WO2000056922A2 - Genetic polymorphism and polymorphic pattern for assessing disease status, and compositions for use thereof - Google Patents

Abstract

The present invention provides methods for assessing disease status in an individual, which comprise determining the sequence at one or more polymorphic positions within the human genes encoding a protein involved in a physiologic pathway associated with a treatment regime. The invention also provides isolated nucleic acids encoding. These polymorphisms, nucleic acid probes that hybridize to polymorphic positions, kits for the prediction of disease status, and nucleic acid and peptide targets for use in identifying candidate drugs.

Description

GENETIC POLYMORPHISM AND POLYMORPHIC PATTERN FOR

ASSESSING DISEASE STATUS, AND COMPOSITIONS

FOR USE THEREOF

FTELD OF THE INVENTION

The present invention relates to genetic polymorphisms and polymorphism patterns useful for assessing disease status in humans. More particularly, the invention relates to identifying and using polymorphism patterns comprising at least one and preferably at least two polymorphisms in genes encoding proteins involved in physiologic pathways to predict a treatment outcome or likelihood of developing disease, and to assist in diagnosis and in prescription of effective therapeutic regimens.

BACKGROUND OF THE INVENTION

Various physiologic pathways have long been associated with various physiologic function and pathways of these in animals, and more specifically mammals, including humans.

For example, the renin-angiotensin-aldosterone system (RAAS) plays an important role in cardiovascular physiology in mammals. Specifically, RAAS regulates salt-water homeostasis and the maintenance of vascular tone. Stimulation or inhibition of this system raises or lowers blood pressure, respectively, and disturbances in this system may be involved in the etiology of, for example, hypertension, stroke, and myocardial infarction. The RAAS system may also have other functions such as, e.g. , control of cell growth. The renin-angiotensin system includes renin, angiotensin converting enzyme (ACE), angiotensinogen (AGT), type 1 angiotensin II receptor (ATI), type 2 angiotensin II receptor (AT2) and aldosterone synthase, as described below. Other proteins involved in cardiovascular physiology include endothelin, B-adronergic receptors, and prostaglandin receptors. Prostaglandins are also involved in the development of glaucoma.

Various pathways in central nervous system (CNS) physiology, cancer physiology, and metabolism, to mention a few examples, are knows as well. RAAS Pathway Components

International Patent Application No. PCT/IB98/00475, filed April 1, 1998, discloses for the first time an association of polymorphism patterns in ACE, AGT, and ATI genes with cardiovascular status, particularly with the ability to predict the therapeutic outcome of a particular treatment regimen.

AGT is the specific substrate of renin, an aspartyl protease. The human AGT gene contains five exons and four introns which span 13Kb (Gaillard et al , DNA 8:87-99, 1989; Fukarnizu et al , J.Biol. Chem. 265:7576-7582, 1990). The first exon (37 bp) codes for the 5' untranslated region of the mRNA. The second exon codes for the signal peptide and the first 252 amino acids of the mature protein. Exons 3 and 4 are shorter and code for 90 and 48 amino acids, respectively. Exon 5 contains a short coding sequence (62 amino acids) and the 3 '-untranslated region.

Plasma AGT is synthesized primarily in the liver and its expression is positively regulated by estrogens, glucocorticoids, thyroid hormones, and angiotensin II (Ang II) (Clauser et al , Am. J. Hypertension 2:403-410, 1989). Cleavage of the arnino- terminal segment of AGT by renin releases a decapeptide prohormone, angiotensin-I, which is further processed to the active octapeptide angiotensin II by the dipeptidyl carboxypeptidase designated angiotensin-converting enzyme (ACE). Cleavage of AGT by renin is the rate-limiting step in the activation of the renin-angiotensin system.

Several epidemiological observations indicate a possible role of AGT in blood pressure regulation. A highly significant correlation between plasma AGT concentration and blood pressure has been observed in epidemiological studies (Walker et al , J. Hypertension 1:287-291, 1979). Interestingly, a number of allelic dimorphisms have been identified in the AGT gene. The frequency of at least two of them (174M and 235T) have been partially characterized and in certain populations shown to be significantly elevated in hypertensive subjects (Jeunemaitre et al , Cell 71: 169-180, 1992). In addition, a specific polymorphism, 235T, has been suggested to be directly involved in coronary atherosclerosis (Ishigami et al , Circulation 91:951-4, 1995). Furthermore, the presence of A or G at position 1218 in the AGT regulatory region has been correlated with differences in in vitro transcriptional capacity for this gene (Inoue et. al., J. Clin. Invest. 99: 1786, 1997). However, the foregoing are studies involving only one or at most two polymorphisms. Furthermore, the sole disclosed use is susceptibility to disease. The human ACE gene is also a candidate as a marker for hypertension and myocardial infarction. ACE inhibitors constitute an important and effective therapeutic approach in the control of human hypertension (Sassaho et al. Am. J. Med. 83:227-235, 1987). In plasma and on the surface of endothelial cells, ACE converts the inactive angiotensin I molecule (Ang I) into active angiotensin II (Ang II) (Bottari et al. , Front. Neuroendocrinology 14: 123-171, 1993). Another ACE substrate is bradykinin, a potent vasodilator and inhibitor of smooth muscle cell proliferation, which is inactivated by ACE (Ehlers et al , Biochemistry 28:5311-5318, 1989; Erdos, E.G. , Hypertension 16:363-370, 1990; Johnston, C.I. Drugs (suppl. 1) 39:21-31, 1990).

Levels of ACE are very stable within individuals, but differ greatly between individuals. A greater risk of myocardial infarction has been identified in a group of subjects with an ACE polymorphism designated ACE-DD (Cambien et al. , Nature 359:641-644, 1992), and a 12-fold greater risk of myocardial infarction has been identified in a subgroup of patients having a combination of the ACE polymorphism ACE-DD and one of the AGT polymorphisms (235T) described above (Kamitani et al. , Hypertension 24:381, 1994). Recently, six ACE polymorphisms were identified and characterized (Villard et al , Am. J. Human Genet. 58: 1268-1278, 1996).

The vasoconstrictive, cell growth-promoting and salt conserving actions of angiotensin II are mediated through binding to and activation of angiotensin receptors, of which at least two types have been cloned (ATI and AT2). The type 1 Ang II receptor (ATI), a G-protein-coupled seven transmembrane domain protein, is widely distributed in the body and mediates almost all known Ang II effects (Fyhrquist et al. , J. Hum. Hypertension 5:519-524, 1995).

Several polymorphisms have been identified in the ATI receptor gene. Initial studies suggest that at least one of them is more frequent in hypertensive subjects: (AT^116oC)(Bonnardeaux et al , Hypertension 24:63-69, 1994). This polymorphism, combined with the ACE-DD polymorphism, has been shown to correlate strongly with the risk of myocardial infarction (Tiret et al , Lancet 344:910-913, 1994).

Other genes discussed below express polypeptides involved in physiologic pathways other than RAAS that also play roles in the regulation of cardiovascular physiology, although it is believed that prior to the present invention, no known association of polymorphism patterns in these genes with a particular disease status or response to a therapeutic regimen has been observed or reported.

Endothelin (ET) Regulation of Cardiovascular Physiology

Endothelin is a potent vasoconstrictive peptide characterized by long lasting action. It was first discovered as a vasoconstricting factor in conditioned medium (Hickey et al , Am. J. Physiol. 248:C550, 1985), and subsequently purified and characterized (Yanagisawa et al, Nature 332:411, 1988). ET is produced as preproendothelin, which is cleaved after removal of the signal sequence by an endopeptidase, followed by cleavage with endothelin converting enzyme (Xu et al. , Cell 78:473, 1994; Shimada et al, J. Biol. Chem. , 269: 18274, 1994). Analysis of the human ET gene has revealed the existence of two additional ET-like peptides expressed in various tissues, termed ET-2 and ET-3 (Inoue et al. , Proc. Natl. Acad. Sci. USA 86:2863, 1989). The first endothelin was accordingly termed ET-1.

One of the important discoveries following characterization of ETs was the discovery of two ET receptors, ET_A and ET_B (Arai et al , Nature 348:730, 1990; Sakumi et al , Nature 348:782, 1990). Both belong to the family of heptahelical G-protein coupled receptors. There is 68% amino acid identity between the two receptor subtypes. ET_A exists as a single copy gene located on human chromosome 4 (Hosoda et al. , J. Biol. Chem. 267: 18797, 1992; Cyr et al , Biochem. Biophys. Res. Commun. 181: 184, 1991). ET_B exists as a single copy gene located on human chromosome 13 (Arai et al. , J. Biol. Chem. 268:3463-70, 1993), although a splice variant of ET_B has been found (Shyamala let all, Cell. Mol. Biol. Res. 40:285-96, 1994). The cDNA sequence of ET_A has been deposited with GENBANK with accession number S57498.

In the early stage of ET research, a great number of pharmacological studies suggested that the responses to ETs could be divided into two groups according to the pharmacological potency of the three peptides. Indeed, these two receptors, ET_A and ET_B, are distinct in their ligand binding affinity and distribution in tissues and cells. ET_A has a high affinity to ET-1 and ET-2, but a low affinity to ET-3. ET_B has equally potent affinities to all three endogenous ETs. ET_A exists on smooth muscle and mediates vasoconstriction. In contrast, ET_B exists on endothelium and mediates the release of relaxing factors such as nitric oxide and prostacycline. However, several reports demonstrated that ET_B on some vascular smooth muscle also mediated vasoconstriction. Cloning of the ET receptor gene facilitated the development of ET-receptor antagomsts, such as BE-18257B, and BQ-123 and FR139317, two derivatives of BE-18257B (See Masaki, Cardiovascular Res. 39:530, 1998). Many selective and non-selective antagonists for ET_A and ET_B have emerged.

Although the pathophysiological role of ET is still unclear, ET antagonists demonstrated significant beneficial effects in pathological conditions, including congestive heart failure, pulmonary hypertension, cerebro vascular spasm after subarachnoid hemorrhage, acute renal failure, and essential hypertension. ET or ET receptor knockout mice have also provided important information regarding the physiological and pathophysiological significance of ET (Masaki, supra). In particular, mice with a knockout of ET-3 or the ET_B receptor genes exhibit phenotypic changes that resemble Hirschsprung's disease, a human hereditary syndrome associated with a missense mutation of the ET_B gene (Pfiffenberger, et al , Cell 79: 1257, 1994).

Despite advances in understanding the role of the endothelin pathway in the treatment of cardiovascular diseases, questions remain. Not all experimental models of hypertension respond to endothelin antagonists, and it remains a uncertain whether endothelin antagonists improve cardiac structure and function beyond the benefits of blood pressure reduction (Moreau, Cardiovascular Res. , 39:534, 1998). Thus, there is a need in the art for a reliable and effective means for predicting whether endothelin antagonists will be effective for treating hypertension in a given individual.

fl-Adrenergic Receptors (ff-Adrenoceptors)

The adrenoceptors fall into three major groups, α,, a₂, β, within each of which further subtypes can be distinguished pharmacologically (Lullmann, et al. in Color Atlas of Pharmacology, New York, 1993). Adrenergic receptors are all G-protein linked. They are involved in regulation of the cardiovascular system, and in the control of metabolic activity, e.g. , insulin secretion and glucose release. They also mediate constriction or relaxation of smooth muscle cells in the respiratory, gastrointestinal, and genitourinary tracts (Berne and Levy, Principles of Physiology (2^nd Ed.), Mosby-Year Books, Inc., 1996, pp. 691-696).

Adrenoceptors are targets for epinephrine and norepinephrine, which are representatives of the family of monoamine neurotransmitters. Epinephrine has equally high affinity for all - and -receptors while norepinephrine differs from epinephrine by its low affinity for /3₂-receptors (The Biochemical Basis of Neuropharmacologv, (7^th Ed.) New York, 1996, pp. 226-292). The adrenoceptors themselves interact preferentially with three different classes of G-proteins: G_s (/3-adrenoceptors) mediating activation of adenylate cyclase, G* (α₂-adrenoceptors) mediating inhibition of adenylate cyclase, and G_q (o-i -adrenoceptors) mediating activation of phospholipase C (Hieble et al , J. of Med. Chem. , 38:3415-3444, 1995).

The pharmacological interest of adrenoceptors is mainly for the treatment of cardiovascular diseases, e.g. , through the development of -antagonists, _x -antagonists and α₂-agonists ^{t0 treat} hypertension, but they are also considered important for the treatment of asthma (/3₂-agonists).

The /3₂-adrenergic receptor is expressed on a number of cell types, e.g. , bronchial smooth muscle, where its activation results in relaxation and bronchial dilatation. These receptors are also being expressed on epithelial cells, vascular endothelium, alveolar walls, immune cells, and presynaptic nerve terminals (Liggett, Am. J. Respir. Crit. Care. Med. , 156:S156-S162, 1997). Cardiac cells express mainly β_r, but also a small fraction of |3₂-adrenoceptors (Collins et al., Biochimica et Biophysica Acta 1172: 171-174). βi-adrenoceptors are also expressed in brain and pineal gland.

β-Adrenoceptor Function

The jS,- and /3₂-adrenergic receptors are coupled to a G_s-protein complex, which activates adenylate cyclase. Agonist binding to the β -receptor, located in cardiac muscle cells, mediates increased contractility and cardiac output (Lϋllmann, supra). Agonist binding to the 3₂-receptor, located in peripheral vascular arteries, mediates vasodilation by increasing the amount of cAMP, and thereby inhibiting activation of myosin kinase, which is necessary for smooth muscle cell constriction (ibid.) Activation of cAMP in cardiac cells by agonist binding to both β_x- and |3-₂-adrenoceptors activates the cAMP-dependent protein kinase (PKA) (Castellano and Bohm, Hypertension, 29:715-722, 1997). /3-adrenoceptors also regulate the control of melatonin production in the pineal gland, by the cAMP activation of one of the enzymes (5-HT-N-acetyl transferase) involved in the synthesis of melatonin (Collins et al , supra).

The /3₂-receptors mediate increased conversion of glycogen to glucose (glycogenolysis) in both the liver and skeletal muscle (H. Lϋllmann, et al , supra), and stimulate influx of potassium into muscle cells to prevent hyperkalemia (Berne and Levy, Principles of Physiology. (2^nd Ed.), Mosby-Year Book, Inc., 1996, pp. 691-696).

The ^-receptors are regulated on the protein level by desensitization. The initial desensitization process results from the phosphorylation of serine and threonine residues in the cytoplasmic tail or third intracellular loop by several protein kinases, including /3ARK and PKA (Hieble et al., supra). /3ARK phosphorylates specific serine or threonine residues in the C-terminal of receptors that are occupied by an agonist. The phosphorylation triggers binding of the cytostolic protein /3-arrestin and results in the uncoupling from G_sα. PKA is activated by cAMP and phosphorylates the /3₂-adrenoceptor by a relatively slow process. The phosphorylated receptor loses the ability to activate G_s (Castellano and Bohm, supra). Prolonged interaction of agonists with adrenoceptors generally results in receptor desensitization.

β-Adrenoceytor Gene Structure

The human /3_radrenoceptor gene is located on the long arm of chromosome 10, the same chromosome as for the α_2A-adrenoceptor gene. The coding sequence of this gene is deposited with GENBANK, accession number X69168. The regulatory region is also deposited with GENBANK, accession number J03019. It codes for an intronless gene product of 1431 base pairs (Hall, Thorax, 51:351-353, 1996). Both the promoter and the coding region of the gene are rich in G and C residues, which make up greater than 70% of the bases. The promoter does not contain any paired consensus TATA box and CAAT box elements but instead clusters with an inverted CAAT box and SP_λ or AP-2 binding motifs. This type of receptor, reminiscent of "housekeeping genes", has been described for other G-protein coupled receptors as well (Collins et al , supra).

The human 3₂-adrenoceptor gene is located on the long arm of chromosome 5, the same chromosome as the α_1B-adrenoceptor gene. The coding sequence has been deposited with GENBANK, with accession numbers M15169, J02728, or M16106. The regulatory region sequence is also deposited with GENBANK, accession number Y00106. It codes for an intronless gene product of 1239 base pairs (Hall, supra). The promoter region is 200-300 bases 5' of the translation initiation codon, and it can form strong secondary structures due to high G-C content. There are two TATA boxes (separated by roughly 10 bp) and a CAAT box located approximately 30 and 80 base pairs upstream, respectively, from the mRNA start region.

β-Adrenoceptor Gene Regulation

There are some regulatory regions identified in the promoter region of the /3_radrenoceptor gene: a cAMP response element (CRE), a consensus thyroid response element (TRE), and a glucocorticoid response element (GRE). This is consistent with the evidence that both thyroid hormone and corticosteroids affect adrenergic sensitivity in both heart and adipose tissue. The CRE region might have a self-regulatory function, as has been shown for the /3₂-adrenoceptor gene (Collins et al. , supra).

There are several regulatory domains in the 5' flanking region of the /3₂-adrenoceptor. Among these is a cAMP-responsive element (CRE), which is recognized and stimulated by a phosphoprotein called CRE binding protein (CREB). CREB is partially under the control of PKA-dependent phosphorylation processes. This is seen as an increase in /3₂-adrenoceptor mRNA level in the early phase after exposure to /3-agonists. However, the level of mRNA is decreased after prolonged exposure to agonists, probably mediated by a shortening of mRNA half-life (Castellano and Bohm, supra). It has also been shown that transcription of the /3₂-adrenoceptor gene is upregulated by stimulation with glucocorticoids in a variety of tissues (Collins et al., supra). In the 3' flanking region there are sequences homologous to glucocorticoid response elements. These might be responsible for the increased expression of β₂ adrenoceptor observed in transfected cells after treatment with hydrocortisone (Emorine and Marullo, Proc. Natl. Acad. Sci. , 84:6995-6999, 1987).

β-Adrenoceptor Protein Structure

The proposed model for /3-adrenoceptors is like most of the G-protein binding receptors, a seven α-helical transmembrane structure, where the seven α-helices are radially arranged around a central "pore", in which the receptor ligands bind. The /3-adrenoceptors have an extracellular glycocylated N-terminus, and an intracellular C-terminus. The 3_rreceptor consists of 477 amino acids; the /3₂-receptor consists of 413 amino acids.

The overall amino acid identity of human /3,- and /3₂- adrenoceptors is only 54% . However, it is likely that the pharmacological differences between 3₂-receptors and β, -receptors are due to subtle changes in orientation of the primary binding sites, resulting in a slightly different binding site rather than to specific amino acid substitutions (Hieble et al , J. Med. Chem. 38:3415-3444, 1995).

Site-directed mutagenesis has demonstrated that an aspartic acid residue, Asp- 113, located in the third transmembrane-spanning helix, and two serine residues, Ser-204 and Ser-207, are required for full agonist binding to the /3₂-adrenoceptor. The /3,-adrenoceptor contains identical amino acid residues located in corresponding positions to those shown to be important for agonist binding to the /3₂-adrenoceptor. Another aspartic acid residue, Asp-79, located in the second α-helix of both /3-receptors is highly conserved in G-protein coupled receptors (Hieble et al , supra). Ser-319 has a potential role in agonist binding to the /3₂-adrenoceptor.

Mutation of Tyr-350, located in the cytoplasmic tail of the /3₂-receptor, interferes with coupling of the receptor to G_s (Hieble et al , supra). Also, palmitoylation of Cys-341 in the C-terminal enables the /3₂-adrenoceptor to form a fourth intracytoplasmic loop, which increases the ability of the agonist-bound receptor to mediate adenylyl cyclase stimulation (Strosberg, Protein Science, 2:1198-1209, 1993).

β-Adrenoceptors as Drus Targets

No cause of disease can be identified in 80-90 % of patients with hypertension. They have so-called essential hypertension, which affects 5-10% of the general population, and is the most common cause of disease in developed countries (J. Axford, Medicine. 1996, Blackwell Science Ltd., 10.119-10.130). Betablockers have been widely used in the treatment of hypertension. They are particularly useful for the treatment of juvenile hypertension with tachycardia and high cardiac output. Betablockers or beta-adrenergic blockers were first introduced as a treatment for essential hypertension in 1964, and are still recommended as first choice because the cost for betablockers is low, which improves patient compliance. They act by binding to /3,-receptors on the cardiac smooth muscle cells, which leads to decreased cardiac output. Most betablockers are not specific β, -receptor antagonists but bind to /3₂-receptors as well. The binding to /3₂-receptors gives the opposite of the desired effect though inhibition of /3₂-receptors leads to vasoconstriction. This gives a side effect with cold hands and feet because most of the /3₂-receptors are located in the peripheral vascular arteries.

They have also been known to cause bronchospasms as well as some central nervous system side effects (nightmares, somnolence). They decrease insulin secretion, which makes them inappropriate to treat hypertensives with diabetes mellitus, and they can cause heart failure and peripheral artery obstructive disease (Velaseco and Rodrigues, Journal of Human Hypertension 10, Suppl. 1, S77-S80, 1996). i(3-adrenoceptor agonists, such as dopamine and dobutamine are used to stimulate myocardial β_λ -adrenoceptors in the acute management of congestive heart failure. They act by increasing contractility and cardiac output.

Many different /?₂-agonists are used in the treatment of asthma. They exert their primary effect on the /3₂-adrenergic receptor of bronchial smooth muscle, resulting in relaxation and bronchial dilatation. They also protect against bronchoconstrictor challenge (Hall, Thorax, 51:351-353, 1996)

Thus, there is a clear need in the art for an improved understanding of the effects of betablockers on different subjects, and to predict which patients will have a better response to treatment with betablockers.

Prostaglandin Receptors

The prostaglandin receptor family encompasses at least five classes of receptors, designated FP, EP, IP, DP, and TP receptors, which are classified based on their sensitivity to the five primary prostanoids (F2c., Ej, I₂, D₂, and TXA₂). EP receptors further comprise four subtypes, designated EP1-4, which differ in their responses to various agonists and antagonists. Furthermore, ligand binding studies have shown a certain degree of cross-reactivity between receptors (Coleman et al. , Pharm. Rev. , 46:205-229, 1994).

Each of the above-identified receptors possesses seven hydrophobic transmembrane domains, which are characteristic of the rhodopsin-type receptor superfamily. The high degree of structural homology between the different receptors also suggests that they may derive from a common ancestral gene. The genes for all the receptors are apparently formed from three exons, wherein the first exon contains 5'- untranslated sequences; the second exon contains the majority of the protein-coding sequence; and the third exon contains the carboxyterminal end of the protein-coding sequence (from the sixth transmembrane domain and downstream) and 3 '-untranslated sequences.

These seven-transmembrane-domain receptors display several important structural/functional domains, including, for example, (i) the three extracellular loops which form the prostano id-binding site and (ii) the intracellular domains, preferably the third, and possibly also parts of the intracellularly located carboxyterminal domain, which interact with a G-protein to initiate a signal transduction pathway. Furthermore, a conserved arginine residue (at position 60) (located in the seventh transmembrane domain) may bind to the α-carboxylic acid of prostanoid ligands. Consistent with this idea, individuals carrying a mutation that results in a substitution of Leu for this Arg residue exhibit impaired platelet aggregation (Ushikubi, et al , Throms. Haemostst, 57: 158 (1987); Hirata, et al , Nature 349:617 (1994); Fuse, et al , Blood; 81:994 (1993)).

Role of Prostaelandins in the Cardiovascular Svstem

The prostanoids are known to act in multiple ways in the human pulmonary vascular system (Jones et al , Clin. Exp. Pharmacol. Physio. 24:969-72, 1997). Four type of prostanoid receptors are present on pulmonary arterial vessels in humans: thromboxane (TP) receptors mediate constriction and are blocked by antagonists, such as BAY u 3405, GR 32,191, and EP 169; prostaglandin (PG) E.P.₃ receptors also mediate constriction, and are agonized by the compounds S C 46,275, solprostone, misoprosto, and prostaglandin E2 (PGEj). PGE^ causes relaxation in a few pulmonary artery preparations, and an EP₂ may be involved (Jones et al. , supra). Prostacyclin produces relaxation, possibly by potassium channel opening (Jones et al , supra). In addition to the prostanoids discussed above, losartin, a non-peptide angiotensin antagonist, interacts with thromboxane A2/prostaglandin H2 receptors, and inhibits prostanoid-induced beta constriction in canine coronary arteries and platelet application and vaso constriction in hypertensive rats (Li et al , J. Cardiovasc. Pharmacol. 32: 198-205, 1998). Previously studies have shown that prostanoids play a role in rennin-dependent and rennin- independent hypertension (Lin et al , Hypertension 17:517-25, 1991), prostaglandins have also been reported to be involved in the development in clinical expression of arteriosclerosis (Hirsh et al. , M. J. Med. 71: 1009-26, 1981). Role of Prostaεlandins in the Pulmonary Svstem

Prostaglandins have also been reported to play an important role in pulmonary hypertension and pulmonary health. Prostaglandin synthesis inhibitors administered in utero are associated with pulmonary hypertension of the fetus and, in the case of humans, children (Wendelberger, Semin. Perinatol 11: 1-11, 1987). Prostaglandin receptors have been localized to lung tissue and appear to play a role in pulmonary development and function.

Glaucoma and Intraocular Pressure

Patients suffering from glaucoma exhibit an increased intraocular pressure (IOP). This condition is not only painful, but can also, when left untreated, lead to permanent damage to the blood vessels in the eye. Interference with blood flow to ocular tissues over time further leads to a serious impairment of vision.

Among the drugs that are currently used to treat IOP are synthetic prostaglandin analogues. These compounds bind to prostaglandin receptors in the eye and thereby reduce IOP by activating a G-protein coupled pathway.

The prostaglandin derivatives bind with varying degrees of specificity and selectivity to different prostaglandin receptors, which can lead to complex physiological responses in the patient being treated. In addition, different prostaglandins may be vasoconstrictors or vasodilators; may contract or relax smooth muscle (including bronchial, tracheal or uterine muscles); and may affect platelet function, immune cell chemotaxis, B-cell differentiation, and other aspects of immune system physiology, as well as kidney function and endocrine and metabolic processes.

The high incidence of hypertension and glaucoma, and the serious clinical consequences of these conditions, mean that there is a need for methods and compositions that allow the identification of the therapeutic regimen that will result in a more positive treatment outcome. It would also be useful to be able to identify individuals who are at risk for toxic or abnormal responses to prostanoid treatment.

The Serotonergic Svstem

Serotonin plays an important role in the physiology of the central and peripheral nervous system of mammals. Specifically, serotonin (5-hydroxytryptamine, 5-

SUBSTΓΓUTE SHEET (RULE 26) HT) is a monoamine neuro transmitter of the central and peripheral nervous system. It has been found to play a major role in a variety of complex central regulated behaviors, such as sleep, thermoregulation, learning, and memory, and behavior such as aggression, sex, feeding, neuroendocnine regulation, motor activity, and biological rhythms. At the peripheral level, it affects smooth muscle cell fibers, causing constriction or relaxation, and affecting the vascular bed and the digestive tract. Serotonin is also believed to play a role in several types of pathological conditions. These includes various psychiatric disorders such as anxiety, depression, aggressiveness, panic, obsessive-compulsive disorders, schizophrenia, suicidal behavior, and autism. In addition, serotonin is believed to be involved in neurodegenerative disorders such as Alzheimer's disease, Parkinsonism, and Huntingtons disease and also migraine, emesis, and alcoholism.

Serotonin exerts its effect by binding to and activating a family of proteins called serotonin receptors. All serotonin receptors, which have a high affinity for serotonin, are coupled to GTP binding proteins that decrease the activity of adenylate cyclase. Presently, fifteen species of serotonin receptors have been characterized and cloned. The receptors are classified into seven different genera based on receptor structure, second messenger system and agonist/antagonist binding. The genus of 5-HTl serotonin receptors has six species. These are 5-HT_1Aι 5-HT1B (only rodents), 5- HT1D/A, 5-HTlD/B, 5-HT1E, and 5-HT1F. The nomenclature of the 5-HTl receptor is not consistent in the literature. The receptor may be denoted as the 5-HT_1A or 5-HT1A receptor.

The 5-HT receptor gene is intronless. The coding sequence contains 1266 bp. The gene is localized on chromosome 5qll.2-ql 3.

The 422 amino acids of the 5-HT_1A receptor are thought to form seven trans-membrane alpha helices. The amino terminus resides outside of the cell and contains glycosylation sites. Three extra cellular loops contain ligand binding sites. Different amino acids have been shown to be important for antagonist and agonist binding. Three peptide loops and the carboxyl terminus are intercellular. The third loop and the carboxyl terminus are thought to bind to the GTP binding protein.

The carboxyl-terminal domain has been shown to possess two threonine residues, which are thought to be targets for phosphorylation by PKC (Protein Kinase C). Phosphorylation by PKC decreases the efficiency of 5-HT_1A coupling to adenylate cyclase. Phorbol esters, which activate PKC block other functions related to 5-HT_1A activation.

The reduction of 5-HT_1A receptor function controlled by 5-HT2A receptors, is known to be coupled to phosphatidylinosides turnover and PKC activation, may be of functional significance. It should be noted that these results are derived from studies performed in vitro on transfected cell lines.

The hormone estrogen enhances the level of 5-HT,_A receptors. However, the mechanism of receptor regulation by estrogen is unknown.

The level of 5-HT_1A receptor expression changes through out an individual's life. During development, high level of 5-HT_1A receptors are found in the cerebellum. The increased level of receptors suggests a tropic role for the serotonergic system. In addition, the number of 5-HT_1A receptors decrease as an individual ages. However, the mechanistic role of the 5-HT_1A receptor during development remains unknown.

In general, long-term variations of receptor stimulation regulate the receptor number.

The limbic system has the highest density of 5-HT_1A receptors. The limbic system is a network of subcortical neurons, which forms a loop circumscribing the inside of the brain, linking the hypothalamus to the cerebral cortex. This neuronal network is believed to be the circuit through which emotions are translated into actions. Consequently, the high density serotonin receptors suggests that the 5-HT hormone plays an important role in reducing emotions to actions.

The psychiatric benefit of compounds which bind to the 5-HT_1A receptor suggests that genetic alterations of the serotonergic pathway result in psychiatric disorders. Pharmacological studies have attempted to clarify the role of the serotonergic system in psychiatric disorders. The 5-HT_1A receptor agonists buspirone, gepirone, and ipsapirone are commonly used antidepressants and anxiolytic drugs.

Great efforts have been made in order to clarify the mechanism of the 5- HT_1A receptor drugs used in treatment of anxiety and depression. Large differences in response to the different antidepressants are a rule rather than an exception. A common feature of the 5-HT_1A receptor agonists is the delay, for several days, before effect is observed and also the relative lack of side effects. Long-term treatment with these drugs causes adaptation. One question, which remains to be answered, is whether the therapeutic effect is observed after the increase of the serotonergic activity or its decrease (chronic treatment resulting in desensitization of the receptors). No conclusion can be made from the adaptive changes of 5-HT_1A receptors in response to the antidepressant treatments.

None of the drugs used in treatment of psychiatric disorders is absolutely selective for the 5-HT_1A receptor but each is rather promiscuous. They more often than not bind, with different affinity, to several serotonin receptor subtypes, to the different dopamine receptors and to the adrenergic receptors. This drug promiscuity has of cause contributed to the difficulties in defining the involvement of the 5-HT_1A receptors in the different disorders and the mechanism whereby the drugs exert their effects.

Since the mechanisms behind psychiatric disorders is thought to involve disturbances in the serotonergic pathway, some attempts have been made in order to identify genetic variants in the 5-HT_IA receptor gene. So far, only a few variants, with no significant role in the genetic predisposition of disease, have been found. These studies have all been done on material from a few patients. The primary method used is SSCP analysis, (Single Strand Conformational Polymorphism analysis). SSCP is regarded as a reliable and robust method, however with a big flaw; several polymorphic positions are not detected. In order to find all polymorphic positions in one gene the superior method is, an allele specific sequencing.

Neurons and glia can accumulate neurotransmitters by a sodium dependent co-transport. Each neurotransmitter seems to have a relative selective uptake system. So far about ten neurotransmitter uptake systems, or a neurotransmitter transporters, have been identified. Among them are transporters for serotonin, dopamine, norepinephrine, glutamate, and GAB A.

As described above, serotonin is one of the major neurotransmitter in the peripheral and central nervous system. The serotonin transporter is the most important regulatory mechanism of serotonin activity. Following release, serotonin is actively cleared from synaptic spaces by the high-affinity Na⁺/Cl^" ion-coupled serotonin transporter localized in pre-synaptic neuronal membranes. It mediates the uptake of serotonin into a variety of cells, e.g. , serotonergic neurons, platelets, mast cells, and endothelial cells. The promoter activity seems to be regulated by interaction of several positive and negative regulatory elements. A unique GC-rich repetitive sequence located in the proximal 5' regulatory region of the transporter gene displays a tetra-strand like structure, has been shown to contain positive response elements and to repress transcriptional activity in non serotonergic cells.

Phosphorylation could also constitute a major regulation mechanism, since several serine and threonine residues in the transporter have been identified as potential phosphorylation sites. Developmental and trans-synaptic events are also likely to control the expression of the brain transporter gene and lead to changes in transporter mRNA abundance.

The gene for the serotonin transporter is localized to chromosome 17qll.l- 17q 12 and organized into 14 exons, spanning over 35 kb. The translation start is located in exon 2. The corresponding protein is composed of 630 amino acids. The structure/function correlation, of the different domains in the serotonin transporter, is so far not known.

The interest in the serotonin transporter system increased when it was discovered that the transporter was the primary target for amphetamine derivative and other stimulant drugs of abuse. Blocking of the action of the transporter increases the level of active serotonin in the synaptic cleft. The degree of pre- and post-synaptic receptor occupation is consequently increased, as is the extent to which the transmitter is subject to diffusion and oxidation, processes that interfere with normal neurotransmitter recycling. Several drugs used in the treatment of depression, anxiety disorders, obsessive- compulsive disorders, eating disorders directed at the serotonin transporter are know available; e.g. fluoxetine, sertraline, paroxetine. The therapeutic effect seems to be indirect, since transporter blockade occurs as soon as the drug enters the brain, but symptomatic relief requires weeks of treatment. The therapeutic mechamsm of these drugs remains to be elucidated.

Allelic variation in the serotonin transporter may play a role in the expression and modulation of complex traits and behavior. Also, different drug responses could be variant dependent. An insertion/deletion polymorphism, as in the above repetitive element in the transporter promoter, has been identified and has been correlated with promoter activity. Also, a VNTR (variable-number-tandem-repeat) polymorphism in intron 2 has been identified. Several studies, with conflicting results, have been conducted with the aim of correlating these polymorphisms with different psychiatric conditions.

The current opinion is that genetic control of and disease-related alteration in transporter function is more likely to be related to differential regulation of transporter expression than to amino acid substitutions. This hypothesis is based on mutation screening studies of the transporter gene exons in the general population and samples of patients with affective spectrum and obsessive-compulsive disorders. These studies only detected rare coding variants. However, the studies where direct sequencing of cDNA are used as the analysis method are based on material from rather few patients (a maximum of 22). Other methods, such as DGGE, have been used in order to detect polymorphisms. This method is not completely reliable and is probably only optimal when the polymorphism is known. Unknown variants can be difficult to detect.

Genetic variation in the genes of the 5-HT_1A receptor and the serotonin transporter of importance for the susceptibility of depression, anxiety or any other psychiatric disorder remains to be identified.

The response and non-response of the antidepressant and anxiolytic drugs, directed at the 5-HT_1A receptor and the serotonin transporter, could also be correlated to genetic variation. Variations in the binding site, the phosphorylation site and for the receptor, the G protein binding site could all influence the efficacy of the drug. Conformational changes caused by variations in other regions of the receptor could also result in a receptor with different properties, as compared to the wild type receptor. Also, variations not leading to amino acid exchange could be of importance since they might influence receptor regulation on a transcriptional level.

Microsomal Triglyceride Transfer Protein

Elevated serum cholesterol, particularly in the form of low density lipoprotein (LDL)-cholesterol, is a principal risk factor for cardiovascular disease. The protein component of LDL, apolipoprotein B (ApoB), is secreted from the liver, and the relative efficiency of apoB secretion is an important determinant of the plasma level of LDL. Microsomal triglyceride transfer protein (MTP) plays an important role in apoB secretion. Accordingly, any phenomenon that alters MTP expression or activity may influence apoB secretion and thereby affect serum LDL-cholesterol levels. MTP is a heterodimer comprising two subunits: (i) an MTP-specific 97 kDa polypeptide and (ii) the multifunctional 55 kDa protein disulfide isomerase (PDI) (Gordon et al., Trends Cell Biol, 5:317-321, 1995). MTP function is absolutely required for assembly and secretion of apoB-containing lipoproteins. Non-apoB-secreting cells can only be converted to apoB secretors if the MTP gene is provided together with the apoB gene (Gordon et al., Proc. Natl. Acad. Sci. (USA), 91:7628-7632, 1994; Leiper et al., J. Biol. Chem., 269:21951-21954, 1994). Conversely, inhibition of MTP activity in cells that normally secrete apoB results in a drastic reduction in apoB secretion (Jamil et al. , Proc. Natl. Acad. Sci. (USA), 93: 11991-11995, 1996; Haghpassand et al. , J. Lipid. Res. , 37: 1468-1480, 1996). A complete lack of MTP activity, such as, e.g. , in cells containing mutations in the MTP coding region, leads to abetalipoproteinemia (Sharp et al., Nature 365:65-69, 1993; Shoulders et al., Hum. Mol. Gen. , 2:2109-2116, 1993; Narcisi et al. , Am. J. Hum. Gen., 57: 1298-13, 1995).

The promoter region of the MTP gene is highly conserved across mammalian species and contains potential control sequences for regulating MTP expression in different cell types and in response to metabolic regulators. Transcriptional activation of the human MTP promoter is suppressed by insulin and enhanced by cholesterol (Haoan et al., J. Biol. Chem. , 269:28737-28744, 1994). The insulin response has also been demonstrated in HepG2 human liver carcinoma cells (Lin et al., /. Lipid Res. , 36: 1073-1081, 1995). It has also been shown that liver cells in hamsters fed either a high-fat or a cholesterol-enriched diet contain higher concentrations of MTP mRNA.

Radiotherapy

The American Cancer Society has estimated that there will be approximately 1.4 million new cases of cancer diagnosed in the USA in 1997 at an overall cost of $35 billion. Cancer is a major cause of death which contributes substantially to medical costs world- wide. The incidence of cancer and death rates are rising steadily and globally the WHO estimates that cancer kills approximately 6 million people annually.

Non-surgical cancer therapy today is based mainly on radiotherapy or chemotherapy, with radiotherapy having greater importance. Radiotherapy has relatively high fixed costs and low variable costs, which means that a large amount of money must be invested in equipment (fixed costs), while the cost of treatment, dependent on the number of patients treated, is much lower (variable costs). These high initial expenditures have created the impression that radiotherapy is expensive and may have made health care financing institutions reluctant to permit expansion in the field of radiotherapy. In fact, radiotherapy has been shown to be a cost effective means of treatment, and will ultimately increase in usage world- wide. The European commission's strategy for cancer research has estimated that a significant increase in cancer survival of 5% in western Europe and as high as 15 % in eastern Europe can be obtained by increasing the level of quality of radiotherapy. Approximately 45-50% of all cancer patients are cured of the disease, and about 30-40% of these patients are cured by radiotherapy, either alone or in combination with other treatments such as surgery and chemotherapy. Approximately half of all cancer patients receive radiotherapy, either curative or palliative, at some stage of their treatment. At present, radiotherapy is based on the premise that all patients have exactly the same non-neoplastic tissue sensitivity to radiation, despite the fact that approximately 20% of patients have normal tissue which lies above the median level of sensitivity in the patient population. Furthermore, approximately as many patients again are more radio- resistant in their normal tissue than the median and therefore should be treated with a 10- 20% higher radiation dose. Selecting those patients who will best benefit from radiotherapy in terms of sensitivity or resistance of both tumor and healthy cells to radiation is not possible with the prognostic and diagnostic methods currently used. The side-effects and the cost of radiotherapy are such that it would be beneficial to refrain from unnecessary treatment. But most importantly there are patients who currently receive radiotherapy who might well benefit from a higher dose or who might suffer unreasonably debilitating side effects from a standard dose.

An approach to predicting the outcome of radiation treatment in cancer patients would be beneficial and would overcome the aforementioned problems. Genetic variation patterns could be used to determine the sensitivity of a given tumor to radiotherapy and the maximum dose a given patient should receive based on the sensitivity of their normal tissue to radiation. However, there is currently little information on the genetic factors, both in the healthy cell and in the tumor cell, which determine how cells respond to ionizing radiation. Research in this field is further hampered by contradictory results and differences in methods and approaches, making the significance of results difficult to interpret. What is urgently needed in this area is a large-scale research project to analyze the genetic factors involved in cell growth arrest, apoptosis, and DNA damage detection and repair, as well as factors important for angiogenesis or oxygen stress, etc. A significantly large number of candidates (both genes and anonymous chromosome loci) have previously been identified which are known to play central roles in each of these phenomena but their links to radiosensitivity remain to be identified.

In breast cancer, treatment prediction is currently the most pressing problem that oncologists face while, in the case of prostate cancer, defining the 30% or so of early detected tumors which will progress, and therefore need immediate treatment, is essential to avoid either over-treatment or lack of timely treatment. Therefore prognostic factors are of high priority in prostate cancer. Different considerations are necessary depending on the type of cancer are taken into account when planning each new application of this technology.

Analysis of loss of heterozygosity in tumors can be a powerful tool for determining the extent to which genome scans for LOH patterns can be mediated, to provide diagnostic information in cancer treatment, i.e., identification of the presence of cancerous cells; prognostic information, i.e., identification of the extent of the progression of disease and the expected outcome or treatment-predictive information i.e predicting the outcome of a particular treatment by correlation to a LOH pattern.

Loss of heterozygosity is genetic deletion that occurs in one of the pair of chromosomes, leaving the cell with only one copy of any genes found in the deleted region. There is already evidence that the frequency and site of LOH in the genome is both tumor type-specific and disease stage specific. There seems to be selection for loss of specific regions of the genome in specific cancer forms and certain genomic regions are lost at certain stages of a given cancer. For example, chromosome 3 loss occurs at an early stage of lung cancer, while in bladder cancer the short arm of chromosome 3 is only lost at a later stage in invasive forms of the disease.

Although patterns of LOH in tumor cells have already been reported in the literature to be associated with tumor diagnosis or disease prognosis in many studies, the results obtained to date have not been validated in clinical studies with patients with cancer. LOH data in the form of genomic deletion maps for each of the major cancer forms, and their clinical importance in cancer therapy, are contemplated.

Identifying Candidates for TAM Therapy

Breast cancer is one of the most common malignancies in the Western world, with 185,700 new cases predicted in the USA for 1996 and approximately 5,800 in Sweden in the same year. Approximately 1 in 10 women in these countries will develop the disease in their lifetime. It is therefore a major medical problem with significant public health and sociological consequences.

One approach to the treatment of breast cancer is through hormone ablation. It is based on the principle that breast tumor growth is hormone dependent and therefore if deprived of estrogen the tumor cells will experience apoptosis and die. Anti- estrogens such as tamoxifen (TAM) inhibit tumor growth primarily by binding to the estrogen receptor (ER) and competitively inhibiting the binding of estrogen to the ER. The types of patients receiving tamoxifen treatment are generally post-menopausal women with estrogen receptor positive tumors or patients with metastases, but it is now becoming accepted that certain pre-menopausal patients can also benefit from tamoxifen this type of treatment (TAM). The majority of breast cancer patients are treated with tamoxifen, and the figure is steadily increasing. In randomized clinical studies in post-menopausal patients, TAM has been shown to be equivalent therapeutically to other therapies. Responses to TAM are seen in 20% to 50% of patients, although these statistics are dependent on the definition of the response and patient characteristics.

The high morbidity and mortality associated with breast cancer demonstrates a need in the art for methods and compositions that allow the determination and/or prediction of the therapeutic regimen that will result in the most effective treatment outcome in a patient suffering from the disease. This includes identification of individuals who are more or less responsive to particular therapeutic regimens, including, e.g. , particular drugs that are conventionally used to treat the disease. It has long been recognized that there is a need in the art for markers capable of identifying patients who could be potential candidates for TAM therapy. The estrogen-receptor content of the tumor has been previously considered as a marker but despite the information provided by determination of estrogen receptor status, its usefulness has, in practice, been limited by factors such as the lability of the steroid binding capacity of the receptor, the heterogeneity of many tumor specimens and the use of a non-optimal definition of receptor positivity. These practical considerations are presumably part of the reason for a low response rate amongst so-called ER-positive patients when treated with tamoxifen. Therefore there is a need to develop an improved method to predict new candidates for TAM therapy.

Furthermore, the heterogeneity in responses to cancer therapies emphasizes a need for another approach to rational drug development. In particular, populations that are identified as non-responsive to a particular therapeutic regimen can be identified for development and testing of alternative regimens. Thus, effective treatment regimens could be developed for a larger percentage of the affected population.

Drug Metabolism Pathways

Most xenobiotics, including pharmaceutical agents, are metabolized through two major reactions. Metabolism results in detoxification and elimination of the drug or activation of the pro-drug to the biologically active therapeutic or toxin. Phase I reactions, which include oxidation, reduction, and hydrolysis, are functionalization reactions in which a derivatizable group is added to the original molecule. This prepares the drug for further metabolism in the phase II reactions. The phase II reactions are conjugate reactions in which the molecule is derivatized with a hydrophilic group. The resulting hydrophilic compounds are inactive and excreted in the urine.

Large variation in the metabolizing ability, both inter-individually and inter-ethnically, have been observed. This variation is due to physiological factors, (e.g. , age and sex), pathological factors (e.g. , liver disease), environmental factors (e.g. , induction/inhibition by drugs or other chemicals) as well as genetic factors.

Cytochromes P450

The cytochrom P450 (CYPs) are a superfamily of heme-containing enzymes, found in eukaryotes (both plants and animals) and prokaryotes, responsible for phase I reactions, including oxidative, peroxidative, and reductive metabolic transformation of drugs, environmental chemicals, and natural compounds. In total over 500 genes belonging to the cytochromes P450 superfamily have been described and divided into subfamilies, CYP1-CYP27. In humans, 35 genes and 7 pseudogenes have, so far, been identified. Members of the three cytochromes P450 gene families, CYP1, CYP2, and CYP3, are responsible for the majority of drug metabolism. The human cytochromes P450 which are of greatest clinical relevance for the metabolism of drugs and other xenobiotics are CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP2E1, and CYP3A4. The liver is the major site of active of these enzymes but several of them are also expressed in other tissues.

Phase II drug metabolizing enzymes

This is a diverse group of enzymes including UDP-Glucuronyltransferase, UDP-Glycosyltransferase, sulfotransferase, methyltransf erase, acetyltransferase and gluthathione-S-transferase. They all have in common that their actions normally leads to a water-soluble product which can be excreted in bile or urine.

Variability in drug metabolism

Since drug metabolism shows a large inter individual variation, the response of drugs exhibit similar variation. Three major classes of metabolizers can be distinguished; poor metabolizers (PMs), extensive metabolizers (EMs) and ultra extensive metabolizers (UEMs). Given a normal dose, PMs risk sever side effects because of too much active drug at the site of action. UEMs on the other hand metabolizes so fast that a normal dose will not give adequate plasma concentration of the drug and thereby not give the desired effects.

Phenotyping is accomplished by administration of a test drug (known to be metabolized only by the enzyme in question) followed by the measurement of the metabolic ratio, MR. MR is defined as the ratio of unchanged drug to metabolite measured in serum or urine. Genotyping involves identification of defined genetic polymorphisms that give rise to the specific drug metabolism phenotype. The polymorphisms include alterations that lead to overexpression (UEM), absence of an active protein (PM) or an enzyme with diminished catalytic activity (EM or PM).

Phenotyping has the advantage over genotyping in revealing drug-drug interactions or defects in the overall process of drug metabolism. As drawbacks with phenotyping should be mentioned discomfort for the patient, risk of adverse drug reactions, problems with incorrect phenotype due to co-administration of other drugs and effects of disease. Also, it takes relatively long time before all analyses are done. Genotyping requires only small amounts of blood or tissue from the patient, are not affected by disease or co-administration of other drugs, and provides results quickly. Also, it is possible to identify if a person is carrying two identical alleles (homozygous) or has two different alleles (heterozygous). Determination if the individual is homozygous or heterozygous is necessary if the correlation to phenotype should be done correctly. A major drawback with genotyping is the fact that not all genetic variation have been identified yet. To correlate genotype with a specific drug metabolism phenotype is therefore not always possible.

Several polymorphisms in genes of drug metabolizing enzymes have been identified and correlated to specific phenotypes. For example, in a Caucasian population the 4 most frequent null-alleles (e.g. , polymorphisms leading to an inactive enzyme) in CYP2D6 explains 90-95% of all PMs of the drugs metabolized by CYP2D6. The individuals with ultra-extensive metabolism (UEMs) can only to a lesser degree be explained by an already known gene duplication polymorphism. In order to a full extent explain the variation in drug metabolism ability, all known as well as new polymorphisms need to be identified. Only then can genotyping data be translated into specific phenotypes with very high accuracy. It is also important to be aware of the fact that many polymorphism frequencies are unequally distributed between different ethnic population.

Need for Effective Disease Status Assessment

The high morbidity and mortality associated with, e.g., cardiovascular disease, cancer, etc. demonstrate a need in the art for methods and compositions that allow the determination and/or prediction of the therapeutic regimen that will result in the most effective treatment outcome in a patient suffering from a particular disease. This includes identification of individuals who are more or less responsive to particular therapeutic regimens, including, e.g. , particular drugs that are conventionally used to treat disease.

Furthermore, the heterogeneity in responses to many therapies emphasizes a need for another approach to rational drug development and utilization. In particular, populations that are identified as non-responsive to a particular therapeutic regimen can be identified for development and testing of alternative regimens. Thus, effective treatment regimens could be developed for a larger percentage of the affected population.

In summary, there is a need to reduce or eliminate trial and error in selecting a therapeutic regimen for a particular disease and a particular individual. It would be desirable instead to predict whether a given individual will be responsive to e.g. a particular class of drugs or even to a particular drug or whether he/she is likely to suffer from adverse reactions or side-effects.

There is also a need in the art for methods and compositions that allow the identification of individuals having a predisposition to certain diseases, such as cardiovascular disease, including myocardial infarction, hypertension, atherosclerosis, and stroke, to facilitate early intervention and disease prevention.

The present invention addresses these and other needs in the art by providing polymorphisms and polymorphic patterns that are characteristic of particular diseases, and by using these polymorphisms and patterns to prescribe (or to develop) more effective treatments or to assist in diagnosis.

Citation of any reference in this application should not be construed as an admission that the reference is prior art to the invention. Each cited document is incorporated herein by reference in its entirety.

SUMMARY OF THE INVENTION

The present invention advantageously provides a general methodology applicable to all human disease conditions for evaluating genetic status ( . e. , establishing a subject's genetic signature) in order to evaluate how that subject is likely to respond to a given therapy, or whether that person has certain genetic predispositions to develop a disease or disorder. The invention is based on research results in a wide variety of unrelated diseases and disorders. It was necessary to confirm the role of genetic signatures in such a variety of diseases and disorders to establish the broad applicability of the methods and associated reagents of this invention.

Thus, in one aspect, the present invention provides reagents and methods for predicting whether a particular therapeutic regime (such as a specific drug, a class of drugs or any other therapeutic regime, pharmacological or not) would be effective in improving a pathological condition in a human individual, or would be ineffective for that purpose, or its use would be associated with adverse reactions or undesirable side-effects. A particular advantage of the invention is that one or more polymorphic markers provide a basis for predicting the outcome of a treatment regimen. By comparing a polymorphic pattern of a subject who requires treatment for a pathological condition, for example hypertension, with a reference pattern previously established to correlate with responsivity to the treatment regimen, a physician can predict whether a treatment plan, such as administration of an ACE inhibitor, is likely or not to be effective before subjecting the subject to the treatment plan. For example, a comparison of the test polymorphic pattern from an individual with reference polymorphic patterns of individuals exhibiting differing responses to a particular therapeutic intervention can be used to predict the type or degree of responsivity of the individual to such intervention. The present invention thus represents a significant breakthrough in treating pathologies in that it reduces or eliminates trial and error in selecting a treatment for a particular individual patient.

An additional advantage of the invention derives from the ability to eliminate subjects from clinical trials who are predictably non-responsive, or at risk for an adverse response, to a particular treatment regimen. Furthermore, adverse results in an early trial can be evaluated to identify polymorphic patterns, so that the adverse results can be correlated with a sub-population of the test population permitting eventual exclusion of such sub-population from the treatment group. The invention may thus ensure that a beneficial drug can be approved for use in the appropriate population, and decrease the number of required patients and therefore the duration and cost of clinical trials. It may also lead to identification of a particular subgroup which can be the target for development of another therapeutic regimen.

All of the foregoing applications within the scope of the invention can be deemed to be assessments of an individual's disease (or physiologic) status, as the term is broadly defined below. In a specific embodiment, the methods and reagents of the invention are adapted for any disease or disorder except cardiovascular disease involving ACE, ACT, and ATI.

The foregoing methods of the invention are carried out by comparing a test polymorphic pattern established by at least one polymorphic position within at least one gene with a polymorphic pattern of a population of individuals exhibiting a predetermined responsivity to the regimen (reference pattern). If the test pattern matches the reference pattern, there is a statistically significant probability that the individual has the same status as that correlated with the reference pattern.

The polymorphic pattern preferably consists of more than or equal to two and more preferably more than two polymorphic positions of at least one gene, the expression product(s) of which is (are) involved in a particular physiologic pathway with which the disease is associated.

Additionally, the invention provides methods for assessing whether a particular individual has a genetic predisposition to a pathology. This aspect of the invention comprises comparing a test polymorphic pattern established by at least one and preferably at least two and most preferably at least three polymorphic positions within a gene with a polymorphic pattern of individuals exhibiting a predisposition to a particular syndrome. The conclusion drawn depends on whether the individual's polymorphism pattern matches the reference pattern.

The breadth of the invention will be better understood by reference to the detailed description below.

DETAILED DESCRIPTION OF THE INVENTION

The invention in based, in part, on the discovery that certain polymorphisms in certain genes define polymorphism patterns that correlate with responsiveness of an individual. The invention is further based on the surprising discovery that this principle is broadly applicable to most if not all diseases or disorders, not only to cardiovascular diseases represented by polymorphisms of ACE, AGT, and ATI genes. Most significantly, by comparing a test individual's polymorphism pattern with a reference polymorphism pattern, which is a polymorphism pattern from a population of individuals with known disease status, that has been correlated with the disease status, one is able to predict whether the test individual has an increased likelihood to exhibit the same responsiveness to a therapeutic regime as that correlated with the reference polymorphism pattern.

The invention provides a powerful predictive tool for clinical testing and treatment of disease. For clinical testing, the present invention permits smaller, more efficient clinical trials by identifying individuals who are likely to respond poorly to a treatment regimen, excluding such individuals from the intend-treat group, or otherwise reducing the amount of uninterpretable data. By evaluating a test individual's polymorphism pattern, a physician can also prescribe a prophylactic or therapeutic regimen customized to that individual's disease status. Adverse responses to particular therapies can be avoided by excluding those individuals whose disease status puts them at risk for an adverse reaction to a particular therapy. Appropriate changes in lifestyle, including diet, environmental stress, and exercise levels can be prescribed for individuals whose test polymorphic pattern matches a reference pattern that correlates with increased predisposition to disease.

Definitions

"Subject" is an individual (human or other mammal) afflicted with a disease for which a therapeutic regime exists.

"Therapeutic regime" includes without limitation drug therapy including chemotherapy as well as non-drug therapeutic modalities such as radiation therapy, balloon catheterization, invasive and non-invasive surgical procedures.

"Correlated with therapeutic responsiveness" (positive or negative) means that the polymorphic pattern is predictive of clinical response (or lack thereof) . This could be derived by examining the polymoφhic pattern of individuals within a population exhibiting the desired responsiveness (or failing to exhibit such responsiveness). Statistical significance (as defined below) is a prerequisite of the correlation.

"Genetic status" as used herein refers to the physiological status of an individual's with respect to responsiveness to a therapeutic regimen for disease, as reflected in one or more status markers or indicators including genotype. Genetic status shall be deemed to include without limitation not only the absence or presence of a pathology or disease in one or more components of the individual's and the individual's predisposition to developing such a condition, but also the individual's responsivity, i.e., the ability or inability of the individual to respond (positively or negatively) to a particular prophylactic or therapeutic regimen or treatment for a condition, such as a drug or a class of drugs. A negative response includes non-responsiveness as well as one or more adverse reactions and side effects. "Cardiovascular status", "cancer status", "depression status", etc., refer to the physiological status of an individual with respect to that specific disease or disorder.

Status markers include without limitation clinical measurements. Status markers of cardiovascular disease include blood pressure, electrocardiographic profile, differentiated blood flow analysis, and the presence of increased levels of cellular proteins associated with a cardiovascular event. Examples of such proteins, also called diagnostic markers, which are important in cardiac events include myosin light chain, myosin heavy chain, myoglobin, troponin I, troponin T, CK-MB, etc. (see U.S. Patents No. 5,604, 105 and No. 5,744,358).

Cancer status markers include white blood cell count, the level of tumor- specific antigens, cachexia, and pain. Depression status markers include fatigue, melancholy, lack of appetite, etc. Status markers according to the invention are assessed using conventional methods well known in the art. Also included in the evaluation of genetic status are quantitative or qualitative changes in status markers with time, such as would be used, e.g. , in the determination of an individual's response to a particular therapeutic regimen or of a predisposed individual's eventual development of a cardiovascular condition.

Examples of cardiovascular syndromes that are included in the foregoing definition of cardiovascular status include diagnosis of, or predisposition to, one or more cardiovascular syndromes, such as, e.g. , hypertension, acute myocardial infarction, silent myocardial infarction, unstable angina, stroke, and atherosclerosis. It will be understood that a diagnosis of a cardiovascular syndrome made by a medical practitioner encompasses not only clinical measurements but also medical judgment.

[PLEASE PROVIDE SOME SIMILAR INFORMATION FOR OTHER DISEASES]

"Responsivity" or "responsiveness", as used herein, refers to the type and degree of response an individual exhibits to a particular therapeutic regimen, i.e. , the effect of a treatment on an individual. Responsivity breaks down into three major categories: therapeutic effect; no effect; and adverse effect. Naturally, there can be differing degrees of a therapeutic effect, e.g. , between full elimination and partial elimination of symptomology. In addition, adverse effects, or side effects, may be observed even though the treatment is beneficial, i.e. , therapeutically effective. Indeed, the present invention may permit identification of individuals with complex responsivity traits or patterns.

A "polymoφhism" as used herein denotes a variation in the nucleotide sequence of a gene in an individual (compared to the nucleotide sequence of another allele or compared to the nucleotide sequence of the same gene in another individual of the same species). Two copies of the same gene in the same individual are called "alleles. " A "polymoφhic position" is a predetermined nucleotide position within the sequence. In some cases, genetic polymoφhisms are reflected by an amino acid sequence variation, and thus a polymoφhic position can result in location of a polymoφhism in the amino acid sequence at a predetermined position in the sequence of a polypeptide. An individual "homozygous" for a particular polymoφhism is one in which both copies of the gene contain the same sequence at the polymoφhic position. An individual "heterozygous" for a particular polymoφhism is one in which the two copies of the gene contain different sequences at the polymoφhic position.

A "polymoφhism pattern" as used herein denotes a set of one or more or preferably two or more, most preferably three or more, polymoφhisms (including without limitation single nucleotide polymoφhisms (SNPs)), which may be contained in the sequence of a single gene or a plurality of genes (including the coding as well as the regulatory regions of such genes preceding or following the coding region). In the simplest case, a polymoφhism pattern can consist of a single nucleotide polymoφhism in only one position of one of two alleles of an individual. However, one has to look at both copies of a gene. A polymoφhism pattern that is appropriate for assessing a particular aspect of disease status (e.g., predisposition to hypertension) need not contain the same number (nor identity, of course) of polymoφhisms as a polymoφhism pattern that would be appropriate for assessing another aspect of disease status. A "test polymoφhism pattern" as used herein is a polymoφhism pattern determined for a human subject of undefined disease status. A "reference polymoφhism pattern" as used herein is determined from a statistically significant correlation of patterns in a population of individuals with known or pre-determined disease status. The polymoφhisms involved in a polymoφhic pattern (whether test or reference) are located within one or more genes (including any introns and regulatory regions thereof) encoding one more proteins involved in a physiologic pathway that the therapeutic regimen is designed to affect, e.g. the serotonergic pathway, the dopamine pathway, the radiotherapy pathway, or the prostaglandin pathway.

A "statistically significant" correlation preferably has a "p" value of less than or equal to 0.05. Any standard statistical method can be used to calculate these values, such as the normal students' T-test or Fischer's exact test.

"Nucleic acid" or "polynucleotide" as used herein refers to purine- and pyrimidme-contøining polymers of any length, either polyribonucleotides or polydeoxyribonucleotides or mixed polyribo-polydeoxyribo nucleotides. Nucleic acids include without limitation single- and double-stranded molecules, i.e. , DNA-DNA, DNA- RNA and RNA-RNA hybrids, as well as "protein nucleic acids" (PNA) formed by conjugating bases to an amino acid backbone. This also includes nucleic acids containing modified bases and non-naturally occurring phosphoester analog bonds, such as phosphorothioates and thioesters. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double- stranded DNA found, inter alia, in linear or circular DNA molecules (e.g. , restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double- stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5 to 3 direction along the nontranscribed strand of DNA (i.e. , the strand having a sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation.

As used herein, the term "oligonucleotide" refers to a nucleic acid, generally of at least 10, preferably at least 15, and more preferably at least 20 nucleotides, that is hybridizable to a genomic DNA molecule, a cDNA molecule, or an mRNA molecule encoding a gene, cDNA, mRNA, or other nucleic acid of interest. Oligonucleotides can be labeled, e.g. , with ³ P-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated. In one embodiment, a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid. In another embodiment, oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning the full length or a fragment of a gene of interest, or to detect the presence of nucleic acids encoding the gene of interest. In a further embodiment, an oligonucleotide of the invention can form a triple helix with a double stranded sequence of interest in a DNA molecule. In still another embodiment, a library of oligonucleotides arranged on a solid support, such as a silicon wafer or chip, can be used to detect various polymoφhisms of interest. Generally, oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds.

An "isolated" nucleic acid or polypeptide as used herein refers to a nucleic acid or polypeptide that is removed from its original environment (for example, its natural environment if it is namrally occurring). An isolated nucleic acid or polypeptide contains less than about 50%, preferably less than about 75%, and most preferably less than about 90%, of the cellular components with which it was originally associated.

A nucleic acid or polypeptide sequence that is "derived from" a designated sequence refers to a sequence that corresponds to a region of the designated sequence. For nucleic acid sequences, this encompasses sequences that are identical to or complementary to the sequence.

A "probe" refers to a nucleic acid or oligonucleotide that forms a hybrid structure with a sequence in a target nucleic acid due to complementarity of at least one sequence in the probe with a sequence in the target nucleic acid. Generally, a probe is labeled so it can be detected after hybridization.

A nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al. , 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. For preliminary screening for homologous nucleic acids, low stringency hybridization conditions, corresponding to a T_m of 55°C, can be used, e.g. , 5x SSC, 0.1 % SDS, 0.25% milk, and no formamide; or 30% formamide, 5x SSC, 0.5% SDS). Moderate stringency hybridization conditions correspond to a higher T_m, e.g. , 40% formamide, with 5x or 6x SCC. High stringency hybridization conditions correspond to the highest T_m, e.g. , 50% formamide, 5x or 6x SCC. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T_m for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher T„) of nucleic acid hybridizations decreases in the following order: RNA: RNA, DNA: RNA, DNA: DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating T_m have been derived (see Sambrook et al. , supra, 9.50-9.51). For hybridization with shorter nucleic acids, i.e. , oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al. , supra, 11.7-11.8). A minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; preferably at least about 15 nucleotides; and more preferably the length is at least about 20 nucleotides.

In a specific embodiment, the term "standard hybridization conditions" refers to a T_m of 55 °C, and utilizes conditions as set forth above. In a preferred embodiment, the T_m is 60°C; in a more preferred embodiment, the T_m is 65°C. In a specific embodiment, "high stringency" refers to hybridization and/or washing conditions at 68°C in 0.2XSSC, at 42°C in 50% formamide, 4XSSC, or under conditions that afford levels of hybridization equivalent to those observed under either of these two conditions.

A "gene" for a particular protein as used herein refers to a contiguous nucleic acid sequence corresponding to a sequence present in a genome which comprises (i) a "coding region, " which comprises exons (i.e. , sequences encoding a polypeptide sequence or "protein-coding sequences"), introns, and sequences at the junction between exons and introns; and (ii) regulatory sequences, which flank the coding region at one or both 5' and 3' termini. For example, the "ACE gene" as used herein encompasses the regulatory and coding regions of the human gene encoding angiotensin converting enzyme. Typically, regulatory sequences according to the invention are located 5' (i.e. , upstream) of the coding region segment.

The present inventors have suφrisingly and unexpectedly discovered the existence of genetic polymoφhisms within the human genes encoding proteins involved in pathological conditions which, singly or in combination, can be used to assess disease status, depending on which component of disease status is under evaluation. In accordance with the invention, the polymoφhic pattern of proteins involved in pathological conditions in an individual can predict the responsivity of the individual to particular therapeutic interventions and serve as an indicator of predisposition to various forms of disease. The invention provides methods for assessing disease status by detecting polymoφhic patterns in an individual.

Genes and physiologic pathways associated with therapeutic regimens for use in the present invention are set forth in the following pending patent applications, incoφorated by reference.

U.S. patent application Serial No. 09/050,059 filed March 27, 1998 and its PCT counteφart PCT/IB98/00475 published as WO 98/45477 on October 15, 1999 discloses genetic polymoφhism in the renin-angiotensin-aldersterone system and methods for assessing cardiovascular status in human. The renin-angiotensin system includes at least renin, angiotensin converting enzyme (ACE), angiotensinogen (AGT), type I angiotensin II receptor (ATI) and type II angiotensin (AT2) genes. Although analysis of the polymoφhic patterns disclosed in this application allowed for their use in assessing cardiovascular status in humans, there is no disclosure or suggestion contained therein that the findings were not limited to RAAS or to the specific genes (e.g. , ACE, AGT, ATI or AT2) themselves.

U.S. patent application Serial No. 60/104,282, filed October 14, 1998 discloses novel polymoφhism patterns that correlate with cardiovascular status. The polymoφhisms are found in the angiotensin converting enzyme (ACE), angiotensinogen (AGT), and type-1 angiogensin II receptor (ATI) genes. Reference patterns correlate with ACE inhibitor responsiveness and ACE inhibitor non-responsiveness. Reference patterns were also found that correlate with predisposition to myocardial infarction and stroke.

U.S. patent application Serial No. 60/104,302 filed October 14, 1998 discloses polymoφhisms in /3-adrenergeric receptor genes, which are useful for creating polymoφhism patterns that correlate with cardiovascular status. Methods for identifying cardiovascular status are also disclosed.

U.S. patent application Serial No. 60/104,284, filed October 14, 1998, discloses in endothelin receptor genes, particularly type A endothelin receptor, which are useful for creating polymoφhism patterns that correlate with cardiovascular status. Methods for identifying cardiovascular status are also disclosed.

U.S. patent application Serial No. 60/104,301 filed October 14, 1998 discloses polymoφhisms in the renin gene, which are useful on their own or in combination with mutations of one or more of the ACE, AGT, and ATI genes for creating polymoφhism patterns that correlate with cardiovascular status. Methods for identifying cardiovascular status are also disclosed.

U.S. patent application Serial No. 60/104,277 filed October 14, 1998 discloses polymoφhisms in the aldosterone synthase gene, which are useful on their own or in combination with mutations of one or more of the ACE, AGT, and ATI genes for creating polymoφhism patterns that correlate with cardiovascular status. Methods for identifying cardiovascular status are also disclosed.

U.S. patent application, Serial No. 60/104,285 filed October 14, 1998 discloses polymoφhisms in the type-2 angiogtensin II receptor gene, which are useful on their own or in combination with mutations of one or more of the ACE, AGT, and ATI genes for creating polymoφhism patterns that correlate with cardiovascular status. Methods for identifying cardiovascular status are also disclosed.

U.S. patent application Serial No. 60/104,286, filed October 14, 1998 discloses polymoφhisms in the ACE, AGT, ATI, AT2, renin, aldosterone synthase, β- adrenergic receptor genes, and endothelin receptor genes, which are useful for creating polymoφhism patterns that correlate with cardiovascular status. Methods for identifying cardiovascular status are also disclosed.

U.S. patent application Serial No. 09/153,552, filed September 15, 1998 discloses the use of genetic polymoφhisms in the microsomal triglyceride transfer protein promoter to evaluate an individual's predisposition to cardiovascular disease and assess responsiveness to drug treatment.

U.S. patent application Serial No. 09/190,076 filed November 12, 1998 discloses polymoφhism in the genes encoding prostaglandin receptor families, FP and EP1, and their use in assessing prostanoid response status in an individual to be tested.

Another system in which polymoφhisms can be used to assess responsiveness to a therapeutic regime is the D1-D3 (dopamine receptors), 5-HT_2A (serotonin receptor) genes and the response to antipsychotic drugs used in the treatment of schizophrenia. In addition, the 5-HTT (serotonin transporter) and 5-HT_1A (serotonin receptor) genes can be used to assess the treatment of patients suffering from major depressive disorder.

Yet another system in which polymoφhisms can be used to assess responsiveness to a therapeutic regime is the cytochrome P450 gene for assessing drug metabolism status.

Various genes have been used to establish the polymoφhism patterns. Table 1 identifies the GenBank accession numbers of specific genes disclosed herein. These GenBank sequences provide the reference point for specific base numbering provided herein, although the skilled artisan can identify the relevant positions in other sequences that start from difference reference points using routine skills.

Table l. GenBank Accession Numbers

Abbreviation Compared master sequence Numbering according to sequence entry in GenBank

AGT Regulatory X15323 X15323 Region

AGT Coding M24686 (exon 2) Protein-coding sequences from exon 2-5 Region M24687 (exon 3) were spliced together as described in the M24688 (exon 4) GenBank entries. M24689 (exon 5) Nucleotide 1 is assigned to the first nucleotide of the initiator methionine codon.

X62855 (intron 16) X62855

ACE Regulatory X94359 X94359 Region

ACE Coding J04144 J04144 Region Nucleotide 1 is assigned to the first nucleotide of the initiator methionine codon.

ATI Regulatory U07144 U07144 Region

ATI Coding S80239 (exon 3) The protein-coding sequence of S80239 Region S77410 (exon 5) was spliced to position 288 of entry

S77410.

Nucleotide 1 is assigned to the first nucleotide of the initiator methionine codon in entry S80239.

Below, the methods for assessing physiologic status are described in detail with specific reference to various pathways involved in cardiovascular status. However, the methods are generally applicable to any gene, the expression product of which is involved in any physiologic pathway which is affected in a pathological condition for which a treatment exists. Hence, the teachings below are readily applicable to polymoφhisms and polymoφhism patterns involved in other pathways even though neither the polymoφhisms nor their number or pattern nor their location(s) on a particular gene or genes will be the same.

However, the present invention has been proven in principle with respect to various pathways involved in cardiovascular status, and polymoφhisms and polymoφhic patterns have been identified with respect to other genes involved in totally different pathologies. Because of the arbitrariness of these choices (the only criterion for selecting a pathway for investigation is that a treatment exists), the present inventors have reasonably established that this methodology to be equally applicable to genes in other pathways.

Methods for Assessing Genetic Status

The present invention provides diagnostic methods for assessing genetic status in a human individual. The methods are carried out by comparing a polymoφhic position or pattern ("test polymoφhic pattern") within the individual's gene encoding a gene in a relevant pathway with the polymoφhic patterns of humans exhibiting a predetermined genetic status ("reference polymoφhic pattern"). If the cardiovascular status is the prediction of responsivity to a therapy, a single polymoφhic position can provide a pattern for comparison. However, it is preferable to use more than one polymoφhic position for the pattern to improve the accuracy of the prediction. If the cardiovascular status is predisposition to a particular syndrome (disease or disorder), at least two, and preferably at least three, polymoφhic positions are used to make the pattern.

For any meaningful prediction, the polymoφhic pattern of the individual is identical to the polymoφhic pattern of individuals who exhibit particular status markers, cardiovascular syndromes, and/or particular patterns of response to therapeutic interventions.

In one embodiment, the method involves comparing an individual's test polymoφhic pattern with reference polymoφhic patterns of individuals who have been shown to respond positively or negatively to a particular therapeutic regimen. Therapeutic regimen as used herein refers to treatments aimed at the elimination or amelioration of symptoms and events associated cardiovascular disease.

For cardiovascular diseases, such treatments include without limitation one or more of alteration in diet, lifestyle, and exercise regimen; invasive and noninvasive surgical techniques such as atherectomy, angioplasty, and coronary bypass surgery; and pharmaceutical interventions, such as administration of ACE inhibitors, angiotensin II receptor antagonists, diuretics, alpha-adrenoreceptor antagonists, cardiac glycosides, phosphodiesterase inhibitors, beta-adrenoreceptor antagonists, calcium channel blockers, HMG-CoA reductase inhibitors, imidazoline receptor blockers, endothelin receptor blockers, and organic nitrites. Interventions with pharmaceutical agents not yet known whose activity correlates with particular polymoφhic patterns associated with cardiovascular disease are also encompassed. The present inventors have discovered that particular polymoφhic patterns correlate with an individual's responsivity to ACE inhibitors (see, e.g. , Example 3 below). It is contemplated, for example, that patients who are candidates for a particular therapeutic regimen will be screened for polymoφhic patterns that correlate with responsivity to that particular regimen.

In another embodiment, the method involves comparing an individual's polymoφhic pattern with polymoφhic patterns of individuals who exhibit or have exhibited one or more markers of cardiovascular disease, such as, e.g. , high blood pressure, abnormal electrocardiographic profile, myocardial infarction, unstable angina, stroke, or atherosclerosis (see, e.g. , Example 2 below) and drawing analogous conclusions as to the individual's responsivity to therapy, predisposition to developing a syndrome, etc., as detailed above.

Identification of Polymorphic Patterns

In practicing the methods of the invention, an individual's polymoφhic pattern can be established, e.g., by obtaining DNA from the individual and determining the sequence at a predetermined polymoφhic position or positions in a gene.

The DNA may be obtained from any cell source. Non-limiting examples of cell sources available in clinical practice include without limitation blood cells, buccal cells, cervico vaginal cells, epithelial cells from urine, fetal cells, or any cells present in tissue obtained by biopsy. Cells may also be obtained from body fluids, including without limitation blood, saliva, sweat, urine, cerebrospinal fluid, feces, and tissue exudates at the site of infection or inflammation. DNA is extracted from the cell source or body fluid using any of the numerous methods that are standard in the art. It will be understood that the particular method used to extract DNA will depend on the nature of the source.

Determination of the sequence of the extracted DNA at polymoφhic positions is achieved by any means known in the art, including but not limited to direct sequencing, hybridization with allele-specific oligonucleotides, allele-specific PCR, ligase-

SUBSTΓΓUTE SHEET (RULE 26) PCR, HOT cleavage, denaturing gradient gel electrophoresis (DGGE), and single- stranded conformational polymoφhism (SSCP). Direct sequencing may be accomplished by any method, including without limitation chemical sequencing, using the Maxam- Gilbert method; by enzymatic sequencing, using the Sanger method; mass spectrometry sequencing; and sequencing using a chip-based technology. See, e.g. , Little et al , Genet. Anal. 6: 151, 1996. Preferably, DNA from a subject is first subjected to amplification by polymerase chain reaction (PCR) using specific amplification primers.

In an alternate embodiment, biopsy tissue is obtained from a subject. Antibodies that are capable of distinguishing between different polymoφhic forms of a particular protein are then applied to samples of the tissue to determine the presence or absence of a polymoφhic form specified by the antibody. The antibodies may be polyclonal or monoclonal, preferably monoclonal. Measurement of specific antibody binding to cells may be accomplished by any known method, e.g., quantitative flow cytometry, or enzyme-linked or fluorescence-linked immunoassay. The presence or absence of a particular polymoφhism or polymoφhic pattern, and its allelic distribution (i.e. , homozygosity vs. heterozygosity) is determined by comparing the values obtained from a patient with norms established from populations of patients having known polymoφhic patterns.

In another alternate embodiment, RNA is isolated from biopsy tissue using standard methods well known to those of ordinary skill in the art such as guanidium thiocyanate-phenol-chloroform extraction (Chomocyznski et al , 1987, Anal Biochem. , 162: 156.) The isolated RNA is then subjected to coupled reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that are specific for a selected polymoφhism. Conditions for primer annealing are chosen to ensure specific reverse transcription and amplification; thus, the appearance of an amplification product is diagnostic of the presence of a particular polymoφhism. In another embodiment, RNA is reverse-transcribed and amplified, after which the amplified sequences are identified by, e.g. , direct sequencing. In still another embodiment, cDNA obtained from the RNA can be cloned and sequenced to identify a polymoφhism.

Establishing Reference Polymorphism Patterns

In practicing the present invention, the distribution of polymoφhic patterns in a large number of individuals exhibiting particular disease status is determined by any of the methods described above, and compared with the distribution of polymoφhic patterns in patients that have been matched for age, ethnic origin, and/or any other statistically or medically relevant parameters, who exhibit quantitatively or qualitatively different disease status. Correlations are achieved using any method known in the art, including nominal logistic regression or standard least squares regression analysis. In this manner, it is possible to establish statistically significant correlations between particular polymoφhic patterns and particular disease statuses. It is further possible to establish statistically significant correlations between particular polymoφhic patterns and changes in disease status such as, would result, e.g. , from particular treatment regimens. Thus, it is possible to correlate polymoφhic patterns with responsivity to particular treatments.

As defined above, a statistically significant correlation preferably has a "p" value of less than or equal to 0.05. Any standard statistical method can be used to calculate these values, such as the normal Student's T Test, or Fischer's Exact Test.

The identity and number of polymoφhisms to be included in a reference pattern depends not only on the prevalence of a polymoφhism and its predictive value for the particular use, but also on the value of the use and its requirement for accuracy of prediction. The greater the predictive value of a polymoφhism, the lower the need for inclusion of multiple polymoφhisms in the reference pattern. However, if a polymoφhism is very rare, then its absence from an individual's pattern might provide no indication as to whether the individual has a particular status. Under these circumstances, it might be advisable to select instead two or more polymoφhisms which are more prevalent. Even if none of them has a high predictive value on its own, the presence of both (or all three) of them is likely to be sufficiently predictive for the particular puφose. If for example the use for a reference pattern is prediction of response to a drug, and among the afflicted population only a 30% response to the drug is observed, the reference pattern need only permit selection of a population that improves the response rate by 10% to provide a significant improvement in the state of the art. On the other hand, if the use for the reference pattern is selection of subjects for a particular clinical study, the pattern should be as selective as possible and should therefore include a plurality of polymoφhisms that together provide a high predictive accuracy for the intended response. In establishing reference polymoφhism patterns, it is desirable to use a defined population. For example, tissue libraries collected and maintained by state or national departments of health can provide a valuable resource, since genotypes determined from these samples can be matched with medical history, and particularly cardiovascular status, of the individual. Such tissue libraries are found, for example, in Sweden, Iceland, Norway, and Finland. As can be readily understood by one of ordinary skill in the art, specific polymoφhisms may be associated with a closely linked population. However, other polymoφhisms in the same gene may correlate with disease status of other genetically related populations. Thus, in addition to the specific polymoφhisms provided in the instant application, the invention identifies genes in which any polymoφhisms can be used to establish reference and test polymoφhism patterns for evaluating disease status of individuals in the population.

In a specific embodiment, DNA samples can be obtained from a well defined population, such as 277 Caucasian males born in Uppsala, Sweden between 1920 and 1924. In a specific embodiment, such individuals are selected for the test population based on their medical history, i.e. , they were either (i) healthy, with no signs of cardiovascular disease (100); or (ii) had suffered one of acute myocardial infarction (68), silent myocardial infarction (34), stroke (18), stroke and acute myocardial infarction (19), or high blood pressure at age 50 (39). DNA samples are obtained from each individual.

In a specific embodiment, DNA sequence analysis can be carried out by: (i) amplifying short fragments of each of the genes using polymerase chain reaction (PCR) and (ii) sequencing the amplified fragments. The sequences obtained from each individual can then be compared with the first known sequences, e.g. , as set forth in Table 1, to identify polymoφhic positions.

Comparing Test Patterns to Reference Patterns

As noted above, the test pattern from an individual can be compared to a reference pattern established for a predetermined disease status. Identity between the test pattern and the reference pattern means that the tested individual has a probability of having the same disease status as that represented by the reference pattern. As discussed above, this probability depends on the prevalence of the polymoφhism and the statistical significance of its correlation with a disease status.

The invention also provides nucleic acid vectors comprising the disclosed gene sequences or derivatives or fragments thereof. A large number of vectors, including plasmid and fungal vectors, have been described for replication and/or expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple cloning or protein expression. Non-limiting examples of suitable vectors include without limitation pUC plasmids, pET plasmids (Novagen, Inc., Madison, WI), or pRSET or pREP (Invitrogen, San Diego, CA), and many appropriate host cells, using methods disclosed or cited herein or otherwise known to those skilled in the relevant art. The particular choice of vector/host is not critical to the practice of the invention.

Suitable host cells may be transformed/transfected/infected as appropriate by any suitable method including electroporation, CaCl₂ mediated DNA uptake, calcium phosphate precipitation, fungal or viral infection, lipofection, microinjection, microprojectile, or other established methods. Appropriate host cells included bacteria, archebacteria, fungi, especially yeast, and plant and animal cells, especially mammalian cells. A large number of transcription initiation and termination regulatory regions have been isolated and shown to be effective in the transcription and translation of heteroiogous proteins in the various hosts. Examples of these regions, methods of isolation, manner of manipulation, etc. are known in the art. Under appropriate expression conditions, host cells can be used as a source of recombinantly produced or derived peptides and polypeptides.

Nucleic acids encoding the gene sequences disclosed herein may also be introduced into cells by recombination events. For example, such a sequence can be introduced into a cell and thereby effect homologous recombination at the site of an endogenous gene or a sequence with substantial identity to the gene. Other recombination-based methods such as nonhomologous recombinations or deletion of endogenous genes by homologous recombination may also be used.

Oligonucleotides The nucleic acids of the present invention find use as probes for the detection of genetic polymoφhisms, as primers for the expression of polymoφhisms, or in molecular library arrays for high throughput screening.

Probes in accordance with the present invention comprise without limitation isolated nucleic acids of about 10 - 100 bp, preferably 15-75 bp and most preferably 17- 25 bp in length, which hybridize at high stringency to one or more of the gene-derived polymoφhic sequences disclosed herein or to a sequence immediately adjacent to a polymoφhic position. Furthermore, in some embodiments a full-length gene sequence may be used as a probe. In one series of embodiments, the probes span the polymoφhic positions in the genes disclosed above. In another series of embodiments, the probes correspond to sequences immediately adjacent to the polymoφhic positions.

The oligonucleotide nucleic acids may also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g. , methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) and with charged linkages (e.g. , phosphorothioates, phosphorodithioates, etc.). Nucleic acids may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g. , nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g. , acridine, psoralen, etc.), chelators (e.g. , metals, radioactive metals, iron, oxidative metals, etc.), and alkylators. PNAs are also included. The nucleic acid may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage. Furthermore, the nucleic acid sequences of the present invention may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, biotin, and the like.

PCR amplification of gene segments that contain a polymoφhism provides a powerful tool for detecting the polymoφhism. The oligonucleotides of the invention can also be used as PCR primers to amplify segments of endothelin receptor containing a polymoφhism of interest. The amplified segment can be evaluated for the presence or absence of a polymoφhism by restriction endonuclease activity, SSCP, or by direct sequencing. In another embodiment, the primer is specific for a polymoφhic sequence on the gene. If the polymoφhism is present, the primer can hybridize and DNA will be produced by PCR. However, if the polymoφhism is absent, the primer will not hybridize, and no DNA will be produced. Thus, PCR can be used to directly evaluate whether a polymoφhism is present or absent. Molecular library arrays of oligonucleotides (including oligonucleotides with modifications as described above) are another powerful tool for rapidly assessing whether one or more polymoφhisms are present in a gene, preferably in combination with other genes. Molecular library arrays are disclosed in US Patents No. 5,677, 195, No. 5,599,695, No. 5,545,531, and No. 5,510,270.

Polymorphic Polypeptides and Polymorphism-Specific Antibodies

The present invention encompasses isolated peptides and polypeptides encoded by all or a portion of the protein-encoding genes disclosed herein comprising polymoφhic positions disclosed above. In one preferred embodiment, the peptides and polypeptides are useful screening targets to identify drugs. In another preferred embodiment, the peptides and polypeptides are capable of eliciting antibodies in a suitable host animal that react specifically with a polypeptide comprising the polymoφhic position and distinguish it from other polypeptides having a different amino acid sequence at that position.

Polypeptides according to the invention are preferably at least five or more residues in length, preferably at least fifteen residues. Methods for obtaining these polypeptides are described below. Many conventional techniques in protein biochemistry and immunology are used. Such techniques are well known and are explained in Immunochemical Methods in Cell and Molecular Biology, 1987 (Mayer and Waler, eds; Academic Press, London); Scopes, 1987, Protein Purification: Principles and Practice, Second Edition (Springer- Verlag, N.Y.) and Handbook of Experimental Immunology, 1986, Volumes I-IV (Weir and Blackwell eds.).

Nucleic acids comprising protein-coding sequences can be used to direct the recombinant expression of polypeptides in intact cells or in cell-free translation systems. The known genetic code, tailored if desired for more efficient expression in a given host organism, can be used to synthesize oligonucleotides encoding the desired amino acid sequences. The polypeptides may be isolated from human cells, or from heteroiogous organisms or cells (including, but not limited to, bacteria, fungi, insect, plant, and mammalian cells) into which an appropriate protein-coding sequence has been introduced and expressed. Furthermore, the polypeptides may be part of recombinant fusion proteins. Peptides and polypeptides may be chemically synthesized by commercially available automated procedures, including, without limitation, exclusive solid phase synthesis, partial solid phase methods, fragment condensation or classical solution synthesis. The polypeptides are preferably prepared by solid phase peptide synthesis as described by Merrifield, 1963, J. Am. Chem. Soc. 85:2149.

Methods for polypeptide purification are well-known in the art, including, without limitation, preparative disc-gel electrophoresis, isoelectric focusing, HPLC, reversed-phase HPLC, gel filtration, ion exchange and partition chromatography, and countercurrent distribution. For some puφoses, it is preferable to produce the polypeptide in a recombinant system in which the protein contains an additional sequence tag that facilitates purification, such as, but not limited to, a polyhistidine sequence. The polypeptide can then be purified from a crude lysate of the host cell by chromatography on an appropriate solid-phase matrix. Alternatively, antibodies produced against endothelin receptor or against peptides derived therefrom, can be used as purification reagents. Other purification methods are possible.

The present invention also encompasses derivatives and homologues of the polypeptides. For some puφoses, nucleic acid sequences encoding the peptides may be altered by substitutions, additions, or deletions that provide for functionally equivalent molecules, i.e. , function-conservative variants. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of similar properties, such as, for example, positively charged amino acids (arginine, lysine, and histidine); negatively charged amino acids (aspartate and glutamate); polar neutral amino acids; and non-polar amino acids.

The isolated polypeptides may be modified by, for example, phosphorylation, sulfation, acylation, or other protein modifications. They may also be modified with a label capable of providing a detectable signal, either directly or indirectly, including, but not limited to, radioisotopes and fluorescent compounds.

The present invention also encompasses antibodies that specifically recognize the polymoφhic positions of the invention and distinguish a peptide or polypeptide containing a particular polymoφhism from one that contains a different sequence at that position. Such polymoφhic position-specific antibodies according to the present invention include polyclonal and monoclonal antibodies. The antibodies may be elicited in an animal host by immunization with endothelin receptor -derived immunogenic components or may be formed by in vitro immunization of immune cells. The immunogenic components used to elicit the antibodies may be isolated from human cells or produced in recombinant systems. The antibodies may also be produced in recombinant systems programmed with appropriate antibody-encoding DNA. Alternatively, the antibodies may be constructed by biochemical reconstitution of purified heavy and light chains. The antibodies include hybrid antibodies (i.e. , containing two sets of heavy chain/light chain combinations, each of which recognizes a different antigen), chimeric antibodies (t^'.e. , in which either the heavy chains, light chains, or both, are fusion proteins), and univalent antibodies (i.e. , comprised of a heavy chain/light chain complex bound to the constant region of a second heavy chain). Also included are Fab fragments, including Fab' and F(ab)₂ fragments of antibodies. Methods for the production of all of the above types of antibodies and derivatives are well-known in the art and are discussed in more detail below. For example, techniques for producing and processing polyclonal antisera are disclosed in Mayer and Walker, 1987, Immunochemical Methods in Cell and Molecular Biology , (Academic Press, London). The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g. , Schreier et al. , 1980, Hybridoma Techniques; U.S. Patent Nos. 4,341,761; 4,399, 121 ; 4,427,783; 4,444,887; 4,466,917; 4,472,500; 4,491,632; and 4,493,890. Panels of monoclonal antibodies produced against epitopes present on the proteins of the present invention can be screened for various properties; i.e. for isotype, epitope affinity, etc.

The antibodies of this invention can be purified by standard methods, including but not limited to preparative disc-gel electrophoresis, isoelectric focusing, HPLC, reversed-phase HPLC, gel filtration, ion exchange and partition chromatography, and countercurrent distribution. Purification methods for antibodies are disclosed, e.g. , in The Art of Antibody Purification, 1989, Amicon Division, W.R. Grace & Co. General protein purification methods are described in Protein Purification: Principles and Practice, R.K. Scopes, Ed., 1987, Springer- Verlag, New York, NY.

Methods for determining the immunogenic capability of the disclosed sequences and the characteristics of the resulting sequence-specific antibodies and immune cells are well-known in the art. For example, antibodies elicited in response to a peptide comprising a particular polymoφhic sequence can be tested for their ability to specifically recognize that polymoφhic sequence, i.e. , to bind differentially to a peptide or polypeptide comprising the polymoφhic sequence and thus distinguish it from a similar peptide or polypeptide containing a different sequence at the same position.

Diagnostic Methods and Kits

The present invention provides kits for the determination of the sequence at a polymoφhic position or positions within the encoding protein in a pathological pathway gene in an individual, in combination with determination of the sequence at polymoφhism positions of other genes. The kits comprise a means for determining the sequence at the polymoφhic positions, and may optionally include data for analysis of polymoφhic patterns. The means for sequence determination may comprise suitable nucleic acid-based and immunological reagents (see below). Preferably, the kits also comprise suitable buffers, control reagents where appropriate, and directions for determining the sequence at a polymoφhic position. The kits may also comprise data for correlation of particular polymoφhic patterns with desirable treatment regimens or other indicators.

Nucleic-acid-based diagnostic methods and kits

The invention provides nucleic acid-based methods for detecting polymoφhic patterns in a biological sample. The sequence at particular polymoφhic positions in the genes is determined using any suitable means known in the art, including without limitation hybridization with polymoφhism-specific probes and direct sequencing.

The present invention also provides kits suitable for nucleic acid-based diagnostic applications. In one embodiment, diagnostic kits include the following components:

(i) Probe DNA: The probe DNA may be pre-labeled; alternatively, the probe DNA may be unlabeled and the ingredients for labeling may be included in the kit in separate containers; and

(ii) Hybridization reagents: The kit may also contain other suitably packaged reagents and materials needed for the particular hybridization protocol, including solid-phase matrices, if applicable, and standards. In another embodiment, diagnostic kits include:

(i) Sequence determination primers: Sequencing primers may be pre- labeled or may contain an affinity purification or attachment moiety; and

(ii) Sequence determination reagents: The kit may also contain other suitably packaged reagents and materials needed for the particular sequencing protocol. In one preferred embodiment, the kit comprises a panel of sequencing primers, whose sequences correspond to sequences adjacent to the polymoφhic positions.

Antibody-based diagnostic methods and kits

The invention also provides antibody-based methods for detecting polymoφhic patterns in a biological sample. The methods comprise the steps of: (i) contacting a sample with one or more antibody preparations, wherein each of the antibody preparations is specific for a particular polymoφhic form of the genes of the present invention under conditions in which a stable antigen-antibody complex can form between the antibody and antigenic components in the sample; and (ii) detecting any antigen- antibody complex formed in step (i) using any suitable means known in the art, wherein the detection of a complex indicates the presence of the particular polymoφhic form in the sample.

Typically, immunoassays use either a labeled antibody or a labeled antigenic component (e.g. , that competes with the antigen in the sample for binding to the antibody). Suitable labels include without limitation enzyme-based, fluorescent, chemiluminescent, radioactive, or dye molecules. Assays that amplify the signals from the probe are also known, such as, for example, those that utilize biotin and avidin, and enzyme- labelled immunoassays, such as ELISA assays.

The present invention also provides kits suitable for antibody-based diagnostic applications. Diagnostic kits typically include one or more of the following components:

(i) Polymorphism- specific antibodies: The antibodies may be pre-labelled; alternatively, the antibody may be unlabelled and the ingredients for labelling may be included in the kit in separate containers, or a secondary, labelled antibody is provided; and (ii) Reaction components: The kit may also contain other suitably packaged reagents and materials needed for the particular immunoassay protocol, including solid- phase matrices, if applicable, and standards.

The kits referred to above may include instructions for conducting the test. Furthermore, in preferred embodiments, the diagnostic kits are adaptable to high- throughput and/or automated operation.

Drug Targets and Screening Methods

According to the present invention, nucleotide sequences derived from the gene encoding a polymoφhic form of such protein, and peptide sequences derived from that polymoφhic form of a protein involved in a physiological pathway associated with the therapeutic regime in a pathological condition in any individual, are useful targets to identify drugs, i.e. , compounds that are effective in treating one or more clinical symptoms of disease. Drug targets include without limitation (i) isolated nucleic acids derived from the gene encoding such proteins and (ii) isolated peptides and polypeptides derived from such receptor polypeptides, each of which comprises one or more polymoφhic positions.

In vitro screening methods

In one series of embodiments, an isolated nucleic acid comprising one or more polymoφhic positions is tested in vitro for its ability to bind test compounds in a sequence-specific manner. The methods comprise:

(i) providing a first nucleic acid containing a particular sequence at a polymoφhic position and a second nucleic acid whose sequence is identical to that of the first nucleic acid except for a different sequence at the same polymoφhic position;

(ii) contacting the nucleic acids with a multiplicity of test compounds under conditions appropriate for binding; and

(iii) identifying those compounds that bind selectively to either the first or second nucleic acid sequence.

Selective binding as used herein refers to any measurable difference in any parameter of binding, such as, e.g. , binding affinity, binding capacity, etc.

In another series of embodiments, an isolated peptide or polypeptide comprising one or more polymoφhic positions is tested in vitro for its ability to bind test compounds in a sequence-specific manner. The screening methods involve:

(i) providing a first peptide or polypeptide containing a particular sequence at a polymoφhic position and a second peptide or polypeptide whose sequence is identical to the first peptide or polypeptide except for a different sequence at the same polymoφhic position;

(ii) contacting the polypeptides with a multiplicity of test compounds under conditions appropriate for binding; and

(iii) identifying those compounds that bind selectively to one of the nucleic acid sequences.

In preferred embodiments, high-throughput screening protocols are used to survey a large number of test compounds for their ability to bind the genes or peptides disclosed above in a sequence-specific manner.

Test compounds are screened from large libraries of synthetic or natural compounds. Numerous means are currently used for random and directed synthesis of saccharide, peptide, and nucleic acid based compounds. Synthetic compound libraries are commercially available from Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ), Brandon Associates (Merrimack, NH), and Microsource (New Milford, CT). A rare chemical library is available from Aldrich (Milwaukee, WI). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available from e.g. Pan Laboratories (Bothell, WA) or MycoSearch (NC), or are readily producible. Additionally, natural and synthetically produced libraries and compounds are readily modified through conventional chemical, physical, and biochemical means.

In vivo screening methods

Intact cells or whole animals expressing polymoφhic variants of a gene encoding the proteins of the invention can be used in screening methods to identify candidate drugs.

In one series of embodiments, a permanent cell line is established from an individual exhibiting a particular polymoφhic pattern. Alternatively, cells (including without limitation mammalian, insect, yeast, or bacterial cells) are programmed to express a gene comprising one or more polymoφhic sequences by introduction of appropriate DNA. Identification of candidate compounds can be achieved using any suitable assay, including without limitation (i) assays that measure selective binding of test compounds to particular polymoφhic variants of selected proteins; (ii) assays that measure the ability of a test compound to modify (i.e. , inhibit or enhance) a measurable activity or function of the proteinend receptor ; and (iii) assays that measure the ability of a compound to modify (i. e. , inhibit or enhance) the transcriptional activity of sequences derived from the promoter (t^'.e. , regulatory) regions the gene.

In another series of embodiments, transgenic animals are created in which (i) a human gene having different sequences at particular polymoφhic positions are stably inserted into the genome of the transgenic animal; and/or (ii) the endogenous genes are inactivated and replaced with human genes having different sequences at particular polymoφhic positions. See, e.g. , Coffman, Semin. Nephrol. 17:404, 1997; Esther et al , Lab. Invest. 74:953, 1996; Murakami et al , Blood Press. Suppl. 2:36, 1996. Such animals can be treated with candidate compounds and monitored for one or more clinical markers of disease status.

Furthermore, populations that are not amenable to an established treatment for a particular disease or disorder can be selected for testing of alternative treatments. Moreover, treatments that are not as effective in the general population, but that are highly effective in the selected population, may be identified that otherwise would be overlooked. This is an especially powerful advantage of the present invention, since it eliminates some of the randomness associated with clinical trials.

The following are intended as non-limiting examples of the invention.

Example 1: Methods for Identification of Polymorphic Positions in Human Genes Encoding ACE. AGT. and ATI

The following studies were performed to identify polymoφhic residues within the genes encoding human ACE, AGT, and ATI.

DNA samples were obtained from 277 individuals. The individuals were Caucasian males born in Uppsala, Sweden between 1920 and 1924. Individuals were selected for the test population based on their medical history, i.e. , they were either (i) healthy, with no signs of cardiovascular disease (100); or (ii) had suffered one of acute myocardial infarction (68), silent myocardial infarction (34), stroke (18), stroke and acute myocardial infarction (19), or high blood pressure at age 50 (39). DNA samples were obtained from each individual.

DNA sequence analysis was carried out by: (i) amplifying short fragments of each of the ACE, AGT, and ATI genes using polymerase chain reaction (PCR) and (ii) sequencing the amplified fragments. The sequences obtained from each individual were then compared with known ACE, AGT, and ATI genomic sequences (see Table 1 in the Appendix attached herein).

(i) Amplification: PCR reactions employed the primers shown in Table 2 below.

Table 2

(0 c

CO 01

H m cn x in *% 30

C r- rπ

M at

c

DI tfl

H m cn x m V

SI

31 c r m κ> σ>

**) See Table 1 below.

Where indicated, the primers were modified in one of the following ways: (i) a biotin molecule was conjugated to the 5' terminus of the indicated sequence (B); (ii) a sequence of nucleotides derived from M13, 5'-CAGGAAACAGCTATGACT-3', [SEQ ID NO: 120] was added at the 5' terminus of the indicated sequence (MT); or (iii) the sequence 5'-AGTCACGACGTTGTAAAACGACGGCCAGT-3' [SEQ ID NO: 121] was added at the 5' terminus of the indicated sequence (T = Tail). Nucleotides were numbered according to the Genbank sequences listed in Table 1 where indicated. When the sequences involved were not publicly available, the numbering was as in the following examples: The designation "i-4: 1-200" indicates that the primer sequence is located within the sequence extending 200 bp upstream of, and including, the nucleotide immediately upstream of the first coding nucleotide of exon 4. Similarly, the designation "i+4: 1-200" indicates that the primer sequence is located within the sequence extending from the nucleotide that is located immediately downstream of the last coding nucleotide of exon 4 downstream for 200 bp. In each case, the specific location of the primer sequence is indicated in Table 2 in the column marked "Nucleotides".

The reaction components used for PCR are described in Table 3 below.

Table 3

CO c

QJ O

m

CO x m

SI c r rπ t

CO

CD ω

m O x m

S| c r- rπ to

O)

CO x m

SJ

3) c r- rπ to

O)

O c

CD CO

H m

CO x m

SI

3 c m r to

The reaction conditions used for PCR are described in Table 4 below.

Table 4

CO c

CD CO

H m

CO x m 0 I c r- m to σ>

All temperatures are given in degrees Celsius.

*) indicates the default initial temperatures (°C) and times of the program.

**) indicates the default temperature (°C) of the program.

***) indicates the default number of cycles of the program, referring to the section of the PCR program where three different temperatures are employed. Any differences are indicated in "Modifications" in Table 5 below.

The amplified fragments are described in Table 5 below with respect to the primers and PCR reaction conditions used for amplification. Table 5

CO c

CD CO

m

CO x m

SI

3 c r rπ to

x m

S|

3 c r rπ to

CO c

CD O

H m

CO x m

SI c m r to

O)

All of the PCR products (except fragments ACEDI, Al i-spec. i ana A I l- spec. 2) were subjected to solid phase sequencing according to the protocol commercially available from Pharmacia Biotech. The sequencing reactions are performed with a sequencing primer having a complementary sequence to the "Tail" sequence previously described in Table 2. The nucleotide sequence of the sequencing primer was 5'- CGACGTTGTAAAACGACGGCCAGT-3', [SEQ ID NO: 122] and the primer was fluorescently labeled with a Cy-5-molecule on the 5 '-nucleotide. The positions carrying a genetic variation were identified by determination of the nucleotide sequence by the use of the ALFexpress™ system commercially available from Pharmacia Biotech.

The detection of the fragment ACEDI was performed by analyzing the sizes of the amplified fragments by gel electrophoresis, where the presence of a shorter PCR product (192 base pairs) indicated the D-allele and a longer PCR product (479 base pairs) indicated the I-allele. The presence of both bands indicated a heterozygote for the two alleles. The detection of the allele-specific reaction of position AT1-1271 was performed by separately running two parallel PCR reactions on the same sample and comparing the sizes of the amplified fragments. A PCR product of 501 base pairs should always be present as a control in both parallel runs, whereas the presence of a PCR product of 378 base pairs in the reaction designated ATI -spec. 1 indicated the presence of an A in this position. The presence of a PCR product of 378 base pairs in the reaction designated ATI-spec. 2 indicated a C in this position. If the shorter PCR product was present in both reactions, the individual is a heterozygote for A and C.

Results:

The analysis described above resulted in the identification of polymoφhic positions within the regulatory and coding/intron segments of the human genes encoding ACE, AGT, and ATI. The polymorphic positions, the variant nucleotides found at each of the positions, and the PCR fragment in which the polymorphism was identified are shown in Table 6 below. Also shown are the frequencies of each genotype in a population of 90 individuals, expressed as the percent of the study population having that genotype. Polymoφhisms that resulted in alternate amino acids in ACE, AGT, or ATI are also indicated. As used hereinbelow, the designations "AGR" , "ACR", and "ATR" refer to the regulatory regions of the human AGT, ACE, and ATI genes, respectively; and the designations "AGT", "ACE", and "ATI ", refer to the coding regions of the AGT, ACE, and ATI genes. Table 6

cn x m q

31

C i- rπ

M O)

A subset of these polymorphic positions were further analyzed in an additional 187 individuals. Table 7 shows the polymorphic positions, the sequence at these positions, and the genotype frequencies for each position in a population of 277 as described in Example 1 above.

Table 7

Example 2: Correlation of Polymorphic Patterns with Cardiovascular Disease

The polymorphic positions identified as in Example 1 were correlated with the following markers of cardiovascular status present in the study population: myocardial infarction (MI); stroke; and high blood pressure. Polymoφhic patterns, i.e. , combinations of sequences at particular polymoφhic positions, that show a statistically significant correlation with one or more of these markers are shown below in Table 8.

Table 8. Polymorphism Pattens in Cardiovascular Disease

ACR 5349 A/T, AGR 1218 A

AGR 1204 A, AGT 620 C, ATI 1271 A, ATI 1167 A, AGR 395 A/T

AGR 1204 A/C, AGT 620 C/T, ATI 1271 A/C, ATI 1167 A, AGR 395 T

AGR 1204 A/C, AGT 620 C/T, ATI 1271 A/C, ATI 1167 A/G, AGR 395 T

Summary of the three previous polymoφhic patterns (which involve the same polymoφhic positions):

AGR 1204 A, ATI 678 C, ATI 1167 A, AGR 395 A/T

AGR 1204 A/C, ATI 678 C/T, ATI 1167 A, AGR 395 T

Example 3: Correlation Between a Specific Polymorphic Pattern and Treatment Response

The following study was undertaken to define polymoφhic patterns in the human ACE, AGT, and/or ATI genes that predict the efficacy of treatments for cardiovascular disease.

Two groups of hypertensive patients were studied, 41 in the first group and 20 in the second group. The groups were analyzed independently and in combination.

The patients in this population were each treated with one of the following five ACE inhibitors: Captopril, Trandolapril, Lisinopril, Fosinopril, or Enalapril. The effect of the drugs on mean arterial blood pressure was quantified. Mean arterial blood pressure was defined as 2/3 of the diastolic blood pressure + 1/3 of systolic blood pressure. The individuals were also categorized as "high responders, " i.e. , those exhibiting a decrease of more than 16 mm Hg during treatment with an ACE inhibitor drug, and "low responders, " i.e. , those not exhibiting a decrease of more than 16 mm

Hg.

One particular polymoφhic pattern, ACE 2193 A/G, AGR 1072 G/G, ATI 1167 A/ A, which was present in 51 % of the first study population, discriminated between high responders and low responders. In the second group of 20 patients, the pattern was less prevalent (25%), but the correlation with lowered blood pressure remained statistically significant. Individuals having this polymoφhic pattern (designated " 1 " below) experienced a larger decrease in blood pressure than those lacking this polymoφhic pattern (designated "0" below).

Table 8A.

Furthermore, the distribution of high responders and low responders (as defined above) was as follows:

Table 8B.

Taken together, the results from the two groups indicate that the presence of this polymoφhic pattern correlates with an incremental decrease of 6.4-7.3 mm Hg relative to individuals not having this polymoφhic pattern.

The prevalence of this polymoφhic pattern was 41 % in this hypertensive population. This suggests that testing for this polymoφhic pattern in hypertensive patients, followed by prescribing ACE inhibitors only to those patients having this polymoφhic pattern, could increase the response rate from 43 % (in a hypertensive population in general) to 76 % in hypertensive population selected according to the methods of the invention.

If even one polymoφhism was absent from the pattern, the high resolution of the variable and therefore the predictive value would be lost.

Polymorphism Patterns Correlated With ACE Inhibitor Responsiveness

The following table lists a set of polymoφhism patterns that have been found to correlate with responsiveness to ACE inhibitor treatment:

Table 8C. Response to ACE-Inhibitor Treatment

The following table lists a set of polymoφhism patterns that have been found to correlate with non-responsiveness to ACE inhibitor treatment:

Table 8D. Non-Response to ACE-Inhibitor Treatment

Polymorphism Patterns Correlated With Predisposition to MI

The following table lists a set of polymoφhism patterns that have been found to correlate with predisposition to myocardial infarction:

Table 8E. Predisposition to MI

Polymorphism Patterns Correlated With Predisposition to Stroke

The following table lists a set of polymoφhism patterns that have been found to correlate with predisposition to stroke:

Table 8F. Predisposition to Stroke

Example 4:Broadening the Scope of the Invention

Polymoφhisms for genes encoding /3-adrenergic receptors- 1 and -2 are listed below. Their numbering corresponds to the GENBANK sequences listed in the Appendix below.

The polymoφhic positions of genes for use in the invention include without limitation those listed below, whose numbering corresponds to the GENBANK sequences listed in Table 1.

/3-adrenergic receptor- 1, positions in the coding region (designated BP1) numbered 2238, 2440, 2493, 2502, 2577, 2585, 2693, 2724, and 2757; and positions in the regulatory region (designated BRl) numbered 231, 1037, 1251 , 1403, and 1528.

/3-adrenergic receptor-2, positions in the coding region (designated BP2) numbered 932, 934, 1005, 1121, and 1221; and positions in the regulatory region (designated B2R) numbered 839, 872, 1045, 1284, 1316, 1846, 1891, and 2032.

In preferred embodiments, the base at each of the above polymoφhic positions is one of:

/3-adrenergic receptor-1 coding region: 2238 C, 2238 A, 2577 C, 2257 T, 2757 A, and 2757 G.

/3-adrenergic receptor-1 regulatory region: 231 A, 231 G, 1251 C, 1251 G, 1403 A, 1403 G, 1528 C, and 1528 A.

0-adrenergic receptor-2 coding region: 934 A, 934 G, 1121 C, 1121 G, 1221 C, and 1221 T.

/3-adrenergic receptor-2 regulatory region: 839 A, 839 G, 872 C, 872 G, 1045A, 1045 G, 1284 C, 1284 T, 1316 A, 1316 C, 1846 C, 1846 G, 2032 A, and 2032 G.

An individual may be homozygous or heterozygous for a particular polymoφhic position.

The following table (Table 9) summarizes polymoφhism patterns that have been found in /3-adrenergic receptor genes:

Table 9.

B1P: Beta adrenergic receptor 1, promoter region. B1R: Beta adrenergic receptor 1, coding region. B2P: Beta adrenergic receptor 2, promoter region. B2R: Beta adrenergic receptor 2, coding region.

A total of nine different polymoφhisms have been identified in the type 2 β- adrenoceptor. All of these differed from the wild type sequence by a single base change. Four of the polymoφhisms alter the amino acid sequence of the receptor protein (Hall, Thorax, 51:351-353, 1996). The amino acid sequence modifications are described in greater detail below:

Arglό→Gly: The Gly 16 variant undergoes an enhanced agonist-promoted down regulation as compared to wild type but the coupling to adenylyl cyclase and agonist binding are maintained (Liggett, Am. J. Respir. Crit. Care Med. , 156:S 156-S162, 1997).

Gln27→Glu: The Glu27 variant displays very little agonist-promoted down regulation and the coupling to adenylyl cyclase and agonist binding are maintained (id.).

Val34- Met: Met34 is very rare. No altering of receptor function has been found (id.).

Thrl64→Ile: Uncommon (about 5 %). The He 164 variant shows depressed coupling to adenylyl cyclase and decreased affinities for agonists with hydroxyl groups on their /3-carbons, such as epinephrine, norepinephrine, and isoproterenol compared to wild type (id.).

The polymoφhism at nucleic acid 523 (CGG→AGG) might be linked with one of the other functional polymoφhisms (id.).

There are no differences in frequency of these polymoφhisms between the normal group and those with asthma but they have been correlated to differences in response to treatment with agonists in asthma, e.g. , the Glylό variant undergoes an enhanced agonist-promoted down regulation compared to wild type (id.).

Example 5: Isolation and Determination of the Nucleic Acids Encoding Polymorphic Variants of the MTP Gene

The following experiments were performed to identify polymoφhic variants of the MTP gene promoter sequence.

I. Methods:

Human subjects: A total of 184 healthy Caucasian men, aged 30-45 years were recruited at random from a register containing all permanent residents in the Stockholm Metropolitan area (response rate 70%). Men with documented coronary heart disease or any other chronic disease were excluded. The mean age of the study group was 40.3 +3.4 years, and the body mass index was 24.5 +2.8 kg/m².

Blood sampling, DNA procedures and lipoprotein analyses: Blood sampling, preparation of plasma and quantification of major fasting plasma lipoproteins were as described (Tornvall et al. , Circulation, 8 8:2180-2189 1993). For DNA procedures, nucleated cells from frozen whole blood were prepared according to Sambrook et al. , and DNA was extracted by a salting-out method (Sambrook et al. , A Laboratory Manual, 1989). All subjects were also genotyped for the apoE polymoφhism (Miller et al. , Nucl, Acids Res., 16: 1215, 1988). Gene sequencing: DNA for direct sequencing of the MTP promoter was amplified in a two-step nested PCR reaction. About 100 ng of genomic DNA was used for each individual PCR reaction. Primers were designed based on the published promoter sequence (-743 base pairs in the 5'-direction) (Shaφ et al., Nature, 365:65-69, 1993). First, a round of PCR was performed using the following primers: 5'- CCCTCTTAATCTCTTTCCTAGAA-3' [SEQ ID NO: 123] (designated MTP-1) and 5'- AAGAATCATTGACCAGCAATC-3' [SEQ ID NO: 124] (designated MTP-2). Then, one μl of this PCR reaction was used for a second PCR reaction, utilizing one unlabeled and one biotin-labeled primer at a concentration of 0.1 μM each. These primers were MTP-1 and 5'-CCAGCTAGGAGTCACTGAGA-3' [SEQ ID NO: 125] (biotinylated). All amplifications were performed for thirty cycles at 96 °C for 1 min, 60 °C for 30 s, and 72 °C for 90 s in a buffer containing 1.0 mM MgCl₂, 0.2 mM dNTP, 1O mM Tris-HCl, pH 8.4 at 70°C, 0.1 % Tween 20, and 0.2 U Taq polymerase. The biotinylated PCR fragments were immobilized by binding to streptavidin-coated magnetic beads (Dynabeads, Dynal, Oslo, Norway), and the non-biotinylated strands were removed by incubation in 50 μl 0.15 M NaOH for 5 min at room temperature. The bound DNA was rinsed three times and suspended in 13 μl distilled water.

Gene sequencing was performed by the chain-termination method, using fluorescently-labeled primers distributed within the 750 bp promoter region. These were: 5'-TAGAAATGAGATTCAGAAAGGAC-3' [SEQ ID NO: 126] (designated MTP-7fl), 5'- CAATCATCTATGTTTC ATCAA-3' [SEQ ID NO: 127] (designated MTP-7A) and 5'- AAGTTTCCTCATGGGTGA-3' [SEQ ID NO: 128] (designated MTP-8A). The products were analyzed using a Pharmacia A.L.F. DNA Sequencer. All primers were synthesized on a Gene Assembler Plus (Pharmacia, Sweden). Labeling of primers with biotin or fluorescein was performed by incoφorating BioDite or FluorePrime phosphoamidites (Pharmacia, Sweden), respectively, during synthesis. Fluorescence-labeled primers were purified by reverse-phase chromatography on a PepRPC column (Pharmacia FPLC). Normally, the sequences could be read with a considerable overlap, thus confirming the sequence.

Genotyping: Primers MTP- 1 and MTP-2 were used for genotyping of the 185 A/T polymoφhism. First, a single-step PCR reaction was further optimized by increasing the MgCl₂ concentration to 2.0 μM and changing to 35 cycles at 94°C for 30 s, 55 °C for 60 s, and 72 °C for 3 min. The PCR product was then incubated with the restriction enzyme Ssp-1 (4 Units). The 185T-allele gave rise to a cutting site. The restriction length polymoφhism (RFLP) was inspected after agarose gel (1.5%) electrophoresis of the incubate. The 18 A-allele gave rise to the full-length fragment (838 bp) whereas the 185T-allele gave rise to two shorter fragments (494 and 344 bp, respectively). The 92G/T polymoφhism does not give rise to a cutting site with any common restriction enzyme. However, a base pair mutation in the 5' primer used for PCR of a gene product covering the 92 site gave rise to a Hph-1 cutting site for the 92G allele. The PCR reaction, which used the following primers: 5'-GGATTTAAATTTAAACTGTTAATTCATATCAC-3' [SEQ ID NO: 129] (designated MTP1U) and 5'-AGTTTCACACATAAGGACAATCATCTA-3' [SEQ ID NO: 130] (designated MTP2D) gave rise to a 109 bp fragment and the gene product was cleaved by Hph-1. Here, the MgCl₂ concentration was increased to 5 mM, and amplification comprised 35 cycles at 94°C for 30 s, 57°C for 60 s, and 72°C for 2 min. The PCR product was incubated with Hphl and the RFLP was studied after high-resolution 3 % agarose gel electrophoresis (Metaphor-agarose) . The 92T allele gave rise to a full-length fragment (109 base pairs), whereas the 92G allele gave rise to two fragments of 89 and 20 base pairs, respectively.

II. Results:

The polymoφhisms identified for this promoter are shown in Table 10. [SEQ ID NO: 131]

Table 10. 1 GCTCCAACC

10 TCATACAGTTTCACACATAAGGACA

35 ATCATCTATGTTTCATGAAAGTTCT

60 ATCTACTTTAACATTATTTTGAAGT

85 GATTGGTGGTGGTATGAATTAACAG

110 TTTAAATTTAAATCCTAAAATTCAG

160 AATTCAAAGATGTCCATACAAGAAA

185 AATTAAAATTTGGTTAGGTTTAGCA

92(G/T) 175(A/G)

185(A/T) and 197(A/G)

Two common polymoφhisms were identified in the promoter region of MTP. One was a G → T substitution at nucleotide 92, the other was an A → T substitution at nucleotide 185. Two less common polymoφhisms were also found at 175 (A/G) and at 197 (A/G). The allele frequency for the MTP 92G/T polymoφhism was 0.75/0.25 in the population of 184 native Swedish men. The corresponding figures for the MTP 185 A/T polymoφhism were 0.68/0.32. The combination of genotypes for the 92 and 185 sites within the group of 184 subjects are shown in Table 1 above.

Example 6: Functional Differences Between MTP Promoter Allelic Variants

The following experiments were performed to compare the transcriptional activating capacity of different MTP promoter allelic variants. I. Methods:

Electrophoretic Mobility Shift Assay (EMSA) : Nuclear extracts were prepared according to Alksnis et al. (Anderson et al. , Circulation, 83:356-362, 1991). All buffers were freshly supplemented with leupeptin (0.7 μ/ml), aprotmin (16.6 μg/ml), PMSF (0.2 μM) and 2-mercaptoethanol (0.33 μl/ml). The protein concentration in the extracts was estimated by the method of Kalb and Bernlohr (Atzel et al. , Biochemistry, 32: 10444-10450, 1993). Incubation for EMSA was conducted as described (Sudhof et al. , Cell, 48: 1061-1069, 1987), and the reaction products were applied to a 7% (wt/vol) polyacrylamide gel (80: 1 acrylamide/N,N'methylene-bisacrylamide weight ratio), after which electrophoresis was performed in 2.5 mM Tris/22.5 mM boric acid/0.5 mM EDTA buffer for 2.5 h at 200V. Non-radioactive competitor DNAs (either identical, or of the opposite allelic variant, or of non-specific origin) were added.

Transfection assay: Twenty-four hours before transfection, cells were plated in DMEM supplemented with 10% newborn calf serum. Two to four hours before transfection, the dishes received fresh medium. Cells were incubated for 16 hours with calcium-phosphate precipitated DNAs (15 μg of plasmid per 90-mm dish) (Tornvall et al. , Circulation, 88:2180-2189, 1993). After a 2-min 15% glycerol shock, fresh medium was added. Cells were harvested for assay of transient expression 36 hours later. The pSV-β-

SUBSTΓΓUTE SHEET RULE 26 galactosidase gene (Promega) was cotransfected as an internal control. II. Results:

EMSA was performed to determine whether there is differential binding of nuclear protein(s) to the polymoφhic sites that might regulate the transcriptional activity of the gene. By use of labeled sequence-specific and excess of non-labeled non-specific oligonucleotides, two factors (bands on the EMSA gel) showed sequence-specific binding to the MTP92 site, whereas the EMSA pattern did not differ between the MTP 185 constructs. The first factor (Factor A) bound to the 92G allele. A second factor represented by a double band (Factor B) only appeared with the 92G allele. The EMSA pattern did not differ between the MPT 185 constructs.

A transfection assay was conducted to assess whether the allele-specific binding of nuclear proteins affects transcriptional activity of the MTP promoter. Two tandem copies of a 31-base pair DNA segment containing either of the 92G or T alleles were inserted upstream of a minimal and heteroiogous promoter driving the chloramphenicol acetyltransferase (CAT) gene. The minimal promoters were used to delineate the impact of putative transcriptional activators or repressors on the 92G/T sites. The promoter constructs harboring the 92T site exhibited an almost two-fold higher transcriptional activity compared with the 92G construct ( + 187+69%, p < 0.05). One inteφretation of this finding (together with the EMSA pattern) is that Factor A and/or B could act as transcriptional repressors.

There was no difference in transcriptional activity between constructs containing either of the two 185 A or T alleles.

Example 7: Association of MTP promoter polymorphism and plasma lipoprotein levels

The following experiments were performed to investigate the physiological consequences of MTP promoter allelic polymoφhisms.

I. Methods:

Blood sampling, DNA procedures and lipoprotein analyses: Blood sampling, preparation of plasma and quantification of major fasting plasma lipoproteins were as described previously (Shaφ et al., Biochemistry, 33:9057-9061, 1994). For DNA procedures, nucleated cells from frozen whole blood were prepared according to Sambrook et al.

(Sambrook et al. , Molecular cloning: A Laboratory Manual, 1989), and DNA was extracted by a salting-out method (Miller et al. , Nucl Acids Res. , 16: 1215, 1988). DNA genotyping

SUBSTΓTUTE SHEET (RULE 26) was performed as described above. II. Results:

Subjects who were homozygous for the rate 92T allele had significantly lower plasma LDL cholesterol and triglyceride levels compared with both heterozygotes (i.e. , 92G/T) and homozygotes for the common allele (i.e., 92G/G (Table 11)). The plasma LDL cholesterol concentration of the 92T/T individuals was on average 22 % lower than that of carriers of one or two copies of the 92G allele. Similarly, men who were homozygous for the 92T allele tended to have lower plasma total cholesterol (p=0.06 compared with individuals with either 92G/G or G/T genotypes). Otherwise, there were no differences in VLDL or HDL lipid concentrations according to the MTP-92 genotype.

TABLE 11

Plasma Concentrations of Major Lipoproteins According to MTP-92G/T Genotype

III. Implications:

Polymoφhisms in the promoter region of MTP have not been reported previously. We have detected a common G/T polymoφhism located 493 base pairs upstream from start of the transcription of the MTP gene. The rare allele, with an allele frequency of approximately 0.25, confers a significantly higher transcriptional activity. Healthy homozygotes for this genetic variant, comprising about 6% of healthy Caucasian, middle- aged Swedish men, have a low LDL cholesterol concentration in plasma.

The difference in LDL cholesterol concentration between carriers of the MTP- 92G/G or G/T genotypes and carriers of the MTP-92T/T genotypes is approximately 0.8 mmol/1. The impact of homozygosity for the MTP-92T allele on cardiovascular risk is therefore likely to be of major significance. Law and colleagues calculated that a 0.6 mmol/1 reduction in serum cholesterol would correspond to a 50% lowering of the risk of future ischemic heart disease in 40-year old men (Law et al. , Br. Med. J. , 308:367-373, 1988). Using the Framingham score, the 10-year risk of developing of cardiovascular disease would be 25% lower in subjects with an MTP-92T/T genotype (Anderson et al., Circulation, 83:356-362, 1991). Thus, this common genetic variation of the MTP promoter is likely to have important implications for cardiovascular disease.

Genotyping for the MTP-92 polymoφhism can be used for diagnostic and prognostic puφoses in patients suffering from various kinds of hyperlipoproteinemias. Furthermore, MTP may play an important role in intracellular compartmentalization of cholesterol. As MTP is also involved in cholesterol transfer (Atzel et al. , Biochemistry, 32- 10444-10450, 1993), an elevated MTP activity could lead to a depletion of cholesterol from intracellular membranes. This would, in turn, be sensed by sterol-regulated binding proteins acting on the promoter of the LDL receptor gene (Sudhof et al. , Cell, 48: 1061-1069, 1987). Perturbation of the intracellular cholesterol homeostasis secondary to elevated MTP activity is likely to be sensed similarly to HMG-CoA reductase inhibition, in which up- regulation of LDL receptors is the key mechanism underlying the lowering of LDL cholesterol in plasma. In line with this reasoning, MTP activity is of importance for the outcome of dietary or pharmacological hypolipidemic treatment. If particular MTP genotypes are linked to a more or less favorable treatment outcome, genotyping would be the preferred way to tailor the treatment strategy.

Example 8: Evaluation of Risk in Developing Myocardial Infarction (MT) Based on Variation in the MTP Gene

The following experiments were performed to identify the risk of developing MI with individuals having TT in position 92 in the promoter of MTP. I. Methods

Human Subjects: a total of 103 subjects diagnosed with myocardial infarction and 100 subjects diagnose healthy with regard ischemic heart disease were recruited from the UPPSALA Longitudinal Survey of adult men. The mean age of the study group was 73 +2 years at the point of analysis.

Blood sampling and DNA procedures were performed as in Example 1 above.

The characterization of the genotype in position 92 in the MTP promoter was performed as set forth below.

PCR was performed as follows:

The fragment was amplified from genomic DNA with the two primers:

Primer 1: MTP92FT: 5'-AGT CAC GAC GTT GTA AAA CGA CGG CCA GTA

CAT AAG GAC AAT CAT CTA TGT T-3' [SEQ ID NO: 132]

Primer 2: MTP92RB: 5'-TCT TGT ATG GAC ATC TTT GAA-3' [SEQ ID NO:

133]

The fragment was amplified from genomic DNA under the following conditions:

SUBSTΓΓUTE SHEET (RULE 26) Table 12.

The amplification was performed with the following thermal cycling

(program):

Table 13.

DNA sequencing:

All of the PCR products were subjected to solid phase sequencing according to the protocol commercially available from Pharmacia Biotech. The sequencing reactions were performed with a sequencing primer having a complementary sequence to the MTP92FT primer. The nucleotide sequence of the sequencing primer was 5'-CGACGTTGTAAAACGACGGCCAGT-3' [SEQ ID NO: 122], and the primer was fluorescently labeled with a Cy5.5 molecule on the 5 '-nucleotide. The positions carrying a genetic variation were identified by determination of the nucleotide sequence by the use of the Micro Gene Blaster System (Visible Genetics).

TABLE 14

Probabilities for developing a myocardial infarction or not related to a specific genotype in position 92 in the promoter of the MTP gene.

Three different genotypes are possible: GG, GT or TT.

As can be seen in the results set forth in Table 14 above, the different genotypes have a large impact on the probability for developing disease where the genotype TT has, by far, the largest effect. The risk of developing a myocardial infarction is 53 % with the TT genotype and 47% to stay healthy with the same genotype. The probability is 82% to stay healthy if the subject has a different (GG or GT) genotype in that specific position.

Thus, using the teachings of the present invention, it is possible to identify individuals that are at an increased risk for developing a myocardial infarction independent of the levels of cholesterol in the blood (where low levels of cholesterol is usually considered a protective factor).

Example 10: Isolation and Determination of the Nucleic Acids

Encoding Polymorphic Variants of the FP and EP1 Prostaglandin Receptor Genes

A. Isolation of genomic DNA

Genomic DNA was purified from the white blood cells obtained from 1.5 ml of a human blood sample. The isolated DNA was dissolved in 5 ml of TE-buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) for amplification by PCR.

B. PCR amplification

1) Strategy:

Genomic DNA was subjected to PCR using pairs of primers shown in Table 15 below:

TABLE 15

Primers used in PCR amplification of the regions of the FP- and EPl-receptor genes displaying genetic variation

Nucleotides SEQ ID NO:

FP/3FT 5'-TTGGCTTTTATCTCCACAACAA-3' 5'UTR1-1 134

FP/4RB 5'-B-GGGCACAGACCAGAAAACAC-3' 346-365 135

FP/5FT 5'-TGGAGCCATAGCAGTATTTGTATA-3 ' 252-275 136

FP/6RB 5'-B-GCCCCAGAAAAGAAAAAAGTAG-3 ' 607-628 137

FP/10F 5'-GCCCTTGGTGTTTCATTGTT-3' 634-653 138

FP/ 11 R 5 '-AGGATCTAAGATTTGATTCC ATGTT-3 ' 879-903 139

FP/13R 5'-GGACAGCCTTTCGTAGAAGAATATA-3 ' 910-934 140

FP/14R 5'-GCACTCCACAGCATTGACTG-3' 957-976 141

FP/15F 5'-TAAAAGTCAGCAGCACAGACAAG-3' 695-718 142

FP/ 16FT 5 ' -GTCG AGG ACCTGGTGTTTCT A-3 ' 543-564 143

FP/17RB 5'-B-AAATGGGCTCCAACAAATACAG-3' 773-795 144

FP/18FT 5'-CAACATTGGAATAAATGGAAATCA-3' 810-833 145

FP/ 19RB 5 ' -B-TAGCCCC AC AC AG ATTT ACTGT-3 ' 1090-112 146

FP/22FB 5 '-B-TTGGCTTTTATCTCCAC A AC A-3 ' 5'UTR1-21 147

FP/23RT 5'-GGGCACAGACCAGAAAACAC-3' 346-365 148

FP/24FB 5'-B-TGGAGCCATAGCAGTATTTGTATA-3 ' 252-275 149

FP/25RT 5'-GCCCCAGAAAAGAAAAAGTG-3 ' 607-628 150

FP/26FB 5'-B-CTGCCCATCCTTGGACATC-3 ' 505-523 151

FP/27RT 5 '- AGTAGGGATC ATTCTC AGC ATTTA-3 ' intron2:81-104 152

FP/28RB 5'-B-CCAGAGAATGATTTCCATTTATTC-3' 818-841 153

FP/33RT 5 '-CCCACACAGATTTACTGTCCTATT-3 ' 1083-1107 154

FP/34F 5'-AAATGCTGAGAATGATCCCTACTC-3' intron2:81-104 155

FP/35FB 5 '-B-TTG AAAAGGCTGC ATC AACTAA-3 ' intron2/2: l-22 156

EP 1 /5FB 5 '-B-CGCCTG ACATGAGCCCTTGC-3 ' 5'UTR1-12 157

EP1/6RT 5'-TGCAGCCGCCCAGGAAGTG-3' 331-349 158

EP1/10FB 5'-B-GGCGAGGCGACCACATG-3' 37-53 159

EP1/11RT 5'-AGCAGCAGCGGGCACAG-3' 363-380 160

EP1/18FB 5'-B-TTCATCGGCCTGGGTCC-3' 565-582 161

EP 1 / 19RT 5 '-CATTGGGCTCCAGCAG ATG-3 ' 922-939 162

EP1/21FT 5'-CAGGGTGGGCTGGCTTAG-3' 1231-1249 163

EP1/27FT 5'-CTATAGCTCTTCTCCGGCTTCC-3' intron2/2: l-21 164

EP1/28RB 5'-B-CAGGGTGGGCTGGCTTAGT-3' 1231-1249 165

EP1/29FT 5'-TTCATCGGCCTGGGTCC-3' 565-582 166

EP 1 /30RB 5 '-B-TGC ACGACACC ACCATGATAC-3 ' 902-922 167

EP1/33FT 5'-TCTGCCCTCCTCTCCTCTATC-3' intronl : l-21 168

EP1/34RB 5'-B-GCCACAGCCCAGCAGCA-3' 673-390 169

EP1/36FB S'-B-CTATAGCTCTTCTCCGGCTTCC-S' intron2/2: l-21 170

EP 1 /38RT 5 '-ACCCAAGGGTCCAGGATCTG-3 ' 1030-1049 171

EP1/39FB 5'-B-CTATAGCTCTTCTCCGGCTTCC-3' intron2/2:l-21 The PCR primers shown in Table 15 were designated as follows:

FP: PCR primer for the amplification of the gene encoding the FP-receptor.

EPl: PCR primer for the amplification of the gene encoding the EPl-receptor.

F: Forward (defines the direction of the sequencing reaction).

R: Reverse (defines the direction of the sequencing reaction).

B: The PCR primer carries a biotin-molecule attached to the 5 '-nucleotide of the primer.

T: Tail (the 29 bases defined as "Tail" below are added to the 5'-end of the PCR primer).

Tail: 5'-AGTCACGACGTTGTAAAACGACGGCCAGT-3' [SEQ ID NO: 121]

2) Reaction mixtures:

PCR reaction mixtures used in the amplification of FP and EP-1 nucleic acids were as follows:

PCR mix 1:

5 μl of 10 x PCR buffer II (Perkin Elmer)

4 μl of 2.5 mM dNTP [dATP:dCTP:dGTP:dTTP = 1: 1: 1: 1] (Pharmacia Biotech)

3 μl of 25 mM MgCl₂ (Perkin Elmer) 2.5 μl DMSO (Pharmacia Biotech)

0.15 μl of AmpliTaq (5U/μl) (Perkin Elmer) 1 μl of diluted genomic DNA solution 1 μl of each primer (10 pmol/μl) 33.35 μl ultrapure water

PCR mix 2:

5 μl of 10 x PCR buffer II (Perkin Elmer)

4 μl of 2.5 mM dNTP [dATP:dCTP:dGTP:dTTP = 4:4: 1:3:4] (Pharmacia Biotech

3 μl of 25 mM MgCl₂ (Perkin Elmer) 2.5 μl DMSO (Pharmacia Biotech)

0.15 μl of AmpliTaq (5U/μl) (Perkin Elmer) 1 μl of diluted genomic DNA solution 1 μl of each primer (10 pmol/μl) 33.35 μl ultrapure water

PCR mix 3:

5 μl of 10 x PCR buffer II (Perkin Elmer)

4 μl of 2.5 mM dNTP [dATP:dCTP:dITP:dTTP = 2:2: 1 : 1 :2] (Pharmacia

Biotech)

3 μl of 25 mM MgCl₂ (Perkin Elmer)

2.5 μl DMSO (Pharmacia Biotech)

0.15 μl of AmpliTaq (5U/μl) (Perkin Elmer)

1 μl of diluted genomic DNA solution

1 μl of each primer (10 pmol/μl)

33.35 μl ultrapure water

3) Reaction conditions:

PCR reactions involved either nested or single PCR reactions. For nested reactions, the protocol designated PCRl below was used in the first reaction and that designated PCR2 was used in the subsequent reaction. For single reactions, the protocol designated PCR2 was used. For PCR2 reactions in nested PCR, lμl of the preceding PCR reaction was used as template.

PCR 1:

98°C 3 min

3 x (98°C 15 sec, T_a°C 30 sec, 72° 45 sec)

22 x (95°C 15 sec, T/C 30 sec, 72°C 45 sec)

72°C 5 min

22°C ∞

PCR 2:

98°C 3 min

3 x (98°C 15 sec, T_a°C 30 sec, 72°C 45 sec) 40 x (95°C 15 sec, T_a°C 30 sec, 72°C 45 sec) 72°C 5 min 22°C oo

4) Resulting fragments:

Table 16 below shows the pairs of primers that were employed in PCR reactions, the annealing temperature (TJ used for each reaction, and the fragments that resulted.

After each PCR reaction, 5 μl of the products were analyzed using agarose gel electrophoresis prior to nucleotide sequencing.

SUBSTΓΓUTE SHEET (RULE 26 5) Sequencing: Sequencing Using Solid-Phase Sequencing Svstem on ALFexpress™

The sequence analysis of the PCR products from the exons and intron 2 of the EPl-receptor gene and the exons of the FP gene was performed by the solid-phase sequencing system method, commercially available as ALFexpress™ (Pharmacia Biotech, Uppsala, Sweden). The procedures were performed according to the instructions provided by Pharmacia Biotech.

Forty μl of the PCR-products were transferred to a 10- well plate and mixed with 80 μl BW-buffer (2 M NaCl, lOmM Tris-HCl, 1 mM EDTA). The combs were inserted into the wells, dipped several times and left to stand at +4°C over night (approximately 16-20 hr) to improve the capture of the PCR products on to the solid phase of the combs.

The DNA fragments bound to the combs were subjected to a denaturing step by incubating the combs in 0.1 M NaOH for 5 min. The combs were subsequently washed once in 10 mM Tris-HCl, pH 7.5.

The annealing mix, comprised of 104 μl of a Cy5-labeled primer (1 pmol/μl) was added to a ten-well plate, and the comb carrying the denatured, washed PCR product was inserted. The annealing mix with the combs inserted was heated to 65°C for 5 min. , and then left at room temperature to cool.

20 μl of the sequence mix were dispensed into a 40- well plate, and the plate was kept on ice. The combs were inserted into the plate, and the plate was transferred to 42°C for an incubation in 5 min. The plate was then transferred to ice. The sequence-mix contains 2 μl lOx annealing buffer, 1 μl extension buffer, 1 μl DMSO, 4 μl d/ddNTP mix,

11 μl water and 1 μl (2 units) T7 DNA polymerase diluted in enzyme dilution buffer. All components are commercially available as the Auto Load Kit (Pharmacia Biotech).

The ALFexpress™ gel (Pharmacia Biotech) was pre- warmed to 55°C, and the wells rinsed with the running buffer. The wells were filled with 100% STOP solution by the use of a syringe, and the combs were inserted and left to incubate for 10 min. The comb was removed and the run of the ALFexpress™ gel was commenced. Sequencing Using Tag Dye Terminators on the ABI 377

The sequence analysis of the PCR products from intron 2 of the FP- receptor gene was performed by a cycle sequencing method, which is commercially available as the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit with AmpliTaq DNA Polymerase FS. The procedure were performed according to the instructions provided by Perkin Elmer. The primer used in the FP receptor intron 2 sequencing reaction had the following sequence: FP/34F 5'-AAATGCTGAGAATGATCCCTACTC-3' [SEQ ID NO: 155]

The PCR-product was purified with QiaQuick Spin columns from KEBO

Lab, Sweden according to manual, and eluted in 30 μl ultrapure water.

1 μl purified DNA

4 μL Terminator Ready Reaction Mix

1.6 pmol primer q.s. ultrapure water

10 μl final reaction volume

The cycling was performed on a Perkin Elmer 2400 or 9600 with the following cycle: 25 x (96°C 10 sec, 50°C 5 sec, 60°C 4 min.) - 4°C.

The reactions were kept in a freezer unless the precipitation was done the same day. For precipitation, 2.0 μl 3M sodium acetate, pH 4.8, and 50 μl cold 95% ethanol were added to a 1.5 ml microcentrifuge tube. The reaction was transferred to the tube, vortexed, and allowed to precipitate for 10 min. Following centrifugation in a microcentrifuge at maximum speed for 15-30, the ethanol solution was carefully aspirated with a micropipette. The pellet was rinsed by adding 250 μl 70% ethanol and carefully aspirating all the alcohol solution with a micropipette. After drying the pellet for 30 minutes at room temperature, it was dissolved in 4.5 μl loading buffer included in the kit.

The ABI gel was pre-warmed to 55°C, and the wells rinsed with running buffer. 1.5 μl of the reaction product was applied to the wells of the gel and the run commenced.

6) Results:

The nucleotide sequences obtained using the above-described procedures yielded the full length FP and EPl receptor sequences, and permitted identification of a number of polymoφhic variants of these sequences. * *

The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description.

Various patents, patent applications, and publications are cited herein, the disclosures of which are incoφorated by reference in their entireties.

SUBSTΓΓUTE SHEET RULE 26

Claims

WHAT IS CLAIMED IS:

1. A method for assessing responsiveness to a therapeutic regimen for treatment of a disease or disorder in an individual afflicted with the disease or disorder, which method comprises:

(a) comparing a test polymoφhic pattern comprising at least two polymoφhic positions within at least one gene encoding a protein involved in a physiologic pathway associated with the therapeutic regimen with

(b) a reference polymoφhic pattern established with the same polymoφhic positions derived from a population of individuals exhibiting a predetermined responsiveness; and concluding whether the individual possesses the responsiveness based on whether the test pattern matches the reference pattern, wherein said polymoφhism pattern is not established solely with polymoφhisms of genes encoding ACE, AGT, or ATI proteins.

2. The method according to claim 1, wherein the responsiveness is responsiveness to a treatment of a cardiovascular syndrome.

3. The method according to claim 2, wherein the cardiovascular syndrome is selected from the group consisting of myocardial infarction, unstable angina, hypertension, atherosclerosis, and stroke.

4. The method according to claim 1, wherein the responsiveness is responsiveness to treatment of a cancer.

5. The method according to claim 4, wherein the cancer is breast cancer.

6. The method according to claim 1, wherein the responsiveness is responsiveness to a prostaglandin agonist or antagonist.

7. The method according to claim 1, wherein the responsiveness is responsiveness to an anti-depressant or an anti-psychotic.

8. The method according to claim 1, wherein the reference pattern comprises at least two polymoφhisms.

9. The method according to claim 8, wherein the reference pattern comprises at least three polymoφhisms.

10. A method for assessing responsiveness of a subject to a therapeutic regimen comprising: comparing a test polymoφhic pattern obtained from the individual to a reference polymoφhic pattern that has been correlated with therapeutic responsiveness to said regimen; and concluding whether the individual would be responsive to said regimen based on whether the test polymoφhic pattern matches the reference polymoφhic pattern.

11. The method according to claim 10 wherein the responsiveness is responsiveness treatment to a cardiovascular syndrome.

12. The method according to claim 11, wherein the cardiovascular syndrome is selected from the group consisting of myocardial infarction, unstable angina, hypertension, atherosclerosis, and stroke.

13. The method according to claim 10, wherein the responsiveness is responsiveness to treatment of a cancer.

14. The method according to claim 13, wherein the cancer is breast cancer.

15. The method according to claim 10, wherein the responsiveness is responsiveness to a prostaglandin agonist or antagonist.

16. The method according to claim 10, wherein the responsiveness is responsiveness to an anti-depressant or an anti-psychotic.

17. The method according to claim 10, wherein the reference pattern comprises at least two polymoφhisms.

18. The method according to claim 17, wherein the reference pattern comprises at least three polymoφhisms.