CA2343969A1 - Novel plant acyltransferases - Google Patents

Abstract

By this invention, novel nucleic acid sequences encoding for acyltransferase related proteins are provided, wherein said acyltransferase-like protein is active in the transfer of a fatty acyl group from a fatty acyl donor to a fatty acyl acceptor. Also considered are amino acid and nucleic acid sequences obtainable from AT-like nucleic acid sequences and the use of such sequences to provide transgenic host cells capable of producing modified lipid content and composition.

Description

WO 00/18889 . PCT/US99I22231 NOVEL PLANT ACYLTRANSFERASES
INTRODUCTION
This application claims the benefit of U.S. Provisional Application Serial No.
b0/101,939 filed September 2S, 199$.
Technical Field The present invention is directed to nucleic acid and amino acid sequences and constructs, and methods related thereto.
B ackground Through the development of plant genetic engineering techniques, it is now possible to produce transgenic varieties of plant species to provide plants which have novel and desirable characteristics. For example, it is now possible to genetically engineer plants for tolerance to environmental stresses, such as resistance to pathogens and tolerance to herbicides and to 2 0 improve the quality characteristics of the plant, far example improved fatty acid compositions.
However, the number of useful nucleotide sequences fox the engineering of such characteristics is thus far limited and the speed with which new useful nucleotide sequences for engineering new characteristics is slow.
The characterization of various acyltransferase proteins is useful for the further study 2 5 of plant fatty acid synthesis systems and for the development of novel andlor alternative oils sources. Studies of plant mechanisms may provide means to further enhance, control, modify, or otherwise alter the total fatty acyl composition of triglycerides and oils:
Furthermore, the elucidation of the factors) critical to the natural production of fatty acids in plants is desired, including the purification of such factors and the characterization of 3 0 element{s) and/or cofactors which enhance the efficiency of the system. Of particular interest are the nucleic acid sequences of genes encoding proteins which may be useful for applications in genetic engineering.

WO 00/18889 . PCTIUS99/22231 z SUMMARY OF THE INVENTION
The present invention provides nucleic acid encoding for amino acid sequences for a class of proteins which are related to acyltransferase proteins. Such proteins are referred to herein as acyltransferase related or acyltransferase like proteins.
By this invention, nucleic acid sequences encoding these acyltransferase related proteins may now be characterized with respect to enzyme activity. In particular, identification and isolation of nucleic acid sequences encoding for acyltransferase related proteins from Arabidopsis, yeast, corn, and soybean are provided.
Thus, this invention encompasses acyltransferase related nucleic acid sequences and the corresponding amino acid sequences, and the use of these nucleic acid sequences in the preparation of oligonucleotides containing such acyltransferase related encoding sequences for analysis and recovery of plant acyltransferase related gene sequences. The acyltransferase related encoding sequence may encode a complete or partial sequence depending upon the intended use. All or a portion of the genomic sequence, or cDNA sequence, is intended.
Of special interest are recombinant DNA constructs which provide for transcription or transcription and translation {expression) of the acyltransferase related sequences in host 2 0 cells. In particular, constructs which are capable of transcription or transcription and translation in plant host cells are preferred. For some applications a reduction in sequences encoding acyltransferase related sequences may be desired. Thus, recombinant constructs may be designed having the acyltransferase related sequences in a reverse orientation for expression of an anti-sense sequence or use of co-suppression, also known as "transwitch", 2 5 constructs rnay be useful. Such constructs rnay contain a variety of regulatory regions including transcriptional initiation regions obtained from genes preferentially expressed in plant seed tissue. For some uses, it rnay be desired to use the transcriptional and translational initiation regions of the acyitransferase related gene either with the acyltransferase related encoding sequence or to direct the transcription and translation of a heterologous sequence.
3 0 Also considered in this invention are the plants and seeds containing the constructs and polynucleotides of this invention.

BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 provides the 204 amino acid conserved sequence profile identified from comparisons of glycerol-3-phosphate acyltransferase and various lysophosphatidic acid acyltransferase using PSI-BLAST.
Figure 2 provides an amino acid sequence alignment for the acyltransferase sequences. The alignment shown is of the regions of the protein extending from about 30 amino acids prior to the conserved H in the conserved sequence HXXXXD to 100 amino acids after, or downstream, of the P in the conserved PEG sequence motif of the acyitransferase-like sequences.
Figure 3 provides schematics showing the relationship of the identified acyitransferases. The relationships described are derived from an alignment of the regions of the protein extending from about 30 amino acids prior to the conserved H in the conserved sequence HXXXXD to 100 amino acids after, or downstream, of the P in the conserved PEG
sequence motif of the acyltransferase-like sequences. Figure 3A provide aphylogenetic tree showing the relationship of several acyltransferases. Figure 3B provides a table showing the percent similarities and percent divergence of the novel acyitransferases and known acyltransferases using the Clustal method with PAM250 residue weight table.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the subject invention, nucleotide sequences are provided which are 2 5 capable of coding sequences of amino acids, such as, a protein, polypeptide or peptide, which are related to nucleic acid sequences encoding acyltransferase proteins, referred to herein as acyltransferase-like or acyltransferase related. The novel nucleic acid sequences find use in the preparation of constructs to direct their expression in a host cell.
Furthermore, the novel nucleic acid sequences may find use in the preparation of plant expression constructs to 3 0 modify the fatty acid composition of a plant cell.
In one embodiment of the present invention, nucleic acid sequences, also referred to herein as polynucleotides, are identified from databases which are related, to acyltransferases.

WO 00/18889 , PCTNS99I22231 Isolated proteins, Polypeptides and Polynucleotides A first aspect of the present invention relates to isolated acyltransferase polynucleatides. The polynucleotide sequences of the present invention include isolated poiynucleotides that encode the polypeptides of the invention having a deduced amino acid sequence selected from the group of sequences set forth in the Sequence Listing and to other polynucleotide sequences closely related to such sequences and variants thereof.
The invention provides a polynucleotide sequence identical over its entire length to each coding sequence as set forth in the Sequence Listing. The invention also provides the coding sequence for the mature polypeptide or a fragment thereof, as well as the coding sequence for the mature polypeptide or a fragment thereof in a reading frame with other coding sequences, such as those encoding a leader or secretary sequence, a pre-, pro-, or prepro- protein sequence. The polynucleotide can also include non-coding sequences, including far example, but not limited to, non-coding 5' and 3' sequences, such as the transcribed; untranslated sequences, termination signals, ribosome binding sites, sequences that stabilize mRNA, introns, polyadenylation signals, and additional coding sequence that encodes additional amino acids. For example, a marker sequence can be included to facilitate the purification of the fused polypeptide. Polynucleotides of the present invention also include polynucleotides comprising a structural gene arid the naturally associated sequences 2 0 that control gene expression.
The invention also includes polynucleotides of the formula:
X-~ROn ~Rz)-(R.3)n Y
wherein, at the 5' end, X is hydrogen, and at the 3' end, Y is hydrogen or a metal, R, and R3 are any nucleic acid residue, n is an integer between 1 and 3000, preferably between I and 2 5 1000 and R2 is a nucleic acid sequence of the invention, particularly a nucleic acid sequence selected from the group set forth in the Sequence Listing and preferably SEQ
IDNOs: 1, 3, 5, 7, 9, 10, 12, 14, 16, 18, 20, 22, and 226-233. In the formula, R2 is oriented so that its 5' end residue is at the left, bound to R,, and its 3' end residue is at the right, bound to R3. Any stretch of nucleic acid residues denoted by either R group, where R is greater than 1, may be 3 0 either a heteropolymer ar a homopolymer, preferably a heteropolymer.
The invention also relates to variants of the polynucleotides described herein that encode fox variants of the polypeptides of the invention. Variants that are fragments of the polynucleotides of the invention can be used to synthesize full-length polynucleotides of the invention. Preferred embodiments are polynucleotides encoding polypeptide variants wherein 5 to 10, i to 5, 1 to 3, 2, 1 or no amino acid residues of a polypeptide sequence of the invention are substituted, added or deleted, in any combination. Particularly preferred are substitutions, additions, and deletions that are silent such that they do not alter the properties 5 or activities of the polynucleotide or polypeptide.
Nucleotide sequences encoding acyltransferases may be obtained from natural sources or be partially or wholly artificially synthesized. They may directly correspond to an acyltransferase endogenous to a natural source or contain modified amino acid sequences, such as sequences which have been mutated, truncated, increased or the like.
Acyltransferases may be obtained by a variety of methods, including but not limited to, partial or homogenous purification of protein extracts, protein modeling, nucleic acid probes, antibody preparations and sequence comparisons. Typically an acyltransferase will be derived in whole or in part from a natural source. A natural source includes, but is not limited to, prokaryotic and eukaryotic sources, including, bacteria, yeasts, plants, including algae, and the like.
Of special interest are acyltransferases which are obtainable from eukaryotic sources, including those which are obtained, from plants, or from acyltransferases which are obtainable through the use of these sequences. "Obtainable" refers to those acyltransferases which have sufficiently similar sequences to that of the sequences provided herein to provide a biologically active protein of the present invention.
2 0 Further preferred embodiments of the invention that are at least 50%, 60%, or 70%
identical over their entire length to a polynucleotide encoding a polypeptide of the invention, and polynucleotides that are complementary to such polynucleotides. More preferable are polynucleotides that comprise a region that is at least 80% identical over its entire length to a polynucleotide encoding a polypeptide of the invention and polynucleotides that are 2 5 complementary thereto. In this regard, polynucleotides at least 90%
identical over their entire length are particularly preferred, those at least 95% identical are especially preferred. Further, those with at least 97% identity are highly preferred and those with at least 98% and 99%
identity are particularly highly preferred, with those at least 99%a being the most highly preferred.
3 0 Preferred embodiments are polynucleotides that encode polypeptides that retain substantially the same biological function or activity as the mature polypeptides encoded by the polynucleotides set forth in the Sequence Listing.

WO 00!18889 PCT/US99122231 The invention further relates to polynucleotides that hybridize to the above-described sequences. In particular, the invention relates to polynucleotides that hybridize under stringent conditions to the above-described polynucleotides. As used herein, the terms "stringent conditions" and "stringent hybridization conditions" mean that hybridization will generally occur if there is at least 95% and preferably at least 97% identity between the sequences. An example of stringent hybridization conditions is overnight incubation at 42°C
in a solution comprising SO% formamide, Sx SSC (150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), Sx Denhardt's solution, 10% dextran sulfate, and 20 micrograms/milliliter denatured, sheared salmon sperm DNA, followed by washing the hybridization support in O.lx SSC at approximately 6S°C. Other hybridization and wash conditions are well known and are exemplified in Sambrook, et al., Molecular Cloning: A
Laboratory Manual, Second Edition, cold Spring Harbor, NY ( 1989), particularly Chapter 11.
The invention also provides a polynucleotide consisting essentially of a polynucleotide sequence obtainable by screening an appropriate library containing the complete gene for a polynucleotide sequence set for in the Sequence Listing under stringent hybridization conditions with a probe having the sequence of said polynucleotide sequence or a fragment thereof; and isolating said polynucleotide sequence. Fragments useful for obtaining such a polynucleotide include, for example, probes and primers as described herein.
As discussed herein regarding polynucleotide assays of the invention, for example, 2 0 polynucleotides of the invention can be used as a hybridization probe for RNA, cDNA, or genomic DNA to isolate full length cDNAs or genomic clones encoding a polypeptide and to isolate cDNA or genomic clones of other genes that have a high sequence similarity to a polynucleotide set forth in the Sequence Listing. Such probes will generally comprise at least 15 bases. Preferably such probes will have at least 30 bases and can have at least 50 bases.
Particularly preferred probes will have between 30 bases and 50 bases, inclusive.
The coding region of each gene that comprises or is comprised by a polynucleotide sequence set forth in the Sequence Listing may be isolated by screening using a DNA
sequence provided in the Sequence Listing to synthesize an oligonucleotide probe. A labeled oligonucleotide having a sequence complementary to that of a gene of the invention is then 3 0 used to screen a library of cDNA, genomic DNA or mRNA to identify members of the library which hybridize to the probe. For example, synthetic oligonucleotides are prepared which correspond to the N-terminal sequence of the polypeptide. The partial sequences so prepared can then be used as probes to obtain acyltransferase clones from a gene library prepared from WO 00!18889 . PCTIUS99I22231 a cell source of interest. Alternatively, where oligonucleotides of low degeneracy can be prepared from particular peptides, such probes may be used directly to screen gene libraries for gene sequences. In particular, screening of cDNA libraries in phage vectors is useful in such methods due to lower levels of background hybridization.
Typically, a sequence obtainable from the use of nucleic acid probes will show 70% sequence identity between the target acyltransferase sequence and the encoding sequence used as a probe. However, lengthy sequences with as little as 50-60% sequence identity may also be obtained. The nucleic acid probes may be a lengthy fragment of the nucleic acid sequence, or may also be a shorter, oligonucleotide probe. When longer nucleic acid fragments are employed as probes (greater than about 100 bp), one may screen at lower stringencies in order to obtain sequences from the target sample which have 20-50%
deviation (i.e., 50-80% sequence homology) from the sequences used as probe.
Oligonucleotide probes can be considerably shorter than the entire nucleic acid sequence encoding an acyltransferase enzyme, but should be at least about 10, preferably at least about 15, and more preferably at least about 20 nucleotides. A higher degree of sequence identity is desired when shorter regions are used as opposed to longer regions. It may thus be desirable to identify regions of highly conserved amino acid sequence to design oligonucleotide probes for detecting arid recovering other related genes. Shorter probes are often particularly useful for polymerase chain reactions (PCR), especially when highly conserved sequences can be 2 0 identified. (See, Gould, et al., PNAS USA ( 1989) 86:1934-1938).
The skilled artisan will appreciate that, in many cases, an isolated cDNA
sequence will be incomplete, in that the region coding for the polypeptide is truncated with respect to the 5' terminus of the cDNA. This is a consequence of the reverse transcriptase, an enzyme with low 'processivity' (a measure of the ability of the enzyme to remain attached to the 2 5 template during the polymerization reaction) employed during the first strand cDNA
synthesis.
There are several methods available and are well know to the skilled artisan to obtain full-length cDNAs, or extend short cDNAs, for example those based on the method of Rapid Amplification of cDNA Ends (RACE) (see, for example, Frohrnan et al. (1988) Proc. Natl.
3 0 Acad. Sci. USA 85:8998-9002). Recent modifications of the technique, exemplified by the Marathonr"' technology (Cionetech Laboratories, Inc.) for example, have significantly simplified obtaining foil-length cDNA sequences.

Another aspect of the present invention relates to isolated acyltransferase polypeptides. Such polypeptides include isolated polypeptides set forth in the Sequence Listing, as well as polypeptides and fragments thereof, particularly those polypeptides which exhibit acyltransferase activity and also those polypeptides which have at least 50%, 60% or 70% identity, preferably at least 80% identity, more preferably at least 90%
identity, and most preferably at least 95% identity to a polypeptide sequence selected from the group of sequences set forth in the Sequence Listing, and also include portions of such polypeptides, wherein such portion of the polypeptide preferably includes at least 30 amino acids and more preferably includes at least 50 amino acids.
"Identity", as is well understood in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as determined by the match between strings of such sequences. "Identity" can be readily calculated by known methods including, but not limited to, those described in Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part l, Griffin, A.M. and Griffin, H.G., eds., Humana Press, New Jersey ( 1994); Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J.Applied Math, 48:1073 (1988). Methods to determine identity are designed to give the largest match between the sequences tested. Moreover, methods to determine identity are codified in publicly available programs. Computer programs which can be used to determine identity between two sequences include, but are not limited to, GCG
(Devereux, J., et al., Nucleic Acids Research 12(1):387 (19$4); suite of five BLAST
programs, three designed for nucleotide sequences queries (BLASTN, BLASTX, and TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology, 12: 76-80 (1994); Birren, et ad., Genome Analysis, 1:
543-559 (1997)). The BLAST X program is publicly available from NCBI and other sources 3 0 (BLAST Manual, Altschul, S., et ad., NCBI NLM NIH, Bethesda, MD 20894;
Altschul, S., et al.; J. Mol. Biol., 215:403-410 (1990)). The well known Smith Waterman algorithm can also be used to determine identity.

Parameters for polypeptide sequence comparison typically include the following:
Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 { 1970) Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, P~oc. Natt. Acad.
Sci USA 89:10915-10919 ( 1992) Gap Penalty: 12 Gap Length Penalty: 4 A program which can be used with these parameters is publicly available as the "gap"
program from Genetics Computer Group, Madison Wisconsin. The above parameters along with no penalty for end gap are the default parameters for peptide comparisons.
Parameters for polynucleotide sequence comparison include the following:
Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970) Comparison matrix: matches = +10; mismatches = 0 Gap Penalty: SO
Gap Length Penalty: 3 A program which can be used with these parameters is publicly available as the "gap"
program from Genetics Computer Group, Madison Wisconsin. The above parameters are the default parameters for nucleic acid comparisons.
The invention also includes polypeptides of the formula:
X-(RE)n (Rz)-{Rs)n Y
2 0 wherein, at the amino terminus, X is hydrogen, and at the carboxyl terminus, Y is hydrogen or a metal, Rt and R3 are any amino acid residue, n is an integer between 1 and 1000, and Rz is an amino acid sequence of the invention, particularly an amino acid sequence selected from the group set forth in the Sequence Listing and preferably SEQ IDNOs: 2, 4, 6, 8, 11, 13, 15, 17, 19, 21, 23, and 218-225. In the formula, Rz is oriented so that its amino terminal residue is at the left, bound to Ri, and its carboxy terminal residue is at the right, bound to R3. Any stretch of amino acid residues denoted by either R group, where R is greater than 1, may be either a heteropvlymer or a homopolymer, preferably a heteropolymer.
Polypeptides of the present invention include isolated polypeptides encoded by a polynucleotide comprising a sequence selected from the group of a sequence contained in 3 0 SEQ ID NOs: 1, 3, 5, 7, 9, 10, 12, 14, 16, 18, 20, 22, and 226-233.
The polypeptides of the present invention can be mature protein or can be part of a fusion protein.

Fragments and variants of the polypeptides are also considered to be a part of the invention. A fragment is a variant polypeptide which has an amino acid sequence that is entirely the same as part but not all of the amino acid sequence of the previously described polypeptides. The fragments can be "free-standing" or comprised within a larger polypeptide 5 of which the fragment forms a part or a region, most preferably as a single continuous region.
Preferred fragments are biologically active fragments which are those fragments that mediate activities of the polypeptides of the invention, including those with similar activity or improved activity or with a decreased activity. Also included are those fragments that antigenic or immunogenic in an animal, particularly a human.
10 Variants of the polypeptide also include polypeptides that vary from the sequences set forth in the Sequence Listing by conservative amino acid substitutions, substitution of a residue by another with like characteristics. In general, such substitutions are among Ala, Val, Leu and Ile; between Ser and Thr; between Asp and Glu; between Asn and Gln; between Lys and Arg; or between Phe and Tyr. Particularly preferred are variants in which 5 to 10; 1 to 5; 1 to 3 or one amino acids) are substituted, deleted, or added, in any combination.
Variants that are fragments of the polypeptides of the invention can be used to produce the corresponding full length polypeptide by peptide synthesis.
Therefore; these variants can be used as intermediates for producing the full-length polypeptides of the invention.
2 0 The polynucleotides and polypeptides of the invention can be used, for example, in the transformation of various host cells, as further discussed herein.
The invention also provides polynucleotides that encode a polypeptide that is a mature protein plus additional amino or carboxyl-terminal amino acids, or amino acids within the mature polypeptide (for example, when the mature form of the protein has more than one 2 5 polypeptide chain). Such sequences can, for example, play a role in the processing of a protein from a precursor to a mature form, allow protein transport, shorten or lengthen protein half life, or facilitate manipulation of the protein in assays or production.
It is contemplated that cellular enzymes can be used to remove any additional amino acids from the mature protein.
3 0 A precursor protein, having the mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide. The inactive precursors generally are activated when the prosequences are removed. Some or all of the prosequences may be removed prior to activation. Such precursor protein are generally called proproteins.

PCT/t3S99/22231 The polynucleotide and polypeptide sequences can also be used to identify additional sequences which are homologous to the sequences of the present invention. The most preferable and convenient method is to store the sequence in a computer readable medium, for example, floppy disk, CD ROM, hard disk drives, external disk drives and DVD, and then to use the stored sequence to search a sequence database with well known searching tools.
Examples of public databases include the DNA Database of Japan (DDBJ)(http:llwww.ddbj.nig.ac.jpn; Genebank (htt //www ncbi nlm nih ~ov/web/GenbanklIndex.html~ and the European Molecular Biology Laboratory Nucleic Acid Sequence Database {EMBL) (http~//www ebi ac uklebi docs/embl db.html). A number of different search algorithms are available to the skilled artisan, one example of which are the suite of programs referred to as BLAST programs. There are five implementations of BLAST, three designed for nucleotide sequences queries (BLASTN, BLASTX, and TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology, 12:

(1994); Birren, et al., Genome Analysis, 1: 543-S59 (1997)). Additional programs are available in the art for the analysis of identified sequences, such as sequence alignment programs, programs for the identification of more distantly related sequences, and the like, and are well known to the skilled artisan.
2 0 Plant Constructs and Methods of Use Of interest in the present invention, is the use of the nucleotide sequences, or polynucleotides, in recombinant DNA constructs to direct the transcription or transcription and translation (expression) of the acyltransferase sequences of the present invention in a host 2 5 cell.
Of particular interest is the use of the nucleotide sequences, or polynucleotides, in recombinant DNA constructs to direct the transcription or transcription and translation (expression} of the acyltransferase sequences of the present invention in a host cell. The expression constructs generally comprise a promoter functional in a host cell operably linked 3 0 to a nucleic acid sequence encoding an acyltransferase of the present invention and a transcriptional termination region functional in a host cell.
By "host cell" is meant a cell which contains a vector and supports the replication, and/or transcription or transcription and translation (expression) of the expression construct.

Host cells for use in the present invention can be prokaryotic cells, such as E. coli, or eukaryotic cells such as yeast, plant, insect, amphibian, or mammalian cells.
Preferably, host cells are monocotyledenous or dicotyledenous plant cells.
Of particular interest in the present invention is the use of the polynucleotides of the present invention for the preparation of constructs to direct the transcription or transcription and translation of the nucleotide sequences encoding an acyltransferase in a host plant cell.
Plant expression constructs generally comprise a promoter functional in a plant host cell operably linked to a nucleic acid sequence of the present and a transcriptional termination region functional in a host plant cell.
Those skilled in the art will recognize that there are a number of promoters which are functional in plant cells, and have been described in the literature.
Chloroplast and plastid specific promoters, chloroplast or plastid functional promoters, and chloroplast or plastid operable promoters are also envisioned.
One set of promoters are constitutive promoters such as the CaMV35S or FMV35S
promoters that yield high levels of expression in most plant organs. Enhanced or duplicated versions of the CaMV35S and FMV35S promoters are useful in the practice of this invention (Odell, et ad. (1985) Nature 313:810-812; Rogers, U.S. Patent Number 5,378;
619). In addition, it may also be preferred to bring about expression of the protein of interest in specific tissues of the plant, such as leaf, stem, root, tuber, seed, fruit, etc., and the promoter 2 0 chosen should have the desired tissue and developmental specificity.
Of particular interest is the expression of the nucleic acid sequences of the present invention from transcription initiation regions which are preferentially expressed in a plant seed tissue. Examples of such seed preferential transcription initiation sequences include those sequences derived from sequences encoding plant storage protein genes or from genes 2 5 involved in fatty acid biosynthesis in oilseeds. Examples of such promoters include the 5' regulatory regions from such genes as napin {Kridl et al., Seed Sci. Res.
1:209:219 (1991)), phaseolin, zero, soybean trypsin inhibitor, ACP, stearoyl-ACP desaturase, soybean a' subunit of ji-coingiycinin (soy 7s, (Chen et al., Proc. Natl. Acad. Sci., 83:8560-8564 (1986))) and oleosin.
3 0 It may be advantageous to direct the localization of proteins conferring acyltransferase to a particular subcellular compartment, for example, to the mitochondrion, endoplasmic reticulum, vacuoles, chloroplast or other plastidic compartment. For example, where the genes of interest of the present invention will be targeted to plastids, such as chloroplasts, fox WO 00!18889 PCTNS99122231 expression, the constructs will also employ the use of sequences to direct the gene to the plastid. Such sequences are referred to herein as chloroplast transit peptides (CTP) or plastid transit peptides (PTP). In this manner, where the gene of interest is not directly inserted into the plastid, the expression construct will additionally contain a gene encoding a transit peptide to direct the gene of interest to the plastid. The chioroplast transit peptides may be derived from the gene of interest, or may be derived from a heterologous sequence having a CTP. Such transit peptides are known in the art. See, for example, Von Heijne et al. (1991) PlantlVlol. Biol. Rep. 9:104-126; Clark et al. (1989) J. Biol. Chem. 264:17544-17550; della-Cioppa et al. (1987) Plant Physiol. 84:965-968; Romer et al. ( 1993) Biochem.
Biophys. Res Commun. 196:1414-1421; and, Shah et al. (1986) Science 233:478-481. Additional transit peptides for the translocation of the protein to the endoplasmic reticulum (ER), or vacuole may also find use in the constructs of the present invention.
Depending upon the intended use, the constructs may contain the nucleic acid sequence which encodes the entire acyltransferase protein, or a portion thereof. For example, where antisense inhibition of a given acyltransferase protein is desired, the entire sequence is not required. Furthermore, where acyltransferase sequences used in constructs are intended for use as probes, it may be advantageous to prepare constructs containing only a particular portion of a acyltransferase encoding sequence, for example a sequence which is discovered to encode a highly conserved acyltransferase region.
2 0 The skilled artisan will recognize that there are various methods for the inhibition of expression of endogenous sequences in a host cell. Such methods include, but are not limited to antisense suppression (Smith, et al. { 1988) Nature 334:724-726) , co-suppression (Napoli, et al. (1989) Plant Cell 2:279-289), ribozymes (PCT Publication WO 97/10328), and combinations of sense and antisense, such as those described by Waterhouse, et al. {1998) Proc. Natl. Acad. Sci. USA 95:13959-13964. Methods for the suppression of endogenous sequences in a host cell typically employ the transcription or transcription and translation of at least a portion of the sequence to be suppressed. Such sequences may be homologous to coding as well as non-coding regions of the endogenous sequence.
Regulatory transcript termination regions may be provided in plant expression 3 0 constructs of this invention as well. Transcript termination regions may be provided by the DNA sequence encoding the acyltransferase or a convenient transcription termination region derived from a different gene source, far example, the transcript termination region which is naturally associated with the transcript initiation region. The skilled artisan will recognize that any convenient transcript termination region which is capable of terminating transcription in a plant cell may be employed in the constructs of the present invention.
Alternatively, constructs may be prepared to direct the expression of the acyltransferase sequences directly from the host plant cell plastid. Such constructs and methods are known in the art and are generally described, for example, in Svab, et al. (1990) Proc. Natl. Acad. Sci. USA 87:8526-8530 and Svab and Maliga ( 1993) Proc.
Natl. Acad. Sci.
USA 90:913-917 and in U.S. Patent Number 5,693,507.
A plant cell, tissue, organ, or plant into which the recombinant DNA
constructs containing the expression constructs have been introduced is considered transformed, transfected, or transgenic. A transgenic or transformed cell or plant also includes progeny of the cell or plant and progeny produced from a breeding program employing such a transgenic plant as a parent in a cross and exhibiting an altered genotype resulting from the presence of an introduced acyltransferase nucleic acid sequence.
The term "introduced" in the context of inserting a nucleic acid sequence into a cell, means "transfection", or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell where the nucleic acid sequence may be incorporated into the genome of the cell (for example, chromosome, plasmid, plastid; or mitochondria) DNA), converted into an autonomous replicon; or transiently expressed (for example, transfected mRNA).
2 0 Plant expression or transcription constructs having an acyltransferase as the DNA
sequence of interest for increased or decreased expression thereof may be employed with a wide variety of plant life, particularly, plant life involved in the production of vegetable oils for edible and industrial uses. Plants of interesC in the present invention include monocotyledenous and dicotyledenous plants. Most especially preferred are temperate 2 5 oilseed crops. Plants of interest include, but are not limited to, rapeseed (Canola and High Erucic Acid varieties), sunflower, safflower, cotton, soybean, peanut, coconut and oil palms, and corn. Depending on the method for introducing the recombinant constructs into the host cell, other DNA sequences may be required: Importantly, this invention is applicable to dicotyledyons and monocotyledons species alike and will be readily applicable to new andlor 3 0 improved transformation and regulation techniques.
As used herein; the term "plant" includes reference to whole plants, plant organs (for example, leaves, stems, roots, etc.), seeds, and plant cells and progeny of same. Plant cell, as used herein includes, without limitation, seeds suspension cultures, embryos, meristematic regions, callus tissue, leaves roots shoots, gametophytes, sporophytes, pollen, and microspores. The class of plants which can be used in the methods of the present invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledenous and dicotyledenous plants. Particularly preferred plants of 5 interest include, but are not limited to, rapeseed (Canola and High Erucic Acid varieties), sunflower, safflower, cotton, soybean, peanut, coconut and oil palms, and corn. Most especially preferred plants include Brassica, soybean, and corn.
As used herein, "transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. Generally, the heteroiogous polynucleotide 10 is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette. "Transgenic" is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well 15 as those created by sexual crosses or asexual propagation from the initial transgenic.
Thus a plant having within its cells a heterologous polynucleotide is referred to herein as a transgenic plant. The heterologous polynucleotide can be either stably integrated into the genorne, or can be extra-chromosomal. Preferably, the polynucleotide of the present invention is stably integrated into the genome such that the polynucleotide is passed on to 2 0 successive generations. The polynucleotide is integrated into the genorne alone or as part of a recombinant expression cassette. "Transgenic" is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acids including those transgenics initially so altered as well as those created by sexual crosses or asexual reproduction of the initial transgenics.
2 5 As used herein, "heterologous" in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous structural gene is from a species different from that from which the structural gene was derived, or, if from the same species, 3 0 one or bath are substantially modified from their original form. A
heterologous protein may originate from a foreign species, or, if from the same species, is substantially modified from its original form by deliberate human intervention.

As used herein, a "recombinant expression cassette" is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements which permit transcription of a particular nucleic acid in a target cell. The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondria) DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter.
It is contemplated that the gene sequences may be synthesized, either completely or in part, especially where it is desirable to provide plant-preferred sequences.
Thus, all or a portion of the desired structural gene (that portion of the gene which encodes the acyltransferase protein) may be synthesized using codons preferred by a selected host. Host-preferred codons may be determined, for example, from the codons used most frequently in the proteins expressed in a desired host species.
One skilled in the art will readily recognize that antibody preparations, nucleic acid probes (DNA and RNA) and the like rnay be prepared and used to screen and recover "homologous" or "related" acyltransferase from a variety of plant sources.
Homologous sequences are found when there is an identity of sequence, which may be determined upon comparison of sequence information, nucleic acid or amino acid, or through hybridization reactions between a known acyltransferase and a candidate source. Conservative changes, such as Glu/Asp, Valllle, SerIThr, Arg/Lys and Gln/Asn may also be considered in determining sequence homology. Amino acid sequences are considered homologous by as little as 25% sequence identity between the two complete mature proteins. (See generally, Dooiittle, R.F., OF URFS and ORFS (University Science Books, CA, 1986.) Thus, other acyltransferase sequences can be obtained from the specific exemplified 2 5 sequences provided herein. Furthermore, it will be apparent that one can obtain natural and synthetic sequences, including modified amino acid sequences and starting materials for synthetic-protein modeling from the exemplified sequences and from acyltransferases which are obtained through the use of such exemplified sequences. Modified amino acid sequences include sequences which have been mutated, truncated, increased and the like, whether such 3 0 sequences were partially or wholly synthesized. Sequences which are actually purified from plant preparations or are identical or encode identical proteins thereto, regardless of the method used to obtain the protein or sequence, are equally considered naturally derived.

WO 00/18889 l ~ PCTIUS99/22231 For immunological screening, antibodies to the acyltransferase protein can be prepared by injecting rabbits or mice with the purified protein or portion thereof, such methods of preparing antibodies being well known to those in the art. Either monoclonal or polyclonal antibodies can be produced, although typically polyclonal antibodies are more useful for gene isolation. Western analysis may be conducted to determine that a related piotein is present in a crude extract of the desired plant species, as determined by cross-reaction with the antibodies to the acyitransferase protein. When cross-reactivity is observed, genes encoding the related proteins are isolated by screening expression libraries representing the desired plant species. Expression libraries can be constructed in a variety of connmercially available vectors, including lambda gtl l, as described in Sambrook, et al.
(Molecular Cloning: A Laboratory Manual, Second Edition ( 1989) Cold Spring Harbor Laboratory, Cold Spring Harbor, New York).
The nucleic acid sequences associated with acyltransferase proteins will find many uses. For example, recombinant constructs can be prepared which can be used as probes, or which will provide for expression of the acyltransferase protein in host cells to produce a ready source of the enzyme and/or to modify the composition of triglycerides found therein.
Other useful applications may be found when the host cell is a plant host cell, either in vitro or in viva.
The modification of fatty acid compositions may also affect the fluidity of plant 2 0 membranes. Different lipid concentrations have been observed in cold-hardened plants, for example. By this invention, one may be capable of introducing traits which will lend to chill tolerance. Constitutive or temperature inducible transcription initiation regulatory control regions may have special applications for such uses.
As discussed above, nucleic acid sequence encoding an acyltransferase of this 2 5 invention may include genornic, cDNA or mRNA sequence. By "encoding" is meant that the sequence corresponds to a particular amino acid sequence either in a sense or anti-sense orientation. By "extrachromosomal" is meant that the sequence is outside of the plant genome of which it is naturally associated. By "recombinant" is meant that the sequence contains a genetically engineered modification through manipulation via mutagenesis, 3 0 restriction enzymes, and the like.
Once the desired acyltransferase nucleic acid sequence is obtained, it rnay be manipulated in a variety of ways. Where the sequence involves non-coding flanking regions, the flanking regions may be subjected to resection, mutagenesis, etc. Thus, transitions, WO 00/18889 . PCT/US99/22231 transversions, deletions, and insertions may be performed on the naturally occurring sequence. In addition, all or part of the sequence may be synthesized. In the structural gene, one or more codons may be modified to provide for a modified amino acid sequence, or one or more codon mutations may be introduced to provide for a convenient restriction site or other purpose involved with construction or expression. The structural gene may be further modified by employing synthetic adapters, linkers to introduce one or more convenient restriction sites, or the like.
The nucleic acid or amino acid sequences encoding an acyltransferase of this invention may be combined with other non-native, or "heterologous", sequences in a variety of ways. By "heterologous" sequences is meant any sequence which is not naturally found joined to the acyltransferase, including, fox example, combinations of nucleic acid sequences from the same plant which are not naturally found joined together.
The DNA sequence encoding an acyltransferase of this invention may be employed in conjunction with all or part of the gene sequences normally associated with the acyltransferase. In its component parts, a DNA sequence encoding acyltransferase is combined in a DNA construct having, in the 5' to 3' direction of transcription, a transcription initiation control region capable of promoting transcription and translation in a host cell, the DNA sequence encoding plant acyltransferase and a transcription and translation termination region.
Potential host cells include both prokaryotic cells, such as E.coli and eukaryotic cells such as yeast, insect, amphibian, or mammalian cells. A host cell may be unicellular or found in a multicellular differentiated or undifferentiated organism depending upon the intended use. Preferably, host cells of the present invention include plant cells, both monocotyledenous and dicotyledenous. Cells of this invention may be distinguished by 2 5 having a sequence foreign to the wild-type cell present therein, for example, by having a recombinant nucleic acid construct encoding an acyltransferase therein.
The methods used for the transformation of the host plant cell are not critical to the present invention. The transformation of the plant is preferably permanent, i.e. by integration of the introduced expression constructs into the host plant genome, so that the introduced 3 0 constructs are passed onto successive plant generations. The skilled artisan will recognize that a wide variety of transformation techniques exist in the art, and new techniques are continually becoming available. Any technique that is suitable for the target host plant can be employed within the scope of the present invention. For example, the constructs can be WO 00118889 PCT/ITS99l22231 introduced in a variety of forms including, but not limited to as a strand of DNA, in a plasmid, or in an artificial chromosome. The introduction of the constructs into the target plant cells can be accomplished by a variety of techniques, including, but not limited to calcium-phosphate-DNA co-precipitation, electroporation, microinjection, Agrobacterium infection, liposomes or microprojectile transformation. The skilled artisan can refer to the literature for details and select suitable techniques for use in the methods of the present invention.
Normally, included with the DNA construct will be a structural gene having the necessary regulatory regions far expression in a host and providing for selection of transformant cells. The gene may provide for resistance to a cytotoxic agent, e.g. antibiotic, heavy metal, toxin, etc., complementation providing prototrophy to an auxotrophic host, viral immunity or the like. Depending upon the number of different host species the expression construct or components thereof are introduced, one or more markers may be employed, where different conditions for selection are used for the different hosts.
Where Agrobacterium is used for plant cell transformation, a vector may be used which may be introduced into the Agrobacterium host for homologous recombination with T-DNA or the Ti- or Ri-plasmid present in the Agrobacterium host. The Ti- or Ri-plasmid containing the T-DNA for recombination may be armed (capable of causing gall formation) or disarmed (incapable of causing gall formation), the latter being permissible, so long as the 2 0 vir genes are present in the transformed Agrobacterium host. The armed plasmid can give a mixture of normal plant cells and gall.
In some instances where Agrobacterium is used as the vehicle for transforming host plant cells, the expression or transcription construct bordered by the T-DNA
border regions) will be inserted into a broad host range vector capable of replication in E.
coli and 2 5 Agrobacterium; there being broad host range vectors described in the literature. Commonly used is pRK2 or derivatives thereof. See, for example, Ditta, et al., (Proc.
Nat. Acad. Sci., U.S.A. (1980) 77:7347-7351) and EPA 0 120 515, which are incorporated herein by reference.
Alternatively, one may insert the sequences to be expressed in plant cells into a vector containing separate replication sequences, one of which stabilizes the vector in E. coli, and 3 0 the other in Agrobacterium. See, for example, McBride and Summerfelt (Plant Mol. Biol.
( 1990) 14:269-276}, wherein the pRiHRI (Jouanin, et al., Mol. Gen. Genet. ( 1985) 201:370-374) origin of replication is utilized and provides for added stability of the plant expression vectors in host Agrobacterium cells.

WU 00/18$$9 PCTIUS99/22231 Included with the expression construct and the T-DNA will be one or more markers, which allow for selection of transformed Agrobacterium and transformed plant cells. A
number of markers have been developed for use with plant cells, such as resistance to chloramphenicol, kanamycin, the aminoglycoside 6418, hygromycin, or the Like.
The 5 particular marker employed is not essential to this invention, one or another marker being preferred depending on the particular host and the manner of construction.
For transformation of plant cells using Agrobacterium, explants may be combined and incubated with the transformed Agrobacterium for sufficient time for transformation, the bacteria killed, and the plant cells cultured in an appropriate selective medium. Once callus 10 forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be grown to seed and the seed used to establish repetitive generations and for isolation of vegetable oils.
There are several possible ways to obtain the plant cells of this invention which 15 contain multiple expression constructs. Any means for producing a plant comprising a construct having a nucleic acid sequence of the present invention, and at least one other construct having another DNA sequence encoding an enzyme are encompassed by the present invention. For example, the expression construct can be used to transform a plant at the same time as the second construct either by inclusion of both expression constructs in a single 2 0 transformation vector or by using separate vectors, each of which express desired genes. The second construct can be introduced into a plant which has already been transformed with the first expression construct, or alternatively, transformed plants, one having the first construct and one having the second construct, can be crossed to bring the constructs together in the same plant.
2 5 In general, acyltransferase proteins are active in the transfer of acyl groups from a donor to a variety of different substrates. For example, diacylglycerol acyltransferases add acyl groups to diacylglycerol to form triacylglycerol (TAG), oracyl:CoA:cholesterol acyltransferase uses an acyl-CoA as a donor to transfer an acyl group to a sterol to form a sterol ester. Typically, the substrates include, but are not limited to glycerides, including 3 0 mono and diglycerides, sterols, stanols, phosphatides, and the like.
Donors include, but are not limited to acyl-CoA and acyl-ACP molecules.

The invention now being generally described, it will be more readily understood by reference to the following examples which are included for purposes of illustration only and are not intended to limit the present invention.
EXAMPLES
Example 1: RNA Isolations Total RNA from the inflorescence and developing seeds of Arabidopsis thaliana is isolated for use in construction of complementary (cDNA) libraries. The procedure is an adaptation of the DNA isolation protocol of Webb and Knapp (D.M. Webb and S.J.
Knapp, (1990) Plant Molec. Reparter, 8, 180-185). The following description assumes the use of lg fresh weight of tissue. Frozen seed tissue is powdered by grinding under liquid nitrogen. The powder is added to lOml REC buffer {50rnM Tris-HCI, pH 9, 0.8M NaCI, IOmM
EDTA, 0.5% w/v CTAB (cetyltrimethyl-ammonium bromide)) along with 0.2g insoluble polyvinylpolypyrrolidone, and ground at room temperature. The homogenate is centrifuged for 5 minutes at 12,000 xg to pellet insoluble material. The resulting supernatant fraction is extracted with chloroform, and the top phase is recovered.
2 0 The RNA is then precipitated by addition of 1 volume RecP (50mM Tris-HCL
pH9, IOmM EDTA and 0.5% (w/v) CTAB) and collected by brief centrifugation as before. The RNA pellet is redissolved in 0.4 ml of 1M NaCI. The RNA pellet is redissolved in water and extracted with phenol/chloraform. Sufficient 3M potassium acetate (pH 5) is added to make the mixture 0.3M in acetate, followed by addition of two volumes of ethanol to precipitate the 2 5 RNA. After washing with ethanol, this final RNA precipitate is dissolved in water and stored frozen.
Alternatively, total RNA may be obtained using TRIzol reagent (BRL-Lifetechnologies, Gaithersburg, MD) following the manufacturers protocol. The RNA
precipitate is dissolved in water and stored frozen.
Example 2: Identification of Acyltransferase Homology Sequences Searches are performed on a Silicon Graphics Unix computer using additional Bioaccellerator hardware and GenWeb software supplied by Compugen Ltd. This software and hardware enables the use of the Smith-Waterman algorithm in searching DNA
and protein databases using profiles as queries. The program used to query protein databases is profilesearch. This is a search where the query is not a single sequence but a profile based on a multiple alignment of amino acid or nucleic acid sequences. The profile is used to query a sequence data set, i.e., a sequence database. The profile contains all the pertinent information for scoring each position in a sequence, in effect replacing the "scoring matrix" used for the standard query searches. The program used to query nucleotide databases with a protein profile is tprofilesearch. Tprofilesearch searches nucleic acid databases using an amino acid profile query. As the search is running, sequences in the database are translated to amino acid sequences in six reading frames. The output file for tprofilesearch is identical to the output file for profilesearch except for an additional column that indicates the frame in which the best alignment occurred.
The Smith-Waterman algorithm, (Smith and Waterman (1981) supra), is used to search for similarities between one sequence from the query and a group of sequences contained in the database. E score values as well as other sequence information, such as conserved peptide sequences of HXXXXD and PEG are used to identify related sequences.
2 0 By using the conserved peptide sequence information, E score values of greater than E-12 and E-8 are considered. For example, the EST sequence originally used to identify ATAT2 had an E score of 0.0094, while the EST sequence originally used to identify ATLPAAT1 had an E score of 0.0868.
A protein sequence of glycerol-3-phosphate from E. toll (Swiss Prot Accession 2 5 P00482) is used to search the NCBI non-redundant protein database using BLAST. In the first round of searches, other membrane forms of G3PAAT are identified. In subsequent PSI-BLAST searches (Altschul, et al. ( 1997) Nucleic Acids Res 25:3389-3402), LPAATs and other acyltransferases are identified. Using sequence alignment software programs, G3PAAT
and different LPAAT amino acid sequences are aligned, and a profile is generated using a 3 0 homologous sequence region, between amino acids 256 and 459 of the E. toll sequence.
The identified 204 amino acid is used to query the protein database using PSI-BLAST.
After 5 iterations of PSI-BLAST, the profile generated from this new query (Figure 1) identified soluble forms of G3PAAT. Prior to this identification, no sequence homology had been identified between the membrane and soluble forms of G3PAAT.
Example 3: Excision of PSI-BLAST Profile The profile generated from the queries using PSI-BLAST is excised from the hyper text markup language (html) file. The worldwide web (www)/html interface to psiblast at ncbi stores the current generated profile matrix in a hidden field in the html file that is returned after each iteration of psiblast. However, this matrix has been encoded into string62 (s62) format for ease of transport through html. String62 format is a simple conversion of the values of the matrix into html legal ascii characters.
The encoded matrix width (x axis) is 26 characters, and comprise the consensus characters, the probabilities of each amino acid in the order A,B,C,D,E,F,G,H,I,K,L,M,N, P,Q,R,S,T,V,W,X,Y,Z (where B represents D and N, and Z represents Q and E, and X
represents any amino acid), gap creation value, and gap extension value.
The length (y axis) of the matrix corresponds to the length of the sequences identified by PSI-BLAST. The order of the amino acids corresponds to the conserved amino acid sequence of the sequences identified using PSI-BLAST, with the N-terminal end at the top of 2 0 the matrix. The probabilities of other amino acids at that position are represented for each amino acid along the x axis, below the respective single letter amino acid abbreviation.
Thus, each row of the profile consists of the highest scoring (consensus) amino acid, followed by the scores for each possible amino acid at that position in sequence matrix, the score for opening a gap that that position, and the score for continuing a gap at that position.
2 5 The string62 file is converted back into a profile for use in subsequent searches. The gap open field is set to 11 and the gap extension field is set to 1 along the x axis. The gap creation and gap extension values are known, based on the settings given to the PSI-BLAST
algorithm. The matrix is exported to the standard GCG profile form. This format can be read by GenWeb.
3 0 The algorithm used to convert the string62 formatted file to the matrix is outlined in Table 1.

Table 1 1. if encoded character z then the value is blast score min 2. if encoded character Z then the value is blast score max 3. else if the encoded character is uppercase then its value is (64-(ascii #
of char)) 4. else if the encoded character is a digit the value is {{ascii # of char)-48) 5. else if the encoded character is not uppercase then the value is {(ascii #
of char) - 87) 6. ALL B positions are set to min of D and N amino acids at that row in sequence matrix 7. ALL Z positions are set to min of Q amd E amino acids at that row in sequence matrix 8. ALL X positions are set to min of all amino acids at that row in sequence matrix 9. kBLAST_SCORE_MAX=999;

10. kBLAST SCORE MIN=-999;

11. all gap opens are set to 11 12. all gap lens are set to 1 Example 4; Identification of Novel Acyltransferase Related Amino Acid Sequences 2 0 The profile (Figure 1 ) is used in further queries to identify a number of previously unidentified proteins from yeast as novel acyltransferases. A protein is identified from an Arabidopsis protein sequence database (ATAT 1 ) (SEQ ID N0:2). Sequences are also identified from nucleic acid databases (Table 2}
2 5 Table 2 Database ID Number BLAST Search Hits Log probability Saccharomyces cerevisiae gi 1078509 Limnanthes putative LPAAT e-10 (SEQ ID
N0:217) 3 0 gi 586485 Limnanthes putative LPAAT e-13 (SEQ ID
N0:218) gi 320748 Limnanthes putative LPAAT e-I9 (SEQ ID
N0:219) gi 2506920 SUPPRESSES CTR1 (choline transport mutant) (SEQ
ID N0:220) gi 549b27 similar to CTRL e-118 {SEQ ID

5 N0:221) gi 2133031 unidentified (SEQ ID

N0:222) gi 2132939 unidentified (SEQ ID

N0:223) 10 gi 2132299 TAFAZZIN e-I4 (SEQ ID

N0:224) In Table 2, the gi number is the database identifier, the middle column shows the results of BLAST searches against the NCBI NR protein database, and the log probability 15 number shows represents the log of the probability of such a match occurring by random chance. These proteins, including the ATAT 1 protein sequence, are identified using the original PSI-BLAST search of the NCBI NR protein database. Thus, these proteins are novel acyltransferase related proteins with unidentified activities.
The Arabidopsis acyltransferase sequence, herein referred to as ATAT1, is also 2 0 identified using the original PSI-BLAST search of the NCBI NR protein database, and did not have an annotated function.
Additional Arabidopsis amino acid sequences related to acyltransferases are identified from the databases, referred to as ATAT2est, ATAT3est, ATAT4est, ATATSest, ATATbest, ATAT7est, ATATBest, ATAT9, ATAT 10, and ATAT 11 est. Furthermore, Arabidopsis 2 5 amino acid sequences are identified which demonstrate sequence similarity to known lysophosphatidic acid, referred to as ATLPAAT 1. The sequences of ATAT9 and are identified from the database as genomic sequences, all otherArabidopsis sequences are identified as ESTs.
Example S: Sequence Analysis of the Novel Acyltransferases To obtain the entire coding region corresponding to the Arabidopsis acyltransferase sequences, synthetic oligo-nucleotide primers are designed to amplify the 5' and 3' ends of partial cDNA clones containing acyltransferase related sequences. Primers are designed according to the respective Arabidopsis acyltransferase related sequences (Table 3) and used in Rapid Amplification of cDNA Ends (RACE) reactions (Frohman et al. ( 1988) Proc. Natl.
Acad. Sci. USA 85:8998-9002) using the Marathon cDNA amplification kit (Clontech Laboratories Inc, Palo Alto, CA). Primers with an R designation are used for 5' RACE
reactions, and primers with an F designation are used for 3' RACE reactions.

Table 3 ATAT2R1 CCATCCGCTTCAAGGGAACGACACCCATCA (SEQ ID N0:135) ATAT2R2 TCCCTGTCTTGCTTGATGAACTTAAAGCTTG (SEQ ID N0:136) ~ ATAT2R3 ACAGCAGGAGTGTCTGATGATGGCAGATTC (SEQ ID N0:137) ATAT3R1 ACTGGAGTTCCAGCCAAAAATGCACCTGTC {SEQ ID N0:138) ATAT3R2 GATACACCCTTGAAATCAGGCGATTTTGCT (SEQ ID N0:139}

ATAT4R 1 TTGCAAATTCAATTCCTGTTTCACCGGGCC (SEQ ID N0:140) ATAT4R2 GTTTTCTGCTATTCCAGAAGGCGTCAACAA (SEQ ID NO:141 ) ATATS
ATATSR1 CATTGAAGATCCGTCCGTGAAGTTNCCTTACC (SEQ ID N0:142) ATATSR2 TCGAGCTGTGATCGATGATTGGCTGTGAAG (SEQ ID N0:143}
ATATSF1 GTCTCTTCAAAAACACACACACACGTCTCT (SEQ ID N0:144) ~ ATATSF2 GTCTCTTCAAAAACACACACACACGTCTCT (SEQ iD N0:145) H76348-F1GTAGAGAGCCTTACTTGCTTCGGTTTAGTC (SEQ ID N0:146) H76348-F2ACGTCATCGTACCTGTTGCTATTGACTCAC (SEQ ID N0:147) H76348-R1ACTTTTCCATTGTCAGGGACTCCTCGACAC (SEQ ID N0:148) 2 H76348-R2ACGGTGTAGGAAGGGAAAGGATTCAAAAGG (SEQ ID N0:149) ATTS0193-F1GCGAT~AACTACAGAGTCGGATTCTTCCTC (SEQ ID N0:150) ATTS0193-F2CCGGTTTACGAGATTACGTTCTTGAACCAG (SEQ ID NO:151) ATTS0193-R1CAATGGAGACAAGGCTCGAAAGTGCTAACC (SEQ ID N0:152) ~ ATTS0193-R2 ATTCTCTGAACATAGTTCGCCACGGTCATG {SEQ ID N0:153) WO 00/18889 . PCT/US99/22231 AA042618-F1 GAAATCCAACGCCTTCCCAATATCACTCTG (SEQ ID N0:154) AA042618-F2 CTTCAACTTTCCATCAGGATCTTGGCACGT (SEQ ID N0:155) AA042618-R 1 ACCACTTGTTAGAGACCTTACCTGCTTAGG (SEQ ID N0:156) ~ AA042618-R2 TCCTACCTACACCATCCAATTTCTCGACCC (SEQ ID N0:157) ATAT11R1 CTGCGTCAAGTGAGCAACTCAGTTCTTGCA {SEQ ID N0:158) ATAT11R2 TGGGAAGCAGCACGTTGTTCAGTATCGGAA {SEQ ID N0:159) ~ ATAT 11 R3 TAGCCTCTGTGTAATCTGTGCCCTCGGGGA {SEQ ID NO: l b0) From the nucleic acid sequences obtained from the RACE reactions, protein sequence is predicted for each nucleic acid sequence using Macvector software. Nucleic acid sequences are provided for ATAT1 (SEQ ID NO:1), ATAT2 (SEQ ID N0:3), ATAT3 (SEQ ID
NO:S), ATAT4 (SEQ ID N0:7), ATATS {SEQ ID NO:9), ATAT6 (SEQ ID NO:10), ATAT7 (SEQ
ID N0:12), ATAT8 (SEQ ID N0:14), ATAT9 (SEQ ID N0:16), ATAT10 (SEQ ID NO:18), ATAT 11 (SEQ ID N0:20) and ATLPAAT 1 (SEQ ID N0:22), respectively.
The protein sequence derived from the ATAT 1 {SEQ ID N0:2) nucleic acid sequence 2 0 from Arabidopsis has- a predicted molecular mass of 32.5 kDa, and a PI of 9.74. Alignment of the Arabidopsis acyltransferase with several LPAAT and G3PAAT shows that some of the domains that are conserved between LPAAT and G3PAAT are conserved in the new acyltransferase protein.
The ATAT2 nucleic acid sequence is predicted to encode a 312 amino acid protein 2 5 (SEQ ID N0:4), with a molecular weight of 34.6 kD, and a pI of 9.99. The ATAT2 protein may also contain 2 to 3 transmernbrane domains. However, the protein encoded by the ATAT2 nucleic acid sequence may be longer than predicted because of the absence of an inframe stop codon upstream of the ATG start codon used.
The ATAT3 nucleic acid sequence is predicted to encode a 398 amino acid protein 3 0 (SEQ ID N0:6), with a molecular weight of 44.7 kD, and a pI of 5.62. The ATAT3 protein may contain 1 to 4 transmernbrane domains. The ATAT4 nucleic acid sequence is predicted to encode a 317 amino acid protein (SEQ ID N0:8), with a molecular weight of 36.5 kD, and a pI of 9.67. The ATAT4 protein is predicted to have 2 to S transmembrane domains.

WO 00/18889 . PCT/US99/22231 The ATLPAAT 1 nucleic acid sequence is predicted to encode a 389 amino acid protein {SEQ ID N0:23), with a molecular weight of 43.7 kD, and a pI of 9.52.
The ATLPAAT 1 protein is predicted to have up to 3 transmembrane domains. The protein predicted from the ATLPAAT1 nucleic acid sequence is similar to LPAATs reported for Brassaca, maize, and meadowfoam (described in PCT Publication WO 94/13814).
The ATAT11 nucleic acid sequence is predicted to encode a 375 amino acid protein (SEQ ID
N0:21 ), with a molecular weight of 43.5 kD, and a pI of 9.45. The deduced amino acid sequences of ATAT6 (SEQ ID NO:I 1), ATAT7 (SEQ ID N0:13), ATAT8 (SEQ ID
N0:15}, ATAT9 (SEQ ID N0:17), and ATAT10 (SEQ iD N0:19) are also provided A sequence region approximately 30 amino acids upstream through approximately 100 amino acids downstream of the conserved amino acid sequences HXXXXD (Heath and Rock, (1998) J. Bacteriol. 180(6):1425-1430) and PEG (Neuwald (1997) Curr Biol7:R465-R466) of the predicted amino acid sequences derived from the nucleic acid sequences of ATATI, ATAT2, ATAT3, ATAT4, ATAT6, ATAT7, ATATB, ATAT9, ATAT10, ATLPAAT1, and ATAT11 are compared to the amino acid sequences of lysophosphatidic acid acyltransferase (Jojoba AT (SEQ ID N0:162, the nucleic acid sequence is provided in SEQ ID NO:I61), maize AT (PCT Publication WO 94/13814), PLSC coco{GenBank accession 1098605), PLSC Lim(GenBank accession 1209507), PLSC, Ecoli (GenBank accession 1209507), and PLSC Yeast(GenBank accession 464422}) and glycerol-3-phosphate 2 0 acyltransferase (PLSB Ecoli(GenBank accession 130326) and PLSB
Mouse(GenBank accession 2498786)) (Figure 2), and similarities are identified (Figure 2 and Figure 3).
Sequence comparisons reveal several classes of acyltransferases exist based on conserved amino acid sequences identified in the comparisons in Figure 2. For example, ATAT1, ATAT6, ATAT7, ATATB, and ATAT9, contain the conserved amino acid sequences of VTYSXS(SEQ ID NO: 128), VXLTRXR(SEQ ID NO: 129), LXXGDLV(SEQ
ID NO: 132} between the HXXXXD and PEG sequences. In addition, ATAT1, ATAT6, ATAT7, ATATB, and ATAT9 also contain the conserved sequences CPEGT(SEQ ID NO:
130) which comprises the PEG sequence, as well as IVPVA(SEQ ID NO: 131) and VANXXQ {SEQ ID NO: 134)(Figure 2) downstream of the PEG sequence. The sequences 3 0 corresponding to ATAT 1, ATAT7, and ATAT9 are the most closely related in this class, with similarities between ATATi and ATAT9 of 67.0%, between ATAT1 and ATAT7 of 58.2%
and between ATAT9 and ATAT7 of 63.9% (Figure 3B).

~a Sequence comparisons also demonstrate that the sequence of ATLPAAT1 is most closely related to the jojoba LPAAT (82.3% similar), and maize (78.0%
similar).
Furthermore, sequence analysis demonstrates that ATAT4 is the most divergent sequence with the highest similarity to ATAT10 (18.5%). The highest similarity {i5.3%) to a known sequence is with a meadowfoam (Limnanthes douglassi) LPAAT. However, the sequences of ATAT4 and ATATiO share several conserved peptide sequences with the amino acid sequences of ATAT2 and ATAT3 (Figure 2), VXNHXS (SEQ ID NO: 127) where the H
comprises the conserved H of the HXXXXD sequence and FXXGAF (SEQ ID NO: 133) downstream of the PEG sequence.
Example 6: Identification of Additional Acyltransferase Sequences The novel Arabidopsis sequences identified above are used to search proprietary databases containing soybean and corn EST sequences. The results of this search identifies EST sequences from soybean (SEQ ID N0:24 through SEQ ID NO: 85) as well as from corn (SEQ ID NO: 86 through SEQ ID N0:126) as encoding acyltransferase related proteins.
Sequence comparisons between the various EST sequences and the complete Arabidopsis sequences reveals that the identified EST sequences demonstrate higher 2 0 similarity to the various Arabidopsis sequences as determined by BLAST
scores.
Expressed Sequence Tag (EST) sequences from soybean and corn databases are identified which are most closely related by BLAST score to ATAT 1 (SEQ ID
NOS:24-29 and SEQ ID NOS:86-88, respectively), ATAT2 (SEQ ID NO: 30 and SEQ ID N0:89, respectively), ATAT3 (SEQ ID NOS:31-35 and SEQ ID NOS:90-94, respectively), (SEQ ID NOS:36-44 and SEQ ID NOS:95-100, respectively), ATAT6 (SEQ ID NOS:45-and SEQ ID NO:101, respectively), ATAT7 (SEQ ID NOS:50-54 and SEQ ID NOS:102-103, respectively), ATAT8 (SEQ ID NOS:55-56 and SEQ ID N0:104, respectively), ATAT9 {SEQ ID NOS:57-79 and SEQ ID NOS:105-111, respectively), ATAT10 (SEQ ID NOS:80-81 and SEQ ID N0:112, respectively), ATAT11, {SEQ ID NOS:82-85 and SEQ ID
3 0 NOS:123-126, respectively), and ATLPAAT1 (SEQ ID NOS: 113-122 respectively).

WO 00/18889 31 PCT/US99l22231 Example 7: Expression Construct Preparation A series of synthetic oligo nucleotide primers were prepared for use in Polymerase Chain Reactions (PGR) to amplify the entire DNA sequences encoding the various acyltransferase sequences identified above. The sequences are listed in Table 3.
Table 3 Primer Sequence ( listed 5 ~ _~ . ~ S~Q =n NO:

CAG

TCAT

ATAT3R GGATCCCCTGCAGGTCATTCTTCTTTCTGATGGA.A.ATC 168 A

TCTTCA

TACCGG

CC

CC

TCCT

AGAT

ATAT11F GGATCCGCGGCCGCAAAATGG~~i~AAAAAGAGTGTACCAAA 181 ~u~sYm~ s~~~r ~u~~ ~s~

TTCT

TTTTTG

',YSCAT ATGTCTTTTAGGGATGTCCTAGAAAGAGGAGATGAATTTT 187 iK0 F CTGTGCGGTATTTCACACCG

I

KO R AGATTGTACTGAGAGTGCAC

TAGG

C

KO CTGTGCGGTATTTCACACCG
F

YSCAT 2 TCAATGATTTTTTTTCATCACAA.ATACAAGAATAAGAAA.A 192 KO AGATTGTACTGAGAGTGCAC
R

'YSCAT GGATCCGCGGCCGCACAATGGGTTTTGTTGATTTCTTCGA 193 ', AAC

F

KO CTGTGCGGTATTTCACACCG
F

KO AGATTGTACTGAGAGTGCAC
R

IKO F CTGTGCGGTATTTCACACCG

KO R AGATTGTACTGAGAGTGCAC
Stlt3STITUTE SHEET' tRllLE 26) 3~

KO F CTGTGCGGTATTTCACACCG

KO R AGATTGTACTGAGAGTGCAC

KO F CTGTGCGGTATTTCACACCG

KO R AGATTGTACTGAGAGTGCAC

YSCAT GGATCCGCTGCAGGTCF~'-~AAAA.TAAAACAATAAAGTTTAT210 YSCAT 7 ATGCTGCATCP~AAAAATAGCTCATAAAGTTCGAA.AAGTCG 211 KO CTGTGCGGTATTTCACACCG
F

KO AGATTGTACTGAGAGTGCAC
R

YSCAT $ ATGAGTGTGATAGGTAGGTTCTTGTATTACTTGAGGTCCG 215 KO CTGTGCGGTATTTCACACCG
F

YSCAT 8 TTAATGCATCTTTTTTACAGATGAA.CCTTCGTTATGGGTA 216 KO AGATTGTACTGAGAGTGCAC
R

The entire coding regions for each of the acyltransfezase sequences were amplified using the respective prixriers listed in the Table 3 above, cloned into the vector pCR2.lTopo (Invitrogen) or pZero (Invitrogen), and labeled as pCGN8558 (ATAT 1 ), pCGN8564 y ~l~S'1"f~t~ SM~~' RULE 26) (ATAT2), pCGF3856S (ATAT3), pGGN8566 (ATAT4), pCC'~N8918 (ATAT6), pCGN8913 (ATAT7), pCGN8904 (ATAT8), pCGN9)70 (ATAT~3), pCGN9940 (ATAT10), pCGN8567 (ATAT11), pCGN8632 (ATLPAAT1), pCGN9901 (YSCAT1 also referred to a5 gi2132299), pCGN9902 (YSCAT2, also referred to as gi 1078509), pCGN9903 ('S;''SCAT3, also referred to as gi2132939), pCGN9904 (YSCAT4, alsa referred to gi2133031 ), pCGN9905 ('YSCATS, also referred to as gi320748), pCGN9906 {YSCAT6, also xe:ferred to as gi549C27), pCGN9907 (YSCAT7, also refezred to a..e giS86485), and pCGN9908 (YSCATB, also referred to as gi464422). The nucleic acid sequencc;s far the respective yeast acyltransferase are provided YSCAT1 (SEQ m N0:225), YSCAT2 (SEQ ID N0:226), YSCAT3 (SEQ II? 1~I0:227), YSCAT4 (SEQ 1D
N0:228), YSCAT5 (SEQ ID N0:229), YSCAT6 (SEQ ID N0:230), YSCAT7 (SEQ ID
N0:231 ), and YSCAT8 (SEQ rD N0:232}.
~U6ST~UT~ SHEET (6~ULE 26) WO 00lI8889 34 PCTIUS99I22231 7A. Baculovirus Expression Constructs Constructs are prepared to direct the expression of the Arabidopsis ATAT
sequences in cultured insect cells. The entire coding regions of ATAT1, 2, 3, 4, 6, 7, 8, 9, 10, and 11 are cloned into the vector pFastBacl {Gibco-BRL, Gaithersburg, MD) digested withNotI and PstI. The respective coding sequences were cloned as NotiISse8387I fragments.
Double stranded DNA sequence was obtained to verify that no errors were introduced by PCR
amplification. The resulting plasmid were designated pCGN9723 (ATAT1), pCGN9724 (ATAT2), pCGN9725 (ATAT3), pCGN9726 (ATAT4), pCGN9727 (ATATS), pCGN9728 (ATAT7), pCGN9729 (ATATB), pCGN9991 (ATAT9) pCGN9730 {ATAT10), pCGN9731 (ATAT11).
7B. Plant Expression Construct Preparation A plasmid containing the napin cassette derived from pCGN3223 (described in USPN
5,639,790, the entirety of which is incorporated herein by reference) was modified to make it more useful for cloning large DNA fragments containing multiple restriction sites, and to allow the cloning of multiple napin fusion genes into plant binary transformation vectors. An adapter comprised of the self annealed oligonucleotide of sequence CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGCAGGGCGCGCCATTTAA
(SEQ ID NU:233) AT was ligated into the cloning vector pBC SK+ (Stratagene) after 2 0 digestion with the restriction endonuclease BssHII to construct vector pCGN7765. Plamids pCGN3223 and pCGN776S were digested with NotI and ligated together. The resultant vector, pCGN7770, contains the pCGN7765 backbone with the napin seed specific expression cassette from pCGN3223.
The cloning cassette, pCGN7787, essentially the same regulatory elements as 2 5 pCGN7770, with the exception of the napin regulatory regions of pCGN7770 have been replaced with the double CAMV 35S promoter and the tml polyadenylation and transcriptional termination region.
A binary vector for plant transformation, pCGNS 139, was constructed from pCGNl558 (McBride and Summerfelt, (1990) Plant Molecular Biology, 14:269-276).
The 30 polylinker of pCGN1558 was replaced as a HindIIIlAsp718 fragment with apolylinker containing unique restriction endonuclease sites, Ascl, Paci, XbaI, Swal, BamHI,and NotI.
The Asp718 and HindIII restriction endonuclease sites are retained in pCGN5139.

WO 00/18889 35 . PCT/US99/2223~
A series of turbo binary vectors are constructed to allow for the rapid cloning of DNA
sequences into binary vectors containing transcriptionai initiation regions (promoters) and transcriptianal termination regions.
The plasmid pCGN8618 was constructed by Iigating oligonucleotides 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' ) (SEQ ID N0:234) and 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3' ) (SEQ ID N0:235) into SaII/Xhol-digested pCGN7770. A fragment containing the napin promoter, polylinker and napin 3' region was excised from pCGN8618 by digestion with Asp718I; the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp7I8I and HindIII and blunt-ended by filling in the 5' overhangs with Klenow fragment. A plasmid containing the insert oriented so that the napin promoter was closest to the blunted Asp718I site of pCGN5139 and the napin 3' was closest to the blunted HindIII site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions: The resulting plasmid was designated pCGN8622.
The plasmid pCGN8619 was constructed by ligating oligonucleotides 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC -3' } (SEQ ID N0:236) and 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' } (SEQ ID N0:237} into SaII/XhoI-digested pCGN7770. A fragment containing the napin promoter, polylinker and napin 3' region was removed from pCGN8619 by digestion with Asp718I; the fragment was blunt-2 0 ended by filling in the 5' overhangs with HIenaw fragment then ligated into pCGN5139 that had been digested with Asp718I and HindIII and blunt-ended by filling in the 5' overhangs with HIenaw fragment. A plasmid containing the insert oriented so that the napin promoter was closest to the blunted Asp718I site of pCGN5139 and the napin 3' was closest to the blunted HindIII site was subjected to sequence analysis to confirm both the insert orientation 2 5 and the integrity of cloning junctions. The resulting plasmid was designated pCGN8623.
The plasmid pCGN8620 was constructed by ligating oligonucleotides 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGGAGCT -3' ) (SEQ ID N0:238) and 5'-CCTGCAGGAAGCTTGCGGCCGCGGATCC-3' ) (SEQ ID N0:239} into SaIT/SacI-digested pCGN7787. A fragment containing the d35S promoter, polylinker and tml 3' region 3 0 was removed from pCGN8620 by complete digestion with Asp718I and partial digestion with NotI. The fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and HindIII and blunt-ended by filling in the 5' overhangs with HIenow fragment. A plasmid containing the insert oriented so that the d35S promoter was closest to the blunted Asp718I site of pCGN5139 and the tm13' was closest to the blunted HindIII site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions.
The resulting plasmid was designated pCGN8624.
The plasmid pCGN8621 was constructed by ligating oligonucleotides 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCCAGCT -3' } (SEQ ID N0:240) and 5'-GGATCCGCGGCCGCAAGCTTCCTGCAGG-3' ) (SEQ ID N0:241) into SaII/SacI-digested pCGN7787. A fragment containing the d35S promoter, polylinker and tml 3' region was removed from pCGN8621 by complete digestion with Asp718I and partial digestion with NotI. The fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and HindIII and blunt-ended by filling in the 5' overhangs with Klenow fragment. A plasmid containing the insert oriented so that the d35S promoter was closest to the blunted Asp7I8I site of pCGN5139 and the tmI 3' was closest to the blunted HindIII site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions.
The resulting -plasmid was designated pCGN8625.
The coding regions of the various acyltransferase sequences were cloned as NotIISse8387I fragments into pCGN8622, pCGN8623, pCGN8624, and pCGN8625, for expression in sense or antisense orientations from a tissue preferential promoter, napin, or the 2 0 35S promoter. Fragments which were cloned into the pCGN8622 vector created the constructs pCGN8901 (ATAT1), pCGN8571 (ATAT2), pCGN8909 (ATAT3), pCGN8596 (ATAT4), pCGN8919 (ATAT6), pCGN8914 {ATAT7), pCGN8905 (ATATB), pCGN9973 (ATAT9), pCGN9942 (ATAT10), pCGN8575 (ATAT11), and pCGN8633 (ATLPAATl) for the sense expression of the respective coding sequences from the napin promoter. Fragments 2 5 which were cloned into the pCGN8623 vector created the constructs pCGN8900 (ATAT 1 );
pCGN8572 (ATAT2}, pCGN8910 (ATAT3), pCGN8597 (ATAT4), pCGN8920 (ATAT6), pCGN8915 (ATAT7), pCGN8906 (ATATB), pCGN9972 (ATAT9), pCGN9943 (ATATiO}, pCGN85?6 (ATAT 11 ), and pCGN8634 (ATLPAAT 1 } for the antisense expression of the respective coding sequences from the napin promoter. Fragments which were cloned into the 3 0 pCGN8624 vector created the constructs pCGN8903 (ATAT1), pCGN8573 (ATAT2), pCGN891I (ATAT3), pCGN8598 (ATAT4), pCGN8921 (ATAT6), pCGN8916 {ATAT7), pCGN8907 (ATATB), pCGN9971 (ATAT9), pCGN9944 (ATAT 10), pCGN8577 (ATAT 11 ), and pCGN8635 (ATLPAAT1) for the sense expression of the respective coding sequences from the 35S promoter. Fragments which were cloned into the pCGN8625 vector created the constructs pCGN8902 (ATAT 1 ) and pCGN9974 (ATAT9) for the antisense expression of the respective coding sequences from the 355 promoter.
In addition, the yeast acyltransferase coding sequences were cloned into the vector pCGN8624 creating the constructs pCGN9926 (YSCATI), pCGN9927 (YSCAT2), pCGN9928 (YSCAT3}, pCGN9929 (YSCAT4), pCGN9930 (YSCATS), pCGN9931 (YSCAT6}, pCGN9932 (YSCAT7}, and pCGN9933 (YSCATB). These constructs allow for the sense expression of the respective acyltransferase coding sequences from the 35S
promoter in plant cells.
Example 8: Plant Transformation A variety of methods have been developed to insert a-DNA sequence of interest into the genome of a plant host to obtain the transcription or transcription and translation of the sequence to effect phenotypic changes.
Transgenic Brassica plants are obtained by Agrobacterium-mediated transformation as described by Radke et al. (Theor. Appl. Genet. ( 1988) 75:685-694; Plant Cell Reports ( 1992) 11:499-505). Transgenic Arabidopsis thaliana plants may be obtained by 2 0 Agrobacterium-mediated transformation as described by Valverkens et al., (Proc. Nat. Acad.
Sci. (1988) 85:5536-5540); or as described by Bent et al. ((1994}, Science 265:1856-1860), or Bechtold et al. ((1993), C.R.Acad.Sci, Life Sciences 316:1194-1199) or Clough, et al. (1998) Plant J., 16:735-43. Other plant species may be similarly transformed using related techniques.
2 5 Alternatively, microprojectile bombardment methods, such as described by Klein et al. (Bio~l'echnology 10:286-291 ) may also be used to obtain nuclear transformed plants.
The above results demonstrate that the nucleic acid sequences identified encode proteins which are related to protein sequences encoding acyltransferase proteins. Such 3 0 acyitransferase sequences find use in preparing expression constructs for plant transformations.
All publications and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claim.

WO 00118889 PCTlUS99/2223I
j SEQUENCE LISTING
<110> Lassner, Michael W
Emig, Robin A
Ruezinsky, Diane Van Eenennaam, Alison <120> Novel Plant Acyltransferases <130> 17029/00/WO
<140>
<141>
<150> 60/101,939 <151> 1998-09-25 <160> 241 <170> PatentTn Ver. 2.0 <210> 1 <211> 869 <212> DNA
<213> Arabidopsis sp.
<400> 1 atggttcatg cgaccaagtc agccacaacg attccaaaag aacgcttaaa gaaccgcata 60 gtcttccatg atgggcgttt agcgcaacgt ccaactccgt taaacgccat tatcacatac 120 ctatggcttc cttttggttt catctctcca tcattcgcgt ctacttcaac ctccctttac 180 ctgaaagatt tgtccgttac acttacgaga tgctcgggat ccacttaacc attcgtggtc 240 atcgtcctcc acctccttcc cctggaactc ttggcaacct ctatgtcctt aaccaccgta 300 ccgcgcttga tcccatcatc gtcgctattg ctcttggacg taagatctgt tgcgtcactt 360 acagtgtctc tcgtctctcc cttatgcttt ctcctattcc tgctgttgcc ctcacccgtg 420 accgtgccac cgatgctgcc aacatgagaa aacttctcga gaaaggcgac ttggtgatat 480 gtccggaagg cacgacgtgt agagaagagt atctactgag atttagcgct ctattcgcag 540 agctaagcga ccggattgtg ccagtagcga tgaactgtaa acaaggaatg ttcaacggga 600 ccacagttag gggtgtgaag ttttgggacc cttacttctt cttcatgaac ccaagaccaa 660 gctatgaagc cactttcttg gatcgtttgc ctgaagaaat gactgtcaac ggtggtggca 720 agactcctat agaggtggct aattacgtcc agaaagttat cggcgcggtt ttgggcttcg 780 aatgcaccga acttactcgc aaggataaat atcttttgct tggaggtaat gacggcaagg 840 tggagtctat caacaacacc aagaagtga 869 <210> 2 <211> 289 <212> PRT
<213> Arabidopsis sp.
<400> 2 Met Val His Ala Thr Lys Ser Ala Thr Thr Ile Pro Lys Glu Arg Leu Lys Asn Arg Ile Val Phe His Asp Gly Arg Leu Ala Gln Arg Pro Thr Pro Leu Asn Ala Ile Ile Thr Tyr Leu Trp Leu Pro Phe Gly Phe Ile LeuSerTle IleArgVal TyrPheAsn LeuProLeu G1u ArgPhe Pro ValArgTyr ThrTyrGlu MetLeuGly IleHisLeu I1e ArgGly Thr HisArgPro ProProPro SerProGly ThrLeuGly Leu TyrVal Asn LeuAsnHis ArgThrAla LeuAspPro IleIleVal Ile AlaLeu Ala SEQUENCE LISTING
<110> Lassner, Michael W
Emig, Robin A
Ruezinsky, Diane Van Eenennaam, Alison <220> Novel Plant Acyltransferases <130> 17029/00/WO
<140>
<141>
<150> 60/101,939 <151> 1998-09-25 <160> 241 <170> Patentln Ver. 2.0 <210> 1 <211> 869 <212> DNA
<213> Arabidopsis sp.
<400> 1 atggttcatg cgaccaagtc agccacaacg attccaaaag aacgcttaaa gaaccgcata 60 gtcttccatg atgggcgttt agcgcaacgt ccaactccgt taaacgccat tatcacatac 120 ctatggcttc cttttggttt catctctcca tcattcgcgt ctacttcaac ctccctttac 180 ctgaaagatt tgtccgttac acttacgaga tgctcgggat ccacttaacc attcgtggtc 240 atcgtcctcc acctccttcc cctggaactc ttggcaacct ctatgtcctt aaccaccgta 300 ccgcgcttga tcccatcatc gtcgctattg ctcttggacg taagatctgt tgcgtcactt 360 acagtgtctc tcgtctctcc cttatgcttt ctcctattcc tgctgttgcc ctcacccgtg 420 accgtgccac cgatgctgcc aacatgagaa aacttctcga gaaaggcgac ttggtgatat 480 gtccggaagg cacgacgtgt agagaagagt atctactgag atttagcgct ctattcgcag 540 agctaagcga ccggattgtg ccagtagcga tgaactgtaa acaaggaatg ttcaacggga 600 ccacagttag gggtgtgaag ttttgggacc cttacttctt cttcatgaac ccaagaccaa 660 gctatgaagc cactttcttg gatcgtttgc ctgaagaaat gactgtcaac ggtggtggca 720 agactcctat agaggtggct aattacgtcc agaaagttat cggcgcggtt ttgggcttcg 780 aatgcaccga acttactcgc aaggataaat atcttttgct tggaggtaat gacggcaagg 840 tggagtctat caacaacacc aagaagtga 869 <210> 2 <211> 289 <212> PRT
<213> Arabidopsis sp.
<400> 2 Met Val His Ala Thr Lys Ser Ala Thr Thr Ile Pro Lys Glu Arg Leu Lys Asn Arg Ile Val Phe His Asp Gly Arg Leu Ala Gln Arg Pro Thr Pro Leu Asn Ala Ile Ile Thr Tyr Leu Trp Leu Pro Phe Gly Phe Ile Leu Sex Ile Ile Arg Val Tyr Phe Asn Leu Pro Leu Pro Glu Arg Phe Val Arg Tyr Thr Tyr G1u Met Leu Gly Ile His Leu Thr Ile Arg Gly His Arg Pro Pro Pro Pro Ser Pro Gly Thr Leu Gly Asn Leu Tyr Val Leu Asn His Arg Thr A1a Leu Asp Pro Ile Tle Val Ala Ile Ala Leu WO 00/18889 ~ . PCT/US99J22231 Gly Arg Lys Ile Cys Cys Val Thr Tyr Ser Val Sex Arg Leu Ser Leu Met Leu Ser Pro I1e Pro Ala Val Ala Leu Thr Arg Asp Arg Ala Thr Asp Ala Ala Asn Met Arg Lys Leu Leu Glu Lys Gly Asp Leu Val Ile Cys Pro Glu G1y Thr Thr Cys Arg Glu Glu Tyr Leu Leu Arg Phe Ser Ala Leu Phe Ala Glu Leu Ser Asp Arg Ile Val Pro Val Ala Met Asn Cys Lys Gln Gly Met Phe Asn Gly Thr Thr Val Arg Gly Val Lys Phe Trp Asp Pro Tyr Phe Phe Phe Met Asn Pro Arg Pro Ser Tyr Glu Ala Thr Phe Leu Asp Arg Leu Pro Glu Glu Met Thr Val Asn Gly Gly Gly Lys Thr Pro Ile Glu Val Ala Asn Tyr Val Gln Lys Val Ile Gly Ala Val Leu Gly Phe Glu Cys Thr Glu Leu Thr Arg Lys Asp Lys Tyr Leu Leu Leu Gly Gly Asn Asp Gly Lys Val Glu Ser Ile Asn Asn Thr Lys Lys <210> 3 <211> 939 <212> DNA
<213> Arabidopsis sp.
<400> 3 atgacgagct ttactacttc ccttcatgct gtcccgagtg aaaaatttat gggcgaaaca 60 agacgtactg gcattcaatg gtctaaccgc tctttaagac atgatcctta cagatttctt 120 gataagaaat cacctagatc aagtcaattg gcaagagata tcactgtgag agcagatctt 180 tcaggagctg caacccctga ctcttctttt cctgaaccag agattaagtt gagctcaaga 240 ctcagaggga tattcttttg tgttgttgct ggcatttcgg ctacttttct cattgtcctg 300 atgattattg ggcatccgtt cgtccttctc ttcgatccct ataggagaaa attccaccac 360 ttcattgcta aactttgggc ttccataagc atttatccgt tttacaaaat caacatcgag 420 ggtttggaga atctgccatc atcagacact cctgctgtat atgtttcaaa ccaccaaagt 480 tttctggata tctacacact tcttagtctt ggaaaaagct ttaagttcat cagcaagaca 540 gggatattcg taattcccat catcggttgg gccatgtcca tgatgggtgt cgttcccttg 600 aagcggatgg acccaagaag ccaagtggat tgcttaaaac gctgcatgga acttttaaag 660 aagggagcat ctgtgttttt cttcccagaa ggaacacgga gtaaggatgg tcggttaggt 720 tctttcaaga aaggcgcatt.tacagtggct gcgaagaccg gagttgcagt agttccaata 780 acgctaatgg gaacaggcaa aatcatgcca acgggtagtg aaggtatact gaaccatggg 840 aatgtgagag ttatcatcca taaaccaata catggaagca aagcggatgt tctttgcaac 900 gaggccagaa gcaagattgc agaatcaatg gatctctaa 939 <210> 4 <z11> 312 <212> PRT
<213> Arabidopsis sp.
<400> 4 Met Thr Ser Phe Thr Thr Ser Leu His Ala Val Pro Ser G1u Lys Phe Met Gly Glu Thr Arg Arg Thr Gly Ile Gln Trp Ser Asn Arg Ser Leu WO 00/18889 ~ PCT/US99/2223I

Arg His Asp Pro Tyr Arg Phe Leu Asp Lys Lys Ser Pro Arg Ser Ser Gln Leu Ala Arg Asp I1e Thr Val Arg Ala Asp Leu Ser Gly A1a Ala Thr Pro Asp Ser Ser Phe Pro Glu Pro Glu Ile Lys Leu Ser Ser Arg Leu Arg Gly Ile Phe Phe Cys Val Val Ala Gly Ile Ser Ala Thr Phe Leu Ile Val Leu Met Ile Ile Gly His Pro Phe Val Leu Leu Phe Asp Pro Tyr Arg Arg Lys Phe His His Phe Ile Ala Lys Leu Trp Ala Ser Ile Ser Ile Tyr Pro Phe Tyr Lys Ile Asn Ile Glu Gly Leu Glu Asn Leu Pro Ser Ser Asp Thr Pro Ala Val Tyr Val Ser Asn His Gln Ser Phe Leu Asp Ile Tyr Thr Leu Leu Ser Leu Gly Lys Ser Phe Lys Phe Ile Ser Lys Thr Gly Ile Phe Va1 Ile Pro Ile I1e Gly Trp Ala Met Ser Met Met GIy Val Val Pro Leu Lys Arg Met Asp Pro Arg Ser Gln Val Asp Cys Leu Lys Arg Cys Met Glu Leu Leu Lys Lys Gly Ala Ser Val Phe Phe Phe Pro Glu Gly Thr Arg Ser Lys Asp Gly Arg Leu Gly Ser Phe Lys Lys Gly Ala Phe Thr Val Ala Ala Lys Thr Gly Val Ala Val Val Pro Ile Thr Leu Met Gly Thr G1y Lys Ile Met Pro Thr Gly Ser Glu Gly Ile Leu Asn His Gly Asn Val Arg Val Ile Ile His Lys Pro Ile His G1y Ser Lys Ala Asp Val Leu Cys Asn Glu Ala Arg Sex Lys Ile Ala G1u Ser Met Asp Leu <210> 5 <211> 1197 <222> DNA
<213> Arabidopsis sp.
<400> 5 atggaatcag agctcaaaga tttgaattcg aattcgaatc ctccgtcgag caaagaggac 60 cggccgttac tgaaatcaga atccgatttg gcggctgcca ttgaagagtt agacaaaaag 220 ttcgcacctt acgcgaggac cgatttgtat gggacgatgg gtttgggtcc tttcccgatg 180 acggagaata ttaaattggc ggttgcattg gtgactcttg ttccattgcg gtttcttctc 240 tcgatgagca tcttgcttct ctattacttg atttgtaggg tatttacgct gttttctgct 300 ccttatcgtg ggccagagga agaggaagat gaaggtggag ttgtttttca ggaagattat 360 gctcacatgg aaggttggaa acggactgtt atcgtccggt ctgggaggtt tctctctagg 420 WO 00/18889 PCT/US99/2223~

gttttgcttt tcgtttttgg gttttattggattcacgagagctgtccaga tcgagattca480 gacatggatt ctaatcctaa aactacttctacagagattaaccagaaagg ggaagccgcc540 acggaggaac ctgaaagacc tggagccattgtgtccaatcatgtttcgta cttggacatt600 ttgtatcata tgtctgcttc ttttccaagttttgttgccaagagatcagt gggcaaactt660 cctcttgttg gcctcattag caaatgccttggttgtgtctatgttcaaag agaagcaaaa720 tcgcctgatt tcaagggtgt atctggcacagtaaatgaaagagttcgaga agctcatagc780 aataaatctg ctccaactat tatgctttttccagaaggaacaactacaaa tggagactac840 ttacttacat tcaagacagg tgcatttttggctggaactccagttcttcc ggtaatatta900 aaatatccgt atgagcgctt cagtgtggcatgggataccatatccggggc acgccacatt960 ttattccttc tctgtcaagt cgtaaatcacttggaagtcatacggttacc tgtatactac ccatcccaag aagagaaaga cgatcccaaactttatgctagcaatgttcg gaaattaatg gccaccgagg gtaacttgat tctatcggagttgggacttagcgacaaaag gatatatcac gcaactctca atggtaatct tagtcaaacccgtgatttccatcagaaaga agaatga <210> 6 <211> 398 <212> PRT

<213> Arabiclopsis sp.

<400> 6 Met Glu Ser Glu Leu Lys Ser Asn Pro Pro Asp Leu Asn Ser Asn Ser Ser Lys Glu Asp Arg Pro Lys Ser Ser Asp Leu Ala Leu Leu Glu Ala Ala Ile Glu Glu Leu Asp Phe Ala Tyr Ala Arg Thr Lys Lys Pro Asp Leu Tyr Gly Thr Met Gly Pro Phe Met Thr Glu Asn Leu G1y Pro Ile Lys Leu Ala Val Ala Leu Leu Val Leu Arg Phe Leu Val Thr Pro Leu Ser Met Ser Ile Leu Leu Tyr Leu Cys Arg Val Phe Leu Tyr Ile Thr Leu Phe Ser Ala Pro Tyr Pro Glu Glu G1u Asp G1u Arg Gly Glu Gly Gly Val Val Phe Gln Glu Ala His Glu Gly Trp Lys Asp Tyr Met Arg Thr Val Ile Val Arg Ser Phe Leu Arg Val Leu Leu Gly Arg Ser Phe Val Phe Gly Phe Tyr Trp Glu Ser Pro Asp Arg Asp Ile His Cys Sex Asp Met Asp Ser Asn Pro fihr Ser Glu Ile Asn Gln Lys Thr Thr Lys Gly Glu A1a Ala Thr Glu Glu Arg Gly Ala Ile Val Glu Pro Pro Ser Asn His Val Ser Tyr Leu Leu Tyr Met Ser Ala Ser Asp Ile His Phe Pro Ser Phe Val Ala Lys Val Gly Leu Pro Leu Val Arg Ser Lys Gly Leu Ile Ser Lys Cys Leu Val Tyr Gln Arg G1u Ala Gly Cys Val Lys Ser Pro Asp Phe Lys Gly Gly Thr Asn Glu Arg Val Val Ser Val Arg WO 00/18889 6 . PCT/US99122231 Glu Ala His Ser Asn Lys Ser Ala Pro Thr Ile Met Leu Phe Pro Glu Gly Thr Thr Thr Asn Gly Asp Tyr Leu Leu Thr Phe Lys Thr Gly Ala Phe Leu Ala Gly Thr Pro Val Leu Pro Val Ile Leu Lys Tyr Pro Tyr Glu Arg Phe Ser Val Ala Trp Asp Thr Ile Ser Gly Ala Arg His Ile Leu Phe Leu Leu Cys Gln Val Va1 Asn His Leu Glu Val Ile Arg Leu Pro Val Tyr Tyr Pro Ser Gln Glu Glu Lys Asp Asp Pro Lys Leu Tyr Ala Ser Asn Va1 Arg Lys Leu Met Ala Thr Glu Gly Asn Leu Ile Leu Ser Glu Leu G1y Leu Ser Asp Lys Arg Ile Tyr His Ala Thr Leu Asn Gly Asn Leu Ser Gln Thr Arg Asp Phe His Gln Lys Glu G1u <210> 7 <211> 1131 <212> DNA
<213> Arabidopsis sp.
<400> 7 atgagcagta cggcagggag gctcgtgact tcaaaatccg agcttgacct cgatcaccct 60 aacatcgaag attaccttcc ttctggttct tccatcaatg aacctcgcgg caagctcagc 120 ctgcgtgatt tgctagacat ctctccaacg ctcactgaag ctgctggtgc cattgttgat 180 gactcgttca caagatgttt caaatcaaat cctccagaac cttggaactg gaatatttac 240 ttattcccac tatactgctt tggggttgtt gttagatact gtatcctctt tcccttgagg 300 tgcttcactt tagcttttgg gtggattatt ttcctttcat tgtttatccc tgtaaatgcg 360 ttgctgaaag gtcaagatag gttgaggaaa aagatagaga gggtcttggt ggaaatgatt 420 tgcagctttt ttgtcgcctc atggaccgga gttgtcaaat atcacgggcc acgtcctagc 480 atccgtccta agcaggtcta tgttgccaac catacttcaa tgattgattt catcgtattg 540 gagcagatga ccgcatttgc tgttataatg cagaagcatc ctggttgggt tggtcttctg 600 caaagcacaa tattagagag tgtgggatgt atctggttca atcgttcaga ggcaaaggat 660 cgtgaaattg tagcaaaaaa gttaagggac catgtccaag gagctgacag taatcctctt 720 ctcatatttc ccgaagggac atgtgtaaat aataattaca cagtgatgtt taagaagggt 780 gcttttgaat tggactgcac tgtttgtcca attgcaatta aatacaacaa gatttttgtt 840 gacgccttct ggaatagcag aaaacaatca tttactatgc acttgctgca actcatgaca 900 tcatgggctg ttgtatgtga agtgtggtac ttggaaccac aaaccataag gcccggtgaa 960 acaggaattg aatttgcaga gagggtcaga gacatgatat ctcttcgggc gggtctcaaa aaggtccctt gggatggata cttgaagtat tcgagaccaa gccccaagca tagtgaacgc aagcaacaga gtttcgcaga gtcgatcctg gctagattgg aagagaagtg a 3.131 <210> 8 <211> 376 <212> PRT
<213> Arabidopsis sp.
<400> 8 Met Ser Ser Thr Ala Gly Arg Leu Val Thr Ser Lys Ser G1u Leu Asp 1 5 1.0 15 Leu Asp His Pro Asn Ile Glu Asp Tyr Leu Pro Ser G1y Ser Ser Ile WO 00/18889 ,~ PCT/US99/Z2231 Asn Glu Pro Arg Gly Lys Leu Ser Leu Arg Asp Leu Leu Asp Ile Ser Pro Thr Leu Thr Glu Ala A1a Gly Ala Ile Val Asp Asp Ser Phe Thr Arg Cys Phe Lys Ser Asn Pro Pro Glu Pro Trp Asn Trp Asn Ile Tyr Leu Phe Pro Leu Tyr Cys Phe Gly Val Val Val Arg Tyr Cys Ile Leu Phe Pro Leu Arg Cys Phe Thr Leu Ala Phe Gly Trp Ile Ile Phe Leu Ser Leu Phe Ile Pro Val Asn Ala Leu Leu Lys Gly Gln Asp Arg Leu Arg Lys Lys Ile Glu Arg Val Leu Val Glu.Met Ile Cys Ser Phe Phe Val Ala Ser Trp Thr Gly Val Val Lys Tyr His Gly Pro Arg Pro Ser Ile Arg Pro Lys Gln Val Tyr Val Ala Asn His Thr Ser Met Ile Asp Phe Ile Val Leu Glu Gln Met Thr Ala Phe Ala Val Ile Met Gln Lys His Pro Gly Trp Val Gly Leu Leu GIn Ser Thr Ile Leu Glu Ser Val Gly Cys Ile Trp Phe Asn Arg Ser Glu Ala Lys Asp Arg Glu Ile Val Ala Lys Lys Leu Arg Asp His Val Gln Gly Ala Asp Ser Asn Pro Leu Leu Ile Phe Pro Glu Gly Thr Cys Val Asn Asn Asn Tyr Thr Val Met Phe Lys Lys Gly Ala Phe Glu Leu Asp Cys Thr Val Cys Pro Ile Ala Ile Lys Tyr Asn Lys Ile Phe Val Asp Ala Phe Trp Asn Ser Arg Lys Gln Ser Phe Thr Met His Leu Leu Gln Leu Met Thr Ser Trp Ala Val Val Cys Glu Val Trp Tyr Leu Glu Pro Gln Thr Ile Arg Pro Gly Glu Thr Gly Ile Glu Phe Ala Glu Arg Val Arg Asp Met Ile Ser Leu Arg Ala Gly Leu Lys Lys Val Pro Trp Asp Gly Tyr Leu Lys Tyr Ser Arg Pro Ser Pro Lys His Ser Glu Arg Lys Gln Gln Ser Phe Ala Glu Sex Ile Leu Ala Arg Leu Glu Glu Lys <210> 9 <211> 965 WO 00/18889 ~ PCT/US99122231 <212> DNA
<213> Arabidopsis sp.
<400> 9 gttgttaagt tacaagtctc ttcaaaaaca cacacacacg tctctcttca cagccaatca 60 tcgatcacag ctcgattttc ctttattgtt ccgttggttt tcttgagnat ttttctttct 120 tgggatcatc aaactngtcg gtaaggwaac ttcacggacg gatcttcaat gttgagctgt 180 tctaatggta ccgtcgtgat cgcaaccgcc atggtttgct caagcaccgc tctgtttctc 240 gccatggctc gtcaattcca tggaaatcat caaaatccta aggttcttga tcagactcta 300 cgacccattc tccgttcttg tctatcttca gaggaaacga agaaacaggg gaagaagata 360 aagaaagtgc ggttcgcgga taatgtgaaa gatacgaaag gtaacgggga agagtaccgg 420 aggagggaat tgaaccggaa aagcgtaccg aagccagtga ctaaaccggg aaagaccggt 480 tctatgtgta gaatctctac catgccagcg aaccggatgg ctctgtacaa tgggattctt 540 agagaccgag atcacagagt tcaatattct tattgacttt ttcttcttga ttagtcaata 600 gatttaggtt ttgtaaatct ttcttttgtt tttcggtaat attagatttt ttcttggaaa 660 tttcagatat tgtagacttt gtagttgggt ggtcttcttt ttctcccttt ttgtgtctca 720 tagtagtagg tggttttctt atgctccact tatctactta cttgttttaa atcaagtgat 780 gatgtaaata attgacatgt aagtagtcat tagaaatttg aaaaggcaaa tgaaagaata 840 taaatttgta aaaacatagt gtgcctattg tacatataaa ctctcttttg ttggggatat 900 ctatggaatt tatattgatt gtgttgaaaa aacaaaaaaa aaaaaaaaaa aaaaaaaaaa 960 aaaaa 965 <210> 10 <211> 1593 <212> DNA
<213> Arabidopsis sp.
<400> 10 atgtccggta ataagatctc gactcttcaa gctcttgtct tcttcttgta ccggtttttc 60 attctccgtc gttggtgtca tcgtagccct aaacaaaaat accaaaaatg cccttctcac 120 ggcctccacc aatatcaaga cctatcgaat cacactttga tattcaacgt cgaaggagct 180 ctactcaaat caaactcttt attcccttac ttcatggttg tggcattcga agccggaggg 240 gtgataaggt cacttttcct cttagttctt tatccattta taagcttgat gagctacgaa 300 atgggcttga agacgatggt gatgctgagc ttctttggag ttaaaaagga aagcttccga 360 gtggggaaat cagttttgcc taagtatttt ctagaagatg ttgggctcga gatgttccag 420 gttttgaaaa gaggaggcaa gagagttgct gtgagtgatt taccacaagt tatgattgat 480 gtattcttgc gagattactt,ggagatagaa gttgtggtcg gaagagacat gaaaatggtc 540 ggtggttact acctaggcat cgtggaggat aagaagaacc ttgaaattgc ttttgataaa 600 gtggttcaag aagaaagact tggtagtggt cgtcgtctta ttggcatcac ttcctttaac 660 tcgccaagtc acagatctct cttctctcaa ttttgccagg aaatttactt cgtcagaaat 720 tcagacaaga aaagttggca aaccctacca caagatcaat accctaaacc attgattttc 780 cacgatggtc gtttagccgt taagccaaca cctttaaaca cactcgtatt attcatgtgg 840 gccccattcg ccgccgtctt agccgctgca agactcgtct tcggcctaaa cttaccttac 900 tccctagcca atcccttcct cgccttttcc ggtatccacc ttactctcac cgtcaacaac 960 cacaacgacc taatatccgc cgacagaaaa agaggttgtc tctttgtgtg taaccataga acgttattgg acccacttta catttcatac gctctaagaa agaaaaacat gaaagccgtg acgtatagtc taagcagatt atctgagctt ctggctccga tcaagaccgt tagattgact cgtgatcgag tcaaagatgg tcaagccatg gagaaattgc tgagccaggg agatctcgtg gtttgtccgg aagggactac gtgtagagag ccttacttgc ttcggtttag tccacttttc tctgaggttt gtgacgtcat cgtacctgtt gctattgact cacacgtgac tttcttctat ggcacgacgg ctagtggtct taaggcattt gatcccattt tcttcctttt gaatcctttc ccttcctaca ccgtcaaatt gcttgaccct gtctctggaa gtagctcgtc cacgtgtcga ggagtccctg acaatggaaa agttaacttc gaggtggcta atcacgtgca gcatgagatc gggaatgcct tggggtttga gtgcaccaac ctcacgagaa gagataagta cttgatcttg gccggtaata acggagttgt caagaaaaaa taa <210> 11 <211> 530 <212> PRT

WO 00/18889 . PCT/US99/22231 <213> Arabidopsis sp.
<400> 11 Met Ser Gly Asn Lys Ile Ser Thr Leu Gln Ala Leu Val Phe Phe Leu Tyr Arg Phe Phe Ile Leu Arg Arg Trp Cys His Arg Ser Pro Lys Gln Lys Tyr Gln Lys Cys Pro Ser His Gly Leu His Gln Tyr Gln Asp Leu Ser Asn His Thr Leu Ile Phe Asn Val Glu Gly Ala Leu Leu Lys Ser Asn Ser Leu Phe Pro Tyr Phe Met Val Val Ala Phe Glu Ala Gly Gly Val Ile Arg Ser Leu Phe Leu Leu Val Leu Tyr Pro Phe Ile Ser Leu Met Ser Tyr Glu Met Gly Leu Lys Thr Met Val Met Leu Ser Phe Phe Gly Val Lys Lys Glu Ser Phe Arg Val Gly Lys Ser Val Leu Pro Lys Tyr Phe Leu Glu Asp Val Gly Leu Glu Met Phe Gln Val Leu Lys Arg Gly Gly Lys Arg Val Aia Val Ser Asp Leu Pro Gln Val Met Ile Asp Val Phe Leu Arg Asp Tyr Leu Glu Ile Glu Val Val Val Gly Arg Asp Met Lys Met Val Gly Gly Tyr Tyr Leu Gly Tle Val Glu Asp Lys Lys Asn Leu Glu Ile Ala Phe Asp Lys Val Val Gln Glu Glu Arg Leu Gly Ser Gly Arg Arg Leu Ile Gly Ile Thr Ser Phe Asn Sex Pro Ser His Arg Ser Leu Phe Ser Gln Phe Cys Gln Glu Ile Tyr Phe Va1 Arg Asn Ser Asp Lys Lys Ser Trp Gln Thr Leu Pro Gln Asp Gln Tyr Pro Lys Pro Leu Ile Phe His Asp Gly Arg Leu Ala Va1 Lys Pro Thr Pro Leu Asn Thr Leu Val Leu Phe Met Trp Ala Pro Phe Ala Ala Val Leu Ala Ala Ala Arg Leu Val Phe Gly Leu Asn Leu Pro Tyr Ser Leu Ala Asn Pro Phe Leu Ala Phe Ser Gly Ile His Leu Thr Leu Thr Val Asn Asn His Asn Asp Leu Ile Ser Ala Asp Arg Lys Arg Gly Cys Leu Phe Val Cys Asn His Arg Thr Leu Leu Asp Pro Leu Tyr Ile Ser Tyr Ala Leu Arg Lys Lys Asn Met Lys Ala Val Thr Tyr Ser Leu Ser Arg Leu Sex WO 00/18889 . PCTIUS99/22231 Glu Leu Leu Ala Pro I1e Lys Thr Val Arg Leu Thr Arg Asp Arg Val Lys Asp Gly Gln Ala Met Glu Lys Leu Leu Ser Gln Gly Asp Leu Val Val Cys Pro Glu Gly Thr Thr Cys Arg Glu Pro Tyr Leu Leu Arg Phe Ser Pro Leu Phe Ser Glu Val Cys Asp Va1 Ile Val Pro Val Ala Ile Asp Ser His Val Thr Phe Phe Tyr Gly Thr Thr Ala Ser Gly Leu Lys Ala Phe Asp Pro Ile Phe Phe Leu Leu Asn Pro Phe Pro Ser Tyr Thr Val Lys Leu Leu Asp Pro Val Ser Gly Ser Ser Ser Ser Thr Cys Arg Gly Val Pro Asp Asn Gly Lys Val Asn Phe Glu Val Ala Asn His Val Gln His Glu Ile Gly Asn Ala Leu Gly Phe Glu Cys Thr Asn Leu Thr Arg Arg Asp Lys Tyr Leu Ile Leu Ala Gly Asn Asn Gly Val Val Lys Lys Lys <210> 12 <211> 1509 <212> DNA
<213> Arabidopsis sp.
<400> 12 atggttatgg agcaagctgg aacgacatcg tattcggtcg tgtcagagtt tgaaggaaca 60 atactgaaga acgcagattc attctcttac ttcatgctcg tagccttcga agcagctggt 120 ctaattcgtt tcgctatctt gttgtttcta tggcccgtaa tcacactcct tgacgttttc 180 agctacaaaa acgcagctct caagctcaag atttttgtag ccactgttgg tctacgtgaa 240 ccggagatcg aatcagtggc tagagccgtt ctgccaaaat tctacatgga cgacgtaagc 300 atggacacgt ggagggtttt cagctcgtgt aagaagaggg tcgtggtcac gagaatgcct 360 cgagttatgg tggagaggtt tgctaaggag catcttagag cagatgaggt catcggtacg 420 gaactgattg taaaccggtt cggttttgtc accggtttga ttcgcgaaac ggatgttgat 480 cagtctgctt tgaaccgtgt cgctaatttg tttgttggtc ggaggcctca actaggtctt 540 ggaaaaccgg ctttgaccgc ctctacaaat ttcttatcgt tatgtgagga gcatattcat 600 gcaccaatcc cggagaacta caaccacggt gaccaacaac ttcagctacg tccacttccg 660 gtgatatttc acgacggaag actagtgaag cggccaacgc cggccaccgc tctcatcatc 720 ctcctttgga tcccatttgg aatcattctc gccgtgatcc ggatctttct tggagccgtc 780 ctcccattgt gggccacacc ttacgtctct cagatattcg gtggccatat catcgtcaaa 840 ggaaagcctc ctcagccacc ggcggctgga aaatccggcg tgctctttgt gtgtactcac 900 agaaccctaa tggaccctgt ggtattatct tatgtcctcg gacgtagcat cccagccgtt 960 acttactcaa tctcgcgctt atcagagatc ttatctccca ttccaaccgt ccgattgaca agaatccgag atgtggatgc ggctaagatc aaacaacaac tgtcaaaagg agatctagtg gtttgtcctg agggaaccac ttgtcgtgaa ccgtttttgt taagattcag cgcgcttttc gctgagttaa cggataggat tgttccggtt gcgatgaact acagagtcgg attcttccac gcgactacag cgagaggctg gaagggtttg gacccaattt tcttcttcat gaacccaaga ccggtttacg agattacgtt cttgaaccag cttcctatgg aggcaacatg ttcgtccggg aagagcccgc atgacgtggc gaactatgtt cagagaatct tggcggctac gttagggttt gagtgcacca acttcacaag aaaagataag tatagggttc tcgctggaaa cgatggaaca gtgtcgtact tgtcgttgct agaccaattg aagaaggtgg ttagcacttt cgagccttgt ctccattga <220> 13 <211> 502 <212> PRT
<213> Arabidopsis sp.
<400> 23 Met Val Met Glu Gln A1a Gly Thr Thr Ser Tyr Ser Val Val Ser Glu Phe Glu Gly Thr Ile Leu Lys Asn Ala Asp Ser Phe Ser Tyr Phe Met Leu Val Ala Phe Glu Ala Ala Gly Leu Ile Arg Phe Ala Ile Leu Leu Phe Leu Trp Pro Val Ile Thr Leu Leu Asp Val Phe Ser Tyr Lys Asn Ala Ala Leu Lys Leu Lys Ile Phe Val Ala Thr Val Gly Leu Arg Glu Pro Glu Ile Glu Ser Val A1a Arg Al.a Val Leu Pro Lys Phe Tyr Met Asp Asp Val Ser Met Asp Thr Trp Arg Val Phe Ser Ser Cys Lys Lys Arg Val Val Val Thr Arg Met Pro Arg Val Met Val Glu Arg Phe Ala Lys Glu His Leu Arg Ala Asp Glu Val Ile Gly Thr Glu Leu Ile Val Asn Arg Phe Gly Phe Val Thr Gly Leu Ile Arg Glu Thr Asp Val Asp Gln Ser Ala Leu Asn Arg Val Ala Asn Leu Phe Val Gly Arg Arg Pro Gln Leu Giy Leu Gly Lys Pro Ala Leu Thr Ala Ser Thr Asn Phe Leu Ser Leu Cys Glu Glu His Ile His Ala Pro Ile Pro Glu Asn Tyr Asn His Gly Asp Gln Gln Leu Gln Leu Arg Pro Leu Pro Val Ile Phe His Asp Gly Arg Leu Val Lys Arg Pro Thr Pro Ala Thr Ala Leu Ile Ile Leu Leu Txp Ile Pro Phe Gly Ile Ile Leu Ala Val Ile Arg Ile Phe Leu Gly Ala Val Leu Pro Leu Trp Ala Thr Pro Tyr Val Ser Gln Ile Phe Gly Gly His Ile Ile Val Lys Gly Lys Pro Pro Gln Pro Pro Ala Ala Gly Lys Ser Gly Val Leu Phe Val Cys Thr His Arg Thr Leu Met Asp Pro Val Val Leu Ser Tyr Va7: Leu Gly Arg Ser Ile Pro Ala Val Thr Tyr Ser Ile Ser Arg Leu Ser Glu I1e Leu Ser Pro Ile Pro Thr Va1 Arg Leu Thr Arg Ile Arg Asp Val Asp Ala Ala Lys Ile Lys Gln Gln Leu Ser Lys Gly Asp Leu Val Val Cys Pro Glu Gly Thr Thr Cys Arg Glu Pro Phe Leu Leu Arg Phe Ser Ala Leu Phe Ala Glu Leu Thr Asp Arg Ile Val Pro Val Ala Met Asn Tyr Arg Val Gly Phe Phe His Ala Thr Thr Ala Arg Gly Trp Lys Gly Leu Asp Pro Ile Phe Phe Phe Met Asn Pro Arg Pro Val Tyr Glu Tle Thr Phe Leu Asn Gln Leu Pro Met Glu Ala Thr Cys Ser Ser Gly Lys Ser Pro His Asp Val Ala Asn Tyr Val Gln Arg Ile Leu Ala Ala Thr Leu Gly Phe Glu Cys Thr Asn Phe Thr Arg Lys Asp Lys Tyr Arg Val Leu Ala Gly Asn Asp Gly Thr Val Ser Tyr Leu Ser Leu Leu Asp Gln Leu Lys Lys Val Val Ser Thr Phe Glu Pro Cys Leu His <210> 14 <211> 1563 <212> DNA
<213> Arabidopsis sp.
<400> 14 atgtccgcca agatttcaat attccaagct cttgtctttc tattctaccg gtttatcctc 60 cggcgatatc ggaactctaa accaaaatac caaaatggcc cttcttctct cctccaatcc 120 gacctatcac gccacacatt gatcttcaac gtagaaggag ctcttctcaa atccgactct 180 ctcttccctt acttcatgtt agtagcattt gaggcgggag gcgtaataag gtcatttctc 240 ctcttcattc tctatccatt gataagcttg atgagccatg agatgggtgt caaagtgatg 300 gtaatggtga gcttcttcgg gatcaaaaaa gaaggttttc gagcggggag agcggttttg 360 cctaaatact ttctagaaga tgtcggactc gagatcttcg aagtgttgaa gagaggaggg 420 aagaaaatcg gagtgagtga tgatcttcct caagttatga tcgaagggtt cttgagagat 480 tacttggaga ttgacgttgt ggtcgggaga gaaatgaaag tcgttggagg ttattatcta 540 ggtatcatgg aggataaaac caaacatgat cttgtctttg atgagttagt tcgtaaagag 600 agactaaaca ccggtcgtgt tattggcatc acttccttca atacatctct tcaccgatat 660 ctattctctc agttttgcca ggaaatttat ttcgtgaaga aatcagacaa gcgaagctgg 720 caaaccctac cacgaagcca gtaccctaaa ccattgattt tccatgatgg ccgtctcgcg 780 atcaaaccaa ccctaatgaa cactttggtc ttgttcatgt ggggtccttt cgcagccgca 840 gccgcagcag ccagactctt cgtctctctt tgcatccctt actctttatc aatcccgatc 900 ctcgcctttt ccggttgcag actaaccgtc actaacgact acgtttcatc tcaaaaacaa 960 aaaccaagtc aacgcaaagg ttgtctcttt gtatgtaacc ataggacttt attggaccct ctctatgttg cattcgcttt gagaaagaaa aacatcaaaa ctgtaacgta tagtttgagt agggtatctg agattttggc tccgatcaag acggtgagac tgacccgtga tcgggtgagc gacggtcaag ccatggagaa attgttaacc gaaggagatc tcgttgtttg tcctgaagga accacttgta gagaacctta cctgcttagg tttagccctt tgttcaccga ggttagtgat gtcatcgttc ccgtggctgt gacggtacac gtgaccttct tctacggtac aacggcgagt ggtcttaagg cacttgaccc gcttttcttc ctcttggatc cttatcctac ctacaccatc caatttctcg accctgtctc cggtgccacg tgccaagatc ctgatggaaa gttgaagttt gaggtggcca acaatgttca gagtgatatt gggaaggcgc tggatttcga gtgcacaagt ctcactagaa aagacaagta tttgatcttg gccggtaata atggagtagt taagaaaaat taa <210> 15 <211> 520 <212> PRT
<213> Arabidopsis sp.
<400> 15 Met Ser Ala Lys Ile Ser Ile Phe Gln Ala Leu Val Phe Leu Phe Tyr Arg Phe I1e Leu Arg Arg Tyr Arg Asn Ser Lys Pro Lys Tyr Gln Asn Gly Pro Ser Ser Leu Leu Gln Ser Asp Leu Ser Arg His Thr Leu Ile Phe Asn Val Glu Gly Ala Leu Leu Lys Ser Asp Ser Leu Phe Pro Tyr Phe Met Leu Va1 Ala Phe Glu Ala Gly Gly Val Ile Arg Ser Phe Leu Leu Phe Ile Leu Tyr Pro Leu Ile Ser Leu Met Ser His Glu Met Gly Val Lys Val Met Val Met Val Ser Phe Phe Gly Ile Lys Lys Glu Gly Phe Arg Ala Gly Arg Ala Val Leu Pro Lys Tyr Phe Leu Glu Asp Val Gly Leu Glu Ile Phe Glu Val Leu Lys Arg Gly Gly Lys Lys Ile Gly Val Ser Asp Asp Leu Pro Gln Va1 Met Ile Glu Gly Phe Leu Arg Asp Tyr Leu Glu Ile Asp Val Val Val Gly Arg Glu Met Lys Val Val Giy Gly Tyr Tyr Leu Gly Ile Met Glu Asp Lys Thr Lys His Asp Leu Val Phe Asp Glu Leu Val Arg Lys Glu Arg Leu Asn Thr Gly Arg Val Ile Gly Ile Thr Ser Phe Asn Thr Ser Leu His Arg Tyr Leu Phe Ser Gln Phe Cys Gln Glu Ile Tyr Phe Val Lys Lys Ser Asp Lys Arg Ser Trp Gln Thr Leu Pro Arg Ser Gln Tyr Pro Lys Pro Leu Ile Phe His Asp 245 ''S0 255 WO 00/18889 . PCT/US99/22231 Gly Arg Leu Ala Tle Lys Pro Thr Leu Met Asn Thr Leu Val Leu Phe Met Trp Gly Pro Phe Ala Ala Ala Ala Ala Ala Ala Arg Leu Phe Val Ser Leu Cys Ile Pro Tyr Ser Leu Ser Ile Pro Ile Leu Ala Phe Ser Gly Cys Arg Leu Thr Val Thr Asn Asp Tyr Val Ser Sex Gln Lys Gln Lys Pro Ser Gln Arg Lys Gly Cys Leu Phe Val Cys Asn His Arg Thr Leu Leu Asp Pro Leu Tyr Val Aia Phe A1a Leu Arg Lys Lys Asn Ile Lys Thr Val Thr Tyr Ser Leu Ser Arg Val Ser Glu Ile Leu Ala Pro Ile Lys Thr Val Arg Leu Thr Arg Asp Arg Val Ser Asp Gly Gln Ala Met Glu Lys Leu Leu Thr Glu Gly Asp Leu Val Val Cys Pro Glu Gly Thr Thr Cys Arg Glu Pro Tyr Leu Leu Arg Phe Ser Pro Leu Phe Thr Glu Val Ser Asp Val Ile Val Pro Val Ala Val Thr Val His Val Thr 420 425 4'30 Phe Phe-Tyr Gly Thr Thr Ala Ser Gly Leu Lys Ala Leu Asp Pro Leu Phe Phe Leu Leu Asp Pro Tyr Pro Thr Tyr Thr Ile Gln Phe Leu Asp Pro Val Ser Gly Ala Thr Cys G1n Asp Pro Asp Gly Lys Leu Lys Phe Glu Val Ala Asn Asn Val Gln Ser Asp Ile Gly Lys Ala Leu Asp Phe Glu Cys Thr Ser Leu Thr Arg Lys Asp Lys Tyr Leu Tle Leu Ala Gly Asn Asn Gly Val Val Lys Lys Asn <210> 16 <211> 1506 <212> DNA
<213> Arabidopsis sp.
<400> 16 atgggagctc aggagaaacg gcgccgtttc gagcagatat caaagtgcga tgttaaggac 60 cggtccaacc ataccgtggc cgctgatcta gacggaacac tactaatctc tcgtagcgcc 120 ttcccttact atttcctcgt agccctcgag gcagggagct tgctccgagc gttgatccta 180 cttgtgtccg taccattcgt ttatcttacg tacttgacca tctccgagac tttagccatc 240 aacgtatttg tcttcatcac gttcgcgggt ctcaagatcc gagacgttga gctagtggtc 300 cgttccgtcc tcccgaggtt ctatgcggag gacgtgaggc ccgatacctg gcgtatcttc 360 aacacgttcg ggaaacggta cataataact gcgagccctc gaattatggt cgagccattc 420 gtgaaaacat tcctaggagt tgataaagtt cttggaacag agctagaggt ctccaaatcg 480 ggtcgggcaa ccgggttcac cagaaaacca ggtattctcg tcggtcagta caaacgtgac 540 gtcgttttga gagagtttgg tggcctagcg tctgatttac ctgatttggg gctcggcgat 600 agcaagacgg accacgactt catgtccatc tgcaaggaag gttacatggt gccacgtacg 660 aaatgcgaaccattaccaagaaacaaactcttaagccccataatattccacgagggcaga720 ttagtccaacgcccaacgccgttagttgctctgttaactttcctctggcttcccgtcggt780 ttcgtcctctctatcatccgcgtctacacgaatattccgttaccggaacgtatcgcccgt840 tacaactacaagcttactggcatcaagctagtcgtcaacggccaccctcctccgccgcca900 aaacctggccagccaggccatcttttggtctgcaaccaccgcaccgttctcgatcctgtg96p gtcacagctgtcgcactcggccggaaaatcagctgcgtcacttacagcatcagcaagttc tctgagctaatctcaccaatcaaagccgttgcgttgactcgtcaacgtgagaaagacgca gcgaacatcaagcgtcttttggaggaaggcgatctcgtgatatgtcccgagggaaccacg tgccgtgagcctttccttctccggtttagtgctcttttcgctgagctcacggaccggatc gttcccgtggcgatcaacacaaagcagagcatgttcaatggtaccaccacacgtggatac aagcttcttgatccttactttgcgttcatgaacccgaggccgacgtatgagatcacgttc ctcaaacagattccagctgagctgacgtgtaaaggaggcaaatctccgatagaggttgcg aattacatacagagggttttgggaggaaccttaggttttgagtgcaccaatttcacaaga aaggataagtacgcaatgcttgctggtactgacggtagggttccggtgaagaaggagaag acgtga <210> 17 <211> 500 <212> PRT
<213> Arabidopsis sp.
<400> 17 Met Gly Ala Gln Glu Lys Arg Arg Arg Phe Glu G1n Ile Ser Lys Cys Asp Val Lys Asp Arg Ser Asn His Thr Val Ala Ala Asp Leu Asp G1y Thr Leu Leu Ile Ser Arg Ser Ala Phe Pro Tyr Tyr Phe Leu Val Ala Leu Glu Ala Gly Ser Leu Leu Arg Ala Leu Ile Leu Leu Val Ser Val Pro Phe Val Tyr Leu Thr Tyr Leu Thr Ile Ser Glu Thr Leu Ala Ile Asn Val Phe Val Phe Ile Thr Phe Ala G1y Leu Lys Ile Arg Asp Val Glu Leu Val Val Arg Ser Val Leu Pro Arg Phe Tyr A1a Glu Asp Val Arg Pro Asp Thr Trp Arg Ile Phe Asn Thr Phe Gly Lys Arg Tyr Ile Ile Thr Ala Ser Pro Arg Ile Met Val Glu Pro Phe Val Lys Thr Phe Leu Gly Val Asp Lys Val Leu GIy Thr Glu Leu Glu Val Ser Lys Ser Gly Arg Aia Thr Gly Phe Thr Arg Lys Pro Gly Ile Leu Val Gly Gln Tyr Lys Arg Asp Val Val Leu Arg Glu Phe Gly Gly Leu Ala Ser Asp Leu Pro Asp Leu Gly Leu Gly Asp Ser Lys Thr Asp His Asp Phe Met Ser Ile Cys Lys Glu Gly Tyr Met Val Pro Arg Thr Lys Cys Gl.u Pro Leu Pro Arg Asn Lys Leu Leu Ser Pro 21e Ile Phe His Glu Gly Arg Leu Val Gln Arg Pro Thr Pro Leu Val Ala Leu Leu Thr Phe Leu Trp Leu Pro Val Gly Phe Val Leu Ser Ile Ile Arg Val Tyr Thr Asn Ile Pro Leu Pro Glu Arg Ile Ala Arg Tyr Asn Tyr Lys Leu Thr Gly Ile Lys Leu Val Val Asn Gly His Pro Pro Pro Pro Pro Lys Pro Gly Gln Pro Gly His Leu Leu Val Cys Asn His Arg Thr Val Leu Asp Pro Val Val Thr Ala Val Ala Leu Gly Arg Lys Ile Ser Cys Val Thr Tyr Ser Ile Ser Lys Phe Ser Glu Leu Ile Ser Pro Ile Lys Ala Val Ala Leu Thr Arg Gln Arg Glu Lys Asp Ala Ala Asn Ile Lys Arg Leu Leu Glu Glu Gly Asp Leu Val Ile Cys Pro Glu G1y Thr Thr Cys Arg Glu Pro Phe Leu Leu Arg Phe Ser Ala Leu Phe Ala Glu Leu Thr Asp Arg Ile Val Pro Val Ala Ile Asn Thr Lys Gln Ser Met Phe Asn Gly Thr Thr Thr Arg Gly Tyr Lys Leu Leu Asp Pro Tyr Phe Ala Phe Met Asn Pro Arg Pro Thr Tyr Glu Ile Thr Phe Leu Lys G1n Ile Pro Ala Glu Leu Thr Cys Lys Gly Gly Lys Ser Pro Ile Glu Val Ala Asn Tyr Ile Gln Arg Val Leu Gly Gly Thr Leu Gly,Phe Glu Cys Thr Asn Phe Thr Arg 465 470' 475 480 Lys Asp Lys Tyr Ala Met Leu Ala Gly Thr Asp Gly Arg Val Pro Val Lys Lys Glu Lys <210> 18 <211> 1620 <212> DNA
<213> Arabidopsis sp.
<400> 18 atggcggatc ctgatctgtc ttctcctttg atccaccatc aatcctccga tcaacctgaa 60 gttgttatct ctatcgccga cgacgacgac gacgagtcag gactcaatct tcttccagcc 120 gttgttgacc ctcgtgtttc acgaggtttt gagtttgacc atcttaatcc ttatggcttt 180 ctcagcgagt cagagcctcc ggttctcggt ccgacgacgg tggatccatt ccggaacaat 240 acacctggag ttagcggatt gtacgaagcg attaagctcg tgatttgtct tccgattgct 300 WO 00/18889 . PCT/US99/22231 ctgattagacttgttctctttgctgctagcttagctgttggttacttggctacaaaattg360 gcacttgctggctggaaagataaagagaaccctatgcctctttggagatgcagaatcatg420 tggattactcggatctgtaccagatgtatcctcttctcttttggctatcagtggataaga480 aggaaagggaaacctgctcggagagagattgctccgattgttgtatcaaatcatgtttct540 tatattgaaccaatcttctacttctatgaattatcaccgaccattgttgcatcggagtca600 catgattcacttccatttgttggaactattatcagggcaatgcaggtgatatatgtgaat660 agattctcacagacatcaaggaagaatgctgtgcatgaaataaagagaaaagcttcctgc720 gatagatttcctcgtctgctgttattccccgaaggaaccacgactaatgggaaagttctt780 atttccttccaactcggtgctttcatccctggttaccctattcaacctgtagtagtccgg840 tatccccatgtacattttgatcaatcctggggaaatatctctttgttgacgctcatgttt900 agaatgttcactcagtttcacaatttcatggaggttgaatatcttcctgtaatctatccc960 agtgaaaagcaaaagcagaatgctgtgcgtctctcacagaagactagtcatgcaattgca acatctttgaatgtcgtccaaacatcccattcttttgcggacttgatgctactcaacaaa gcaactgagttaaagctggagaacccctcaaattacatggttgaaatggcaagagttgag tcgctattccatgtaagcagcttagaggcaacgcgatttttggatacatttgtttccatg attccggactcgagtggacgtgttaggctacatgactttcttcggggtcttaaactgaaa ccttgccctctttctaaaaggatatttgagttcatcgatgtggagaaggtcggatcaatc actttcaaacagttcttgtttgcctcgggccacgtgttgacacagccgctttttaagcaa acatgcgagctagccttttcccattgcgatgcagatggagatggctatattacaattcaa gaactcggagaagctctcaaaaacacaatcccaaacttgaacaaggacgagattcgagga atgtaccatttgctagacgacgaccaagatcaaagaatcagccaaaatgacttgttgtcc tgcttaagaagaaaccctcttctcatagccatctttgcacctgacttggccccaacataa <210> 19 <211> 539 <212> PRT
<213> Arabidopsis sp.
<400> 19 Met Ala Asp Pro Asp Leu Ser Ser Pro Leu Ile His His Gln Ser Ser Asp Gln Pro Glu Val Val Ile Ser Ile Ala Asp Asp Asp Asp Asp Glu Ser Gly Leu Asn Leu Leu Pro Ala Val Val Asp Pro Arg Val Ser Arg Gly Phe Glu Phe Asp His Leu Asn Pro Tyr Gly Phe Leu Ser Glu Ser Glu Pro Pro Va1 Leu Gly Pro Thr Thr Val Asp Pro Phe Arg Asn Asn Thr Pro Gly Val Ser Gly Leu Tyr G1u Ala Ile Lys Leu Val Ile Cys Leu Pro Ile Ala Leu Ile Arg Leu Val Leu Phe Ala Ala Ser Leu Ala Val Gly Tyr Leu Ala Thr Lys Leu Ala Leu Ala Gly Trp Lys Asp Lys Glu Asn Pro Met Pro Leu Trp Arg Cys Arg Ile Met Trp Ile Thr Arg Ile Cys Thr Arg Cys Ile Leu Phe Ser Phe Gly Tyr Gln Trp IIe Arg WO UO/I8889 1 g PCT/US9912223I
Arg Lys Gly Lys Pro Ala Arg Arg Glu I1e Ala Pro Ile Val Val Ser Asn His Val Ser Tyr Ile Glu Pro Ile Phe Tyr Phe Tyr Glu Leu Ser Pro Thr Iie Val Ala Ser Glu Ser His Asp Ser Leu Pro Phe Val Gly Thr Ile Ile Arg Ala Met Gln Val Ile Tyr Val Asn Arg Phe Sex Gln Thr Ser Arg Lys Asn Ala Val His Glu Ile Lys Arg Lys Ala Ser Cys Asp Arg Phe Pro Arg Leu Leu Leu Phe Pro Glu G1y Thr Thr Thr Asn Gly Lys Val Leu Ile Ser Phe Gln Leu Gly Ala Phe Ile Pro Gly Tyr Pro Ile Gln Pro Val Val Val Arg Tyr Pro His Val His Phe Asp Gln Ser firp Gly Asn Ile Ser Leu Leu Thr Leu Met Phe Arg Met Phe Thr Gln Phe His Asn Phe Met Glu Val G1u Tyr Leu Pro Val Ile Tyr Pro Ser Glu Lys Gln Lys Gln Asn Ala Val Arg Leu Ser Gln Lys Thr Ser His Ala Ile Ala Thr Ser Leu Asn VaI Val Gln Thr Ser His Ser Phe Ala Asp Leu Met Leu Leu Asn Lys Ala Thr Glu Leu Lys Leu Glu Asn Pro Ser Asn Tyr Met Val Glu Met Ala Arg Val Glu Ser Leu Phe His Val Ser Ser Leu Glu Ala Thr Arg Phe Leu Asp Thr Phe Val Ser Met Ile Pro Asp Ser Ser Gly Arg Val Arg Leu His Asp Phe Leu Arg Gly Leu Lys Leu Lys Pro Cys Pro Leu Ser Lys Arg Ile Phe Glu Phe Ile Asp Val Glu Lys Val Gly Ser Ile Thr Phe Lys Gln Phe Leu Phe Ala Ser Gly His Val Leu Thr Gln Pro Leu Phe Lys Gln Thr Cys Glu Leu Ala Phe Ser His Cys Asp Ala Asp Gly Asp Gly Tyr Ile Thr Ile Gln Glu Leu Gly Glu Ala Leu Lys Asn Thr Ile Pro Asn Leu Asn Lys Asp Glu Ile Arg Gly Met Tyr His Leu Leu Asp Asp Asp Gln Asp Gln Arg Ile Ser Gln Asn Asp Leu Leu Ser Cys Leu Arg Arg Asn Pro Leu Leu Ile Ala Ile Phe Ala Pro Asp Leu A1a Pro Thr <210> 20 <211> 1128 <212> DNA
<213> Arabidopsis sp.
<400> 20 atggaaaaaa agagtgtacc aaattctgat aagttgtctc tgattagagt gttaagaggt 60 ataatatgtc tgatggtgtt agtttcaaca gcttttatga tgttgatatt ctgggggttc 120 ttatcagctg tagtgttgag gcttttcagc attcgctata gccgtaaatg tgtttccttc 180 ttctttggct cgtggctcgc cttgtggcct ttcctctttg agaagattaa caaaaccaaa 240 gttatcttct ctggtgataa ggttccttgc gaggatcgag tattgctcat tgcaaaccac 300 cgaacagaag ttgattggat gtacttctgg gatcttgcac tgcgtaaagg ccagattggg 360 aatatcaaat atgtgcttaa gagtagtttg atgaaattac ctctctttgg ttgggcgttt 420 cacctctttg agtttattcc tgttgagagg agatgggaag tcgatgaagc aaacttgaga 480 cagatagttt cgagttttaa ggatccccga gacgctttat ggcttgctct tttccccgag 540 ggcacagatt acacagaggc taaatgccaa aggagtaaga aatttgctgc tgaaaatggc 600 cttccgatac tgaacaacgt gctgcttccc aggacaaaag gtttcgtctc ctgcttgcaa 660 gaactgagtt gctcacttga cgcagtttat gatgtgacca tcggttataa aacccgctgc 720 ccatctttct tagacaacgt ttatggaatt gagccatcag aagttcacat ccacatccgt 780 cgtatcaacc tgacccaaat cccaaatcaa gaaaaggaca tcaatgcttg gttaatgaac 840 acattccagc tcaaagacca gctgctcaat gacttttact ccaatggtca tttccctaac 900 gaaggaacag agaaagagtt caacacaaag aagtacctca taaactgttt ggcagtgatt 960 gccttcacca ccatctgtac acatctcacc ttcttctcat caatgatttg gttcaggatt tatgtctctt tggcctgtgt ctacttgacc tctgctacgc atttcaatct tcgttctgtt ccacttgttg agactgcaaa aaattccctc aaattagtaa acaaataa <210> 21 <211> 375 <212> PRT
<213> Arabidopsis sp.
<400> 22 Met Glu Lys Lys Ser Val Pro Asn Ser Asp Lys Leu Ser Leu Ile Arg Val Leu Arg Gly Ile Ile Cys Leu Met Val Leu Val Ser Thr Ala Phe Met Met Leu Ile Phe Trp Gly Phe Leu Ser Ala Val Val Leu Arg Leu Phe Ser Ile Arg Tyr Ser Arg Lys Cys Val Ser Phe Phe Phe Gly Ser Trp Leu Ala Leu Trp Pro Phe Leu Phe Glu Lys Ile Asn Lys Thr Lys Val Ile Phe Ser Gly Asp Lys Val Pro Cys Glu Asp Arg Val Leu Leu Ile Ala Asn His Arg Thr Glu Val Asp Trp Met Tyr Phe Trp Asp Leu Ala Leu Arg Lys Gly Gln I1e G1y Asn Ile Lys Tyr Val Leu Lys Ser Ser Leu Met Lys Leu Pro Leu Phe Gly Trp Ala Phe His Leu Phe Glu Phe I1e Pro Val Glu Arg Arg Trp Glu Val Asp Glu Ala Asn Leu Arg Gln Ile Val Ser Ser Phe Lys Asp Pro Arg Asp Ala Leu Trp Leu Ala WO 00!18889 Za . PCTIUS99/22231 Leu Phe Pro Glu G1y Thr Asp Tyr Thr Glu Ala Lys Cys Gln Arg Sex Lys Lys Phe AIa A1a Glu Asn Gly Leu Pro Ile Leu Asn Asn Val Leu Leu Pro Arg Thr Lys Gly Phe Val Ser Cys Leu G1n Glu Leu Ser Cys Ser Leu Asp Ala Val Tyr Asp Val Thr Ile Gly Tyr Lys Thr Arg Cys Pro Ser Phe Leu Asp Asn Val Tyr Gly Ile GIu Pro Ser Glu Val His Ile His I1e Arg Arg Ile Asn Leu Thr Gln Ile Pro Asn Gln Glu Lys Asp Ile Asn Ala Trp Leu Met Asn Thr Phe.Gln Leu Lys Asp Gln Leu Leu Asn Asp Phe Tyr Ser Asn Gly His Phe Pro Asn Glu Gly Thr Glu Lys Glu Phe Asn Thr Lys Lys Tyr Leu Ile Asn Cys Leu A1a Val Ile Ala Phe Thr Thr Ile Cys Thr His Leu Thr Phe Phe Ser Ser Met Ile Trp Phe Arg Ile Tyr Val Ser Leu Ala Cys Va1 Tyr Leu Thr Ser Ala Thr His Phe Asn Leu Arg Ser Val Pro Leu Val Glu Thr Ala Lys Asn Ser Leu Lys Leu Val Asn Lys <210> 22 <211> 1170 <212> DNA
<213> Arabidopsis sp.
<400> 22 atggtgattg ctgcagctgt catcgtgcct ttgggccttc tcttcttcat atctggtctc 60 gctgtcaatc tctttcaggc agtttgctat gtactcattc gaccactgtc taagaacaca 120 tacagaaaaa ttaaccgggt ggttgcagaa accttgtggt tggagcttgt atggatagtt 180 gactggtggg ctggagttaa gatccaagtg tttgctgata atgagacctt caatcgaatg 240 ggcaaagaac atgctcttgt cgtttgtaat caccgaagtg atattgattg gcttgtggga 300 tggattctgg ctcagcggtc aggttgcctg ggaagcgcat tagctgtaat gaagaagtct 360 tccaaattcc ttccagtcat aggctggtca atgtggttct cggagtatct ctttctggaa 420 agaaattggg ccaaggatga aagcactcta aagtcaggtc ttcagcgctt gagcgacttc 480 cctcgacctt tctggttagc cctttttgtg gagggaactc gctttacaga agccaaactt 540 aaagccgcac aagagtatgc agcctcctct gaattgccta tccctcgaaa tgtgttgatt 600 cctcgcacca aaggtttcgt gtcagctgtt agtaatatgc gttcatttgt cccagcaatt 660 tatgatatga cagtgactat tccaaaaacc tctccaccac ccacgatgct aagactattc 720 aaaggacaac cttcagtggt gcatgttcac atcaagtgtc actcgatgaa agacttacct 780 gaatcagatg acgcaattgc acagtggtgc agagatcagt ttgtggctaa ggatgctctg 840 ttagacaaac acatagctgc agacactttc cccggtcaac aagaacagaa cattggccgt 900 cccataaagt cccttgcggt ggttctatca tgggcatgcg tactaactct tggagcaata 960 aagttcctac actgggcaca actcttttct tcatggaaag gtatcacgat atcggcgctt ggtctaggta tcatcactct ctgtatgcag atcctgatac gctcgtctca gtcagagcgt tcgaccccag ccaaagtcgt cccagccaag ccaaaagaca atcaccaccc agaatcatcc tcccaaacag aaacggagaa ggagaagtaa <210> 23 <211> 389 <212> PRT
<213> Arabidopsis sp.
<400> 23 Met Val Ile Ala Ala Ala Val Ile Val Pro Leu Gly Leu Leu Phe Phe Ile Ser Gly Leu Ala Val Asn Leu Phe Gln Ala Val Cys Tyr Va1 Leu Ile Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Va1 Val Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp Ala Gly Val Lys Ile Gln Val Phe Ala Asp Asn Glu Thr Phe Asn Arg Met Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile Asp Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser Aia Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp Ala Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Ser Asp Phe Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Glu Leu Pro Ile Pro Arg Asn Val Leu Ile Pro Arg Thr Lys G1y Phe Val Ser Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala I1e Tyr Asp Met Thr Val Thr Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu Phe Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser Met Lys Asp Leu Pro Glu Ser Asp Asp Ala Ile Ala Gln Trp Cys Arg Asp Gln Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Tle Ala Ala Asp Thr Phe Pro Gly Gln Gln Glu Gln Asn Ile G1y Arg Pro Ile Lys Ser Leu Ala Val Val Leu Ser Trp Ala Cys Val Leu Thr Leu G1y Ala Ile Lys Phe Leu His Trp Ala Gln Leu Phe Ser Ser Trp Lys Gly I1e Thr WO 00118889 22 PCT/US99l22231 Ile Ser Ala Leu Gly Leu G1y Ile Ile Thr Leu Cys Met Gln Ile Leu Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Val .Pro Ala Lys Pro Lys Asp Asn His His Pro Glu Ser Ser Ser G1n Thr Glu Thr Glu Lys Glu Lys <210> 24 <211> 269 <212> DNA
<213> Glycine max <400> 24 gac.ccactga acgctctcat caccttcacg tggctcccct tcggcttcat cctctccatc 60 ataagggtct acttcaacct ccctctccca gaacncattg tccgctacac ctacgagatg 120 ctcggcatca acctcgtcat ccgcggccac cgccctcctc cgccttcccc cggcaccccc 180 ggcaacctct acgtctgcaa ccaccgcacc gctctcgacc ccatcgtcat cgccattgcc 240 ctcggccgca aggtctcctg cgtcaccta 269 <210> 25 <211> 242 <2i2> DNA
<213> Glycine max <400> 25 tgatcttcca cgacggccgt ttcgtgcaga ggccagaccc actgaacgct ctcatcacct 60 tcacgtggct ccccttcggc ttcatcctct ccatcataag ggtctacttc aaccttcctc 120 tcccagaacg cattgtccgc tacacctacg agatgctcgg catcaacctc gtcatccgcg 180 gCCaCCgCCC tcctccgcct tcccccggca cccccggcaa cctctacgtc tgcaaccacc 240 gc 242 <210> 26 <211> 272 <212> DNA
<213> Glycine max <400> 26 gtttgttcaa aggccaactc ctctagcagc cctcttgacc ttcctatggt tgccaattgg 60 catcatactc tccatnctta agggtctacc ttaacatccc tttgcctgaa agaattgctt 120 ggtataacta taagctatta ggaatcagag ttattgtgaa gggtacccct ccaccacccc 180 caaagaaggg tcaaagtggt gtcctatttg tttgtaacca ccgcacagtt ttagaccctg 240 tggttactgc agttgcactt ggaagaaaaa tt 272 <210> 27 <211> 218 <212> DNA
<213> Glycine max <400> 27 atagcacagg agggttacat ggtgcctccg agcaaatcag caaaggcagt cccacaggag 60 cgtctgaaga gcagaatgat cttccacgac gggcgtttcg tgcagaggcc agacccaatg 120 aatgccctca tcaccttcac atggctccct ttgggtttcg tcctctccat cataagggtc 180 tacttcaacc tccctctccc agaacgcatc gtccgcta 218 <210> 28 <211> 270 <212> DNA
<213> Glycine max <400> 28 gtgcctgttg ctgtgaactg caagcagaac atgttctttg gaaccaccgt tcgtggcgtc 60 aagttctggg acccttaact tacttcttac atgaacccta ggcctgtgta cgaggttacc 120 ttaccttgat acctttgccg aggagatgtc ggttaaggct ggggggaagt cgtccattga 180 ggtggccaac cacgtggcag aaggtgctgg gggatgtgtt agggtttgag tgcaccgggt 240 tgactaggaa ggataagtat atgttgttgg 270 <210> 29 <211> 252 <212> DNA
<213> Glycine max <400> 29 catgagggta ggtttgctca aaggccaact cctctagctg ccctcttgac cttcctatgg 60 ctgccaattg gcatcatact ctccatctta agggtctacc ttaacatccc tttgcctgaa 120 agaattgttg gtacaactac aagctcttag gaatcagagt tattgtgaag ggtacccctc 180 caccgccccc aaagaagggt caaagtggtg tctatttgtt tgtaaccacc gcacagtatt 240 agaccctgtt gt 252 <210> 30 <211> 272 <212> DNA
<213> Glycine max <400> 30 ctgggactgc cttaaacgat gcatggatct tatcaagaaa ggagcctctg tttttttctt 60 tccagaggga acacgcagta aagatggaag actaggcaca ttcaagaagg gtgctttcag 120 tgttgctgca aagacaaatg caccagtagt accaattacc cttattggaa ctggtcaaat 180 catgcctgca ggaaaggagg gaatagtgaa cataggttct gtgaaagtgg ttatacataa 240 acctattgtt ggaaaggatc ctgacatgtt at 272 <210> 31 <211> 239 <212> DNA
<213> Glycine max <400> 31 cgggaatcaa ggtcatcaga cttcaagggt gtttcagctg ttgtcactga cagaattcga 60 gaagctcatc agaatgagtc tgctccatta atgatgttat ttccagaagg tacaaccaca 120 aatggagagt tcctccttcc attcaagact ggtggttttt tggcaaaggc accggtactt 180 cctgtgatat tacgatatca ttaccagaga tttagccctg cctgggattc catatctgg 239 <210> 32 <211> 242 <212> DNA
<213> Glycine max <400> 32 gaacggcaac ggcaacagcg ttcgcgatga ccgtcctctg ctgaagccgg agcctccggt 60 cttccgccga cagcatcgcc gatatggaga agaagttcgc cgcttacgtc cgccgctacg 120 tgtacggcac catgggacgc ggcgagttgc ctcccaagga gaagctcttg ctcggtttcg 180 cgttggtcac tcttctcccc attcgagtcg ttctcgccgt caccatattg ctcttttatt 240 ac 242 <210> 33 <211> 248 <212> DNA
<213> Giycine max <400> 33 ttcttcttct ctcactctct aaaaccctaa ctctatacat ggaagggaaa nctcaaatct 60 natgactaat taattaatcc atcgatcaag catggagtcc gaactcaaag acctcaattc 120 gaagccgccg aacggcaacg gcaacagcgt tcgcgatgac cgtcctctgc tgaagccgga 180 gcctccggtc tccgccgaca gcatcgccga tatggagaag.aagttcgccg cttacgtccg 240 ccgcgacg 248 <210> 34 <211> 217 <212> DNA
<213> Glycine max <400> 34 aaaaccctaa ttctatacat ggaagggaaa tctcaaatct aatgactaat taattaatcc 60 atcgatcaag catggagtcc gaactcaaag acctcaattc gaagccgccg aacggcaacg 120 gcaacagcgt tcgcgatgac cgtcctctgc tgaagccgga gcctccggtc tccgccgaca 180 gcatcgccga tatggagaag aagttcgccg cttacgt 217 <210> 35 <211> 257 <222> DNA
<213> Glycine max <400> 35 atctctgtct ctgcatttcc ctccctaaaa ccctaattct acatttggaa aggaaatctc 60 aaatctaatg actaattaat caatcaatcg tattaataat ccatcgatca agtatggagt 220 ccgaactcaa agacctcaat tcgaagccac ccaactgcaa cggcaacgcc aacagcgttt 180 gcgacgaccg tcctctgctg aagccggagc ctccggcctc ctccgacagc atcgccgaga 240 tggagaagaa gttcgcc 257 <210> 36 <211> 284 <212> DNA
<213> Glycine max <400> 36 cccgaccaaa acaggttttt gtggccaatc atacttccat gattgatttc attatcttag 60 aacagatgac tgcatttgct gttattatgc agaagcatcc tggatgggtt ggattattgc 120 agagcaccat tntggagagt gtagggtgta tctggttcaa ccgtacagag gcaaaggatc 180 gagaagttgt ggcaaggaaa ttgagggatc atgtcctggg agctaacaac.aaccctcttc 240 ttatatttcc tgaaggaact tgtgtaaata atcactactc gtca 284 <210> 37 <211> 246 <212> DNA
<213> Glycine max <400> 37 ggagatccgc ataagcaaat caatcatcct gttccttcct tatctctgtc tctgcatttc 60 cctccctaaa accctaattc tacatttgga aaggaantct caaatctaat gataattaat 120 caatcaatcg tattaataat ccatcgatca agtatggagt ccgaactcaa agacctcaat 180 tcgaagccac ccaactgcaa cggcaacgcc aacagcgttt gcgacgaccg tcctctgctg 240 aagccg 246 <210> 38 <211> 278 <212> DNA
<213> Glycine max <400> 38 gttttctatt gccacgttgt ggaagcgtaa cgaagatgaa tggcattggg aaactcaaat 60 cgtcgagttc tgaattggac cttcacattg aagattacct accttctgga tccagtgttc 120 aacaagaacg gcatggcaag ctccgactgt gtgatttgct agacatttct cctagtctat 180 ctgaggcagc acgtgccatt gtagatgata cattcacaag gtgcttcaag caaatcctcc 240 agaaccttgg aactggaatg tttatttgtt tcctttgt 278 <210> 39 <211> 322 <212> DNA
<213> Glycine max <400> 39 ttaactttgg cacattctcc ttttgttcat caatgtgtgt tgtaaattgt ncatttcctt 60 cagaggtctt tggtaganat gatgtgcagt ttctgtggtg catcttggac tgnggntgtt 120 aagnatcatg gacccaggcc tagcaggaga ccaaagcagg tttttgtagc caaccatact 180 tcatgattga tntcattatn tnagaacaga tgactgcttt tgcngttatn atgcagaagc 240 atcctggatg ggttggtaag cntacagnat gtcaacngtg tatnaaatat gntacacnnn 300 acttgcgtct tc 312 <210> 40 <211> 255 <212> DNA
<213> Glycine max <400> 40 ggattattgn ngcanatgca gtcatctgtt ctaagataat ganatcnatc atggaagtat 60 gattggncac anaaacctgt yttttggttg gatactaggt cttggcccat ggtacttgac 120 naccccagtc catgatgcaa canaganact gnacatcatc tccaccaaac ccctctgana 180 ganacgagaa ttgagcaatt tagagtacct tggtttgatg caagtcagta tattcaagtt 240 tctattcatc aaagg 255 <210> 41 <211> 291 <212> DNA
<213> Glycine max <400> 41 caacctccca tgcaatcgct caccctctcc gtcacctgaa tctgttttct attccctccg 60 tcgcgtaaca aggatgaatg gcattgggaa actcaaatcg tcgagttctg aattggacct 120 tcacattgaa gattacctgc cttctggatc cagtgttcaa caagaacggc atggcaagct 180 ccgcctgtgt gatttgctag acatttctcc tagtctatct gaggcagcac gtgccattgt 240 agatgataca ttcacaaggt gcttcaagtc aaatcctcca gaaccttgga a 291 <210> 42 <211> 284 <212> DNA
<213> Glycine max <400> 42 ctgcaaccta ccatgcaatt cctcacctga atccgttttc tattgccacg.ttgtggaagc 60 gtaacgaaga tgaatggcat tgggaaactc aaatcgtcga gttctgaatt ggaccttcac 120 attgaagatt acctaccttc tggatccagt gttcaacaag aacggcatgg caagctccga 180 ctgtgtgatt tgctagacat ttctcctagt ctatctgagg cagcacgtgc catgtagatg 240 atacatcaca aggtgctcaa gtcaaatctc cagaaccttg gaat 284 <210> 43 <211> 268 <212> DNA
<213> Glycine max <400> 43 ctgaagtatt ctcgtcctag cccaaagcat agagaaaggn agcaacagaa ctttgctgag 60 tcagtgctgc ggcgatggga ggaaaagtga tgtgtacctt tatgtggtgt tgttcttaat 120 tattcttagt aatgccattg cttcgacccc tttttttgct tttgttttgt cattgctaac 180 tatttatttt taacactttt attaaagata tggcatatat ncacttcagt anacaaagtt 240 gtnccagtaa tttnttttcc aaaaaaaa 268 <210> 44 <211> 241 <212> DNA
<213> Glycine max <400> 44 gancaaaatt gccctccatc actttccttg ttagagttgg tttctgcnac ctaccatgca 60 attccctcac ctgaatccgt tttctattgc cacgttgtgg aagcgtaacg aagatgaatg 120 gcattgggaa actcaaatcg tcgagttctg aattggacct tcacattgaa gattacctac 180 cttctggatc cagtgttcaa caagaacggc atggcaagct ccgactgtgt gatttgctag 240 a 241 <210> 45 <211> 247 <212> DNA
<213> Glycine max <400> 45 gtaggatgtc tgagatcctt gccccaatca aaacggtgcg gttaactaga aaccgcgacg 60 aggatgcgaa aatgatgaaa aatttgctgg ggcaagggga cctggtggtt tgtcctgaag 120 ggaccacatg tagagaacct tatttattga ggttcagccc tctgttctca gagatgtgcg 180 atgagattgt ccccgttggc agttgattcc cagttatatg ttccacggaa ccactgctgg 240 tgganta <210> 46 <211> 271 <212> DNA

WO 00/18889 26 . PCT/US99I22231 <213> Glycine max <400> 46 tgcagggggg cttgttagag ccatagtttt ggttcttcta tacccttttg tttgtgtcgt 60 aggaaaagag atggggttga agataatggt catggcatgc ttcttcggga tcaaagcatc 120 gagcttcaga gttggaaggt ccgttttgcc cnaattcttc tnggaggacg ttngtgcaga 180 aatgtttgag gcactcaaaa aaggagggaa gacagtggga gttaccaatt taccccacgt 240 gatggtggaa agcttcttga gagagtattt g 271 <210> 47 <211> 242 <212> DNA
<213> Glycine max <400> 47 ttcacagctg tcacgccgtn aacggaaaat ggcaacggcg agacgcagtt tcccgcctat 60 caccgaatgc aacggaacga cnccgtgcga ntctgtngnc gccgacctcg agggtacgct 120 cctcatctcc cgtngctcgt tcccgtactt catgctcgtc gccgtcgaag ccggcagcnt 180 cctccgcggc ctcatgctnc tcctctccct tccgttcgtc atnatcgcct acctcttcat 240 ct 242 <210> 48 <211> 244 <212> DNA
<213> Glycine max <400> 48 acatattctt cagttagctc ccccaaccta tacacttcac caccacacca caaccctacc 60 ctctctctct gtcatggtca ttggaggagc cttccctcgt ttcgacccaa tcaccaaatg 120 tagacccaag accgctccaa ccagaccatc gcctcggacc tcgatggcac cctccttgtc 180 tcccggagtg ccttccccta ctacttcctc gtcgccctcg aagccggcag cgtcttccga 240 gcct 244 <210> 49 <211> 230 <212> DNA
<213> Glycine max <400> 49 caacattcca cctagctccc caatcacatc ttcaccacac cataaacctt cttaatttct 60 ctcttcattt tctcctctat tgtcataatc atggggacct tccctcgctt cgacccaatc 120 accacccaag accggtccaa ccagaccgtg gcctccgacc ttgacggcac cctcctcgtc 180 tcccggagcg ccttccccta ctacctcctc gttgccctcg aagccggcag 230 <210> 50 <211> 265 <212> DNA
<213> Glycine max <400> 50 ctggtgaata atcctaagtt atggagtctg tggtgtgtga gctagaaggc acgcttgtga 60 aggacaagga tgcgttctca tacttcatgt tggttgcgtt tgaagcttca ggtttggttc 120 gtttcgcctt gttgctaaca ctattgcccg tgattcggtt ccttgacatg gttggcatga 180 acgatgcatc tctcaagcta ntnatcttcg tggctgtggc tggtgttcca aagtccgaga 240 ttgaatcagt ggctagggca gtttt 265 <210> 51 <211> 252 <212> DNA
<213> Glycine max <400> 51 ctggtgaata atcctaagtt atggagtctg tggtgtgtga gctagaaggc acgcttgtga 60 aggacaagga tgcgttctca tacttcatgt tggttgcgtt tgaagcttca ggtttggttc 120 gtttcgcctt gttgctaaca ctattgcccg tgattcggtt ccttgacatg gttggcatga 180 acgatgcatc tctcaagcta atgatcttcg tggctgtggc tgggttccaa agtccgagat 240 tgaatcagtg gc 252 <210> 52 <211> 218 WO 00118889 2~ PCTIUS99l22231 <212> DNA
<213> Glycine max <400> 52 aactgcaact acaacaacat tcattcattc acagctgtca cgccgtgaac ggaaaatggc 60 aacggcgaga cgcagtttac ccgcctatac accgaatgca acggaacgac accgtgcgag 120 tctgtggccg ccgacctcga cggtacgctc ctcatntccc gtagctcgtt cccgtacttc 180 atgctcgtcg ccgtcgaagc cggcagcctc ctccgcgg 218 <2I0> 53 <211> 262 <212> DNA
<213> Glycine max <400> 53 ggttaaggac attgagatgg tcgnntcctc ggtgctgccc aagttctaca ccgaggacgt 60 gcnccccgag agctggagag tcttcaatcc ttcgggaagc gttacattgt cactgctagt 120 ctagggtgat ggtggagcan tttgttaaga cgtttcttgg ggctgataag gtgcttggga 180 ctgagcttga ggccacgaaa tcggggaggt tcatgggttt gttaaggagc ctggtgtgct 240 tgttggggag cacaagaaag tg 262 <210> 54 <211> 212 <212> DNA
<223> Glycine max <400> 54 gcaactacaa caacattcat tcattcacag ctgtcacgcc gtgaacggaa aatggcaacg 60 gcgagacgca gtttcccgcc tatcaccgaa tgcaacggaa cgacgccgtg cgagtctgtg 120 gccgccgacc tcgacggtac gctcctcatc tcccgtagnc cgttcccgta cttcatgctc 180 gtngccgtcg aagccggcag cctcctccgc gg 212 <210> 55 <211> 273 <212> DNA
<213> Glycine max <400> 55 catggttttc ttgagcttct ttggcctcag aaaggacaca ttcagaacag gatcagctgt 60 tctggcaaag ttcttcttag aagatgttgg attggaaggc tttgaggccg taatatgttg 120 tgagagaaaa gtggcatcta gtaagttgcc aagggtcatg gttgaaaatt tcctcaagga 180 ctatttaggg gttgatgctg ttatagcaag agaattgaag tcctttagtg gcttcttttt 240 gggagttttt gagagtaaga agccaattaa aat 273 <210> 56 <211> 257 <212> DNA
<213> Glycine max <400> 56 ctctcaaaaa aggagggaag acagtgggag tcaccaatct accccatgtg atggtggaaa 60 gcttcttgag agagtatttg gacattgatt tcgttgtggg cagggagctg aaagttttct 120 gtggatacta cgtaggattg atggatgaca caaaaactat gcatgccttg gagctggtta 180 aagaaggaaa aggatgctcc gacatgatcg gaatcacaag gtttcgcaac atacgcgacc 240 atgatgattt tttctcc 257 <210> 57 <211> 240 <212> DNA
<213> Glycine max <400> 57 gaactaagtg tgaaccacta ccaagaaaca agcttttaag tccaattatt tttcatgagg 60 gtaggtttgc tcaaaggcca actcctctag ctgnnctctt gaccttccta tggctgccaa 120 ttggcatcat actctccatc ttaagggtct accttaacat ccctttgcct gaaagaattg 180 cttggtacaa ctacaagctc ttaggaatca gagttattgt gaagggtacc cctccaccgc 240 <210> 58 <211> 254 <212> DNA

WO 00118889 2g PCT/US99/22231 <213> Glycine max <400> 58 cttggaataa gggtcattag gaagggtatc cctccacccc cagcnaagaa gggccaaagt 60 ggagtcctat ttgtatgcaa ccacaggaca gttttagacc ctgtggttac agctgttgca 120 ttaggaagga aaattagctg tgtcacatat agcataagca aattcactga aataatttca 180 ccaatcaaag ctgtggcact ctctagggag agggacaaag atgctgccaa catcaagang 240 ttgcttgagg aagg 254 <210> 59 <211> 267 <212> DNA
<223> Glycine max <400> 59 gccaganaga cttgcttggt acaactacaa gcttcttgga ataagggtca ttaggaaggg 60 tatccctcca cccccagcaa agaagggcca aagtggagtc ctatttgtat gcaaccacag 120 gacagtttta gaccctgtgg ttacagctgt tgcattagga aggaaaatta gctgtgtcac 180 atatagcata agcaaattca ctgaaataat tcaccaatca aagctgtggc actctctagg 240 gagagggacc nagatgctgc cnacatc 267 <210> 60 <211> 261 <212> DNA
<213> Glycine max <400> 60 gtaaccacag ggtctaaaac tgtgcggtgg ttactgcagt tgcacttgnc nagaaaaatt 60 tgcttatgct atatgtgaca cagctaattc actgnaataa tttcaccaat taaagctgtg 120 gcactctcaa ggganngaga gaaagatgct gccaatatcc ngagactact tgaggaaggg 180 gacttggtga tttgccctga aggcacaact tgtagagagc cttcctcttg aggttcagtg 240 cactatttgc tgaactcact g 262 <210> 61 <211> 258 <212> DNA
<213> Glycine max <400> 61 caaggagctc acatgcagtg gagggaaatc agctattgaa gttgcaaact acattcaaag 60 ggttcttgca gggactttgg gatttgagtg cacaaatttg actaggaaga gcaaatatgc 120 catgcttgca ggcacagatg ggacagttcc atctaaggag aaggcttgan aagggagaga 180 aattaagttc tcccttttga ttattctgta ttggtgccca atgtgtttcc aaaacactta 240 gaattatgat agaaataa 258 <210> 62 <211> 258 <212> DNA
<213> Glycine max <400> 62 attggcataa tcctctccat cctaagggtc tatctcaaca tccctctgcc agaaagactt 60 gcttgntaca actacaagct tcttggaata agggtcatta ggaagggtat ccctccaccc 120 ccagcaaaga agggccaaag tggagcctat ttgtatgcaa ccacaggaca gttttagacc 180 ctgtggttac agctgttgca ttaggaagga aaattagctg tgtcacatat agcataagca 240 aattcactga aataattt 258 <210> 63 <211> 239 <212> DNA
<213> Glycine max <400> 63 cacttcacca ccacaccaca accctaccct ctctctctgt catggtcatt ggaggagcct 60 tccctcgttt cgacccaatc accaaatgta gcacccaaga ccgctccaac cagaccatcg 120 cctcggacct cgatggcacc ctccttgtct cccggagtgc cttcccctac tacttcctcg 180 tcgccctcga agccggcagc gtcttccgag ccctccttct cttaaccttc gtccccttc 239 <210> 64 <211> 531 WO UQ/1$$$9 . PCT/US99/22231 <212> DNA
<213> Glycine max <400> 64 ccgagaaccg gtctaaccaa accgtggcct cggacttgga cggcaccctc ctggtgtccc 60 ccagcgcatt tccttactac atgctggtcg ccatcgaagc cggcagcttc ctccgtggcc 120 ttgtcctcct tgcctccgtc cctttcgtgt attcacgtac atattcctct ccgagaccgc 180 ggccatcaag tccctgatct tcatcgcctt cgcgggcctg aaggtcaggg acgttgagat 240 ggtcgcgtgc tcggtgctgc ccaagttcta cgccgacata ttcttcagtt agctccccca 300 acctatacac ttcaccacca caccacaacc ctaccctctc tctctgtcat ggtcattgga 360 ggagccttcc ctcgtttcga cccaatcacc aaatgtagca cccaagaccg ctccaaccag 420 accatcgcct cggacctcga tggcaccctc cttgtctccc ggagtgcctt cccctactac 480 ttcctcgtcg ccctcgaagc cggcagcgtc ttccgagccc tccttctctt a 531 <210> 65 <211> 256 <212> DNA
<213> Glycine max <400> 65 acatattctt cagttagctc ccccaaccta tacacttcac caccacacca caaccctacc 60 ctctctctct gtcatggtca ttggaggagc cttccctcgt ttcgacccaa tcaccaaatg 120 tagcacccaa gaccgctcca accagaccat cgcctcggac ctcgatggca ccctccttgt 180 ctcccggagt gccttcccct actacttcct cgtcgccctc gaagccggca gcgtcttccg 240 agccctcctt ctctta 256 <210> 66 <211> 260 <212> DNA
<213> Glycine max <400> 66 ccatccaaca tattcttcag ttagctcccc caacctatac acttcaccac cacaccacaa 60 ccctaccctc tctctctgtc atggtcattg gaggagcctt ccctcgtttc gacccaatca 120 ccaaatgtag cacccaagac cgctccaacc agactatcgc ctcggacctc gatggcaccc 180 tccttgtctc ccggagtgcc ttcccctact acttcctcgt cgccctcgaa gccggcagcg 240 tcttccgagc cctccttctc 260 <210> 67 <211> 248 <212> DNA
<213> Glycine max <400> 67 caccaaccaa acctcactct ccctttctcc cctgaccctc tccctgccat ggtcatggga 60 gcctttggcc acttcgaacc ggtctccaaa tgcagcaccg agaaccggtc taaccaaacc 120 gtggcctcgg acttggacgg caccctcctg gtgtccccca gcgcatttcc ttactacatg 180 ctgggcgcca tcgaagccgg cagcttcctc cgtggccttg tcctccttgc ctccgtccct 240 ttcgtgta 248 <210> 68 <211> 283 <212> DNA
<213> Glycine max <400> 68 ttcttcccca ccatcacacc aancaaacct cactctncct ggccatggtc atgnnngcct 60 ttccgccact tcgaaccggt ttccaaatgc agcaccgaaa accggtttaa ccaaaccgtg 120 gcctcggact tggacggcac cctcctggtg tcccctagcg CCtttCCtta CtaCatgCtC 180 gtcgccatcg aagccggcag cttcctccgt ggccttgtcc tccttggatc cgtccctttc 240 gtgtacttca cgtacatatt cttctccgag accgcggcca tca 283 <210> 69 <211> 258 <212> DNA
<213> Glycine max <400> 69 ctcttcttcc ccaccatcnn accaaccaaa cctcactctc cctgaccatg gtcatgggag 60 cctttcgcca cttcgaaccg gtttccaaat gcagcaccga aaaccggttt aaccaaaccg 120 WO 00/18889 3~ PCTIUS99/22231 tggcctcgga cttggacggc accctcctgg tgtcccctag cgcctttcct tactacatgc 180 tcgtcgccat cgaagccggc agcttcctcc gtggccttgt cctccttgga tccgtccctt 240 tcgtgtactt cacgtaca 258 <210> 70 <211> 256 <212> DNA
<213> Glycine max <400> 70 tgcaactaca acaacattca ttcattcaca gctgtcacgc cgtgaacgga aaatggcaac 60 ggcgagacgc agtttcccgc ctatcaccga atgcaacgga acgacaccgt gcgagtctgt 120 ggccgccgac ctcgacggta cgctcctcat ctcccgtagc tcgttcccgt acttcatgct 180 cgtcgccgtc gaagccggca gcntcctccg cggcctcatc ctcctcctng ccantccgtt 240 cgtcatcanc gcctac 256 <210> 71 <211> 259 <212> DNA
<213> Glycine max <400> 71 cttccccacc atcacaccan ggcnaacctc antctccctt tctccacnga ccctctccct 60 gccatngtca tgggancctt tggccacttc gaaccggtct ccaaatgcag caccgagaac 120 cggnctaacc aaaccgtggc ctcggacttg gacggcaccc tcctggtgtc ccncagcgca 180 tttccttact acatgctggc ngccatcgaa gccggcagct tcctccgtgg ccttgtcctc 240 cttgcctccg tccctttcg 259 <210> 72 <211> 249 <212> DNA
<213> Glycine max <400> 72 ccaacatatt cttcagttag ctcccccaac ctatacactt caccaccaca ccacaaccct 60 accctctctc tctgtcatgg tcattggagg agccttccct cgtttcgacc caatcaccaa 120 atgtagcacc caagaccgct ccaaccagac catcgcctcg gacctcgatg gcaccctnct 180 tgtctcccgg agtgccttcc cctactactt cctcgtcgcc ctcgaagccg gcagcgtctt 240 ncgagccct 249 <210> 73 <211> 257 <212> DNA
<213> Glycine max <400> 73 caaccctctt cttccccacc atcacaccaa ncaaacctca ctctcccttt ctcccctgac 60 cctctccctg ccatggtcat gggagccttt ggccacttcg aaccggtctc caaatgcagc 120 accgagaacc ggtctaacca aaccgtggcc tcggacttgg acggcaccct cctggtgtcc 180 cccagcgcat ntccttacta catgctggtc gccatcgaag ccggcagctt cctccgtggc 240 cttgtcctcc ttgcctg 257 <210> 74 <211> 255 <212> ANA
<213> Glycine max <400> 74 gccgaagacg tgcacccgga gagttggaga gtgttcaact ctttcgggaa gcgttacatt 60 gtcacggcta gtcctagggt gatggtggag ccgtttgtta aggcgtttct cggggctgac 120 aaggtgcttg ggactgaact tgaggccacc aaatcgggga cgttcactgg gtttgttaag 180 aagcctggtg tgcttgttgg ggagcataag aaagtggctc tggtgaagga gtttcagggt 240 aattacctga cttgg 255 <210> 75 <211> 244 <212> DNA
<213> Glycine max <400> 75 WO 00/1$$$9 31 PCT1US99/22231 caacaacatt cattcattca cagctgtcac gccgtgaacg gaaaatggca acggcgagac 60 gcagtttccc gcctatcacc gaatgcaacg gaacgacacc gtgcgagtct gtggccgccg 120 acctcgacgg tacgctcctc atcncccgta gctcgttccc gtacttcatg ctcgtcgccg 180 tcgaagccgg cagcctcctc cgcggcctca tgcnttcctg ggtttanttt gagnacccct 240 gagg 244 <210> 76 <211> 240 <212> DNA
<213> Glycine max <400> 76 gctggctacc ctcttcttcc ccaccatcac accaatcaaa cctcactcta ccctggccat 60 ggtcatggga gcctttncgc cacttcgaac cggtttccaa atgcagcacc gaanaccggt 120 ttnaccanac cgtggcctcg gncttggacg gcaccctcct ggtgtcccct agcgcctttc 180 cttactacat gctcgtcgcc atcgaagccg gcagcttcct ccgtggcttg tcctccttgg 240 <210> 77 <211> 263 <212> DNA
<213> Glycine max <400> 77 gtttctcggg gctgacaagg tgcttgggac tgaacttgag gccaccaaat cggggacgtt 60 cactgggttt gttaagaagc ctggtgtgct tgttggggag cataagaaag tggctctggt 120 gaaggagttt cagggtaatt tacctgactt gggtctaggt gatagtaaaa gtgattatga 180 cttcatgtca atttgcaagg aagggtacat ggtgccaaga actaagtgtg aaccactacc 240 aagaaacaag cttttaagtc caa 263 <210> 78 <211> 258 <212> DNA
<213> Glycine max <400> 78 ggccacgaaa tcggggaggt tcactgggtt tgttaaggag cctggtgtgc ttgttgggga 60 gcacaagaaa gtggctgttg tgaaggagtt tcagggtaat ttacctgact tgggactagg 120 agatagtaaa agtgattatg acttcatgtc aatttgcaag gaagggtaca tggtgccaag 180 gactaagtgt gaaccactac caagaaacaa acttttaagt ccaattattt ntcatgaggg 240 taggtttgtt caaaggcc 258 <210> 79 <211> 260 <222> DNA
<213> Glycine max <400> 79 ctcttcttcc ccaccatcac accaancaaa cctcactctc cctttctccc ctgaccctct 60 ccctgccatg gtcatgggag cctttggcca cttcgaaccg gtctccaaat gcagcaccga 120 gaaccggtct aaccaaaccg tggcctcgga cttggacggc accctcctgg tgtcccccag 180 cgcatttcct tactacatgc tggtcgccat cgaagccggc agcttcctcc gtgggccttg 240 tcctccttgc ctccgtccct 260 <210> 80 <211> 257 <212> DNA
<213> Glycine max <400> 80 gggaacaaca acaaatggca ngaaccttat ctccttccaa cttggtgcat ttatccctgg 60 atacccaatc cagcctgtaa ttgtacgcta tcctcatgtg cactttgacc aatcctgggg 120 tcatgtntct ttgggaaagc ttatgttcag aatgttcact caatttcaca acttttttga 180 ggtagaatat cttcctgtca tttatcccct ggatgataag gaaactgctg tancttntcg 240 ggagaggact agccggg 257 <210> 81 <211> 272 <212> DNA
<213> Glycine max WO 00/1$889 32 PCT/US99122231 <400> 81 catacctttt gttggcacca ttattagagc aatgcaggtc.atatatgtta acagattctt 60 accatcatca aggaagcagg ctgttaggga aataaaggaa ctgaataaca gagaagggcc 120 tcttgtgata aatttcctcg agtactatta tttcccgagg gaacaacaac taatggcagg 180 aaccttatct ccttccaact tggtgcattt atccctggat acccaatcca gcctgtaatt 240 atacgctatc ctcatgtaca ctttgaccaa tc 272 <210> 82 <211> 245 <212> DNA
<213> Glycine max <400> 82 gggcatttca catactagag ttcatcccag tgaaaagaaa gtgggaggct gatgaatcaa 60 tcatgcgcca tatgctttct acattcaagg atccacaaga tcctctctgg cttgcgcttt 120 tcccagaagg cactgatttc actgagcaaa agtgccttcg gagtcaaaaa tatgctgctg 180 aacataagtt accggttctg aaaaatgttt tacttccaag gacaaagggg cttctgtgcc 240 gcttg <210> 83 <211> 268 <212> DNA
<213> Glycine max <400> 83 cagtgtcctt cctttctgga caatgttttt ggtgttgacc cttcagaagt gcacctgcat 60 gtgcggcgta ttccggtgga ggagattcca gcttctgaaa ccaaagctgc ttcttggtta 120 atcgacacat tccagatcaa ggaccaattg ctttcggatt tcaagattca aggccatttc 180 cctaaccaac taaatgaaaa tgaaatttct agatttaaga gcctactctc ttttatggtg 240 atagtttctt ttactgccat gtttattt 268 <210> 84 <211> 265 <212> DNA
<213> Glycine max <400> 84 gaaagagact gggcaaaaga tgaaacatca ctgaagtcag gttttaggca tctagagcac 60 atgccattcc ctttctggtt ggcccttttt gttgaaggaa ctcgtttcac gcagacaaag 120 cttttacaag ctcaagagtt tgctgcttca aaagggctgc ctatacctag aaatgttttg 180 attcctcgta ctaagggttt tgtcacagca gnacaaagcc ttcggccatt tcgttccagc 240 catttatgat tgcacatatg cagtt 265 <210> 85 <211> 265 <212> DNA
<213> Glycine max <400> 85 gaaagagact gggcaaaaga tgaaacatca ctgaagtcag gttttaggca tctagagcac 60 atgccattcc ctttctggtt ggcccttttt gttgaaggaa ctcgtttcac gcagacaaag 120 cttttacaag ctcaagagtt tgctgcttca aaagggctgc ctatacctag aaatgttttg 180 attcctcgta ctaagggttt tgtcacagca gnacaaagcc ttcggccatt tcgttccagc 240 catttatgat tgcacatatg cagtt 265 <210> 86 <211> 301 <212> DNA
<213> Zea mays <400> 86 ctcgtcgtca agggcacccc gccgccgccg cccaagaagg gccacccggg cgtcctcttc 60 gtctgcaacc accgcaccgt gctcgacccc gtcgaggtgg ccgtggcgct gcgccgcaag 120 gtcagctgcg tcacctacag catctccaag ttctccgagc tcatctcgcc catcaaggcc 180 gtcgcgctgt cgcgggaggc gacaaggacg ccgagaacat ccgccgcctg ctggaggagg 240 gcgacctggt catctgcccc gagggnaaca actgccgcga gcccttcctg ctgcgttcag 300 g 301 <210> 87 <211> 309 <212> DNA
<213> Zea mays <400> 87 cgctcatgcg gtgtacatca acctgccgct gcccgagcgc atcgtctact acacctacaa 60 gctcatgggc atcaggctcg tcgtcaaggg caccccgccg ccgccgccca agaagggcca 120 cccgggcgtc ctcttcgtct gcaaccaccg caccgtgctc gaccccgtcg aggtggccgt 180 ggcgctgcgc cgcaaggtca gctgcgtcac ctacagcatc tccaagttct ccgagctcat 240 ctcgcccatc aaggccgtcg cgctgtcggg gaggcgacaa ggacgccgag aacatccgcc 300 gcctgctgg 309 <210> 88 <211> 304 <212> DNA
<213> Zea mays <400> 88 tggctgtgca ggaggcctac ctggtgacgt caaggaagta cagcccggtg cccaggaacc 60 agctgctgag cccgctgatt cgtgcacgac ggccgcctcg tgcagcgccc gacgccgctc 120 gtcgcgctcg tcaccttcct ctggatgccg ttcggcttcg cgctggcgct catgcgcgtg 180 tacatcaacc tgccgctgcc cgagcgcatc gtctactaca cctacaagct catgggcatc 240 aggctcgtcg tcaagggcac cccgccgccg ccgcccaaga agggccaccc gggcgtcctc 300 ttcg <210> 89 <211> 312 <212> DNA
<213> Zea mays <400> 89 ggttcatcca cttgtgttgc tattngaccg gtaccgtagg agagcacagc actancatcg 60 caaagatttn gggctacggt gacaatctcc atgttctaca atcttnaggt cgaaggaatg 120 gagaatctgc ctccaaatag ctgtcctggt gtctatgttg ctaaccatca gagcttcttg 180 gatatttata cccttctaac tctagggagg tgcttcaaat ttataagcaa gaccagcatc 240 tttatgttcc ctattatagg gtgggcaatg tatctcttgg gtgtgattcc tctgcggcgt 300 atggacagca gg <210> 90 <211> 264 <212> DNA
<213> Zea mat's <400> 90 ggtgctgtat ctgaaagaat ccatcgtgct catcaacaga aaaatgcacc aatgatgcta 60 ctcttcccct gagggcacaa ctacaaatgg ggattatctc cttccattca aaacaggtgc 120 ttttcttgca aaggcaccag ttcaaccagt cattttgaga tatccttaca aaagatttaa 280 tgcagcatgg gattccatgt caggggcacg tcatgtattt ctgctgctct gtcaatttgt 240 aaattaccta gaggtggtcc gctt 264 <210> 91 <221> 212 <212> DNA
<213> Zea mat's <400> 91 aaatgtcttg gatgcatttt tgttcagcgg gagtcgaaaa caccagattt caaaggtgtt 60 tcaggtgctg tatttgaaag aatccatcgt gctcatcaac agaaaaatgc accaatgatg 120 ctactcttcc ctgagggcac aactacaaat ggggattatc tccttccatt caaaacaggt 180 gcttttcttg caaaggcacc agttcaacca gt 212 <210> 92 <211> 267 <212> DNA
<213> Zea mat's <400> 92 gtctaaagaa atngaaaggc gtggggnaat tgtgtctaat catgtntctt atgtggatat 60 tctttatcan atgtcagcct cttttcctag ttttgttgct aagagatcag tggntagatt 120 gcctctagtt ggtctcataa gcaaatgtct tggatgcatt tttgttcagc gggagtnnaa 180 aatncanatt tcaaaggtgt ttaaggtgtg gnatctgaaa gaatccatcg tgctcatcaa 240 WO 00/18889 34 . PCTlUS99/22231 cagaaaaatg caccaatgat gctactc 267 <210> 93 <211> 152 <212> DNA
<213> Zea mat's <400> 93 ctacaaatgg ggattacctt cttccattta agactggagc ctttnttgca ggtgcaccag 60 tgcagccagt cattttgaaa tacccttaca ggagatttag tccagcatgg gattcaatgg 120 atggagcacg tcatgtgtta ttgctgctct gt 152 <210> 94 <211> 274 <212> DNA
<213> Zea mat's <400> 94 aaaatataaa ttaatatggt cttaatccca ccatataaat aacgttctct ttctgcaggg 60 caatttagtt ctttctaata ttgggctggc agagaagcgc gtgtaccatg cagcactgac 120 tggtagtagt ctacctggcg ctagacatga gaaagatgat tgaaagacgt tgcgtcgctt 180 tttctgtaac agacagccga ggaacactta aaaatgtaac tgtgtgcgtg tttttatacc 240 tgtaatgtgg cagtttattt gtttgaggag gctg 274 <210> 95 <211> 295 <212> DNA
<213> Zea mat's <400> 95 aatagctatc aagtacaata aaatatttgt tgatgccttt tggaacagta agaagcaatc 60 ttttacaatg cacttggtcc ggctgatgac atcatgggct gttgtgtgtg atgtttggta 120 cttacctcct caatatctga gggagggaga gacggcaatt gcatttgctg agagagtaag 180 ggacatgata gctgctagag ctggactaaa gaaggttcct tgggatggct atctgaaaca 240 caaccgtcct agtcccaaac acactgaaga gaacaacgca tattgccgat ctgtc 295 <210> 96 <211> 273 <212> DNA
<213> Zea mat's <400> 96 gngccatctc accggcggcn ggcctgcggc cggcaaccgg aggcgatggc gagctngtct 60 gtggtggcgg acatggagca ntaccgcccc aacctggagg actacctccc gcccgactcg 120 ctcccgcagg aggcgcceag gaatctccat ctgcgcgatc tgcttgacat ctcgccggtg 180 ctaaccgagg cagcgggtgc catagtcgat gattcattca cccgttgctt taagtcgaat 240 tctccagaac catggaatgg aacatatatt tgt 273 <210> 97 <211> 127 <212> DNA
<213> Zea mat's <400> 97 ctcaatatct ganggaggga gagactgcaa ttgcgtttgc tgagagagta agggacatga 60 tagcagctag agctggtctt aagaaggtcc cgtgggatgg ctatctgaag cacaaccgcc 120 ctagtcc 127 <210> 98 <211> 286 <212> DNA
<213> Zea mat's <400> 98 gaaccgtacg cgcctcatta cgcccatcca cgtgctcgcc tctccccatc gcataatttt 60 nctcggcggc gtcgccatct ccancggcng cnggcctgcn gccggcaacc ggaggcgatg 120 gcgagctcgt ctgtggcggc ggacatggag ctggaccgcc ccaacctgga ggactacntc 180 ccgcccgant cgctcccgca ggaggcgacc aggaatctcc atctgngcga tctgcttgan 240 atctcgccgg tgctaaccga ggcagcgggt gccatagtcg atgatt 286 <210> 99 <211> 308 <212> DNA
<213> Zea mat's <400> 99 cgccatctca tcggcggcgg gcgtgcggcc ggcggcngag gcgaggngcg attggcgagc 60 tcgtctgtgg cgccggacat ggagctggac cgcccanacc tggaggacta nctcccgccc 120 gactcgnncc cgcagaggcg ccccggaatc tccanctgcg cgatctgctg gacatcncgc 180 cggtgctcac cgaggcagcg ggtgccattg tcgatgactc cttcacacgg ngctttaagt 240 caaattctcc agagccatgg aattggaaca tatatctgtt ccccttatgt gctttggtgt 300 ataataag 308 <210> 200 <211> 282 <212> DNA
<213> Zea mat's <400> 100 cagaaactag angttagtca cagcatggca ttaaattgtc atagtaaaca acancncact 60 gagcaactat gcaatttaat gccatgctgt gactaacttc tagtttctgg cattaaatta 120 ctgtttggct actaggaaga ccgaggtaga gaagcaaata taagaatacc ctccaacgca 180 canccaaatg acagagtaaa tgaaggtagg gttcaccttc ttgaacatga ccgtatactg 240 gttgttaaca caagttcctc tgggaaaatc agagagggtt tt 282 <210> 101 <211> 282 <212> DNA
<213> Zea mat's <400> 101 ggcgcggctg gccgtggcgc tggtCCtgCC gtacagtact cgacgccgat cctggcngcg 60 acnggcatgt cgtggcggct caaagggtng cgcccngngc ttgcnnngcc gtgctccggc 120 gggcgctgnc agctgttcgt gtgcaacnac cggacgctga tcgacccngt gtacgtgtcc 180 gtagcgtgga ccgggaaatg cgcgncgtgt nctacagnct gangcggntn tcggagctca 240 tctcccccat ngncggaang tgcacctgan accgggaacg gg 282 <210> 102 <211> 290 <212> DNA
<213> Zea mat's <400> 102 ggacgcggca ccatgcgcgc cgagctggcc agtggcgacg tggccgtgtg ccccgagggc 60 accacgtgcc gggagccctt cctgctccgc ttctccaagc tcttcgcgga gctcagcgac 120 aggatcgtgc ccgtggcgat gaactaccgc gtggggctct tccacccgac gacggcgcgc 180 gggtggaaag ccatggaccc catcttcttc ttcatgaacn gcggcccgtg tacgaggtga 240 cgttcctgaa ccantccccg caaagcgacg tgcgcggcgg ggaagagccc 290 <210> 103 <211> 279 <212> DNA
<213> Zea mat's <400> 103 acgaggtgac gttcctgaac cagctccccg cagaggcgac gtgcgcggcg gggaagagcc 60 ccgttgatgt agccaactac gttcagcgga tactcgctgc cacgctcggg ttcgagtgca 120 ccaccctcac aaggaaggac aaatacacgg tgctcgccgg caacgacggc gtcctgaacg 180 ccaagccggc ggcggcccgg aagccggctt ggcagagccg cgtgaaggaa gtcctcgggt 240 tctgctccac taacaattac accttgccca gatctggac 279 <210> 104 <211> 315 <212> DNA
<213> Zea mat's <400> 104 gcccgagcgc atcgtctact acacctacaa gctcatgggc atcaggctcg tcgtcaaggg 60 caccccgccg ccgccgccca agaagggcca cccgggcgtc ctcttcgtct gcaaccaccg 120 caccgtgctc gaccccgtcg aggtggccgt ggcgctgcgc cgcaangtca gctgcgtcac 180 WO 00118889 3~ PCT/US99/22231 tacagcatct ccaagttctc cgagctcatc tcgcccatca aggccgtagc agnaaagcag 240 gtcgcaaatg gagcagnagc gagtcgatgg aagngaattg gcgactggtc atctgcncga 300 aggnacactg cggag 315 <210> 105 <211> 314 <212> DNA
<213> Zea mat's <400> 105 cgagacaccg agcacgtact accagcaaga tggtggcgtc tcccagattc aagcccatcg 60 aggagtgctg ctcggagggg cggtcggagc agacggtggc cgccgacctg gacggcacgc 120 tgctcatctc caggagcgcg ttcccctact acctcctcgt ggctctcgag gccggcagcg 180 tcctccgcgc cgcgctgctg ctcctgtccg tgccgttcgt ctacgtcacc tacgccttct 240 tctccgagtc gctggccatc agcacgctgg tgtacatctc cgtggcgggg ctcaaggtgc 300 gcanatcgag atgg 314 <210> 106 <211> 291 <212> DNA
<213> Zea mat's <400> 106 ctctgggtct ggggccgaga caccgagcac gtactaccag caagatggtg gcgtctccca 60 gattcaagcc catcgaggag tgctgctcgg aggggcggtc ggagcagacg gtggccgccg 120 acctggacgg cacgctgctc atntccagga gcgcgttccc ctactacctc ctcgtggctc 180 tcgaggccgg cagcgtcctc cgcgccgcgc tgctgctcct gtccgtgccg ttcgtctacg 240 tcacctacgc cttcttctcc gagtcgctgg ccatcagcac gctggtgtac a 291 <210> 107 <211> 300 <212> DNA
<213> Zea mat's <400> 107 gcacgcagca gtacgacgtc tctcctctgg gtctggggcc gagacaccga gcacgtacta 60 ccagcaagat ggtggcgtct cccagattca agcccatcga ggagtgctgc tcggaggggc 120 ggtcggagca gacggtggcc gccgacctgg acggcacgct gctcatctcc aggagcgcgt 180 tcccctacta cctcctcgtg gctctcgagg ccggcagcgt cctccgcgcc gcgctgctgc 240 tcctgtccgt gccgttcgtc tacgtcacct acgccttctt ctccgagtcg ctggccatca 300 <210> 108 <211> 284 <212> DNA
<213> Zea mat's <400> 108 gnggccgaga caccgagcac gtactaccag cangatggtg gcgtctccca gattcangcc 60 antcgaggag tgctgctcgg aggggcggtc ggagcagacg gtggccgccg acctggacgg 120 cacgctgctc atctccagga gcgcgttccc ctacnacctc ctcgtggctc tcgaggccgg 180 cagcgtcctc cgcgccgcgc tgctgctcct gtccgtgccg ttcgtctacg tcactacgcc 240 ttcttctccg agtcgctggc catcaanacg ctggtgtaca tctc 284 <210> 109 <211> 280 <212> DNA
<213> Zea mat's <400> 109 ctcctctggg tctggggccg agacaccgag cacgtactac cagcaagatg gtggcgtctc 60 ccagattcaa gcccatcgag gagtgctgct cggaggggcg gtcggagcag acggtggccg 120 ccgacctgga cggcacgctg ctcatctcca ggagcgcgtt ccnctactac ctcctcgtgg 180 ctctcgaggc cggcagcgtc ctccgcgccg cgctgctgct cctgtccgtn ccgttcgtct 240 acgtcaccta cgcnttnttc tccgagtcgc tggccatcag . 280 <210> 110 <211> 287 <212> DNA
<213> Zea mat's WO 00/18889 3~ . PCTIUS99/22231 <400> 110 cgtctctcct ctgggtctgg ggccgagaca ccgagcacgt actaccagca agatggtggc 60 gtctcccaga ttcaagccca tcgaggagtg ctgctcggag gggcggtcgg agcagacggt 120 ggccgccgac ctggacggca gctgctcatc tccaggagcg cgttccccta ctacctcctc 180 gtggctctcg aggccggcag cgtcctccgc gccgcgctgc tgctcctgtc cgtgccgttc 240 gtctacgtca ctacggcttc ttctccgagt cgctggccat cagcacg 287 <210> 111 <211> 286 <212> DNA
<213> Zea mays <400> 111 cgcacagtta cgacgtctct cctctgggtc tggggccgag acaccgagca cgtactacca 60 gcaagatggt ggcgtctccc agattcaagc ccatcgagga gtgctgctcg gaggggcggt 120 cggagcagac ggtggccgcc gacctggacg gcacgctgct catctccagg agcgcgttcc 180 cctactactc ctcgtgctct cgaggccggc aggtcctccg cgccgcgctg tgctcctgtc 240 gtgcgttcgt ctagtcacta cgcttttctc gancgtggca ataana 286 <210> 112 <211> 323 <212> DNA
<213> Zea mat's <400> 112 gt~attccct gaaggtacca caacaaatgg gagattcctg atttcgttcc aacatggtgc 60 attcatacct ggctaccctg ttcaacctgt tgttgtccgt tatccacatg tgcactttga 120 tcaatcatgg gggnatatat cgttattaaa gctcatgttt aagatgttca cccaatttca 180 taatttcatg gaggtagagt accttcctgt tgtctaccct cctgagatca agcaagagaa 240 tgcccttcat tttgcggagg ataccagcta tgctatggca cgtgccctca atgtcttgcc 300 aacttcctat tcatatggtg att 323 <210> 113 <211> 312 <212> DNA
<213> Zea mat's <400> 113 cgataaggcc cttttcgaag agcttctacc gtcggatcaa cagattcttg gccgagctgc 60 tgtggcttca gcttgtctgg gtggtggact ggtgggcagg tgttaaggta caactgcatg 120 cagatgagga aacttacaga tcaatgggta aagagcatgc actcatcata tcaaatcatc 180 ggagtgatat tgattggctc attggatgga tattggccca gcgttcaggg tgccttggaa 240 gtacacttgc tgtcatgaag aagtcatcca agttccttcc agttattggc tggtcaatgt 300 ggtttgcaga gt 312 <210> 114 <211> 279 <212> DNA
<213> Zea mat's <400> 114 agtggggtct ccaaaggttg aaagacttcc ctagaccatt ttggctagct ctttttgttg 60 agggtactcg ctttactcca gcaaagcttc tcgcagctca ggagtatgcg gcttcccagg 120 gcttaccagc tcctagaaat gtacttattc cacgtaccaa gggatttgta tctgccgtaa 180 gtattatgcg agattttgtt ccagccattt acgatacaac tgtaatagtt cctaaagatt 240 cccctcaacc aacaatgctg cggattttga aagggcaat 279 <210> 115 <211> 304 <212> DNA
<213> Zea mat's <400> 115 cgtcaacgcc atccaggccg tcctatttgt gacgataagg cccttttcga agagcttcta 60 ccgtcggatc aacagattct tggccgagct gctgtggctt cagcttgtct gggtggtgga 120 ctggtgggca ggtgttaagg tacaactgca tgcagatgag gaaacttaca gatcaatggg 180 taaagagcat gcactcatca tatcaaatca tcggagtgat attgattggc tcatggatgg 240 atattggccc agcgttcagg gtgccttgga agtacattgc tgtcatgaag aagtcatcca 300 agtt 304 WO 00118889 . PCTIUS99I22231 <210> 216 <211> 259 <212> DNA
<213> Zea mat's <400> 116 cttcctcctg tccggcctca tcgtcaacgc catccaggcc gtcctatttg tgacgataag 60 gcccntttcg aagagcttct aacgtcggat caacagattc ntggccgagc tgctgtggct 120 tcagcttgtc tgggtggtgg acnggtgggc aggtgttaag gtacaactgc atgcngatga 180 ggaaacttac agatcnatgg gtanagagca tgcactcatc atatcaaatc atcggagtga 240 tattgattgg cncattgga 259 <210> 117 <211> 235 <212> DNA
<213> Zea mat's <400> 117 attccacgta ccaagggatt tgtatctgct gtaagtatta tgcgagattt tgttccagcc 60 atttatgata caactgtaat agttcctaaa gattcccctc aaccaacaat gctgcggatt 120 ttgaaagggc aatcatcagt gatacatgtc cgcatgaaac gtcatgcaat gagtgagatg 180 ccaaaatcag atgaggatgt ttcaaaatgg tgtaaagaca tttttgtggc aaagg 235 <210> 118 <211> 282 <212> DNA
<213> Zea mat's <400> 118 tgagatgcca aaatcagatg atgacgtttc aaaatggtgt aaagacattt ttgtgacaaa 60 ggatgcctta ctggacaaac atttggcaac aggcactttc gatgaggaga ttagacctat 120 cggccgccca gtgaaatcat tgctggtgac cctgttttgg tcgtgcctgc tgttgtttgg 180 tgccatcgag ttcttcaagt ggacgcagct cctatcgaca tggagaggag tggcattcac 240 tgccgcagga tggcgctcgt gacaggggtc atgcacgtct tc 282 <210> 119 <211> 166 <212> DNA
<213> Zea mat's <400> 129 ctggtgggca ggcgttaagg tacaactaca tgcggatgag gacacttacc gatcaatggg 60 taaagagcat gcactcgtca tatcaaatca tcgaagtgat attgattggc ttattggatg 120 gatattggcc cagcgctcag ggtgccttgg aagtacgctc gctgtc 166 <210> 120 <211> 234 <212> DNA
<213> Zea mat's <400> 120 agtcanccaa gntccttcca gtcattggct ggtcaatgtg gtttgcagag tacctctttt 60 nggagaggag ctgggccaag gatgaaaaga cactaaagtg gggtctccaa aggttgaaag 120 acttccctag accatttngg ctagctcttn tttgtngagg gnantcgctt tactccagca 180 angnttntng aggnnncagn agnnncgggn ttcccanggg ttaacagncc cana 234 <210> 121 <211> 210 <212> DNA
<213> Zea mat's <400> 121 gtgagatgcn aaaatcagat gatgacgttt caaaatggtg taaagacatt tttgtggaca 60 aaggatgcct tactggacaa acatttggca acaggcactt tcgatgagga gattagacct 120 atcggccgcc cagtgaaatc atngctggtg accctgtnnt ggtcgtgcct gctgttgttt 180 ggtgccatcg agntcttcaa gtggacgcag 210 <210> 122 <211> 274 <212> DNA

<213> Zea mays <400> 122 acncccgaat ccgccgcgcg cgcnccgtcc tcgtcgccgg cggaggcgcc cgcnaccgcc 60 cacagcagcc tatcgccgga gaaggaacgc cgcggggagc ttttccacng ccatctcccg 120 tctgacccct ccgagatcgn aagcggcggc catggcgatc ccgctcgtgc tcgtcgtgct 180 cccgctcggc ctcctcttcc tcctg~ccgg cctcatcgtc aacaccatcc aggccatcct 240 atttgtgaca ataaggccct tttccaagag cttg 274 <210> 123 <211> 305 <212> DNA
<213> Zea mays <400> 123 ttgcactgag gaaaggccat tagggatata tcaagtacat acataagagc agcttgatga 60 agttgcctat ttttagctgg gcatttcaca tttttgagtt tatcccggta gaacggaaat 220 gggagattga tgaagcaatt attcagaaca agctatcaaa-atttaagaac ccgagagatc 180 ctatctggtt ggcggttttt cctgaaggca cggattatac tgagaagaaa tgcatcatga 240 gtcaagagta tgcttcagaa catggcttgc ctatgctaga acatgtcctc cttccaaaga 300 caagg <210> 124 <211> 279 <212> DNA
<213> Zea mays <400> 124 ccagattttc tggacaatgt gtatggcgtt gatccttctg aagtccacat ccacgtcaga 60 atggttcagc tccatcacat ccccacaaca gaagacaaga taacagaatg gatggncgag 120 aggtttaggc agaaggacca gctcctggca gatttcttca tgaaggggca tttcctgatg 180 aaaggaactg aaaggagatc tgtcgacgcc gagtgcctgg caaactttct taaccagtag 240 tatgcttgac ggccnatctg gtttgtacct aaactcttt 279 <210> 125 <211> 219 <212> DNA
<213> Zea mays <400> 125 agattttntg gacaatgtgt atggngttga tccttntgaa gtncacatcc acgtnagaat 60 ggttcagctc catcacatcc ccacaacagn agacaagata acagaangga tggtagagag 120 gtttaggcag aaggaccagc tcctggcaga tttcttcatg aaggggcact ttcctgatga 180 aggaactgaa ggagatctgt cgacgccgaa gtgcctggc 219 <210> 126 <211> 293 <212> DNA
<213> Zea mays <400> 126 taccatagat gctgtgtacg acatcacgat cgcntacaaa caccggcngc ngacatttct 60 ngacaacgtc tacngcgtgg ntccttcgga agtccacatc cacatcanca gcatccaggt 120 ctccgacata ncggcgtccg aaaaacgggg tggctggcng gntnngtgga gcggttcaag 180 gcntnganna acgagctngc tgttcggggc tttctaccgc ggctggggcc aatttcnccc 240 cgaacgaaag ggaaaaaggg gaaccgaagg ggggaacctg ttngaacggg ncc 293 <210> 127 <211> 6 <212> PRT
<213> conserved sequence <400> 127 Val Xaa Asn His Xaa Ser <210> 128 <211> 6 <212> PRT

WO 00/18889 4~ . PCT/US99122231 <213> conserved sequence <400> 128 Val Thr Tyr Sex Xaa Ser <210> 129 <211> 7 <212> PRT
<213> conserved sequence <400> 129 Val Xaa Leu Thr Arg Xaa Arg <210> 130 <211> 5 <212> PRT
<213> conserved sequence <400> 130 Cys Pro Glu Gly Thr <210> 131 <211> 5 <212> PRT
<213> conserved sequence <400> 131 Ile VaI Pro Val Ala <210> 132 <211> 7 <212> PRT
<213> conserved sequence <400> 132 Leu Xaa Xaa Gly Asp Leu Val <210> 133 <211> 6 <212> PRT
<213> conserved sequence <400> 133 Phe Xaa Xaa Gly Ala Phe <210> 13~
<211> 6 <212> PRT
<213> Synthetic Oligonucleotide <400> 134 Val Ala Asn Xaa Xaa Gln <210> 135 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 135 ccatccgctt caagggaacg acacccatca 30 <210> 136 <211> 31 <212> DNA
<213> Synthetic Oligonucleoti:de <400> 136 tccctgtctt gcttgatgaa cttaaagctt g 31 <210> 137 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 137 acagcaggag tgtctgatga tggcagattc 30 <210> 138 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 138 actggagttc cagccaaaaa tgcacctgtc 30 <210> 139 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 139 gatacaccct tgaaatcagg cgattttgct 30 <210> 140 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 140 ttgcaaattc aattcctgtt tcaccgggcc 30 <210> 141 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 141 gttttctgct attccagaag gcgtcaacaa 30 <210> 3.42 <211> 32 <212> ANA

<213> Synthetic Oligonucleotide <400> 142 cattgaagat ccgtccgtga agttncctta cc 32 <210> 143 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 143 tcgagctgtg atcgatgatt ggctgtgaag 30 <210> 144 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 144 gtctcttcaa aaacacacac acacgtctct 30 <210> 145 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 145 gtctcttcaa aaacacacac acacgtctct 30 <210> 146 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 146 gtagagagcc ttacttgctt cggtttagtc 30 <210> 147 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 147 acgtcatcgt acctgttgct attgactcac 30 <210> 148 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 148 acttttccat tgtcagggac tcctcgacac 30 <210> 149 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 149 acggtgtagg aagggaaagg attcaaaagg 30 <210> 150 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 150 gcgatgaact acagagtcgg attcttcctc 30 <210> 151 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 151 ccggtttacg agattacgtt cttgaaccag 30 <210> 152 <211> 30 <212> DNA

<213> Synthetic Oligonucleotide <400> 152 caatggagac aaggctcgaa agtgctaacc 30 <210> 153 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 153 attctctgaa catagttcgc cacggtcatg 30 <210> 154 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 154 gaaatccaac gccttcccaa tatcactctg 30 <210> 155 <211> 30 <2I2> DNA
<213> Synthetic Oligonucleotide <400> 155 cttcaacttt ccatcaggat cttggcacgt 30 <210> 156 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 156 accacttgtt agagacctta cctgcttagg 30 <210> 157 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 157 tcctacctac accatccaat ttctcgaccc 30 <210> 158 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 158 ctgcgtcaag tgagcaactc agttcttgca 30 <210> 159 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 159 tgggaagcag cacgttgttc agtatcggaa 30 <210> 160 <211> 30 <212> DNA
<213> Synthetic Oligonucleotide <400> 160 tagcctctgt gtaatctgtg ccctcgggga 30 <210> 161 <211> 1702 <212> DNA
<213> Simmondsia chinensis <400> 161 gaattctagc ctctctcctc ctgcaattct acttgctttc tacgatcttt ccctctctct 60 ctctaaaacc ttaaaattgg aatggaatcg tttaaaaata tgatcttttt gtaattgaat 120 tagtataatt atatctgggt aatcttgaat ttgttggtga ggccatgggg atcccagctg 180 cggctgtgat tgtaccgctt ggcttgctct tcttcttctc tggtctcttc atcaacttca 240 ttcaggcaat ttgttttgtg ctcgtgcggc cactgtcaaa gnntacatac agaaggatta 300 acagggtgct ggtggaattg ttgtggcttg agctgatatg gctcgtagat tggtgggcaa 360 gtgttaagat caagttgttc acagatcctg atacctttcg gctaatgggt aaagagcatg 420 cacttgtgat atcaaaccac agaagtgata ttgattggct tgttggatgg gtgttggccc 480 agagatcagg ctgcctggga agcacactgg ctgtcatgaa gaaatcatca aagtttctcc 540 cggtcatagg ttggtctatg tggttttctg agtacctttt tcttgagaga agctgggcca 600 aggatgaaag cacattgaag ttaggtcttc aacgcctcaa ggactaccct ctgcctttct 660 ggttggctct tttcgtagaa ggaacacgat ttacccaagc taaactttta gcagctcaag 720 aatatgctac ttcaatggga ttgccagttc ctagaaatac tttgatccct cgtactaagg 780 gatttgtttc agccgtgagc catatgcgtt cgtttgtccc ggccatatat gatgtaacgg 840 tggccatccc taaatcttct tcgcagccta caatgctcag acttttcaaa ggccagccat 900 ccacggttca tgtacacatc aagcgccgct cgatgaaaga tctccctgaa gcagcagatg 960 atgttgcaca atggtgtcga gacacattcg tcgcaaagga tgcactcctg gacaagcata atgtagatga cactttcgga gatgagtatc tgcaggacac tggccggcct ttgaaatctc tctttgtagc agtctcttgg gcattgattc tcatcctggg aggtttgaaa ttcctacgat ggtcgtccct tctatcatca tggaaggggg tcgccttctc agccgcatgc cttgtgctcg tcaccattct tatgcagatc ttaatccaat tttctcaatc cgagcgctcg actcctgcta aggtagcccc aggaaagccc aagaacatgg tatcagaacc cacggaaacg caacgacata agcagcacta aaagtatata tggaccccaa ctaagaagat tcagacgcaa gccacagttg attcaactgt tcagaatgtc aaatatagtt tgagaaacaa aagatcaaga ttagctgatg aagagcctaa tgaacctaca tacttggatc tgtcgtcgcc accgtctgct gctagctcgt tatcagaatt cgtgattccg ggaccgatcc cggatcttag ccttctatgc atggattatg atagtatctt aaatttcttt aatgatgtac cggaattata atgttagtta attaggggga tgagcattgt ttgggtttat atcgtggtaa atccttgtat tgtttataag atttgaagaa aattcgattc gagtgctctg as <210> 162 <211> 387 <212> PRT
<2I3> Simmondsia chinensis <400> 162 Met Gly Ile Pro Ala Ala Ala Val Ile Val Pro Leu Gly Leu Leu Phe Phe Phe Ser Gly Leu Phe Ile Asn Phe Ile Gln Ala Ile Cys Phe Val Leu Val Arg Pro Leu Ser Lys Thr Tyr Arg Arg Ile Asn Arg Val Leu Val Glu Leu Leu Trp Leu Glu Leu Ile Trp Leu Val Asp Trp Trp Ala Ser Val Lys Ile Lys Leu Phe Thr Asp Pro Asp Thr Phe Arg Leu Met Gly Lys Glu His Ala Leu Val Ile Ser Asn His Arg Ser Asp Ile Asp Trp Leu Val Gly Trp Val Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser Thr Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Ser Trp Ala Lys Asp Glu Ser Thr Leu Lys Leu Gly Leu Gln Arg Leu Lys Asp Tyr Pro Leu Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr Gln Ala Lys Leu Leu Ala Ala Gln Glu Tyr Ala Thr Ser Met Gly Leu Pro Val Pro Arg Asn Thr Leu Ile Pro Arg Thr Lys Gly Phe Val Ser Ala Val Ser His Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Val Thr Val Ala Ile Pro Lys Ser Ser Ser Gln Pro Thr Met Leu Arg Leu Phe Lys Gly Gln Pro Ser Thr Val His Va1 His Ile Lys Arg Arg Ser Met Lys Asp Leu Pro Glu Ala Ala Asp Asp Val Ala Gln Trp Cys Arg Asp Thr Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Asn Val Asp Asp Thr Phe Gly Asp Glu Tyr Leu Gln Asp Thr Gly Arg Pro Leu Lys Ser Leu Phe Val Ala Val Ser Trp Ala Leu Ile Leu Ile Leu Gly Gly Leu 305 31,0 315 320 Lys Phe Leu Arg Trp Ser Ser Leu Leu Ser Ser Trp Lys Gly Val Ala Phe Ser Ala Ala Cys Leu Val Leu Val Thr Ile Leu Met Gln Ile Leu Ile Gln Phe Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Ala Pro Gly Lys Pro Lys Asn Met Val Ser Glu Pro Thr Glu Thr Gln Arg His Lys Gln His <210> 163 <211> 43 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 163 aagcttgcat gcgtcgacac aatggttcat gcgaccaagt cag 43 <210> 164 <212> 35 WO PCTlUS99122231 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>164 ggtaccgtcg 35 actcacttct tggtgttgtt gatag <210>165 <211>44 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>165 ggatccgcgg 44 ccgcacaatg acgagcttta ctacttccct tcat <210>166 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>166 ggatcccctg 38 caggttagag atccattgat tctgcaat <210>167 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>167 ggatccgcgg 38 ccgcataatg gaatcagagc tcaaagat <210>168 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>168 ggatcccctg 38 caggtcattc ttctttctga tggaaatc <210>169 <211>41 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>169 ggatccgcgg ccgcacaatg actcgttcac aagatgtttc 41 a ~~

<210>170 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>170 ggatcccctg ctagccag 38 caggtcactt ctcttccaat <210>171 <211>46 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>171 ggatccgcgg agatctcgac tcttca 46 ccgcacaatg tccggtaata <210>172 <211>46 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>172 ggatcccctg actccgttat taccgg 46 caggttattt tttcttgaca <210>173 <211>39 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence; Synthetic Oligonucleotide <400>173 atatccgcgg aagctggaa 39 ccgcacaatg gttatggagc <210>174 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>174 ggatcccctg tcgaaagt 38 caggtcaatg gagacaaggc <210>175 <211>42 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400> 275 4$

ggatccgcgg 42 ccgcacaatg tccgccaaga tttcaatatt cc <210>176 <221>38 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>176 ggatcccctg 38 caggttaatt tttcttaact actccatt <210>177 <211>42 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>177 ggatccgcgg 42 ccgcacaatg ggagctcagg agaaacggcg cc <210>178 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>178 ggatcccctg 38 caggtcacgt cttctccttc ttcaccgg <210>179 <211>44 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <4O0>179 ggatccgcgg 44 ccgcacaatg gcggatcctg atctgtcttc tcct <210>180 <211>44 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <4oa>1so ggatcccctg caggttatgt tggggccaag tcaggtgcaa 44 agat <210>181 <211>44 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide WO 00/18889 49 . PCT/US99/22231 <400>181 ggatccgcgg gtgtaccaaa ttct 44 ccgcaaaatg gaaaaaaaga <210>182 <211>46 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>182 ggatcccctg ttgagggaat tttttg 46 caggttattt gtttactaat <210>183 <211>36 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>183 tcgacctgca tgctgc 36 ggaagcttaa ggatggtgat <210>184 <211>31 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>184 ggatccgcgg g 31 ccgcttactt ctccttctcc <210>185 <211>39 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>185 ggatccgcgg atgtcctag 39 ccgcacaatg tcttttaggg <210>186 <211>41 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>186 ggatcccctg caggtcaatc atccttaccc 41 tttggtttac c <210>187 <212>60 <212>DNA

<213>Artificial Sequence <220>

5~

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>187 atgtctttta tttcacaccg gggatgtcct 60 agaaagagga gatgaatttt ctgtgcggta <210>188 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <40d>188 tcaatcatcc gagagtgcac ttaccctttg 60 gtttaccctc tggaggcaga agattgtact <210>189 <211>44 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>189 ggatccgcgg 44 ccgcacaatg aagcattccc aaaaataccg tagg <210>190 <211>41 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>190 ggatcccctg 41 caggtcaatg attttttttc atcacaaata c <210>192 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence:5ynthetic Oligonucleotide <400>191 atgaagcatt tttcacaccg cccaaaaata 60 ccgtaggtat ggaatttatg ctgtgcggta <210>192 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of Artificial Sequence: Synthetic Oligonucleotide <400>192 tcaatgattt gagagtgcac tttttcatca 60 caaatacaag aataagaaaa agattgtact <210>193 <211>43 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>193 ggatccgcgg atttcttcga aac 43 ccgcacaatg ggttttgttg <210>194 <211>45 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic 0ligonucleotide <400>194 ggatcccctg ttaatatttt tttgc 45 caggttattt ggtctcaatt <210>195 <211>50 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>195 atgggttttg atggtcggtt ctgtgcggtatttcacaccg ttgatttctt 60 cgaaacatat <210>196 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>196 ttatttggtc caaggactcg agattgtactgagagtgcac tcaattttaa 60 tatttttttg <210>197 <211>44 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>197 ggatccgcgg ccaattggag agac 44 ccgcacaatg gaaaagtaca <210>198 <211>42 <212>DNA

<213>Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 198 ggatcccctg caggctactt cctcttttta cgttgatcgc tg 42 <210> 199 <211> 60 WO OO/I8889 52 . PCT/US99/22231 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 199 atggaaaagt acaccaattg gagagacaat ggtacgggaa ctgtgcggta tttcacaccg 60 <210> 200 <211> 60 <212> DNA
<213> Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>200 ctacttcctc atattccttc agattgtactgagagtgcac tttttacgtt 60 gatcgctgat <210>201 <211>41 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>202 ggatccgcgg aactcacgga g 41 ccgcacaatg cctgcaccaa <210>202 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>202 ggatcecctg ttcccttc 3$
caggctacgc atctccttct <210>203 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>203 atgcctgcac gcctcttcca ctgtgcggtatttcacaccg caaaactcac 60 ggagaaatct <210>204 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>204 ctacgcatct ttcttcctct agattgtactgagagtgcac ccttctttcc 60 cttcttcttc <zlo>205 <211>46 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence:.Synthetic Oligonucleotide <400>205 ggatccgcgg ctgccgatca taacgc 46 ccgcacaatg tctgctcccg <210>206 <211>44 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>206 ggatcccctg tgttctcttt tctg 44 caggtcattc tttcttttcg <210>207 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>207 atgtctgctc gccaaaccta ctgtgcggtatttcacaccg ccgctgccga 60 tcataacgct <210>208 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleoti.de <400>208 tcattctttc tcttaccagc agattgtactgagagtgcac ttttcgtgtt 60 ctcttttctg <210>209 <211>49 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>209 ggatccgcgg aaatagctca taaagttcg49 ccgcacaatg ctgcatcaaa <210>210 <211>49 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400> 210 WO . PCT/US99/22231 ggatcccctg taaagtttat aaactaacc49 caggtcaaaa aataaaacaa <220>211 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>211 atgctgcatc cgaaaagtcg ctgtgcggtatttcacaccg aaaaaatagc 60 tcataaagtt <210>212 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>222 tcaaaaaata taaccaaatt agattgtactgagagtgcac aaacaataaa 60 gtttataaac <210>223 <211>41 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>213 ggatccgcgg gtaggttctt g 42 ccgcacaatg agtgtgatag <210>214 <211>41 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>214 ggatcccctg acagatgaac c 41 caggttaatg catctttttt <210>215 <211>60 <212>DNA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence: Synthetic Oligonucleotide <400>215 atgagtgtga ttgaggtccg ctgtgcggtatttcacaccg taggtaggtt 60 cttgtattac <210>216 <211>60 <212>ANA

<213>Artificial Sequence <220>

<223>Description of ArtificialSequence:Synthetic ' Oligonucleotide <400> 216 ttaatgcatc ttttttacag atgaaccttc gttatgggta agattgtact gagagtgcac 60 <210> 217 <211> 381 <212> PRT
<213> Saccharomyces sp.
<220>
<400> 217 Met Ser Phe Arg Asp Val Leu Glu Arg Giy Asp Glu Phe Leu Glu Ala Tyr Pro Arg Arg Ser Pro Leu Trp Arg Phe Leu Ser Tyr Ser Thr Ser Leu Leu Thr Phe Gly Val Ser Lys Leu Leu Leu Phe Thr Cys Tyr Asn Vai Lys Leu Asn Gly Phe Glu Lys Leu G1u Thr Ala Leu Glu Arg Ser 5o s5 60 Lys Arg Glu Asn Arg Gly Leu Met Thr Val Met Asn His Met Ser Met Val Asp Asp Pro Leu Val Trp Ala Thr Leu Pro Tyr Lys Leu Phe Thr Ser Leu Asp Asn Ile Arg Trp Ser Leu G1y Ala His Asn Ile Cys Phe 100 105 1.10 Gln Asri Lys Phe Leu A1a Asn Phe Phe Ser Leu Gly Gln Val Leu Ser Thr Glu Arg Phe Gly Val Gly Pro Phe G1n Gly Ser I1e Asp Ala Ser T1e Arg Leu Leu Ser Pro Asp Asp Thr Leu Asp Leu Glu Trp Thr Pro His Ser Glu Val Ser Ser Ser Leu Lys Lys Ala Tyr Ser Pro Pro I1e Ile Arg Ser Lys Pro Ser Trp Val His Val Tyr Pro Glu Gly Phe Val Leu Gln Leu Tyr Pro Pro Phe Glu Asn Ser Met Arg Tyr Phe Lys Trp Gly Ile Thr Arg Met Ile Leu Giu Ala Thr Lys Pro Pro Ile Val Val Pro Ile Phe Ala Thr Gly Phe Glu Lys Ile Aia Ser Glu Ala Val Thr Asp Ser Met Phe Arg Gln Ile Leu Pro Arg Asn Phe Gly Ser Glu Ile Asn Val Thr Ile Gly Asp Pro Leu Asn Asp Asp Leu.Ile Asp Arg Tyr Arg Lys Glu Trp Thr His Leu Val Glu Lys Tyr Tyr Asp Pro Lys Asn Pro Asn Asp Leu Ser Asp Glu Leu Lys Tyr Gly Lys Giu Ala Gln Asp Leu Arg Ser Arg Leu Ala Ala Glu Leu Arg Ala His Val Ala Glu Ile Arg Asn Glu Val Arg Lys Leu Pro Arg G1u Asp Pro Arg Phe Lys Ser Pro Ser Trp Trp Lys Arg Phe Asn Thr Thr Glu Gly Lys Ser Asp Pro Asp Val Lys Val Ile Gly Glu Asn Trp Ala Tle Arg Arg Met Gln Lys Phe Leu Pro Pro Glu G1y Lys Pro Lys G1y Lys Asp Asp ' <210> 218 <211> 396 <212> PRT
<213> Saccharomyces sp.
<220>
<400> 228 Met Lys His Ser Gln Lys Tyr Arg Arg Tyr Gly Ile Tyr Glu Lys Thr Gly Asn Pro Phe Ile Lys Gly Leu Gln Arg Leu Leu Ile Ala Cys Leu Phe Ile Ser Gly Ser Leu Ser Ile Val Val Phe Gln Ile Cys Leu Gln Val Leu Leu Pro Trp Ser Lys Ile Arg Phe Gln Asn Gly Ile Asn Gln Ser Lys Lys Ala Phe Ile Val Leu Leu Cys Met Tle Leu Asn Met Val Ala Pro Ser Ser Leu Asn Val Thr Phe Glu Thr Ser Arg Pro Leu Lys Asn Ser Ser Asn Ala Lys Pro Cys Phe Arg Phe Lys Asp Arg Ala Ile Ile Ile Ala Asn His Gln Met Tyr Ala Asp Trp Ile Tyr Leu Trp Trp Leu Ser Phe Val Ser Asn Leu Gly Gly Asn Val Tyr Ile Ile Leu Lys Lys Ala Leu Gln Tyr Ile Pro Leu Leu Gly Phe Gly Met Arg Asn Phe Lys Phe Ile Phe Leu Ser Arg Asn Trp G1n Lys Asp Glu Lys Ala Leu Thr Asn Ser Leu Val Ser Met Asp Leu Asn Ala Arg Cys Lys Gly Pro Leu Thr Asn Tyr Lys Ser Cys Tyr Ser Lys Thr Asn Glu Sex Ile Ala Ala Tyr Asn Leu Ile Met Phe Pro G1u Gly Thr Asn Leu Ser Leu Lys Thr Arg Glu Lys Ser Glu Ala Phe Cys Gln Arg Ala His Leu Asp His Val Gln Leu Arg His Leu Leu Leu Pro His Ser Lys Gly Leu Lys Phe WD 001i$$$9 5~ PCT/US99/22233 A1a Val Glu Lys Leu Ala Pro Ser Leu Asp Ala Ile Tyr Asp Val Thr Ile Gly Tyr Ser Pro Ala Leu Arg Thr Glu Tyr Val Gly Thr Lys Phe Thr Leu Lys Lys Ile Phe Leu Met Gly Val Tyr Pro Glu Lys Val Asp Phe Tyr Ile Arg Glu Phe Arg Val Asn Glu Ile Pro Leu Gln Asp Asp Glu Val Phe Phe Asn Trp Leu Leu Gly Val Trp Lys Glu Lys Asp Gln Leu Leu Glu Asp Tyr Tyr Asn Thr Gly Gln Phe Lys Ser Asn Ala Lys Asn Asp Asn Gln Ser Ile Val Val Thr Thr Gln. Thr Thr Gly Phe Gln His Glu Thr Leu Thr Pro Arg Ile Leu Ser Tyr Tyr Gly Phe Phe Ala Phe Leu Ile Leu Val Phe Val Met Lys Lys Asn His <210> 219 <211> 479 <212> PRT
<213> Saccharomyces sp.
<220>
<400> 219 Met Gly Phe Val Asp Phe Phe Giu Thr Tyr Met Val Gly 5er Arg Val Gln Phe Lys Gln Leu Asp Ile Ser Asp Trp Leu Ser Leu Thr Pro Arg Leu Leu Ile Leu Phe Gly Tyr Phe Tyr Leu His Ser Phe Phe Thr Ala Ile Asn Gln Phe Leu Gln Phe Ile Asn Thr Asn Ser Phe Cys Leu Arg Leu His Leu Leu Tyr Asp Arg Phe Trp Ser His Val Pro Ile Ile Gly Glu Tyr Lys Ile Arg Leu Leu Ser Arg Ala Leu Thr Tyr Ser Lys Leu Lys Ile Ile Pro Thr Leu Asp Lys Val Leu Glu Ala Ile Glu Ile Trp Phe Gln Leu His Leu Val Glu Met Thr Phe Glu Lys Lys Lys Asn Val G1n Ile Phe Ile Thr G1u Gly Ser Asp Asp Leu Asn Phe Phe Lys Asp Ser Lys Phe Gln Thr Thr Leu Met Ile Cys Asn His Arg Ser Val Asn Asp Tyr Thr Leu Ile Asn Tyr Leu Phe Leu Lys Ser Cys Pro Thr Lys WO 00/18889 5g PCT/US99122231 Phe Tyr Thr Lys Trp Glu Phe Leu Gln Lys Leu Arg Lys Gly G1u Asp Leu Ala Glu Trp Pro Gln Leu Lys Phe Leu Giy Trp Gly Lys Met Phe Asn Phe Pro Arg Leu Asp Leu Leu Lys Asn Ile Phe Phe Lys Asp Glu Thr Leu Ala Leu Ser Ser Asn Glu Leu Arg Asp Ile Leu Glu Arg Gln Asn Asn Gln Ala Ile Thr Ile Phe Pro Glu Val Asn Ile Met Ser Leu Glu Leu Ser Ile Ile Gln Arg Lys Leu His Gln Asp Phe Pro Phe Val Ile Asn Phe Tyr Asn Leu Leu Tyr Pro Arg Phe Lys Asn Phe Thr Thr Leu Met Ala Ala Phe Ser Ser Ile Lys Asn Ile Lys Arg Lys Lys Asn Arg Asn Asn Ile Ile Lys Glu Ala Arg Tyr Leu Phe His Arg Glu Leu Asp Lys Leu Val His Lys Ser Met Lys Met Glu Ser Ser Lys Val Ser Asp Lys Thr Thr Pro Pro Met Ile Val Asp Asn Ser Tyr Leu Leu Thr Lys Lys Glu Glu Ile Ser Ser Gly Lys Pro Lys Val Val Arg Ile Asn Pro Tyr Ile Tyr Asp Va1 Thr Ile Ile Tyr Tyr Arg Val Lys Tyr Thr Asp Ser Gly His Asp His Thr Asn Gly Asp Leu Arg Leu His Lys Gly Tyr Gln Leu Glu Gln Ile Ser Pro Thr Ile Phe Glu Met Ile Gln Pro Glu Met Glu Ser Glu Asn Asn Ile Lys Asp Lys Asp Pro Ile Val Val Met Val Asn Val Lys Lys His Gln Ile Gln Pro Leu Leu Ala Tyr Asn Asp Glu Ser Leu Glu Lys Trp Leu Glu Asn Arg Trp Ile Glu Lys Asp Arg Leu Ile Glu Ser Leu Gln Lys Asn Ile Lys Ile Glu Thr Lys <210> 220 <211> 300 <212> PRT
<213> Saccharomyces sp.
<400> 220 Met Glu Lys Tyr Thr Asn Trp Arg Asp Asn Gly Thr Gly Ile Ala Pro Phe Leu Pro Asn Thr Ile Arg Lys Pro Ser Lys Val Met Thr Ala Cys WO 00/18889 59 PCT/US99/2223!
Leu Leu Gly Ile Leu Gly Val Lys Thr Ile Ile Met~Leu Pro Leu Ile Met Leu Tyr Leu Leu Thr Gly Gln Asn Asn Leu Leu Gly Leu Ile Leu Lys Phe Thr Phe Ser Trp Lys Glu Glu Ile Thr Val Gln Gly Ile Lys Lys Arg Asp Val Arg Lys Ser Lys His Tyr Pro Gln Lys Gly Lys Leu Tyr Ile Cys Asn Cys Thr Ser Pro Leu Asp Ala Phe Ser Val Val Leu Leu Ala Gln Gly Pro Val Thr Leu Leu Val Pro Ser Asn Asp Ile Val Tyr Lys Val Ser Ile Arg Glu Phe Ile Asn Phe Ile Leu Ala Gly Gly Leu Asp Ile Lys Leu Tyr Gly His Glu Val A1a Glu Leu Ser Gln Leu Gly Asn Thr Val Asn Phe Met Phe Ala Glu Gly Thr Ser Cys Asn G1y Lys Ser Val Leu Pro Phe Ser Ile Thr Gly Lys Lys Leu Lys Glu Phe 180 185 1:90 Ile Asp Pro Ser Ile Thr Thr Met Asn Pro Ala Met Ala Lys Thr Lys Lys Phe Glu Leu Gln Thr Ile Gln Ile Lys Thr Asn Lys Thr Ala Ile Thr Thr Leu Pro Ile Ser Asn Met Glu Tyr Leu Ser Arg Phe Leu Asn Lys Gly Ile Asn Val Lys Cys Lys Ile Asn Glu Pro Gln Val Leu Ser Asp Asn Leu Glu Glu Leu Arg Val Ala Leu Asn Gly Gly Asp Lys Tyr Lys Leu Val Ser Arg Lys Leu Asp Val Glu Ser Lys Arg Asn Phe Val Lys Glu Tyr Ile Ser Asp Gln Arg Lys Lys Arg Lys <210> 221 <211> 759 <212> PRT

<213> Saccharomyces sp.

<400> 221 Met Pro Pro Leu ThrGluLys PheAlaSer SerLysSer Thr Ala Lys G1n Lys Thr Tyr SerSerIle GluAlaLys SerValLys Thr Thr Asn Ser Ala Gln Tyr IleTyrGln GluProSer AlaThrLys Lys Asp Ala Ile Leu Ser Ala ThrTrpLeu LeuTyrAsn IlePheHis Cys Tyr Ile WO 00/18889 6~ PCT/US99/22231 Phe Phe Arg Glu Ile Arg Gly Arg Gly Ser Phe Lys Val Pro Gln Gln 65 70 75 ~ 80 Gly Pro Val Ile Phe Val Ala Ala Pro His Ala Asn Gln Phe Val Asp Pro Val Ile Leu Met Gly Glu Val Lys Lys Ser Val Asn Arg Arg Val Ser Phe Leu Ile Ala Glu Ser Ser Leu Lys Gln Pro Pro Ile Gly Phe Leu Ala Ser Phe Phe Met Ala Ile Gly Va1 Val Arg Pro Gln Asp Asn Leu Lys Pro Ala Glu Gly Thr Ile Arg Val Asp Pro Thr Asp Tyr Lys Arg Va1 Ile Gly His Asp Thr His Phe Leu Thr Asp Cys Met Pro Lys Gly Leu Ile Gly Leu Pro Lys Ser Met Gly Phe Gly Glu Ile Gln Ser Tle Glu Ser Asp Thr Ser Leu Thr Leu Arg Lys Glu Phe Lys Met Ala Lys Pro Glu Ile Lys Thr Ala Leu Leu Thr Gly Thr Thr Tyr Lys Tyr Ala AIa Lys Val Asp Gln Ser Cys Val Tyr His Arg Val Phe Glu His Leu Ala His Asn Asn Cys Ile Gly Ile Phe Pro Glu Gly Gly Ser His Asp Arg Thr Asn Leu Leu Pro Leu Lys Ala Gly Val Ala I1e Met Ala Leu Gly Cys Met Asp Lys His Pro Asp Val Asn Val Lys Ile Val Pro Cys Giy Met Asn Tyr Phe His Pro His Lys Phe Arg Ser Arg Ala Val Val Glu Phe Gly Asp Pro Ile Glu Ile Pro Lys Glu Leu Val Ala Lys Tyr His Asn Pro Glu Thr Asn Arg Asp Ala Val Lys Glu Leu Leu Asp Thr Ile Ser Lys Gly Leu Gln Ser Val Thr Val Thr Cys Ser Asp Tyr Glu Thr Leu Met Val Val Gln Thr 21e Arg Arg Leu Tyr Met Thr Gln Phe Ser Thr Lys Leu Pro Leu Pro Leu Ile Val Glu Met Asn Arg Arg Met Val Lys Gly Tyr Glu Phe Tyr Arg Asn Asp Pro Lys Ile Ala Asp Leu Thr Lys Asp Ile Met Ala Tyr Asn Ala Ala Leu Arg His Tyr Asn Leu Pro Asp His Leu Val Glu Glu Ala Lys Val Asn Phe Ala Lys Asn WO 00/18889 61 PC'1'IUS99/22231 Leu Gly Leu Val Phe Phe Arg Ser Ile Gly Leu Cys Ile Leu Phe Ser Leu Ala Met Pro Gly Ile Ile Met Phe Ser Pro Val Phe Ile Leu A1a Lys Arg Ile Ser Gln Glu Lys Ala Arg Thr Ala Leu Ser Lys Ser Thr Val Lys Ile Lys Ala Asn Asp Val Ile Ala Thr Trp Lys Ile Leu Ile Gly Met Gly Phe Ala Pro Leu Leu Tyr Ile Phe Trp Ser VaI Leu Ile Thr Tyr Tyr Leu Arg His Lys Pro Trp Asn Lys Ile Tyr Val Phe Ser Gly Ser Tyr Ile Ser Cys Val Ile Val Thr Tyr Ser Ala Leu Ile Val Gly Asp Ile Gly Met Asp Gly Phe Lys Ser Leu Arg Pro Leu Val Leu Ser Leu Thr Ser Pro Lys Gly Leu Gln Lys Leu Gln Lys Asp Arg Arg Asn Leu Ala Glu Arg Tle Ile Glu Val Val Asn Asn Phe Gly Ser Glu Leu Phe Pro Asp Phe Asp Ser Ala Ala Leu Arg Glu Glu Phe Asp Val.

Ile Asp Glu Glu Glu Glu Asp Arg Lys Thr Ser Glu Leu Asn Arg Arg Lys Met Leu Arg Lys Gln Lys Tle Lys Arg Gln Glu Lys Asp Ser Ser Ser Pro Ile Tle Ser Gln Arg Asp Asn His Asp Ala Tyr Glu His His Asn Gln Asp Ser Asp Gly Val Ser Leu Val Asn Ser Asp Asn Ser Leu Ser Asn Ile Pro Leu Phe Ser Ser Thr Phe His Arg Lys Ser Glu Ser Ser Leu Ala Ser Thr Ser Val Ala Pro Ser Ser Ser Ser Glu Phe Glu Val Glu Asn Glu Ile Leu Glu Glu Lys Asn Gly Leu Ala Ser Lys Ile Ala Gln Ala Val Leu Asn Lys Arg Ile Gly Glu Asn Thr Ala Arg Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Gly Lys Glu Gly Asp Ala <210> 222 <211> 743 <212> PRT
<213> Saccharomyces sp.
<400> 222 WO 00/18889 (~ PCT/US99/22231 Met Ser Ala Pro Ala Ala Asp His Asn Ala Ala Lys Pro Ile Pro His Val Pro Gln A1a Ser Arg Arg Tyr Lys Asn Ser Tyr Asn Gly Phe Val Tyr Asn Ile His Thr Trp Leu Tyr Asp Val Ser Val Phe Leu Phe Asn Ile Leu Phe Thr Ile Phe Phe Arg Glu Ile Lys Val Arg Gly Ala Tyr Asn Val Pro Glu Val Gly Val Pro Thr Ile Leu Val Cys Ala Pro His Ala Asn Gln Phe Ile Asp Pro Ala Leu Val Met Ser Gln Thr Arg Leu Leu Lys Thr Ser Ala Gly Lys Ser Arg Ser Arg Met Pro Cys Phe Val Thr Ala Glu Ser Ser Phe Lys Lys Arg Phe Ile Sex Phe Phe Gly His Ala Met Gly Gly Ile Pro Val Pro Arg Ile Gln Asp Asn Leu Lys Pro Val Asp Glu Asn Leu Glu Ile Tyr Ala Pro Asp Leu Lys Asn His Pro G1u Ile Ile Lys Gly Arg Ser Lys Asn Pro Gln Thr Thr Pro Val Asn Phe Thr Lys Arg Phe Ser Ala Lys Ser Leu Leu Gly Leu Pro Asp Tyr Leu Ser Asn Ala Gln Ile Lys Glu Ile Pro Asp Asp Glu Thr Ile Ile Leu Ser Ser Pro Phe Arg Thr Ser Lys Ser Lys Val Val Glu Leu Leu Thr Asn Gly Thr Asn Phe Lys Tyr Ala Glu Lys Ile Asp Asn Thr Glu Thr Phe Gln Ser Val Phe Asp His Leu His Thr Lys Gly Cys Val Gly Ile Phe Pro G1u Gly Gly Ser His Asp Arg Pro Ser Leu Leu Pro Ile Lys Ala G1y Val Ala IIe Met Ala Leu Gly Ala Val Ala Ala Asp Pro Thr Met Lys Val A1a Val Val Pro Cys Gly Leu His Tyr Phe His Arg Asn Lys Phe Arg Ser Arg Ala Val Leu Glu Tyr Gly Glu Pro I1e Val Va1 Asp Gly Lys Tyr Gly Glu Met Tyr Lys Asp Ser Pro Arg Glu Thr 325 330 335 ' Vai Ser Lys Leu Leu Lys Lys Ile Thr Asn Ser Leu Phe Ser Val Thr Glu Asn Ala Pro Asp Tyr Asp Thr Leu Met Val Ile Gln Ala Ala Arg Arg Leu Tyr Gln Pro Val Lys Val Arg Leu Pro Leu Pro Ala Ile Val Glu Ile Asn Arg Arg Leu Leu Phe Gly Tyr Ser Lys Phe Lys Asp Asp Pro Arg I1e Ile His Leu Lys Lys Leu Val Tyr Asp Tyr Asn Arg Lys Leu Asp Ser Val Gly Leu Lys Asp His Gln Val Met Gln Leu Lys Thr Thr Lys Leu Glu Ala Leu Arg Cys Phe VaI Thr Leu Ile Val Arg Leu Ile Lys Phe Ser Val Phe Ala Ile Leu Ser Leu Pro Gly Ser Ile Leu Phe Thr Pro Ile Phe Ile Ile Cys Arg Val Tyr Ser Glu Lys Lys Ala Lys G1u Gly Leu Lys Lys Ser Leu Val Lys Ile Lys G1y Thr Asp Leu Leu Ala Thr Trp Lys Leu Ile Val Ala Leu Ile Leu Ala Pro Ile Leu Tyr Val Thr Tyr Ser Ile Leu Leu Ile Ile Leu Ala Arg Lys Gln His Tyr Cys Arg Ile Trp Val Pro Ser Asn Asn Ala Phe Ile Gln Phe Val Tyr Phe Tyr Ala Leu Leu Val Phe Thr Thr Tyr Ser Ser Leu Lys Thr Gly Glu Ile Gly Val Asp Leu Phe Lys Ser Leu Arg Pro Leu Phe Val Ser Ile Val Tyr Pro Gly Lys Lys Iie Glu Glu Ile Gln Thr Thr Arg Lys Asn Leu Ser Leu Glu Leu Thr Ala Val Cys Asn Asp Leu Gly Pro Leu Val Phe Pro Asp Tyr Asp Lys Leu Ala Thr Glu Ile Phe Ser Lys Arg Asp Gly Tyr Asp Va1 Ser Ser Asp Ala Glu Ser Ser Ile Ser Arg Met Ser Va1 Gln Ser Arg Sex Arg Ser Ser Ser Ile His Ser Ile Gly Ser Leu Ala Ser Asn Ala Leu Ser Arg Val Asn Ser Arg Gly Ser Leu Thr Asp Ile Pro Ile Phe Ser Asp Ala Lys Gln G1y G1n Trp Lys Ser Glu Gly G1u Thr Ser Glu Asp Glu Asp Glu Phe Asp Glu Lys Asn Pro Ala I1e Val Gln Thr Ala Arg Ser Ser Asp Leu Asn Lys Glu Asn Ser Arg Asn Thr Asn I1e Ser Ser Lys Ile Ala Ser Leu Val Arg Gln Lys Arg Glu His Giu Lys Lys G1u WO 00/18889 ~4 PCT/US99/22231 <210> 223 <211> 397 <212> PRT
<213> Saccharomyces sp.
<400> 223 Met Leu His Gln Lys Ile Ala His Lys Val Arg Lys Val Val Val Pro Gly Ile Ser Leu Leu Ile Phe Phe Gln Gly Cys Leu Ile Leu Leu Phe Leu Gln Leu Thr Tyr Lys Thr Leu Tyr Cys Arg Asn Asp Ile Arg Lys Gln Ile Gly Leu Asn Lys Thr Lys Arg Leu Phe Ile Val Leu Val Ser Ser Ile Leu His Val Val Ala Pro Sex Ala Va1 Arg Ile Thr Thr Glu Asn Ser Sex Val Pro Lys Gly Thr Phe Phe Leu Asp Leu Lys Lys Lys Arg Ile Leu Ser His Leu Lys Ser Asn Ser Val Ala Ile Cys Asn His Gln Ile Tyr Thr Asp Trp Ile Phe Leu Trp Trp Leu Ala Tyr Thr Ser Asn Leu Gly Ala Asn Val Phe Ile Ile Leu Lys Lys Ser Leu Ala Ser Ile Pro Ile Leu Gly Phe G1y Met Arg Asn Tyr Asn Phe Ile Phe Met Ser Arg Lys Trp Ala Gln Asp Lys Ile Thr Leu Ser Asn Ser Leu Ala Gly Leu Asp Ser Asn Ala Arg Gly Ala Gly Ser Leu Ala Gly Lys Ser Pro Glu Arg Ile Thr Glu G1u Gly Glu Ser Ile Trp Asn Pro Glu Val Tle Asp Pro Lys Gln I1e His Trp Pro Tyr Asn Leu Ile Leu Phe Pro Glu G1y Thr Asn Leu Ser Ala Asp Thr Arg Gln Lys Ser Ala Lys Tyr Ala Ala Lys Ile Gly Lys Lys Pro Phe Lys Asn Val Leu Leu Pro His Ser Thr Gly Leu Arg Tyr Ser Leu Gln Lys Leu Lys Pro Ser Ile Glu Ser Leu Tyr Asp Ile Thr Ile Gly Tyr Ser Gly Val Lys Gln Glu Glu Tyr Gly Glu Leu Ile Tyr Gly Leu Lys Ser Ile Phe Leu Glu G1y Lys Tyr Pro Lys Leu Val Asp T1e His Ile Arg Ala Phe Asp Val Lys Asp Ile Pro Leu Glu Asp Glu Asn Glu Phe Ser Glu Trp Leu Tyr Lys Ile Trp Ser Glu Lys Asp Ala Leu Met Glu Arg Tyr Tyr Ser Thr Gly Ser Phe Val Ser Asp Pro Glu Thr Asn His Ser Val Thr Asp Ser Phe Lys Tle Asn Arg Ile Glu Leu Thr Glu Val Leu Ile Leu Pro Thr Leu Thr Ile Ile Trp Leu Val Tyr Lys Leu Tyr Cys Phe Ile Phe <210> 224 <211> 303 <212> PRT
<213> Saccharomyces sp.
<400> 224 Met Ser Val Ile Gly Arg Phe Leu Tyr Tyr Leu Arg Ser Val Leu Val Val Leu Ala Leu Ala Gly Cys Gly Phe Tyr Gly Val Ile Ala Ser Ile Leu Cys Thr Leu Ile Gly Lys Gln His Leu Ala Gln Trp Ile Thr Ala Arg Cys Phe Tyr His Val Met Lys Leu Met Leu Gly Leu Asp Val Lys Val Val Gly Glu Glu Asn Leu Ala Lys Lys Pro Tyr Ile Met Ile Ala Asn His Gln Ser Thr Leu Asp Ile Phe Met Leu G1y Arg I1e Phe Pro Pro Gly Cys Thr Val Thr Ala Lys Lys Ser Leu Lys Tyr Val Pro Phe Leu Gly Trp Phe Met Ala Leu Ser Gly Thr Tyr Phe Leu Asp Arg Ser Lys Arg Gln Glu Ala I1e Asp Thr Leu Asn Lys Gly Leu Glu Asn Val Lys Lys Asn Lys Arg Ala Leu Trp Val Phe Pro Glu Gly Thr Arg Ser Tyr Thr Ser Glu Leu Thr Met Leu Pro Phe Lys Lys Gly Ala Phe His Leu Ala Gln Gln Gly Lys Ile Pro I1e Val Pro Val Val Val Ser Asn Thr Ser Thr Leu Val Ser Pro Lys Tyr Gly Val Phe Asn Arg Gly Cys Met Tle Val Arg Ile Leu Lys Pro Ile Ser Thr Glu Asn Leu Thr Lys Asp Lys Ile Gly Glu Phe Ala Glu Lys Val Arg Asp Gln Met Val Asp Thr Leu Lys Glu Ile Gly Tyr Ser Pro Ala Ile Asn Asp Thr Thr Leu Pro Pra Gln Ala Ile Glu Tyr Ala Ala Leu Gln His Asp Lys Lys Val WO 00/18889 (6 . PCT/US99/22231 Asn Lys Lys Ile Lys Asn Glu Pro Val Pro Ser Val Ser Ile Ser Asn Asp Val Asn Thr His Asn Glu Gly Ser Ser Val Lys Lys Met His <210> 225 <221> 1146 <212> DNA
<213> Saccharomyces sp.
<400> 225 atgtctttta gggatgtcct agaaagagga gatgaatttt tagaagccta tcccagaaga 60 agcccccttt ggagatttct ttcatacagt acatcattac tgaccttcgg tgtatcaaaa 120 ctgcttcttt tcacatgcta taatgtcaaa ttgaatggtt ttgaaaaatt agaaactgcc 180 ttggaacgtt ccaaaaggga aaatagaggc cttatgacgg tcatgaacca tatgagtatg 240 gtcgatgatc cgttagtttg ggcaacacta ccatataagt tatttacgtc tttggacaac 300 ataagatggt ctttgggtgc acataatatt tgctttcaaa ataaatttct ggccaacttt 360 ttctcacttg gccaagtcct ttcaacagaa agatttgggg tgggcccatt tcaaggttct 420 atagatgctt caataagatt gttaagccct gacgacactt tagacttgga atggacccct 480 cactctgagg tctcttcttc gctaaaaaaa gcctactccc cgcccataat aaggtcgaag 540 ccatcttggg tccatgttta tccagaagga tttgtactac aattatatcc gccttttgaa 600 aattcgatga ggtattttaa atggggtatt accagaatga tcctagaagc aacaaagccg 660 cccattgtag taccaatatt tgctacaggg tttgaaaaaa tagcatccga agcagtcaca 720 gattcaatgt ttagacaaat tctaccaaga aactttggct ctgaaataaa tgttaccata 780 ggggatcctt taaatgatga tttaatcgac aggtatagaa aagaatggac acatttggtt 840 gaaaaatact atgatcccaa aaatcctaac gacctctctg acgaattgaa atatggtaaa 900 gaggcgcaag atttaagaag cagattagcc gctgaactga gagcccatgt tgctgaaatt 960 agaaatgaag ttcgcaaatt accacgcgaa gaccctaggt tcaaatcccc ctcatggtgg aagcggttca acaccacgga aggtaaatcg gacccagatg ttaaagtcat tggcgaaaat tgggcaataa ggaggatgca aaagtttctg cctccagagg gtaaaccaaa gggtaaggat gattga <210> 226 <211> 1191 <212> DNA
<213> Saccharomyces sp.
<400> 226 atgaagcatt cccaaaaata ccgtaggtat ggaatttatg aaaagactgg taatcccttt 60 ataaaagggt tgcaaaggct gcttatcgct tgcttgttca tttcaggctc gctgagtatt 120 gtcgtttttc agatctgtct acaggtgctt ctcccttgga gcaagattag atttcaaaat 180 ggtataaatc aaagtaagaa ggcttttatc gttttattat gcatgatctt gaacatggtg 240 gctccctctt ctttgaatgt cacttttgaa acatcgcggc cattgaagaa ctcttctaac 300 gccaagccat gctttagatt taaagacagg gctataataa ttgcaaatca tcaaatgtat 360 gcagactgga tttatctctg gtggctttcc tttgtttcaa atttgggtgg taacgtttat 420 atcatcctga agaaagctct gcagtacata ccattactgg gatttggcat gcgaaatttt 480 aagtttatat ttttaagtag gaactggcaa aaggatgaga aagctttaac aaatagtttg 540 gtttctatgg acttaaacgc gaggtgcaag gggcccctta caaattataa gagttgttat 600 tccaagacaa atgaatccat tgccgcttat aatttaatca tgttccctga gggtacaaat 660 ctaagcctca agacaagaga aaaaagcgag gcattctgtc aaagagcaca tttggaccat 720 gtccaattaa gacatttgtt attaccgcac tctaaaggct tgaagtttgc agtagaaaaa 780 ctagctccta gtttagatgc tatctacgat gtcactattg gatattctcc cgccttgaga 840 acggaatacg tcggcaccaa attcaccttg aagaaaatat tcttaatggg tgtctatccg 900 gagaaagtag atttttatat tagggaattt agagttaatg agatcccttt gcaagatgac 960 gaagtttttt tcaattggtt actgggcgtg tggaaagaaa aagatcaact gctagaagac tactacaaca caggccaatt taaaagtaat gctaaaaatg acaaccaatc catcgttgtt acgacacaaa cgactggatt tcagcacgaa acattgacac cccgtatcct ttcatattac gggttcttcg cttttcttat tcttgtattt gtgatgaaaa aaaatcattg a WO 00/18889 ('7 PCT/US99/22231 <210> 227 <211> 1440 <212> DNA
<213> Saccharomyces sp.
<400> 227 atgggttttg ttgatttctt cgaaacatat atggtcggtt ctagggtcca gttcaaacag 60 ttagatattt ctgattggtt gagtctgacc ccaaggttgc ttattctttt tggctatttt 120 taccttcatt ctttttttac tgcaatcaat caattcctac agttcattaa cacgaattcc 180 ttctgtctta gactgcattt actatatgac agattttggt cgcatgtgcc cataataggt 240 gagtacaaaa ttcggctgct ctcgagggca ctgacatata gtaaactgaa aataatacca 300 actttagaca aggtgctgga ggcgattgaa atttggtttc agctacattt agttgaaatg 360 accttcgaaa aaaaaaaaaa cgtccaaatt ttcataaccg agggaagtga tgacctaaac 420 ttttttaaag atagcaaatt ccaaaccaca ttaatgatat gtaatcatcg atcagtgaat 480 gactacacat tgattaatta cctttttctc aaaagttgtc ccaccaagtt ttatactaaa 540 tgggaatttc tacaaaagct gaggaagggg gaagatctag ctgaatggcc tcagttaaaa 600 tttcttggtt ggggaaaaat gtttaacttt cctcgattgg atctactaaa gaacatattc 660 ttcaaagatg aaacactcgc actctcatcg aatgagttaa gagatatttt agaaagacaa 720 aacaatcaag ctattactat ttttcccgaa gtcaatatca tgagtttgga actatcaatt 780 attcaaagaa aattacacca agattttccc tttgttataa acttctataa tttattatac 840 ccaagattta aaaactttac cactttgatg gctgcttttt catcaattaa aaacatcaaa 900 agaaagaaaa accgtaacaa tataatcaaa gaggcccgat acctgtttca cagagaactt 960 gacaaattag ttcacaagag catgaaaatg gagtcttcca aggtatccga taagacgacg ccgcccatga tcgtagataa ttcatactta cttacaaaaa aggaagaaat cagcagcggc aagcccaagg tggtacgaat caatccatac atatatgatg tcaccataat ttattaccga gtcaaatata ctgatagtgg gcatgatcat accaacggag atttgagact tcataaaggt tatcaattag agcaaatatc tccgacaatc tttgagatga ttcaaccaga aatggagtct gaaaacaaca taaaggataa ggaccccatt gttgtgatgg taaatgtaaa aaagcatcaa attcaaccat tactcgcata caatga~gag agtttagaaa agtggcttga aaataggtgg 138a atagaaaaag atagattaat cgagtccttg caaaaaaata ttaaaattga gaccaaataa <210> 228 <211> 903 <212> DNA
<213> Saccharomyces sp.
<400> 228 atggaaaagt acaccaattg gagagacaat ggtacgggaa tagctccatt tctaccaaac 60 acaatcagga aacctagtaa ggtgatgaca gcgtgtttgt tgggtatcct aggggtgaaa 120 accattataa tgctaccatt gattatgctg taccttctaa ctggccagaa caacttactg 180 ggtttgatat tgaagtttac attcagttgg aaagaggaaa ttaccgtgca aggaatcaag 240 aaacgtgacg taaggaaatc caagcattat ccacagaagg gcaagcttta tatttgcaat 300 tgtacctcac ctttagatgc tttttcagtg gtgttattag ctcaagggcc tgttacgttg 360 ttggtcccat ccaatgacat tgtatacaaa gtttccataa gagaattcat caacttcatc 420 ctcgccggtg ggttagatat aaaactctat ggccacgagg tagcagagct atctcaattg 480 ggcaataccg tgaattttat gtttgctgag ggtacctcat gtaatggtaa aagcgtctta 540 ccgtttagta taaccgggaa aaaacttaaa gaattcatag acccttcaat aaccacaatg 600 aaccccgcaa tggccaaaac taaaaaattt gaattgcaga ccatccaaat caaaactaat 660 aaaactgcca tcaccacatt gcccatctcc aatatggagt atttatctag atttctgaac 720 aagggcatta atgttaaatg caagatcaac gagccacaag tactctcgga taatttagag 780 gaattacgcg ttgcattaaa cggtggcgac aaatataaac tagtctcacg gaagttagat 840 gttgaatcta agaggaattt tgtgaaggaa tatatcagcg atcaacgtaa aaagaggaag 900 tag 903 <210> 229 <211> 2280 <212> DNA
<213> Saccharomyces sp.
<400> 229 atgcctgcac caaaactcac ggagaaattt gcctcttcca agagcacaca gaaaactacg 60 aattacagtt ccatcgaggc caaaagcgtc aagacgtcgg ctgatcaggc atacatctac 120 WO 00118889 (g PCTIUS99/22231 caagagcctagcgctaccaagaagatactttactccatcgccacatggctgttgtacaac180 atcttccactgcttctttagagaaatcagaggccggggcagtttcaaggtaccgcaacag240 ggaccggtgatctttgttgcggctccgcatgctaaccagttcgtcgaccctgtaatcctt300 atgggcgaggtgaagaaatctgtcaacagacgtgtgtccttcttgattgcggagagctca360 ttaaagcaaccccccatagggtttttggctagtttcttcatggccataggcgtggtaagg420 ccgcaggataatttgaaaccggcagaaggtactatccgcgtagatccaacagactacaag480 agagttatcggccacgacacgcatttcttgactgattgtatgccaaagggtctcatcggg540 ttacccaaatcaatgggatttggagaaatccagtccatagaaagtgacacgagtttgacc600 ctaagaaaagagttcaaaatggccaaaccagagattaaaactgctttactcaccggcact660 acttataaatatgccgctaaagtcgaccaatcttgcgtttaccatagagtttttgagcat720 ttggcccataacaactgcattgggatctttcctgaaggtgggtcccacgacagaacaaac780 ttgttgcccctgaaagcaggtgtggcgattatggctcttggttgcatggataagcatcct840 gacgtcaatgttaagattgttccctgcggtatgaattatttccatccacataagttcagg900 tcgagagcggttgttgaattcggtgaccccattgaaataccgaaggaactagtcgccaag960 taccacaacccggaaacgaacagagatgcagtgaaagaattattagataccatatcgaag ggtttacaatccgttaccgttacatgttctgattatgaaactttgatggtggttcaaacg ataagaagactatatatgacacaatttagcaccaagttaccgttgcccttgattgtggaa atgaacagaagaatggtcaaaggttacgaattctatagaaacgatcctaaaatagcggac ttgaccaaagatataatggcatataatgccgccttgagacactataatcttcctgatcac cttgtggaggaggcaaaggtaaatttcgcaaaaaacctcggacttgttttttttagatcc atcgggctctgcatcctcttttcgttagccatgccaggtatcattatgttctcacctgtc ttcatattagccaagagaatttctcaagaaaaggcccgtaccgctttgtccaagtctaca gttaaaataaaggctaacgatgtcattgccacgtggaaaatcttgattgggatgggattt gcgcccttgctttacatcttttggtccgttttaatcacttattacctcagacataaacca tggaataaaatatatgttttttccgggtcttacatctcgtgtgttatagtcacgtattcc gccttaatcgtgggtgatattggtatggatggtttcaaatctttgagaccactggtttta tctcttacatctccaaagggcttgcaaaagctacaaaaggatcgtagaaatctggcagaa agaataatcgaagttgtaaataactttggaagcgaattattccccgatttcgatagtgcc gccctacgtgaagaattcgacgtcatcgatgaagaggaagaagatcgaaaaacctcagaa ttgaatcgcaggaaaatgctaagaaaacagaaaataaaaagacaagaaaaagattcgtca tcacctatcatcagccaacgtgacaaccacgatgcctatgaacaccataaccaagattcc gatggcgtctcattggtcaatagtgacaattccctctctaacattccattattctcttct acttttcatcgtaagtcagagtcttccttagcttcgacatccgttgcaccttcttcttcc tccgaatttgaggtagaaaacgaaatcttggaggaaaaaaatggattagcaagtaaaatc gcacaggccgtcttaaacaagagaattggtgaaaatactgccagggaagaggaagaggaa gaagaagaggaagaagaagaagaggaagaagaagaagaagggaaagaaggagatgcgtag <210> 230 <211> 2232 <212> DNA
<213> Saccharomyces sp.
<400> 230 atgtctgctc ccgctgccga tcataacgct gccaaaccta ttcctcatgt acctcaagcg 60 tcccgacggt acaaaaattc atacaatgga ttcgtataca atatacatac atggctgtat 120 gatgtgtctg tatttctgtt taatattttg ttcactattt tcttcagaga aattaaggta 180 cgtggtgcat ataacgttcc cgaagttggg gtgccaacca tccttgtgtg tgcccctcat 240 gcaaatcagt tcatcgaccc ggctttggta atgtcgcaaa cccgtttgct gaagacatca 300 WO 00/18$89 g9 . PCT/US99122231 gcgggaaagtcccgatccagaatgccttgttttgttactgctgagtcgagttttaagaaa360 agatttatctctttctttggtcacgcaatgggcggtattcccgtgcctagaattcaggac420 aacttgaagccagtggatgagaatcttgagatttacgctccggacttgaagaaccacccg480 gaaatcatcaagggccgctccaagaacccacagactacaccagtgaactttacgaaaagg540 ttttctgccaagtccttgcttggattgcccgactacttaagtaatgctcaaatcaaggaa600 atcccggatgatgaaacgataatcttgtcctctccattcagaacatcgaaatcaaaagtg660 gtggagctcttgactaatggtactaattttaaatatgcagagaaaatcgacaatacggaa720 actttccagagtgtttttgatcacttgcatacgaagggctgtgtaggtattttccccgag780 ggtggttctcatgaccgtccttcgttactacccatcaaggcaggtgttgccattatggct.840 ctgggcgcagtagccgctgatcctaccatgaaagttgctgttgtaccctgtggtttgcat900 tatttccacagaaataaattcagatctagagctgttttagaatacggcgaacctatagtg960 gtggatgggaaatatggcgaaatgtataaggactccccacgtgagaccgtttccaaacta ctaaaaaagatcaccaattctttgttttctgttaccgaaaatgctccagattacgatact ttgatggtcattcaggctgccagaagactatatcaaccggtaaaagtcaggctacctttg cctgccattgtagaaatcaacagaaggttacttttcggttattccaagtttaaagatgat ccaagaattattcacttaaaaaaactggtatatgactacaacaggaaattagattcagtg ggtttaaaagaccatcaggtgatgcaattaaaaactaccaaattagaagcattgaggtgc tttgtaactttgatcgttcgattgattaaattttctgtctttgctatactatcgttaccg ggttctattctcttcactccaattttcattatttgtcgcgtatactcagaaaagaaggcc aaagagggtttaaagaaatcattggttaaaattaagggtaccgatttgttggccacatgg aaacttatcgtggcgttaatattggcaccaattttatacgttacttactcgatcttgttg attattttggcaagaaaacaacactattgtcgcatctgggttccttccaataacgcattc atacaatttgtctatttttatgcgttattggttttcaccacgtattcctctttaaagacc ggtgaaatcggtgttgaccttttcaaatctttaagaccactttttgtttctattgtttac cccggtaagaagatcgaagaaatccaaacaacaagaaagaatttaagtctagagttgact gctgtttgtaacgatttaggacctttggttttccctgattacgataaattagcgactgag atattctctaagagagacggttatgatgtctcttctgatgcagagtcttctataagtcgt atgagtgtacaatctagaagccgctcttcttctatacattctattggctcgctagcttct aacgccctatcaagagtgaattcaagaggctcgttgaccgatattccaattttttctgat gcaaagcaaggtcaatggaaaagtgaaggtgaaactagtgaggatgaggatgaatttgat gagaaaaatcctgccatagtacaaaccgcacgaagttctgatctaaataaggaaaacagt cgcaacacaaatatatcttcgaagattgcttcgctggtaagacagaaaagagaacacgaa aagaaagaatga <210> 231 <211> 1194 <212> DNA
<213> Saccharomyces sp.
<400> 231 atgctgcatc aaaaaatagc tcataaagtt cgaaaagtcg tcgtcccagg tatttcctta 60 ttgattttct tccagggatg ccttattctt ttgtttctcc aactcaccta taagactctt 120 tactgtagaa atgatataag gaaacaaatt ggtctcaata aaaccaaaag attatttatt 180 gtcttggtat catccatttt gcatgttgtc gcaccatctg cagtgagaat taccactgaa 240 aattccagtg ttcctaaagg tacttttttt ttagacttga agaagaaaag gattctttct 300 catctaaagt ccaattcggt ggccatttgc aatcaccaaa tatacacgga ttggatattt 360 ttatggtggt tggcttacac atcgaactta ggggctaatg tcttcattat tttaaaaaaa 420 tcgttggctt ccattcctat cctcggtttc ggtatgagaa actataattt catttttatg 480 WO 00/18889 ~p PCTIUS99I22231 agtagaaagt gggcacaaga caaaataacc ctaagcaaca gccttgctgg ccttgattcg 540 aatgcaaggg gcgccggctc acttgctgga aagtcacctg agcgcataac tgaggaagga 600 gagagcatat ggaatccgga ggttattgat ccaaaacaaa tccattggcc atacaatctt 660 atcctattcc ctgaaggtac aaatctcagt gctgatacta ggcaaaaaag tgctaaatat 720 gctgccaaaa taggcaaaaa gccattcaag aatgtgctac tgcctcattc tacaggccta 780 agatactcgt tacaaaagtt gaagccaagt attgaaagtc tttatgatat tacgatcggc 840 tactccggtg taaaacagga ggaatatggt gagcttatat atgggctgaa gagcatattt 900 ttagaaggaa aatacccgaa gttagtcgat attcacatca gagcatttga tgttaaagat 960 attccattag aggacgagaa tgaattttca gaatggctgt ataaaatttg gagtgagaag gatgctctaa tggaaaggta ctattccact ggatcattcg taagtgatcc tgaaacaaac cattcagtta ccgatagttt caagatcaat cgtattgagt taactgaagt gctaatatta ccaactctaa caataatttg gttagtttat aaactttatt gttttatttt ttga <210> 232 <211> 912 <212> DNA
<213> Saccharomyces sp.
<400> 232 atgagtgtga taggtaggtt cttgtattac ttgaggtccg tgttggtcgt actggcgctt 60 gcaggctgtg gcttttacgg tgtaatcgcc tctatccttt gcacgttaat cggtaagcaa 220 catttggctc agtggattac tgcgcgttgt ttttaccatg tcatgaaatt gatgcttggc 180 cttgacgtca aggtcgttgg~ cgaggagaat ttggccaaga agccatatat tatgattgcc 240 aatcaccaat ccaccttgga tatcttcatg ttaggtagga ttttcccccc tggttgcaca 300 gttactgcca agaagtcttt gaaatacgtc ccctttctgg gttggttcat ggctttgagt 360 ggtacatatt tcttagacag atctaaaagg caagaagcca ttgacacctt gaataaaggt 420 ttagaaaatg ttaagaaaaa caagcgtgct ctatgggttt ttcctgaggg taccaggtct 480 tacacgagtg agctgacaat gttgcctttc aagaagggtg ctttccattt ggcacaacag 540 ggtaagatcc ccattgttcc agtggttgtt tccaatacca gtactttagt aagtcctaaa 600 tatggggtct tcaacagagg ctgtatgatt gttagaattt taaaacctat ttcaaccgag 660 aacttaacaa aggacaaaat tggtgaattt gctgaaaaag ttagagatca aatggttgac 720 actttgaagg agattggcta ctctcccgcc atcaacgata caaccctccc accacaagct 780 attgagtatg ccgctcttca acatgacaag aaagtgaaca agaaaatcaa gaatgagcct 840 gtgccttctg tcagcattag caacgatgtc aatacccata acgaaggttc atctgtaaaa 900 aagatgcatt as 912 <210> 233 <211> 54 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 233 cgcgatttaa atggcgcgcc ctgcaggcgg ccgcctgcag ggcgcgccat ttaa 54 <210> 234 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 234 tcgaggatcc gcggccgcaa gcttcctgca gg 32 <210> 235 <211> 32 <212> DNA
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 235 tcgacctgca ggaagcttgc ggccgcggat cc 32 <210> 236 <211> 32 <212> DNA

<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 236 tcgacctgca ggaagcttgc ggccgcggat cc 32 <210> 237 <211> 32 <212> DNA

<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 237 tcgaggatcc gcggccgcaa gcttcctgca gg 32 <210> 238 <211> 36 <212> DNA

<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 238 tcgaggatcc gcggccgcaa gcttcctgca ggagct 36 <210> 239 <211> 28 <212> DNA

<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 239 cctgcaggaa gcttgcggcc gcggatcc 28 <210> 240 <211> 36 <212> DNA

<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 240 tcgacctgca ggaagcttgc ggccgcggat ccagct 36 <210> 241 <211> 28 <212> DNA

<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic Oligonucleotide <400> 241 ggatccgcgg ccgcaagctt cctgcagg 2$

Claims (23)

Claims What is Claimed is:

1. An isolated DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, wherein said enzyme includes the amino acid sequence of SEQ ID NO: 127 (VxNHxS) wherein the H is the conserved Histidine residue in the conserved peptide sequence HXXXXD of said acyltransferase-like protein, x representing any amino acid.

2. An isolated DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, wherein said enzyme includes the amino acid sequence of SEQ ID NO: 128 (VTYSxS) within about 30 amino acids downstream from the conserved amino acid sequence HXXXXD of said acyltransferase-like protein, x representing any amino acid.

3. An isolated DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, wherein said enzyme includes the amino acid sequence of SEQ ID NO: 129 (VxLTRxR) within about 60 amino acids downstream from the conserved amino acid sequence HXXXXD of said acyltransferase-like protein, x representing any amino acid.

4. An isolated DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, wherein said enzyme includes the amino acid sequence of SEQ ID NO: 132 (LxxGDLV) within about 20 amino acids upstream of the conserved amino acid sequence PEG of said acyltransferase-like protein, x representing any amino acid.

5. An isolated DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, wherein said enzyme includes the amino acid sequence of SEQ ID NO: 130 (CPEGT) containing the conserved amino acid sequence PEG of said acyltransferase-like protein.

6. An isolated DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, wherein said enzyme includes the amino acid sequence of SEQ ID NO: 133 (FxxGAF) within about 20 amino acids downstream from the conserved amino acid sequence PEG of said acyltransferase-like protein, x representing any amino acid.

7. An isolated DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, wherein said enzyme includes the amino acid sequence of SEQ ID NO: 131 (IVPVA) within about 40 amino acids downstream from the conserved amino acid sequence PEG of said acyltransferase-like protein.

8. An isolated DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, wherein said enzyme includes the amino acid sequence of SEQ ID NO: 134 (VANxxQ) within about 110 amino acids downstream from the conserved amino acid sequence PEG of said acyltransferase-like protein, x representing any amino acid.

9. A DNA sequence encoding an enzyme of the class of acyltransferase-like proteins, said DNA sequence obtainable by the steps comprising:
(a) using the profile of Figure 1 to search a nucleic acid sequence database;
(b) obtaining a probability score for nucleic acid sequences in said sequence database using the Smith-Waterman algorithm; and (c) selecting a nucleic acid sequence having a probability score of less than about 1.

10. The DNA encoding sequence according to Claim 9, wherein said DNA sequence is an encoding sequence.

11. The DNA encoding sequence according to Claim 9, wherein said DNA sequence is an EST.

12. The DNA encoding sequence according to any one of Claims 1 to 11, wherein said acyltransferase-like protein is from a plant.

13. A construct comprising a DNA sequence of any one of Claims 1 to 11 linked to a heterologous transcriptional and translational initiation region functional in a host cell.

14. The construct according to Claim 13 wherein said host cell is a plant cell.

15. A plant cell comprising a DNA construct according to Claim 13.

16. A plant comprising a cell according to Claim 15.

17. The DNA encoding sequence of any one of 1 to 11 wherein said acyltransferase-like protein is from Arabidopsis thaliana.

18. The DNA encoding sequence of any one of 1 to 11 wherein said acyltransferase-like protein is from corn.

19. The DNA encoding sequence of Claim 18 wherein said sequence comprises and EST selected from the group consisting of SEQ ID NO: 86 through SEQ ID NO:
126.

20 . The DNA encoding sequence of any one of 1 to 11 wherein said acyltransferase-like protein is from soybean.

21. The DNA encoding sequence of Claim 20 wherein said sequence comprises and EST selected from the group consisting of SEQ ID NO:24 through SEQ ID NO:85.

22. The DNA encoding sequence of any one of Claims 2, 3, 4, 5, 7 and 8 wherein said acyltransferase-like protein is selected from the group consisting of SEQ
ID NO:1, SEQ
ID NO: 10, SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16.

23. The DNA encoding sequence of either of Claim 1 and Claim 6 wherein said acyltransferase-like protein is selected from the group consisting of SEQ ID
NO:3, SEQ ID
NO:5, SEQ ID NO:7 and SEQ ID NO:18.