GeneAmp® RNA PCR Kit (Perkin-Elmer) was used. Total RNA samples were heated to 65°C for 2 minutes to disrupt secondary structures which could mask the polyA segment of the mRNA and 1 μg of RNA pipeted directly into the master mix containing 2.5 μM oligo d(T)¹⁶, 50 mM KC1, 5mM MgC_2, 10 mM

Tris-HCl pH 8.3, dNTPs lmM each, RNase inhibitor 1 U/μl and 2.5 U/μl MuLN Reverse transcriptase, final volume 20 μl. The reactions were incubated at room temperature for 10 minutes for primer annealing and reverse transcription was performed for 30 min at 42°C in a hot top PCR machine, followed by 5 min 99°C denaturation and 5 min 5°C cooling step. For the PCR step, gene specific primers and I unit of Taq polymerase were added and the reactions diluted to 2.2 mM Mg CI2 and

0.2 mM dΝTP, in final volume of 100 μl. Amplification was carried out for 40 cycles, with denaturation at 95°C for 30s, annealing 61 °C for 1 min and extension at 72°C for 2 min in a Perkin-Elmer DNA thermal cycler .

Two overlapping PCR fragments covering the full length human pancreatic elastase I transcript were amplified using the primers pairs: forward primer

5'CAAGAAGGCAGTGGTCTACT 3' and reverse primer

5'CTGACATCCAGAGCGAACTC3' yielding a 639bp N-terminal fragment and the forward primer 5'CAATGGGCAGCTGGCCCAGA3' with the reverse primer 5 CGCAAGTCCTATTGCAGATC3' for the 370 bp C-terminal fragment. The 125 bp overlapping region of these two fragments contains a unique Pst I site. The PCR products were resolved in a 1.5% agarose gel. The fragments were gel purified using GeneClean (Bio 101, Inc. Vista, CA, USA ) and subcloned into pGEM-T vector (Promega, Madison, WI, USA). The clones were sequenced in both directions using PCR as well as additional internal primers. Further fragments from different primary keratinocyte cultures of different skin types were purified and sequenced directly, however 45 PCR cycles were required to create enough 639bp template for direct sequencing.

The RT-PCR primers for detection of human elastase II or elastase III were designed to recognise all known isoforms of the corresponding enzymes. The known mRNA sequences were aligned and primers chosen based on the mRNA full identity regions.

RT-PCR primer sequences for elastase II (ELS2), based on mRNA sequences submitted to Genbank (Accessions: D00236, E01220, M16631, M16652, M16653) were:

421 bp 5' fragment: forward primer 5' GCTGGAGCCCTCAGTTGTGGG 3' reverse primer 5' TGTTGGGTAGAATGGTGCCGG 3' 520 bp 3' fragment: forward primer 5' AGTCCGGCTCGCTGGCAG 3' reverse primer 5' GCAATCACCGAATTGATCCAGTCG 3'

and elastase in (EL3)(Genbank Accessions: M18692 J03516, E01257):

430 bp 5' fragment: forward primer 5' GCTCAGTTCCCTCCTCCTTGTGG 3' reverse primer 5' ACCAGCCGGAGGGAGTGAGG 3'

615 bp 3' fragment: forward primer 5' GCTCCCGGACCTACCAGGTGG 3' reverse primer 5' TCGATCAGCACTGCCAGCTGG 3'

Sequencing of genomic DNA

DNA was isolated from human blood samples using Nucleon® BACC3 DNA extraction kit (Nucleon Biosciences, Strathclyde, UK) according to manufacturers instructions. PCR reactions were typically performed with AB Thermostable DNA polymerase and reaction buffer ('Advanced Biotechnologies', Epsom, Surrey, UK) at 60-62°C primer annealing.

Primers for the PCR amplification of the human elastase I from the genomic DNA primers were designed based on the sequence in the GenBank (Submission by Kawasima et. al 1992; Accession: X62252-X62259). For the exons where only a few basepairs of flanking sequence were available in the public domain, primers were placed in the exon to amplify the introns. Long range Advantage® Genomic Polymerase mix (Clontech, Palo Alto, CA, USA) and 68°C annealing temperature was used for PCR of the long fragments. For intron 6 a Genome Walking approach (as described in Siebert et al, Nucleic Acids Res 23:1087-1088, 1995 was required. The adaptor-ligated genomic DNA fragment libraries and adaptor specific primers were a generous gift from Dr. Ian Gray. The primary PCR reaction was performed using the outer adaptor primer and an outer gene specific primer in the middle of the neighbouring exon. Thereafter the primary reactions were diluted 50 fold and a "nested" PCR reaction was performed using corresponding inner primers. The nested PCR yielded clear single bands, which were column purified and sequenced directly.

Primer sequences designed based on the obtained intron sequences were used to screen the coding region and splice sites of the human elastase I for mutations/polymoφhism. The primer pairs which amplify the 8 exons of the ELAl gene are as follows (these primers form aspects of the invention):

EXON 1 :

Forward primer: 5' ATGGATGACAAGGGGTGCTCCC 3' Reverse primer: 5' GGGCCTGAATAGCCAGTGGCC 3'

EXON 2: Forward primer: 5' CTCAGAGAACTCACAGCTGGGCC 3' Reverse primer: 5' ACCACCTAAGCCTGATCCCATCC 3'

EXON 3:

Forward primer: 5' CAGCTCNTAGGCTCAACTGATCCTC 3' Reverse primer: 5' GAGAGGGCAAAATTATATCCTCTTTCAG 3'

EXON 4: Forward primer: 5 'CCATTCTCCTATCTCTAAAGTGGGC 3'

Reverse primer: 5' CTCCTGGACGAATGAGCCAGC 3'

EXON 5: Forward primer: 5' GCTGCAATACCAATGTCCCACC 3' Reverse primer: 5' CCTGGTCTCTGGCCATAAGCAC 3' EXON 6:

Forward primer: 5 ' CCTGAGCTCAGCTTTCACGAGAG 3 '

Reverse primer: 5 ' AAGTGAGGGC ATCGAGC AAGATC 3 '

EXON 7:

Forward primer: 5 ' TTT AGG ATTCTGTTTCTCCTCCCTGC 3 '

Reverse primer: 5 ' AAGGAAGATGACGGCTTGCCC 3 '

EXON 8: PCR forward primer: 5 ' GCTTGAGAGTT AGGTGAGGCTCTG 3 ' Reverse primer: 5 ' AGGGACCCCTGCTCTGGAGG 3 '

Sequenced forward with: 5 ^l GCTCACGGCCATTTCAAGGTC 3 '

The PCR products were purified using QIAquick PCR purification columns (QIAgen) and sequenced on both strands using the ABI PRISM^M Rhodamine or BigDye® terminator sequencing ready reaction mix (Perkin Elmer) on an ABI 377 automatic sequencer.

Example 1 - A pancreatic elastase-like protein is present in normal human skin

An antibody raised against the porcine pancreatic elastase (PPE), which has 89% amino acid identity with its human homologue (an alignment of the respective sequences is shown in Figure 5 A), was used to screen sections of normal human skin for the presence and localisation of the ELAl protein. The antibody detected expression of an elastase-like protein in the basal layer of normal human epidermis from breast, palm, sole and foreskin.

The results of the immunohistochemical staining of human sole skin with the anti- porcine pancreatic elastase antibody are shown in Fig 1 , where a clear continuous staining of the basal cell layer of epidermis can be seen in b), suggesting that a pancreatic elastase-like protein is present in human skin. An antibody directed against human leukocyte elastase did not recognise this protein (not shown).

The presence of a pancreatic elastase-like protein in human skin raises the question of whether the changes in the promoter enhancer region of the human elastase I gene (Rose et al, Hum Mol Genet 6:897-903, 1997) do not affect its expression in skin or have redirected expression from the pancreas to skin. Accordingly, cryosections of pig and mouse skin were stained with the same anti-PPE antibody. The antibody clearly stained the basal layers of these skin sections, but also the hair follicle and the sebaceous gland epithelia. These observations suggest that a similar protein is present in the skin of other mammals which are known to express the enzyme in the pancreas.

Example 2 - Normal human keratinocytes express elastase I (ELAl)

Due to the high level of amino acid conservation between pancreatic elastases, cross reactivity of the anti-PPE antibody with the other two known pancreatic elastases could not be excluded. Very weak staining of acinary cells in cryosections from human pancreas could be observed at higher concentrations of the anti-PPE antibody, although pancreatic elastase I has been shown to be absent in human pancreas. This suggests that the antibody can also detect other pancreatic elastases.

Therefore, mRNA specific primers for all three known human pancreatic elastase genes (ELAl, ELS2 and EL3) were made to investigate mRNA expression in human cultured keratinocytes and fresh pancreatic tissue by RT-PCR (see Materials and Methods).

Two nucleotide polymoφhisms have been suggested in the exon 1 sequence of the ELAl gene (Kawashima et al, DNA Seq 2:303 -312, 1992; Accessions X62258, X62259). A gene specific primer was therefore designed in the region upstream of the translation start codon, which is identical in both sequence variants. The results are shown in Figure 2, in which K indicates the fragments isolated from keratinocytes and P indicates those isolated from pancreas. It can be seen that the two ELAl specific fragments could be found in the keratinocyte total RNA preparation (lanes 1 ,2), but not in the pancreas total RNA preparation.

RT-PCR amplified 4 fragments of the expected size (421 bp & 520 bp fragments of elastase II (lanes 7, 8) and 430 bp & 615 bp fragments of elastase III (lanes 11, 12)) from the total RNA preparation from human pancreas. However, these fragments were not detected in cultured human primary keratinocytes (lanes 5 ,6 ,9 & 10).

This suggests that the protein detected by the anti-PPE antibody in the epidermis is likely to be human elastase I.

Example 3 - cDNA sequence analysis

The respective 640 and 370 bp fragments, which were obtained by RT-PCR from the human keratinocyte total RNA (see Fig 2, lanes 1,2) and cover the full length of the gene coding sequence, were subcloned into pGEM-T. The 125 bp overlapping region of these two fragments contains a unique Pst I site. Sequencing was carried out as described in the Materials and Methods.

The full length cDNA sequence of human elastase I (GenBank accession number: AF 120493) and the amino acid translation of the coding region obtained by sequencing is shown in Figure 3.

In Figure 3, underlined nucleotides denote differences between the sequence and the one proposed by Kawashima et al, DNA Seq 2:303 -312, 1992. Thus, the cDNA sequence contains two nucleotide substitutions (t -> c in exon 3 and g --> a in exon 7) as compared to the proposed sequence. These substitutions lead to exchange of the coded amino acids: Tφ-44 is replaced by an Arg residue and Arg-243 is replaced by a Gln residue. The same nucleotide differences were also found in all of our genomic DNA samples (see text below). However, these changes may reflect an allelic polymoφhism between Caucasian and Mongolian populations.

The amino acids of the catalytic triad (His-63, Asp-111 and Ser-206) are printed in bold with double underlining. Bold script with single underline highlights the Nal-227 and Thr-239 residues present at the mouth of the substrate binding pocket, which contribute to the substrate specificity of elastase I. The amino acids printed in bold italic are involved in the primary contact of the enzyme complex with elafin (SKALP).

Although two alternative splice variants of the exonl of the gene (Accession X62258) differing by 40 bp in length have been proposed (Kawashima et al, DNA Seq 2:303 - 312, 1992), only the short form could be identified here, implying that the first splice site is preferentially used for mRΝA splicing in keratinocytes. The signal peptide of the translated product (only 8 amino acids) is therefore too short for a secretory enzyme. Although not likely to be secreted, elastase I could be involved in the detachment of cells from the basement membrane upon their movement to the upper layers.

Total RΝA preparations of primary keratinocytes cultured from normal human skin of different body sites (breast, abdomen, palm), as well as from individuals of different ethnic and racial origin were positive for the two human elastase I RT-PCR fragments. A RT-PCR product could also be obtained from normal skin total RΝA samples.

Example 4 - A polymorphism is present immediately downstream of the active site of the enzyme

The coding region of the ELAl gene (including splice sites) in genomic DΝA was screened in a number of individuals. This sequencing revealed a single nucleotide polymoφhism in exon 7. The sequencing traces of wild type (top), heterozygous (middle) and homozygous (bottom) individuals for the variant are compared in Figure 4.

The insertion of an extra C is revealed as an extra G on the reverse strand (3'-> 5'), as shown with an arrow. The insertion is in a potential mutation "hot spot" comprised of a stretch of 5 guanine and followed by 5 cytosine nucleotides.

Referring to Figure 3, it can be seen that this "hot spot" lies directly downstream from the sequence encoding the active site pocket of the enzyme, and that the insertion in the variant leads to a frame shift causing an early stop codon and shortening the putative 258 amino acid protein by 26 amino acids. The nucleotide sequence of the variant is shown in Figure 5.

The amino acid sequences of the human elastase gene (ELAl_hum) and of its truncated variant (ELAl var) are compared in Figure 6A. The amino acids of the catalytic triad (His-63, Asp-111 and Ser-206) are shown in bold with double underline. The amino acids printed in bold italic with double underline are involved in the primary contact of the enzyme/inhibitor complex with SKALP are shown in bold italic. Bold script with single underline highlights the Nal-227 and Thr-239 residues present at the mouth of the substrate binding pocket, which contribute to the substrate specificity of elastase I.

Screening of 70 unrelated normal individuals for this variant revealed a relatively high allele frequency (about 25%). Individuals homozygous for this mutation appear normal with no obvious skin complaints. Unfortunately, no skin biopsies were available from the individuals who are homozygous for this polymoφhism (7%) to investigate any subtle epidermal changes. Example 5 - Evaluation of polymorphism on secondary structure of ELAl

Because of the unexpectedly high frequency of the protein truncating variant among apparently normal individuals, the possible effect of the frame shift on the folding of the translated protein was evaluated.

The active site of ELAl protein includes the amino acids of the catalytic triad (His-63, Asp-111 and Ser-206). These residues, as well as all but the last of the cysteine residues which stabilise the secondary structure of the protein, are coded upstream of the frame shift and remain unaffected (see alignments in Figure 6A).

The secondary structures of the two putative gene products were analysed and compared using the SOPM protein analysis program (Geourjon et al, Prot Engineering

7:157-164, 1994). The results are shown in Figure 6B, where and the arrow indicates the active site pocket with Ser-206. On secondary structure level, the polymoφhism manifests itself in an excision of a short sheet-coil-turn-coil-turn-coil-sheet loop that precedes the terminal helix. This loop carries the key amino acid residues Nal-227 and Thr-239 present at the mouth of the substrate binding pocket, which contribute to the substrate specificity of elastase I (highlighted in Figure 3), as well as 5 of the 8 amino acids involved in the primary contact of the elafin/elastase complex formation (see Figure 3) (Tsunemi et al, Biochem 35:11570-11576, 1996). These observations suggest that the sequence variant modifies the substrate specificity of the enzyme without abolishing the inhibitor binding capability.

Claims

Claims:

1. An isolated or recombinant polynucleotide comprising a nucleic acid sequence encoding a mutant of human elastase I, the nucleic acid sequence comprising the sequence of Figure 3 with a frame shift mutation in any one of codons 207 to 225.

2. A polynucleotide as claimed in claim 1, wherein the frame shift mutation is a single base insertion in codon 208

3. A polynucleotide as claimed in claim 1 or claim 2, wherein the single base inserted is a cytosine nucleotide.

4. An isolated polypeptide comprising a mutant of human elastase I which comprises the amino acid sequence shown in Figure 6A (ELAl var) or has substantial sequence identity with that sequence.

5. A method of determining the predisposition of a subject to a hypeφroliferative skin condition or cancer, the method comprising detecting in the subject the presence of an allele of ELAl, wherein said allele encodes a mutant of human elastase I and has a frame shift mutation in any one of codons 207 to 225 of the nucleic acid sequence of

Figure 3.

6. A method as claimed in claim 5, wherein the frame shift mutation is a single base insertion in codon 208

7. A method as claimed in claim 6, wherein the single base inserted is a cytosine nucleotide.

8. A method as claimed in claim 5, 6 or 7, wherein the allele is detected by sequencing a genomic DNA segment from chromosome 12ql3 of the subject.

9. A method as claimed in claim 5, 6 or 7, wherein the allele is detected by (i) mixing a nucleic acid sample from the subject with one or more polynucleotide probes capable of hybridising selectively to an ELAl allele in a reaction and .

(ii) monitoring the reaction to determine the presence of the gene allele acid in the sample, thereby indicating whether the subject is at risk for a hypeφroliferative skin condition or cancer.

10. A method as claimed in claim 5, 6 or 7, wherein detection of the allele comprises (i) mixing in an immunological assay a human elastase I protein sample from the subject with an antibody reagent specific for the allele and (ii) monitoring the assay to determine specific binding between the antibody reagent and the protein sample, thereby indicating whether the subject is at risk for a hypeφroliferative skin condition or cancer.

11. A method as claimed in claim 10, wherein the antibody reagent is a monoclonal antibody specifically reactive with an antigenic determinant specific for an allele.

12. A method as claimed in claim 11, wherein the antibody reagent is a monoclonal antibody specifically reactive with the polypeptide as claimed in claim 4.

13. A monoclonal antibody specifically reactive with the polypeptide as claimed in claim 4.

14. A vector comprising a polynucleotide as claimed in claim 1, 2 or 3.

15. A host comprising a vector as claimed in claim 14..

16. A method for obtaining a polypeptide as claimed in claim 4, comprising incubating a host as claimed in claim 15 under conditions causing expression of the polypeptide and then purifying the polypeptide.