WO2000055330A9 - Polysaturated fatty acid (pufa) elongase from caenorhabditis elegans - Google Patents

Polysaturated fatty acid (pufa) elongase from caenorhabditis elegans


Publication number
WO2000055330A9 PCT/GB2000/001035 GB0001035W WO0055330A9 WO 2000055330 A9 WO2000055330 A9 WO 2000055330A9 GB 0001035 W GB0001035 W GB 0001035W WO 0055330 A9 WO0055330 A9 WO 0055330A9
Grant status
Patent type
Prior art keywords
polypeptide according
Prior art date
Application number
Other languages
French (fr)
Other versions
WO2000055330A1 (en )
Johnathan A Napier
Original Assignee
Univ Bristol
Johnathan A Napier
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date



    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • A61K38/00Medicinal preparations containing peptides


A isolated polypeptide comprising a functional long chain polyunsaturated fatty acid (PUFA) elongase.



The present invention relates to polyunsaturated fatty acid (PUFA) elongases. More specifically, the invention relates to a DNA sequence from C. elegans encoding a PUFA elongase.

Unsaturated fatty acids are essential components required for normal cellular function, being involved in a diverse number of roles ranging from membrane fluidity to acting as signal molecules (Gill, I., Valivety, R. (1997). Trends Biotechnol. 15, 401-409; Broun, P., et al (1999) Ann. Rev. Nutr. 19, 197-216). In particular, the class of fatty acids known as the polyunsaturated fatty acids (PUFAs) has attracted considerable interest as pharmaceutical and nutraceutical compounds (Broun supra; Horrobin, D. F. (1990) Revtews in Contemp Pharmacotherpy 1, 1-45).

The synthesis of PUFAs i.e. fatty acids of 18 carbons or more in length and containing two or more double bonds, is thought to be catalyzed in a variety of organisms by a specific fatty acid elongase enzyme. This elongase is responsible for the addition of 2 carbon units to an 18 carbon PUFA, resulting in a 20 carbon fatty acid. An example of this reaction is the elongation of γ-linolenic acid (GLA; 18:3Δ6,9,12) to di-homo-γ-linolenic acid (DHGLA; 20:3Δ8'π'14) in which the tri-unsaturated 18 carbon fatty acid is elongated by the addition of a two carbon unit to yield the tri-unsaturated 20 carbon fatty acid. Since there is considerable interest in the production of long chain PUFAs of more than 18 carbons in chain length, for example arachidonic acid and eicosapentanoic acid, the identification of this enzyme is of both academic and commercial interest.

At present, there are no examples of identified cloned genes encoding PUFA elongases, though a number of genes encoding enzymes likely to be involved in other aspects of lipid synthesis have been identified. For example, an Arabidopsis gene (FAE1) has been shown to be required for the synthesis of very long chain monounsaturated fatty acids (such as erucic acid; 20:1Δ") (James, D. W. et al, (1995) Plant Cell 7, 309-319). However, it is clear that this enzyme does not recognize di- and tri-unsaturated 18 carbon fatty acids, for example, linoleic acid, 18:2Δ9'12 or α-linolenic acid, 18:3Δ9'12,15 respectively, as substrates, and is therefore not involved in the synthesis of long chain PUFAs (Millar & Kunst (1997), Plant Journal 12, 121-131). This in itself is not surprising, since, of the plant kingdom, only a very few lower plant species, such as the moss Physcomicotrella patens (Girke et al., (1998), Plant J 15: 39-48); are capable of synthesising long chain PUFAs, and therefore Arabidopsis would not be expected to contain any such enzymes (Napier et al. (1997), Biochem j, 328: 717-720; Napier et al, (1999) Trends in Plant Sci 4, 2-5).

A schematic diagram representing a generalized pathway for the product of PUFAs is shown in Figure 1. Biochemical characterisation of mammalian elongation systems (most notably from liver microsomes) has indicated that a mammalian elongase consists of four subunits, made up of a condensing enzyme, a β-ketoreductase, a dehydrase and an enoyl reductase (reviewed in Cinti, D. L., et al (1992) Prog. Lipid Res. 31, 1-51). The Arabidopsis FAEl gene product encodes a polypeptide of 56kDa, which shows very limited homology to condensing enzymes such as chalcone synthase and stillbene synthase (James, D. W. supra). Although FAEl is normally only expressed in seed tissues, ectopic expression in non-seed tissue (or heterologously in yeast) revealed that FAEl could direct the synthesis of erucic acid (Millar, A. A., Kunst, L. (1997) Plant J. 12, 121-131).

Three fatty acid elongase activities have been characterised from the yeast S. cerevisiae. Again, this organism does not synthesis PUFAs, and therefore does not contain genes encoding a PUFA elongase. One gene ELO1, was identified on the basis of a screen to isolate mutants defective in elongation of 14 carbon (i.e. medium) chain saturated fatty acids (Toke & Martin (1996) J Biol Chem 271, 18413-18422). Complementation of elol mutants restored viability, and the ELO1 gene product was shown to encode a polypeptide which was responsible for the specific elongation of 14:0 fatty acids to 16:0 fatty acids.

Two related genes were also detected in the genome of S cerevisiae, and their function determined by disruption. These two genes, subsequently named ELO2 and ELO3, were shown to be involved in the elongation of the very long chain saturated fatty acids found in sphingolipid molecules (Oh et al (1997), J. Biol Chem 272, 17376-17384). In particular, ELO2 was required for elongation of fatty acids up to 24 carbons, and ELO3 was required for elongation of the 24 carbon fatty acid to 26 carbons. However, neither gene was essential for viability. Examination of the these three fatty acid elongases revealed the presence of a conserved "histidine box" motif (Shanklin et al., (1994), Biochemistry, 33, 12787-12794) (His-X-X-His-His, where X is any amino acid) towards the centre of the polypeptide sequences. Importantly, there was no detectable homology between the yeast elongases (ELO 1,2,3) and the plant very long chain mono-unsaturated fatty acid elongase (FAEl) (Oh et al, supra).

In order to identify genes encoding PUFA elongases, it is necessary to study systems in which the synthesis of PUFAs is well documented; a good example of this is the model animal system C. elegans, a small free- living worm (Tanaka et al., (1996), Lipids 31, 1173-1178). C. elegans, like most other animals, and in contrast to higher plants, synthesises PUFAs such as arachidonic acid (AA; 20:4 ΔS'8'1 U4) as precursors to a class of molecules known as the eicosanoids, which in turn serve as precursors for compounds such as prostaglandins and leucotrienes (Horrobin, (1990), Reviews in Contemp Pharmacotherpy, 1:1-45). The presence of AA and other long chain polyunsaturated fatty acids in C. elegans is well documented (Tanaka et al, (1996), Lipids 31, 1173-1178). The complete sequence of the nematode's genome is now publicly available (The C. elegans consortium, 1998, Science 282, 2012-2018: Database at http://www.sanger.ac.uk/Projects/C_elgans/blast_server.shtml). .

An object of the invention is to provide an isolated PUFA elongase.

Using the above-mentioned C. elegans genomic sequence, together with suitable search strings, the inventors identified eight related putative open reading frames (ORFs) encoding for PUFA elongases. A number of different search criteria were applied to identify a number of (ORFs) which were likely to encode polypeptides with fatty acid elongase activities. These ORFs were then subject to functional characterisation by heterologous expression in yeast, allowing the identification of a PUFA elongase.

Accordingly, a first aspect of the invention provides an isolated polypeptide comprising a functional long chain polyunsaturated fatty acid (PUFA) elongase i.e. the polypeptide has the function of extending the chain length of an 18 carbon PUFA to 20 carbons in length. This polypeptide can be used to elevate PUFA levels in animals, thereby providing a ready source of PUFAs.

The polypeptide may be from a eukaryote.

The polypeptide may comprise at least a portion of the amino acid shown in SEQ ID. 15, or variants thereof.

For the purposes of the present application, the term "variant" in relation to a certain sequence means a protein or polypeptide which is derived from the sequence through the insertion or deletion of one or more amino acid residues or the substitution of one or more animo acid residues with amino acid residues having similar properties, e.g. the replacement of a polar amino acid residue with another polar amino acid residue, or the replacement of a non-polar amino acid residue with another non-polar amino acid residue. In all cases, variants must have an elongase function as defined herein.

A second aspect of the invention provides a polypeptide having at least 60 % homology to a polypeptide according to a first aspect of the invention. The polypeptide may have at least 80%), or as much as 90% or more homology to a polypeptide according to a first aspect of the invention.

The polypeptide according to either aspect of the invention may include a sequence motif responsible for Endoplasmic Reticulum (ER) - retention. This allows the polypeptide to be specifically located or targeted to the ER of a cell.

The polypeptide may also be able to elongate palmitoleic acid (PA; 16: 1Δ9) to vacceric acid (VA; 18: 1Δ"). Thus, the polypeptide is also capable of elongation of a Δ9- monounsaturated 16C fatty acid.

Preferably, the polypeptide is from an animal, more preferably, the animal is an invertebrate such as a worm. Where the animal is a worm, it is preferably C. elegans. Alternatively, the animal is a vertebrate, preferably a mammal such as a human, rat or mouse. A third aspect of the invention provides an isolated DNA sequence, preferably a cDNA sequence, encoding a polypeptide according to a first or second aspect of the invention. This DNA sequence may be used to engineer transgenic organisms.

Preferably, the DNA sequence comprises the sequence shown in SEQ ID NO: 7 or variants of that sequence due, for example, to base substitutions, deletions, and/or additions.

A fourth aspect of the invention provides an engineered organism, such as a transgenic animal, engineered to express a polypeptide according to a first or second aspect of the invention. The engineered organism may be engineered to express elevated levels of the polypeptide, thereby providing a supply of polypeptide at a reduced cost as a reduced number of organisms need be used.

Preferably, the engineered organism is a mammal such as a rat, mouse or monkey.

A fifth aspect of the invention provides an engineered organism containing a synthetic pathway for the production of a polypeptide according to a first or second aspect of the invention. This has the advantage of allowing greater control over the production of PUFAs by the pathway by an organism.

The pathway may include Δ5-fatty acid desaturase, and/or Δ6-fatty acid desaturase.

The engineered organism according to a fourth or fifth aspect of the invention may be a lower eukaryote, such as yeast. Alternatively, the transgenic organism may be a fish.

A sixth aspect of the invention provides a transgenic plant engineered to express a polypeptide according to a first aspect of the invention.

A seventh aspect of the invention provides a transgenic plant containing a DNA sequence according to a third aspect of the invention. An eighth aspect of the invention provides a method of producing a PUFA comprising carrying out an elongase reaction catalysed by a polypeptide according to a first or second aspect of the invention.

The PUFA may be di-homo-gamma-linoleic acid (20:3Δ8 11 14), arachidonic acid (20:4Δ5'8'1 U4), eicosapentanoic acid (20:5Δ5'8', U4'17), docosatrienoic acid (22:3Δ3 16 19), docosatetraenoic acid (22:4Δ7 10 13'16), docosapentaenoic acid (22:5Δ7 10 13 16 '9) or docosahexaenoic acid (22:6Δ4-7-,°'13-16'19).

The PUFA may be a 24 carbon fatty acid with at least 4 double bonds.

A ninth aspect of the invention provides a PUFA produced by a method according to an eighth aspect of the invention.

The PUFA may be used in foodstuffs, dietary supplements or pharmaceutical compositions.

A tenth aspect of the invention provides a foodstuff comprising a PUFA according to a fifth aspect of the invention. The foodstuff can be fed to an animal.

An eleventh aspect of the invention provides a dietary supplement comprising a PUFA according to a fifth aspect of the invention. The dietary supplement can be supplied to an animal to augment its PUFA levels.

An twelfth aspect of the invention provides a pharmaceutical composition comprising a polypeptide according to a first or second aspect of the invention or a PUFA according to a ninth aspect of the invention.

Preferably, the pharmaceutical composition comprises a pharmaceutically-acceptable diluent, carrier, excipient or extender. This allows the composition to be supplied in a form which best suits the pharmaceutical application in question. For example, a topical application would preferably be a cream or lotion, whereas if the composition was to be ingested a different form would be more suitable. A thirteenth aspect of the invention provides a method of treatment of an animal, such as a mammal, or a plant, comprising supplying to the animal or plant a DNA sequence according to a third aspect of the invention, a foodstuff according to a tenth aspect of the invention, a dietary supplement according to an eleventh aspect of the invention, a pharmaceutical composition according to a twelfth aspect of the invention or a PUFA according to a ninth aspect of the invention.

Preferably, the mammal is a human.

The invention will now be further described, by way of example only, with reference to SEQ EDI to 16, and Figures 2 to 11, in which;

SEQ ID 1 to 8 show the putative ORFs encoding PUFA elongases A to H respectively; and

SEQ ID9 to 16 show the deduced amino acid sequences of the putative ORFs of SEQ ID NO: 1 to 8 respectively; and

Figures 2 to 9 show hydrophobicity plots for each of PUFA elongases A to H respectively.

Figure 10 shows an amino acid sequence line-up comparing the C. elegans ORF F56H11.4 (Z68749) with related sequences.

Figure 11 shows chromatograms of fatty acid methyl esters from transformed yeast.

Introduction to general strategy

Initially the C. elegans databases were searched for any sequences which showed low levels of homology to yeast ELO genes (EL02 and EL03) using the TBLASTN programme. A similar search was carried out using short (20 to 50 amino acid) stretches of ELO genes which were conserved amongst the three ELO polypeptide sequences. C. elegans sequences which were identified by this method were then used themselves as search probes, to identify any related C. elegans genes which the initial search with the yeast sequences failed to identify. This was necessary because the level of homology between the yeast ELO genes and any worm genes is always low (see BLAST scores later). To allow for a more sensitive search of worm sequences, a novel approach was adopted to circumvent the major drawback with searches using the BLAST programmes, namely that the search string (i.e. the input search motif) must be longer than 15 characters for the algorithm to work. Thus, if it was desired to search for a short motif (like a histidine box), then the BLAST programme would not be capable of doing this. A complete list of all the predicted ORFs present in the C. elegans genome exists as a database called Wormpep, which is freely available from the Sanger WWW site (http://www.sanger.ac.uk/Projects/C_elegans/webace_front_end.shtml). The latest version of Wormpep was down loaded to the hard disc of a Pentium PC, and re-formatted as a Microsoft Word6 document, resulting in a document of about 3,500 pages. This was then searched using the "Search & Replace" function of Word6, which also allows for the introduction of "wildcard" characters into the search motif. So, for example, it is possible to search both for the short text string HPGG, which would identify any predicted worm ORF present in the Wormpep 3,500 page document containing this motif, or alternatively search with HPGX (where X is a wild card character). Clearly, such (manual) searches of a 3,500 page document are extremely time-consuming and demanding, also requiring visual inspection of each and every identified ORF. For example, searching with a motif such as HXXHH identifies in excess of 300 different ORFs. However, by using a number of different short search strings (as outlined below), and combining these with other methods for identifying putative elongase enzymes, a number of candidate ORFs have been identified.

Database search using the FAEl polypeptide sequence

As a negative control, to demonstrate that the FAEl gene sequence was unlikely to provide a useful search sequence in the identification of C elegans sequences encoding for PUFA elongases, the GenBank databases (http://www.ncbi.nlm.nih.gov/Web/Search index.html) were searched using the Arabidopis FAEl polypeptide sequence to identify related genes or expressed sequence transcripts (ESTs). GenBank is the NIH genetic sequence database, an annotated collection of all publicly available DNA sequences (Nucleic Acid Research (1998) 26, 1-7). There are approximately 2,162,000,000 bases in 3,044,000 sequence records as of December 1998. The search was carried out using the BLAST2 (Basic Local Alignment Search Tool) algorithm (Altschul et al, (1990) J Mol Biol 215,403,410) Although a number of plant ORFs and ESTs were reported as being related, no animal sequences were identified by this search, confirming the observation that FAEl was unlikely to be a suitable candidate as a search template for PUFA elongases.

Database search using yeast ELO sequences

Using the three yeast fatty acid elongase sequences (ELO 1 , 2, 3) as probes, a number of putative ORFs in the DNA of C. elegans-deήved cosmid sequences which form the C. elegans genomic sequence database were identified. Moreover, an extensive and time-consuming search of a downloaded copy of the WormPep database (ftp://ftp.sanger.ac.uk./pub/databases/wormpep) using manual search strings in MSWord 6, identified a number of C. elegans ORFs which contained presumptive histidine boxes. Wormpep contains predicted proteins from the Caenorhabditis elegans genome sequence project, which is carried out jointly by the Sanger Centre in Cambridge, UK and Genome Sequencing Center in St. Louis, USA. The current Wormpep database, Wormpep 16, contains 16,332 protein sequences (7,120,115 residues). Search strings used included [HXXHH], [HXXXHH], [QXXHH] and [YHH]. Comparison of the data from the two different searches indicated a small (<10) number of putative ORFs as candidate elongases. The histidine box motifs are shown in bold in SEQ ID 9 to 16.

Hydrophobicity plot analysis

Since the fatty acid elongase reaction is predicted to be carried out on the cytosolic face of the endomembrane system (Toke & Martin (1996), supra; Oh et al (1997), supra), the putative C. elegans ORFs were examined for potential membrane spanning domains, via Kyte & Doolittle hydrophobicity plots (J. Mol Biol, (1982), 157, 105-132). This revealed a number of ORFs with possible membrane-spanning domains, and also indicated a degree of similarity in the secondary-structure of a number of identified ORFs.

Screening for ER-retention signal sequences

The inventors postulated that since fatty acid elongases are expected to be endoplasmic reticulum (ER) membrane proteins, they might be expected to have peptide signals which are responsible for "ER-retention". In the case of ER membrane proteins, this signal often takes the form of a C-terminal motif [K-K-X2.3-Stop], or similar variants thereof (Jackson et al, (1990), EMBO J, 9, 3153-3162). Further sequence analysis of the C. elegans putative elongases revealed that 4 ORFs (F41H10.7, F41H10.8, F56H11.4, Y53F4B.c) had C-terminal motifs that exactly matched this search pattern, and that a further 2 ORFs (F11E6.5, C40H1.4) had related sequences. These sequence motifs are underlined in SEQ ID 9 to 13, 15 and 16.

Chromosome mapping

Since the inventors had previously observed that C elegans genes involved in the synthesis of PUFA may exist in tandem (for example the Δ5 and Δ6 desaturases required for AA and GLA synthesis, respectively, are < 1 kB apart on chromosome IV (Michaelson et al, (1998), FEBS Letts 439, 215-218), the positions of the putative C. elegans elongase ORFs were determined using the Sanger Centre's WebAce C. elegans server (http://www.sanger.ac.uk/Projects/C_elegans/webace_front_end.shtml).. This indicated that two pairs of putative elongases were in close proximity to each other on the C. elegans chromosome IV.

F41H10.7 and F41H10.8 were identified as being approximately 10 Kb apart on chromosome IV, and F56H11.3 and F56H11.4 were identified as being approximately 2 Kb apart on chromosome TV.

Putative C. elegans fatty acid elongases

The positions of the putative ORFs in the C. elegans genome are shown below i.e. chromosome number, and map position in centiMorgans, together with the GenBank database accession numbers.

The designations used employ the same method as used on the Sanger Centre's C. elegans database, i.e. ORF C40H1.4 is predicted coding sequence 4 on cosmid C40H1.

Elongase Cosmid Sanger ID GenBank Ace Chromosome


C40H1.4 Z19154 HI B D2024.3 U41011 IV, 7.68

F11E6.5 Z81058 IV, 18.8

D F41H10.7* U61954 IV, 29.8

F41H10.8* U61954 IV, 29.8

F56H11.3* Z68749 rv, 2.5

F56H11.4* Z68749 IV, 2.5

H Y53F4B.C Z92860 π

* or# indicates genes in tandem

Comparison of C. elegans putative elongase ORFs with yeast genes:

Each of the three yeast ELO polypeptides were compared against all of the worm putative elongase translated ORF sequences, and then ranked in order of similarity (as measured by the BLAST score) (Altschul et al (1990), supra)

The results are shown below, with the ORF sequences ranked from most similar to least similar, and the BLAST scores are shown in brackets:

Yeast ELO1 (14 to 16 carbon fatty acid elongase)

G (262) > E (241) > D (225) > C (219) > A (216) > F (215) > H (197) > B (172)

Yeast ELO2 (24 carbon sphingolipid elongase)

E (231) > C (226) > G (189) > A (181) > F (166) > D (150) > H (141) > B (140) Yeast ELO3 (24 to 26 sphingolipid elongase)

D (171) > G(163) > F (154) > A (152) > E (150) > C (131) > B (132) > H (128)

It is clear from the numeric values of the BLAST scores that the sequences are related, but the levels of homology are low. For comparison, the BLAST score for homology between two related worm proteins, the Δ5 and the Δ6 desaturase is in excess of 500.

Analysis of potential sphingolipid ancestry

Previously, the inventors had noted the similarities between the fatty acid Δ6 desaturase and sphingolipid desaturases in plants, and that the two distinct enzymes could have arisen from one ancestral gene. Moreover, it was considered likely that the sphingolipid desaturase predated the fatty acid desaturase, and may in fact have been the ancesteral progenitor. Therefore it is plausible that the next step in the arachidonic acid biosynthetic pathway has also evolved from the sphingolipid metabolic pathway. It is therefore considered highly significant that some of the C. elegans ORF putative elongases have similarity to sphingolipid enzymes. For this reason, these ORFs are considered to be very clear candidates for PUFA elongases. It has previously been considered that the C. elegans Δ5 and Δ6 fatty acid desaturases have evolved from 1 ancestral gene (Michaelson et al., (1998), EE5S Letts 439, 215-218). It is also significant that one pair of C. elegans putative elongase ORFs (F & G) genetically maps close to the Δ5/Δ6 fatty acid desaturase genes, with both gene pairs being located at the top end of chromosome IV.

Cosmid Sanger ID GenBank Ace Chromosome Encoded Peptide


W08D2.4 Z70271 TV, 3.06 Δ6 fatty acid desaturase

T13F2.1 Z81122 IV, 3.06 Δ5 fatty acid desaturase Cloning of Desaturase and Elongase Genes in Yeast Expression Vectors

Putative elongases sequences F56H11.4 and F41H10.8 were cloned by PCR into the pYES2 vector (Invitrogen). A C. elegans mixed stage cDNA library was used as a PCR template. F56H11.4 was amplified using primers:

56hl l4.for 5'-GCGG_______ATGGCTCAGCATCCGCTC-3' and;


F41H10.8 was amplified using primers:

41hl08.for 5'-GCGG___ACCATGCCACAGGGAGAAGTC-3' and;


Amplified sequences were then restricted using Kpnl and BamHI (underlined in the forward and reverse primers, respectively), purified using the Qiagen PCR purification kit, and ligated into a Kpnl/BamHI cut pYes2 vector.

An ORF encoding the Mortierella alpina Δ5-fatty acid desaturase (Michaelson, L. V., et al (1998) J. Biol. Chem. 273, 19055-19059) was amplified using primers:



and restricted using EcoRI and Sαcl, gel purified as described and ligated into a EcoRUSacl cut pΕSC-TRP vector (Stratagene) to generate pΕSC/Δ5.

An ORF encoding the borage Δ6-fatty acid desaturase (Sayanova, O., et al (1997) Proc. Natl Acad. Sci USA 94, 4211-4216) was restricted from pGΕM3 using BamRl and Xhol and ligated into a BamRVXhol cut pESC-TRP vector to generate pESC/Δ6. A double construct was also generated by ligating the BamΗUXhol borage Δ6 insert into the pESC/Δ5 construct described previously, generating pESC/(Δ56).

Functional Characterisation in Yeast

Elongases and desaturase constructs were introduced in Saccharomyces cerevisiae W303-1A using a lithium acetate based method (Elble, R. (1992) Biotechniques 13, 18-20) and expression of the transgenes was induced by addition of galactose to 2% (w/v) as described in Napier et al (Napier, J. A., et al (1998) Biochem J330, 611-614; Michaelson L. V., supra; Michaelson, L. V., (1998) FEBS Letts 439, 215-218). Yeast transformants containing pYES2-derived constructs were grown on synthetic minimal media (SD, the composition of which is defined in Sherman, F (1991) Methods in Enzymology 194, 3-21); synthetic minimal medium minus uracil; pESC-derived constructs were grown on SD minimal medium minus tryptophan. Co-transformed yeast (containing both pYES2 and pESC derivatives) were grown on SD minimal medium minus uracil and tryptophan. Prior to induction, cultures were grown in the presence of 2%> raffinose and supplemented with 0.5 mM of the appropriate fatty acid substrate in the presence of 1% tergitol-(NP40) (Sigma). All cultures were then grown for a further 48-h unless indicated.

Fatty Acid Analysis

To identify the elongation reaction responsible for the synthesis of di-homo-γ-linolenic acid (DHGLA; 20:3Δ8,11,14) from GLA, this latter fatty acid was supplied as the (exogenous) substrate.

Lipids were extracted from transformed and control yeast by homogenisation in MeOH-CHC using a modification of the method of Bligh and Dyer (Dickenson & Lester (1999) Biochim Biophys Ada 1426, 347-357). The resulting CHC13 phase was evaporated to dryness under nitrogen gas and the samples were transmethylated with 1M HC1 in methanol at 80 °C for 1 hour. Fatty acid methyl esters (FAMES) were extracted in hexane and purified using a small column packed with Florisil. Analysis of FAMES was conducted using a Hewlett Packard 5880 A Series Gas Chromato graph equipped with a 25M x 0.32mm RSL-500BP bonded capilliary column and a flame ionisation detector. Fatty acids were identified by comparison of retention times with FAME standards (Sigma) separated on the same GC. Quantitation was carried out using peak height area integrals expressed as a total of all integrals (Bligh, E.G. & Dyer, W.J. (1959) Can. J. Biochem. Physiol. 37, 911-917).

Total fatty acids extracted from yeast cultures were analysed by gas chromatography (GC) of methyl ester derivatives. Lipids were extracted, transmethylated and the fatty acid methyl esters (FAMEs) analysed as described by Sayanova et al.

Figure 11 shows chromatograms of fatty acid methyl esters from yeast transformed with the control (empty) plasmid pYES2 (Fig. 11 A) or with ORF F56H11.4 in pYES2 (Fig. 1 IB). Exogenous substrate in the form of GLA was supplied to the cultures. Two novel peaks are observed in (B); these peaks (annotated as 20:3 and 18:1*) were identified (against known standards) as DHGLA and vaccenic acid, respectively. Detection was by flame ionisation.

One cDNA ORF tested in this manner displayed a high level of elongase activity on the GLA substrate, converting 44%> to DHGLA. The identity of this elongation product was confirmed as DHGLA by comparison with a known standard (the standards used were known standards for either DHGLA, AA, EPA or VA from Sigma Chemicals, Ltd.), using GCMS analysis using a Kratos MS80RFA (Napier, J. A., supra; Michaelson, L. V., supra; Michaelson, L. V., supra). The deduced amino acid sequence of the functional elongase clone identified it as being encoded by the C. elegans gene F56H11.4, and comparison with the yeast EEO genes showed low homology confined to a few short amino acid motifs (see Fig. 10). Some similarity with a mouse gene Cig30 (Tvrdik, P., (1997) J. Biol Chem. 272, 31738-31746), which has been implicated in the recruitment of brown adipose tissue in liver tissue, was also observed, as well as a potential human homologue encoded by a gene located on chromosome 4q25, BAC 207d4. The most closely related C. elegans ORFs, F41H10.8 (U61954) and F56H11.3 (Z68749) are also shown, as is part of a related human gene present on chromosome IV (present on BAC clone B207d4; AC004050). The GenBank accession numbers are given for all sequences.

The range of fatty acids synthesised by C. elegans can potentially require a number of different elongation reactions (Tanaka, T., (1996) Lipids 31, 1173-1178). The substrate-specificity of the F56H11.4 PUFA elongase was therefore determined using a range of exogenously supplied fatty acids. This revealed that GLA is the major substrate, with a number of other fatty acids being elongated at a lower efficiency (see Table 1). Although most of these substrates are polyunsaturated fatty acids, it was unexpectedly observed that palmitoleoic acid (PA; 16:1 Δ9) was also elongated by F56H11.4 to yield vaccenic acid (VA; 18:1 Δ"). The biosynthetic pathway for VA is unclear, but the data indicate that it may be synthesised by elongation of Δ9-monounsaturated 16C fatty acid.

The C. elegans PUFA elongase ORF F56H11.4 maps to the top of chromosome IV (at 4.32 cM) with a related sequence (F56H11.3; 51 % similarity) located l,824bp downstream. Another C. elegans gene (F41H10.8) was also observed, which is present on chromosome TV, and which shows a slightly higher level (53%>) of similarity to the PUFA elongase than F56H11.3 (see Fig. 10). However, when a PCR product encoding ORF F41H10.8 was expressed in yeast in a manner identical to that used for F56H1 1.4, the former failed to direct the elongation of any fatty acids, despite the provision of a range of substrates (see Table II).

In order to reconstitute the PUFA biosynthetic pathway in a heterologous system, the PUFA elongase F56H11.4 was expressed in yeast in conjunction with either the Δ6- or Δ5-fatty acid desaturases previously isolated and characterised by the inventor (Napier, J. A., supra; Michaelson, L. V., supra). Expression of the Δ6-fatty acid desaturase and F56H11.4 was carried out in the presence of two different substrates (LA or ALA) while the Δ5-fatty acid desaturase and the elongase were expressed in the presence of GLA only. This demonstrated that was possible to combine a desaturase and an elongase in yeast to generate significant amounts of a final "product" (see Table III). In the case of the elongase and the Δ6-fatty acid desaturase, the reactions proved highly efficient with the production of 4.5% of DHGLA from the LA substrate. This resulted from 25% desaturation of the LA substrate to GLA, which was then elongated to DHGLA at a similar level of efficiency (18%>). This is lower than the % conversion observed for GLA when supplied exogenously (see Table I), indicating that the in vivo production of substrates for elongation may be rate-limiting. If ALA was used as a substrate, 27%> of this was initially Δ6-desaturated to yield octadecatetraenoic acid (OTA; 18:4 Δ6,9 12'15) but only 8% of was subsequently elongated to yield eicosatetraenoic acid (20:4 _8,11'14'17). Thus, the conversion efficiency of ALA to the final 20-carbon tetraenoic PUFA was only about 2.2%.

Since DHGLA is an n-6 fatty acid, whilst the OTA-derived eicostetraenoic acid is an n-3 type, this demonstrates that the elongase is capable of accepting both forms of essential fatty acid, albeit with different efficiencies. Verification was also provided that the 20C PUFAs synthesised in the yeast expression system were generated by the Δ6-desaturation of 18C substrates which were subsequently elongated, as the Δδ-desaturase showed no activity on 20:2 or 20:3 substrates (see Table m).

The combination of the Δ5-desaturase and the elongase also demonstrated that these two enzymes could work in tandem, although the efficiency of this overall conversion was lower (3.3%o AA from GLA) which was due to the previously observed low activity of the Δ5-desaturase enzyme itself (Michaelson, L. V., supra; Michaelson, L. V., supra). Thus, although nearly 45% of the GLA substrate was elongated to DHGLA, only 7.5% of this was then desaturated to AA (see Table III).

Finally, the production of either AA or eicosapentanoic acid (EPA; 20:5Δ5'8 11'14,17) in yeast from dienoic or trienoic 18 carbon substrates was achieved via expression of all three enzymes (the two desaturases and the F56H11.4 PUFA elongase) simultaneously. As shown in Table IV, small but significant amounts of AA were produced when the yeast was supplied with the 18C dienoic fatty acid LA.

GC-Mass Spectroscopy (MS) Analysis

Peak identification and confirmation were carried out by GC-MS using a Kratos MS80RFA using known standards (Sigma). The identity of this 20C PUFA was verified by GCMS, indicating that the conversion efficiency from LA was 0.65%>. When ALA was used as a substrate, 12.5% of the (Δ6-desaturated and elongated) eicosatetraenoic n-3 fatty acid was Δ5-desaturated, resulting in a total conversion of 0.3% of the ALA substrate to EPA (the identity of EPA was confirmed by GCMS). Expression of C. elegans elongase in plants

In order to express C. elegans elongase in plants, the following protocol is an example of a process which can be used to create the transgenic plants. C. elegans ORF sequence can be subcloned into a plant expression vector pJD330, which comprises a viral 35S promoter, and a Nos terminator. The resulting cassette or promoter/coding sequence/terminator can then be subcloned into the plant binary transformation vector pBin 19, and the resulting plasmid introduced into Agrobacterium tumefaciens. This Agrobacterium strain can then be used to transform Arabidopsis by the vacuum-infiltration of inflorescences, and the seeds harvested and plated onto selective media containing kanamycin. Since pBin 19 confers resistance to this antibotic, only transformed plant material will grow. Resistant lines can therefore be identified and self-fertilized to produce homozygous material. Leaf material can then be analyzed for expression of C. elegans elongase.

Fatty acid methyl ester analysis can be carried out as previously described.

Figure imgf000021_0001

~ 22 41

M ^> 4141 ao

« 3 -» o>

ti +<9+<9 t o

41 o —i■ o -ό• in o ψ* m -1 ■ ιή

Figure imgf000021_0002
Table II mole% Fatty Acids

ORF F41H10.8

Substrate GLA LA ALA EPA


16:0 19.0 ±0.9 19.3 ± 0.2 28.110.6 28.010.9 23.910.7 24.410.2 22.810.2 23.410.2 23.010.6 23.710.9

16:1 50.910.7 50.8 ±0.6 33.512.2 35.511.5 22.412.1 23.610.3 17.610.2 15.810.9 34.713.6 32.213.2

18:0 4.2 ±0.1 5.110.1 5.310.1 5.610.1 5.110.2 5.810.1 5.410.3 5.910.1 4.810.7 5.110.3

18:1 24.5 ±1.3 24.910.5 16.211.4 17.111.0 9.110.3 10.110.2 7.810.1 9.510.6 15.312.5 15.311.8

18:1* ND - ND - ND - ND - ND -

LA - - - - 39.510.6 36.110.4 - - - -

ALA - - - - - - 46.410.5 45.411.3 - -

GLA - - 14.311.6 14.210.6 - - - - - -

20:2 - - - - ND - - - - -

DHGLA . . ND . . - . - - -

20:3 ND

EPA 22.312.8 23.812.2

% Elongated





Table HI mole% Fatty Acids

Construct Δ6 F56H11.4 +Δ6 F56H11.' 1 +Δ5 Substrate 20:2 20:3 LA ALA GU Induction + + - + - + -

16:0 24.711.3 25.211.5 18.710.6 23.710.5 17.410.7 21.011.3 27.914.2 29.813.8

16:1 46.012.8 43.713.7 18.911.2 24.610.7 5.310.6 9.110.9 24.613.4 25.113.2

16:2 5.211.2 4.111.4 0.610.1 - 0.410.1 - - -

18:0 4.810.4 5.110.4 4.010.3 5.110.1 6.210.7 5.410.2 5.610.8 5.410.7

18:1 15.311.1 16.111.2 12.211.4 11.210.4 5.710.8 6.010.4 12.712.9 13.012.5

18:1* - - 7.710.7 - 2.610.3 - 2.910.9 -

LA - - 25.013.2 35.412.1 - - - -

ALA - - - - 42.313.3 58.514.7 - -

GLA - - 7.912.2 - - - 13.2 ± 3.6 19.213.5

OTA - - - - 15.311.8 - - -

20:2 4.010.3 - 3.310.5 - - - - -

DHGLA - - 1.710.2 - - - 9.811.8 -

20:3 - 5.810.5 - - 3.410.4 - - -

AA - - - - - - 0.810.2 -

20:4 - - - - 1.410.2 - - -


% Elongated

GLA 17.7 44.5 OTA 8.4 LA 8.7 ALA 5.4


C40H1 . 4 atggagcttgccgagttctggaatgatctcaacaccttcaccatctacggaccgaatcac acagatatgaccacaaaatacaaatattcatatcacttcccaggtgaacaggtggcggat ccgcagtattggacgattttattccagaaatattggtatcattcgatcacaatatcagtt ctttatttcattttaattaaggtgattcaaaagtttatggagaatcgaaaaccattcact ttgaaatacccattgattctttggaatggagctcttgcagcattcagtataattgccaca ttgcggttctctattgatcctctacgatcactatatgctgaaggattctacaaaactctg tgctattcgtgtaatccaactgatgtggctgcattttggagctttgcattcgctctttcc aagattgttgaacttggagacactatgttcattat ttgagaaaacggccattgatcttt ttacactactatcatcatgcagcagtgttaatctacactgtccattctggtgccgagcat actgcagctggtcgtttctacatcctaatgaactacttcgcacattctctcatgtatact tactacacagtttctgccatgggatacagattaccgaaatgggtatcaatgactgtcaca actgttcaaacaactcaaatgttagctggagtcggaataacttggatggtgtacaaagtg aaaactgaatacaagcttccttgtcaacaatccgtagccaatttg atctcgcattcgtc atctatgtcacatttgccattcttttcattcaattcttcgtcaaggcatacattatcaag tcgtcgaagaagtcgaaatcggtgaagaacgaataa


D2024 . 3 atggcaaaatacgactacaatccgaagtatgggttagaaaattacagcatattccttccc tttgagacatcttttgatgcatttcgatcgacaacatggatgcaaaatcactggtatcaa tcaattacagcatctgtcgtgtatgtagccgtcatttttacaggaaagaaggtggttctc atctacaaaaaatcacgagt at acttttgagtctagccttcagaatgcaattaagaat cgaaaccgaaaatcacttaatagttctcaaatgtttcagattatggaaaagtacaagccc ttccaactggacacaccactcttcgtctggaattcatttttagccattttctcaattctc gggttcctccgaatgacacctgaatttgtatggagttggtcagcagaaggaaactcattc aaatattcaatttgtcattcatcttatgctcaaggagtcactggtttctggactgaacaa ttcgcaatgagcaaacttttcgagctcatcgacacaatcttcatcgttcttcgtaaacgt ccactcatcttccttcactggtatcatcatgtaactgttatgatctacacatggcacgcg tacaaggatcacactgcatcaggacggtggttcatttggatgaattatggagttcatgct cttatgtattcctactatgctcttcgttctctgaaattccgtcttccaaaacaaatggca atggttgttactactctccaacttgctcaaatggttatgggagtaatcatcggagtcact gtctaccgtatcaagtcatcgggtgaatactgccaacagacatgggacaatttgggat a tgctttggagtttatttcacatatttccttcttttcgccaacttcttctaccatgcatat gttaagaaaaacaaccgtacagtaaattatgaaaataattcaaaaaatttccccgatctc gttttaatttacctgagaaaaaaggtttcaagaaaatcgaaaaatcggcaatgttcagaa aataattataaaattcaattttcatcaaattttgttaatgttgatggaaaaaaacataag aaaacatatgaacttattcttccaagaagaaaaatgaccacaattttaacttttctattt ggaaaaaatcgaattttttcgaaatatcagaaaaatcgaaaaaacatttcgattcctgtt gatttcgaaattctggagccaaaagaagatatcaatgctaacatcgctgagccatccatc acaacgaggtccgccgccgcacgaagaaaagttcaaaaagctgattag SEQ ID3

F11E6 . 5 atggcagcagcacaaacaagtccagcagccacgctcgtcgatgttttgacaaaaccatgg agtctggatcagactgattcttacatgtctacatttgtaccattatcctataaaatcatg attggttatctcgtcaccatctacttcgggcaaaaattaatggctcacagaaaaccattc gatctccaaaatacacttgctctctggaacttcgggttttcactgttctcgggaatcgcc gcctataagcttattccagaactattcggagttttcatgaaggacgggtttgtcgcttcc tactgtcaaaacgagaactactacaccgatgcatcaactggattctggggctgggccttt gtgatgtcgaaagctccagaactaggggatactatgttcttggtccttcgtaaaaaacca gttatcttcatgcactggtatcatcatgccctcacatttgtctacgcagtagtcacatac tctgagcatcaggcatgggctcgttggtctttggctctcaaccttgccgtccacactgtt atgtatttctacttcgccgttcgcgccttgaacatccaaactccacgcccagtggcaaag ttcatcactactattcaaattgtccaatttgtcatctcatgctacatttttgggcatttg gtattcattaagtctgctgattctgttcctggttgcgctgt agctggaatgtgctatcg atcggaggactcatgtacatcagttatttgttcctttttgccaagttcttctacaaggcc tacattcaaaaacgctcaccaaccaaaaccagcaagcaggagtag


F41H10 . 7 atgtca cggacgatcgtggcactagaaccttcaagatgatggatcaaattcttggaaca aacttcacttatgaaggtgccaaagaagttgctcgaggccttgaaggtttctcagcaaag cttgccgtcggata attgccactatttttggactgaaatattatatgaaagaccgaaaa gccttcgatctcagtactccattaaacatttggaatggtattctttcgacattcagctta ttgggattcttattcacttttcctactttgttatcagttatcagaaaggatggatttagt cacacctattcccatgtctctgagctttacactgacagtacctctggatattggatcttc ctttgggttatctcaaagattccggaacttttggatacagtat cattgttcttcgcaag agaccacttattttcatgcactggtaccatcacgcattgaccggttactatgctcttgtc tgctaccatgaggatgctgtccatatggtttgggttgtatggatgaattatattattcat gcattcatgtatggatactatcttctgaaatctctgaaagttccaattccaccatcagtt gctcaagcaatcaccacatctcaaatggttcaattcgcagttgccattttcgcacaagtt catgtttcctataaacactatgttgagggagttgaaggattagcctactcgttcagagga acagctatcggatttttcatgcttactace acttctatctatggattcaattctacaaa gagcactatcttaagaatggaggcaaaaagtacaatttggcaaaggatcaggcaaaaact caaacaaagaaggctaactaa


F41H10 . 8 ( ce477 ] atgccacagg gagaagtctc attctttgag gtgctgacaa ctgctccatt cagtcatgag ctctcaaaaa agcatattgc acagactcag tatgctgctt tctggatctc aatggcatat gttgtcgtta tttttgggct caaggctgtc atgacaaacc gaaaaccatt tgatctcacg ggaccactga atctctggaa tgcgggtctt gctattttct caactctcgg atcacttgcc actacatttg gacttctcca cgagttcttc agccgtggat ttttcgaatc ttacattcac atcggagact tttataatgg actttctgga atgttcacat ggcttttcgt tctctcaaaa gttgctgaat tcggagatac actttttatt attcttcgta aaaagccatt gatgttcctt cattggtatc atcatgtgct tacaatgaat tatgctttta tgtcatttga agctaatttg ggatttaata cttggattac atggatgaat ttctcagttc actcaattat gtatggatat tatatgcttc gttcttttgg tgtcaaggtt ccagcatgga ttgccaagaa tattacaaca atgcaaattc ttcaattcgt tattactcat ttcattcttt tccacgttgg atatttggca gttactggac aatctgttga ctcaactcca ggatattatt ggttctgcct tctcatggaa atctcttatg tcgttctgtt cggaaacttc tactatcaat catacatcaa gggaggtggc aagaagttta atgcagagaa gaagactgaa aagaaaattg aataa


F56H11.3 atgtatttgaattatttcgcgacggaaatcttccatcgtagtgcggtttgtgaaacagaa gcttgtcgctcgtcaaaaataatgattgctgacgtgttcaaatggaaattcgatgcaaac gaattgtggagtcttttaacgaatcaggatgaagttttcccgcatattagagcacggcga ttca tcaagaacattttggtctattcgtccagatggcaattgcatatgtcattttggtg ttctcaatcaaaaggttcatgagggatcgtgaaccatttcaactcaccacagctcttcgt ctctggaacttcttcctctccgtcttctcaatttatggttcctggacaatgtttccattt atggttcaacaaataagactttatggtctctacggatgtggatgcgaagcactttcaaac cttccgagtcaagcagaatattggcttttcctgacgatcttgtccaaagctgtggagttt gttgatacatttttcttggttctccggaaaaaaccactcatcttcctacactggtatcat catatggcaacatttgtcttcttctgcagtaattacccgactccatcgtcacaatcacgc gtcggagttatcgtcaacctgttcgtgcatgccttcatgtaccca actatttcacccga tcaatgaacatcaaagttcctgcgaaaatttcaatggctgttacagttcttcaattgact caattcatgtgctttatctatggatgtactctcatgtactactcgttggccactaatcag gcacgatacccctcaaatacacctgcgacactccaatgtttgtcctacactctacatttg ctttga


F56H11 . 4 ( Ce 166 ) atg gctcagcatc cgctcgttca acggcttctc gatgtcaaat tcgacacgaa acgatttgtg gctattgcta ctcatgggcc aaagaatttc cctgacgcaga aggtcgcaa gttctttgct gatcactttg atgttactat tcaggcttcaa tcctgtacat ggtcgttgtg ttcggaacaa aatggttcat gcgtaatcgt caaccattcc aattgactat tccactcaac atctggaatttcatcctcgc cgcattttcc atcgcaggag ctgtcaaaat gaccccagag ttctttggaa ccattgccaa caaaggaatt gtcgatcctactgc aaagtgtttg atttcacgaa aggagagaat ggatactgggt gtggctctt catggcttcc aaacttttcg aacttgttga caccatcttc ttggttctccgtaaacgtcc actcatgttc cttcactggt atcaccatat tctcaccatg atctacgcctggtactctca tccattgacc ccaggattca acagatacgg aatttatctt aactttgtcg tccacgcctt catgtactct tactacttcc ttcgctcgat gaagattcgc gtgc caggattcatcgccca agctatcaca tctcttcaaa tcgttcaatt catcatctc t tgcgccgttcttgctcatct tggttatctc atgcacttca ccaat gccaactgt gatttcgagc catcagtatt caagctcgca gttttcatgg acacaacata cttggctctt ttcgtcaact tcttcctcca atcatatgtt ctccgcggag gaaaagacaa gtacaaggca gtgccaaaga agaagaacaa ctaa


Y53 F4B . C atgtcggccg aagtgtccga acgattcaaa gtttggacag gaaacaatga gaccatcatc tattccccat tcgagtacga ttccacgttg ctcatcgagt catgtcggtg tacttatcag ctgcttatat tattgcgaca aatttattac agagatatat ggagtcacgg aaacctaaaa cttttactag catggaacgg ttttttggca gtgttcagta ttatgggtac atggagattt ggaatcgaat tctacgatgc tgttttcaga agaggcttca tcgattcgat ctgcctggct gtaaatccac gttcaccgtc cgcattctgg gcatgcatgt tcgctctatc gaaaatcgcc gagtttgggg acacgatgtt cttggtgctg aggaaacggc cggttatatt ccttcactgg tatcatcacg ctgttgttct gatcctttct tggcatgctg caatcgaact cacagctcca ggacgctggt ttatttttat gaactatttg gtgcattcaa taatgtatac atactacgca ataacatcaa tcggctatcg tcttcccaaa atcgtttcaa tgactgttac attccttcaa actcttcaaa tgctcattgg tgtcagcatt tcttgcattg tgctttattt gaagcttaat ggagagatgt gccaacaatc ctacgacaat ctggcgttga gcttcggaat ctacgcctca ttcctggtgc tattctccag tttcttcaac aatgcatatt tggtaaaaaa ggacaagaaa cccgatgtga agaaggatta











































1. An isolated polypeptide comprising a functional long chain polyunsaturated fatty acid (PUFA) elongase as herein defined.
2. A polypeptide according to claim 1 wherein the polypeptide is from a eukaryote.
3. A polypeptide according to claim 1 or claim 2 wherein the polypeptide has at least a portion of the amino acid sequence shown in SEQ ID 15, or variants thereof.
4. A polypeptide having at least 60% homology to a polypeptide according to claim 3 and having a PUFA elongase function.
5. A polypeptide according to claim 4 having at least 80% homology.
6. A polypeptide according to claim 5 having at least 90% homology.
7. A polypeptide according to any preceding claim wherein the polypeptide sequence includes a sequence motif responsible for Endoplasmic Reticulum (ER) - retention.
8. A polypeptide according to any preceding claim wherein the polypeptide is capable of elongating palmitoleic acid (PA; 16:1Δ9) to vacceric acid (VA; 18: lΔn).
9. A polypeptide according to any preceding claim wherein the polypeptide is from an animal.
10. A polypeptide according to claim 9 wherein the animal is an invertebrate.
11. A polypeptide according to claim 10 wherein the invertebrate is a worm.
12. A polypeptide according to claim 11 wherein the worm is C. elegans.
13. A polypeptide according to claim 9 wherein the animal is a vertebrate.
14. A polypeptide according to claim 13 wherein the vertebrate is a mammal.
15. A polypeptide according to claim 14 wherein the mammal is a human, rat or mouse.
16. A DNA sequence encoding a polypeptide according to any preceding claim.
17. A DNA sequence according to claim 16 wherein the DNA comprises the sequence shown in SEQ ID 7 or variants of that sequence due to base substitutions, deletions and/or additions.
18. An engineered organism engineered to express a polypeptide according to any one of claims 1 to 15.
19. An engineered organism according to claim 18 wherein the animal is a mammal.
20. An engineered organism according to claim 19 wherein the mammal is a rat, mouse or monkey.
21. An engineered organism containing a synthetic pathway for the production of a polypeptide according to any one of claims 1 to 15.
22. An engineered organism according to claim 21 wherein the pathway includes Δ5-fatty acid desaturase.
23. An engineered organism according to claim 21 or 22 wherein the pathway includes Δ6-fatty acid desaturase.
24. An engineered organism according to any one of claims 21 to 23 wherein the animal is a lower eukaryote.
25. An engineered organism according to claim 24 wherein the lower eukaryote is a yeast.
26. An engineered organism according to claim 18 wherein the animal is a fish.
27. A transgenic plant engineered to express a polypeptide according to any one of claims 1 to 15.
28. A transgenic plant containing a DNA sequence according to claim 16 or 17.
29. A method of producing a PUFA comprising carrying out an elongase reaction catalysed by a polypeptide according to any one of claims 1 to 15.
30. A method according to claim 29 wherein the PUFA is di-homo-gamma-linoleic acid (20:3Δ8 U4), arachidonic acid (20:4Δ5Λ, U4), eicosapentanoic acid (20:5Δ5'8'"'14,17), docosatrienoic acid (22:3Δ3,16,19), docosatetraenoic acid (22:4Δ7,10,13 16), docosapentaenoic acid (22:5Δ7'10'13 16'19) or docosahexaenoic acid (22:6Δ4'7'10'13'16 19).
31. A method according to claim 29 wherein the PUFA is a 24 carbon fatty acid with at least 4 double bonds.
32. A PUFA produced by a method according to any one of claims 29 to 31.
33. A foodstuff comprising a PUFA according to claim 32.
34. A dietary supplement comprising a PUFA according to claim 32.
35. A pharmaceutical composition comprising a polypeptide according to any one of claims 1 to 15.
36. A pharmaceutical composition comprising a PUFA according to claim 32.
37. A pharmaceutical composition according to claim 35 or claim 36 wherein the composition comprises a pharmaceutically-acceptable diluent, carrier, excipient or extender.
38. A method of elevating the PUFA levels of an animal or a plant by supplying to the animal or plant a polypeptide according to any of claims 1 to 15, a DNA sequence according to claim 16 or claim 17, a foodstuff according to claim 33, a dietary supplement according to claim 34, a pharmaceutical composition according to any of claims 35 to 37 or a PUFA according to claim 32.
39. A method of treatment according to claim 38 wherein the animal is a mammal.
40. A method of treatment according to claim 39 wherein the mammal is a human.
PCT/GB2000/001035 1999-03-18 2000-03-20 Polysaturated fatty acid (pufa) elongase from caenorhabditis elegans WO2000055330A9 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
GB9906307A GB9906307D0 (en) 1999-03-18 1999-03-18 Novel polypeptides
GB0003869.5 2000-02-18
GB9906307.5 2000-02-18
GB0003869A GB0003869D0 (en) 2000-02-18 2000-02-18 Elongase II

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
EP20000911091 EP1161542A1 (en) 1999-03-18 2000-03-20 Polysaturated fatty acid (pufa) elongase from caenorhabditis elegans
CA 2365096 CA2365096A1 (en) 1999-03-18 2000-03-20 Polyunsaturated fatty acid (pufa) elongase from caenorhabditis elegans
JP2000605748A JP2002538826A (en) 1999-03-18 2000-03-20 Kaenorabujichisu Elegance derived polyunsaturated fatty acids (pufa) elongase
AU3308500A AU3308500A (en) 1999-03-18 2000-03-20 Polysaturated fatty acid (pufa) elongase from caenorhabditis elegans
NO20014542A NO20014542A (en) 1999-03-18 2001-09-18 More saturated fatty acid (PUFA) elongase from Caenorhabditis elegans

Publications (2)

Publication Number Publication Date
WO2000055330A1 true WO2000055330A1 (en) 2000-09-21
WO2000055330A9 true true WO2000055330A9 (en) 2002-08-29



Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2000/001035 WO2000055330A9 (en) 1999-03-18 2000-03-20 Polysaturated fatty acid (pufa) elongase from caenorhabditis elegans

Country Status (4)

Country Link
EP (1) EP1161542A1 (en)
JP (1) JP2002538826A (en)
CA (1) CA2365096A1 (en)
WO (1) WO2000055330A9 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8853432B2 (en) 2004-04-22 2014-10-07 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6403349B1 (en) * 1998-09-02 2002-06-11 Abbott Laboratories Elongase gene and uses thereof
GB0107510D0 (en) * 2001-03-26 2001-05-16 Univ Bristol New elongase gene and a process for the production of -9-polyunsaturated fatty acids
WO2002099068A3 (en) * 2001-06-05 2003-12-04 Marcia Belvin LCES AS MODIFIERS OF THE p53 PATHWAY AND METHODS OF USE
EP1487985B1 (en) 2002-03-16 2011-01-12 The University Of York Transgenic plants expressing enzymes involved in fatty acid biosynthesis
EP2166071B1 (en) * 2003-08-01 2016-01-06 BASF Plant Science GmbH Method for producing polyunsaturated fatty acids in transgenic organisms
US7834250B2 (en) 2004-04-22 2010-11-16 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US7892792B2 (en) 2008-06-27 2011-02-22 Indian Institute Of Science Cells expressing Pichia cytochrome C
CN102317459A (en) 2008-11-18 2012-01-11 粮食研究发展公司 Enzymes and methods for producing omega-3 fatty acids
CA2953008A1 (en) 2014-06-27 2015-12-30 Nuseed Pty Ltd Lipid comprising docosapentaenoic acid
CN104920307B (en) * 2015-06-19 2018-01-26 安徽省农业科学院农业工程研究所 Suitable for single particle microbeam apparatus fixation Caenorhabditis elegans

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6403349B1 (en) * 1998-09-02 2002-06-11 Abbott Laboratories Elongase gene and uses thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8853432B2 (en) 2004-04-22 2014-10-07 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell

Also Published As

Publication number Publication date Type
WO2000055330A1 (en) 2000-09-21 application
CA2365096A1 (en) 2000-09-21 application
EP1161542A1 (en) 2001-12-12 application
JP2002538826A (en) 2002-11-19 application

Similar Documents

Publication Publication Date Title
Spychalla et al. Identification of an animal ω-3 fatty acid desaturase by heterologous expression in Arabidopsis
Domergue et al. Cloning and functional characterization of Phaeodactylum tricornutum front‐end desaturases involved in eicosapentaenoic acid biosynthesis
Zank et al. Cloning and functional characterisation of an enzyme involved in the elongation of Δ6‐polyunsaturated fatty acids from the moss Physcomitrella patens
Jako et al. Seed-specific over-expression of an Arabidopsis cDNA encoding a diacylglycerol acyltransferase enhances seed oil content and seed weight
US7247461B2 (en) Nucleic acid molecule encoding ORFA of a PUFA polyketide synthase system and uses thereof
US6344548B1 (en) Diacylglycerol o-acyltransferase
Fulda et al. Two long‐chain acyl‐CoA synthetases from Arabidopsis thaliana involved in peroxisomal fatty acid β‐oxidation
US6365802B2 (en) Methods for increasing stearate content in soybean oil
US6051754A (en) Methods and compositions for synthesis of long chain poly-unsaturated fatty acids in plants
Agaba et al. Cloning and functional characterisation of polyunsaturated fatty acid elongases of marine and freshwater teleost fish
US7217856B2 (en) PUFA polyketide synthase systems and uses thereof
Burgal et al. Metabolic engineering of hydroxy fatty acid production in plants: RcDGAT2 drives dramatic increases in ricinoleate levels in seed oil
US7214853B2 (en) Schizochytrium PKS genes
Xu et al. Cloning and characterization of an acyl‐CoA‐dependent diacylglycerol acyltransferase 1 (DGAT1) gene from Tropaeolum majus, and a study of the functional motifs of the DGAT protein using site‐directed mutagenesis to modify enzyme activity and oil content
Dyer et al. High‐value oils from plants
Hawkins et al. Characterization of acyl‐ACP thioesterases of mangosteen (Garcinia mangostana) seed and high levels of stearate production in transgenic canola
US20050262588A1 (en) Thioesterase-related nucleic acid sequences and methods of use for the production of plants with modified fatty acid composition
Jones et al. Palmitoyl-acyl carrier protein (ACP) thioesterase and the evolutionary origin of plant acyl-ACP thioesterases.
LEONARD et al. Cloning of a human cDNA encoding a novel enzyme involved in the elongation of long-chain polyunsaturated fatty acids
US6770465B1 (en) Engineering B-ketoacyl ACP synthase for novel substrate specificity
Cho et al. Cloning, expression, and nutritional regulation of the mammalian Δ-6 desaturase
US6822141B2 (en) Diacylglycerol acyl transferase proteins
Hastings et al. Molecular cloning and functional characterization of fatty acyl desaturase and elongase cDNAs involved in the production of eicosapentaenoic and docosahexaenoic acids from α-linolenic acid in Atlantic salmon (Salmo salar)
US20060117414A1 (en) Fad4, Fad5, Fad5-2, and Fad6, novel fatty acid desaturase family members and uses thereof
NAPIER et al. Identification of a Caenorhabditis elegans Δ6-fatty-acid-desaturase by heterologous expression in Saccharomyces cerevisiae

Legal Events

Date Code Title Description
AL Designated countries for regional patents

Kind code of ref document: A1


AK Designated states

Kind code of ref document: A1


121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000911091

Country of ref document: EP

ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2365096

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2365096

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 09936845

Country of ref document: US

ENP Entry into the national phase in:

Ref country code: JP

Ref document number: 2000 605748

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 2000911091

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

COP Corrected version of pamphlet


AL Designated countries for regional patents

Kind code of ref document: C2


AK Designated states

Kind code of ref document: C2


WWW Wipo information: withdrawn in national office

Ref document number: 2000911091

Country of ref document: EP