WO2000050436A1 - Isogenes de recepteur: polymorphismes dans le recepteur du facteur de necrose tissulaire - Google Patents

Isogenes de recepteur: polymorphismes dans le recepteur du facteur de necrose tissulaire Download PDF

Info

Publication number
WO2000050436A1
WO2000050436A1 PCT/US2000/004606 US0004606W WO0050436A1 WO 2000050436 A1 WO2000050436 A1 WO 2000050436A1 US 0004606 W US0004606 W US 0004606W WO 0050436 A1 WO0050436 A1 WO 0050436A1
Authority
WO
WIPO (PCT)
Prior art keywords
tnfrl
seq
gene
haplotype
polymoφhic
Prior art date
Application number
PCT/US2000/004606
Other languages
English (en)
Inventor
Krishnan Nandabalan
Vincent P. Schulz
J. Claiborne Stephens
Anne Chew
Original Assignee
Genaissance Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genaissance Pharmaceuticals, Inc. filed Critical Genaissance Pharmaceuticals, Inc.
Priority to AU2000236029A priority Critical patent/AU2000236029A1/en
Publication of WO2000050436A1 publication Critical patent/WO2000050436A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • This invention relates to va ⁇ ation in genes that encode pharmaceutically important proteins.
  • this invention provides genetic variants of the human tumor necrosis factor receptor 1 (TNFRl) gene and methods for identifying which va ⁇ ant(s) of this gene is/are possessed by an individual.
  • TNFRl tumor necrosis factor receptor 1
  • nucleotide sequence of a particular gene may vary tremendously among individuals.
  • Subtle alterat ⁇ on(s) in the primary nucleotide sequence of a gene encoding a target protein may be manifested as significant va ⁇ ation in expression of or m the structure and/or function of the protein.
  • Such alterations may explain the relatively high degree of uncertainty inherent in treatment of individuals with drugs whose design is based upon a single representative example of the target. For example, it is well-established that some classes of drugs frequently have lower efficacy in some individuals than others, which means such individuals and their physicians must weigh the possible benefit of a larger dosage against a greater ⁇ sk of side effects.
  • va ⁇ able information on the biological function or effects of a particular protein may be due to different scientists unknowingly studying different isoforms of the gene encoding the protein.
  • information on the type and frequency of genomic va ⁇ ation that exists for pharmaceutically important proteins would be useful.
  • TNF receptor 1 tumor necrosis factor receptor 1
  • TNF tumor necrosis factor
  • monocytes monocytes
  • neutrophils T-cells
  • NK cells TNF alpha and TNF beta.
  • TNF alpha and TNF beta TNF receptor superfamily member 1 A
  • TNF-RSF1A TNF receptor superfamily member 1 A
  • TNF exerts a spectrum of biological effects by binding to the TNFRl receptor. Due to its cytotoxic and cytostatic effects, TNF can destroy the blood vessels in malignant tumors and can serve as an anti-tumor agent (Bruce et al., Nature Med. 2: 788-794, 1996). TNF also mediates part of cell mediated immunity and confers resistance to infection caused by the facultative bacteria Listeria monocytogenes (Rothe et al., Nature 364; 798-802, 1993).
  • the C- terminal region of TNFRl contains a death domain that interacts with MAP kinase- Activating Death Domain (MADD), a protein that acts as a mediator of the down stream effects of TNF signaling. MADD activates the MAP kinases and induces the phosphorylation of cytosolic phospholipase A2 (Schievella et al., JBiol. Chem. 272: 12069-75, 1997). Autosomal dominant periodic fever syndrome, also known as TNF Receptor-Associated Periodic Syndromes (TRAPS), is characterized by episodes of fever and severe localized inflammation.
  • TRAPS TNF Receptor-Associated Periodic Syndromes
  • the TNFRl gene in humans is located on chromosome 12pl3 and the corresponding murine homolog is located on chromosome 6.
  • the coding region and the 3'UTR of the TNFRl gene are distributed over 10 exons (Fuchs et al., Genomics 13: 219-224, 1992).
  • the unprocessed precursor receptor is a glycosylated protein of 455 amino acids that contains a 29 amino acid signal sequence, an extracellular domain of 171 amino acids and a cytoplasmic domain of 221 amino acids (Loetscher et al., Cell 61: 351-359).
  • a reference sequence for the TNFRl gene comprises the non-contiguous sequences in Figure 1 (GenBank Accession No. X69810, Version X69810.1 , G 288493; SEQ ID NO:l) which contains exon 1, Figure 2 (GenBank Accession No. M75865, Version M75865.1, G 339747; SEQ ID NO:2) which contains exons 2-5 and Figure 3 (GenBank Accession No. M75866, Version M75866.1, G 339748; SEQ ID NO:3), which contains exons 6-10.
  • Reference sequences for the TNFRl coding sequence and amino acid sequence accesion No.
  • Membrane TNFRl is regulated in part by metalloprotease-mediated cleavage where shedding of receptors followed by their clearance from the membrane takes place.
  • Leukocytes bearing the Cys52Phe mutation showed increased levels of membrane receptor and diminished cleavage following stimulation.
  • the down regulation of the membrane TNFRl is impaired and the amount of soluble receptors in the cell decreases. This condition is manifested as an autoinflammatory syndrome (McDermott et al., Cell 97: 133-144, 1999).
  • polymorphic sites correspond to the nucleotide positions 201 (PSl), 230 (PS2), 845 (PS3), 873 (PS4) of Fig 1; nucleotide positions 481 (PS5), 526 (PS6), 839 (PS7), 880 (PS8), 971 (PS9), 1135 (PS10) of Fig 2; and nucleotide positions 162 (PSl 1) and 701 (PS12) of Fig 3.
  • the polymorphisms at these sites are guanme or thymine at PS 1 , guanme or adenme at PS2, adenme or guanme at PS3, guanme or adenme at PS4, cytosme or thymine at PS5, cytosme or thymine at PS6, guanme or adenme at PS7, thymine or cytosme at PS8, cytosme or thymine at PS9, cytosme or thymine at PS 10, guanme or adenme at PSl 1, and thymine or cytosme at PS12.
  • TNFRl -encoding polynucleotides containing one or more of the novel polymorphic sites reported herein will be useful in studying the expression and biological function of TNFRl, as well as in developing drugs targeting this protein.
  • information on the combinations of polymorphisms in the TNFRl gene may have diagnostic and forensic applications.
  • the invention provides an isolated polynucleotide comp ⁇ smg a nucleotide sequence which is a polymorphic va ⁇ ant of a reference sequence for the TNFRl gene or a fragment thereof.
  • a particularly preferred polymorphic va ⁇ ant is a naturally-occurring isoform (also referred to herein as an "isogene") of the TNFRl gene.
  • a TNFRl isogene of the invention comp ⁇ ses guanme or thymme at PSl, guanme or adenme at PS2, adenme or guanme at PS3, guanme or adenme at PS4, cytosme or thymine at at PS5, cytosme or thymine at PS6, guanme or adenme at PS7, thymine or cytosme at PS8, cytosme or thymine at PS10, guanme or adenme at PSl 1 and thymine or cytosme at PS12.
  • the invention also provides a collection of TNFRl isogenes, referred to herein as a TNFRl genome anthology.
  • a TNFRl isogene may be defined by the combination and order of these polymorphisms m the isogene, which is referred to herein as a TNFRl haplotype.
  • the invention also provides data on the number of different TNFRl haplotypes found m the above four population groups. This haplotype data is useful m methods for denvmg a TNFRl haplotype from an individual's genotype for the TNFRl gene and for determining an association between a TNFRl haplotype and a particular trait.
  • the invention provides a polynucleotide comp ⁇ smg a polymorphic va ⁇ ant of a reference sequence for a TNFRl cDNA of a fragment thereof.
  • Polynucleotides complementary to these TNFRl genomic va ⁇ ants are also provided by the invention.
  • the invention provides a recombinant expression vector compnsmg one of the polymorphic genomic va ⁇ ants operably linked to expression regulatory elements as well as a recombinant host cell transformed or transfected with the expression vector.
  • the recombinant vector and host cell may be used to express TNFRl for protein structure analysis and drug binding studies.
  • the invention provides a polypeptide comp ⁇ smg a polymorphic va ⁇ ant of a reference ammo acid sequence for the TNFRl protein.
  • a polymorphic va ⁇ ant of TNFRl is useful in studying the effect the va ⁇ ant amino acid on the biological activity of TNFRl as well as studying the binding affinity of candidate drugs targeting TNFRl for the treatment of tumors, bacte ⁇ al infection and disorders of the immune system and apoptosis-related disorders.
  • the invention provides methods, compositions, and kits for haplotypmg and/or genotypmg the TNFRl gene m an individual.
  • the methods involve identifying the nucleotide or nucleotide pair present at one or more polymorphic sites selected from the group consisting of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS12 in one or both copies of the TNFRl gene from the individual.
  • the compositions contain oligonucleotide probes and p ⁇ mers designed to specifically hyb ⁇ dize to one or more target regions containing, or that are adjacent to, a polymorphic site.
  • the present invention also provides transgemc animals compnsmg one of the TNFRl genomic polymorphic va ⁇ ants desc ⁇ bed herem and methods for producmg such animals.
  • the transgemc animals are useful for studying expression of the TNFRl isogenes in vivo, for in vivo screening and testing of drugs targeted against TNFRl protein, and for testing the efficacy of therapeutic agents and compounds for tumors, apotosis-related disorders, bacte ⁇ al infection and disorders of the immune system a biological system.
  • the present mvention also provides a computer system for sto ⁇ ng and displaying polymorphism data determined for the TNFRl gene.
  • the computer system comprises a computer processing unit; a display; and a database containing the polymorphism data.
  • the polymorphism data includes the polymorphisms, the genotypes and the haplotypes identified for the TNFRl gene in a reference population.
  • the computer system is capable of producing a display showing TNFRl haplotypes organized according to their evolutionary relationships
  • Figure 1 illustrates a partial reference sequence for the TNFRl gene (contiguous lines; SEQ ID NO: 1), with the underlines mdicatmg start and stop codons, shading mdicatmg the reference coding sequence, and bold nucleotides indicating the polymorphic sites and polymorphisms identified by Applicants in a reference population.
  • Figure 2 illustrates a partial reference sequence for the TNFRl gene (contiguous lines; SEQ ID NO:2), with the underlines indicating start and stop codons, shading indicating the reference codmg sequence, and bold nucleotides indicating the polymorphic sites and polymorphisms identified by Applicants m a reference population.
  • Figure 3 illustrates a partial reference sequence for the TNFRl gene (contiguous lines; SEQ ID NO:3), with the underlines indicating start and stop codons, shading indicating the reference coding sequence, and bold nucleotides indicating the polymorphic sites and polymorphisms identified by Applicants in a reference population
  • Figure 4 illustrates a reference sequence for the TNFRl coding sequence (contiguous lines; SEQ ID NO:4), with underlines indicating the start and stop codons, and bold nucleotides indicating the polymorphic sites and polymorphisms identified by Applicants m a reference population.
  • Figure 5 illustrates a reference sequence for the TNFRl protein (contiguous lines; SEQ ID NO:5), with the bold ammo acids indicating the ammo acid vanations caused by the polymorphisms of Fig. 4.
  • the present invention is based on the discovery of novel va ⁇ ants of the TNFRl gene.
  • the inventors herem discovered twelve novel polymorphic sites by characte ⁇ zmg the TNFRl gene found in genomic DNAs isolated from an Index Repository that contains immortalized cell lines from one chimpanzee and 150 human individuals.
  • the human individuals included a reference population of 112 unrelated individuals self-identified as belonging to one of four major population groups: Caucasian (42 individuals), African descent (26 individuals) Asian (27 individuals) Hispanic/Latino (17 individuals). To the extent possible, the members of this reference population were organized into population subgroups by the self-identified ethnogeographic o ⁇ gm of their four grandparents as shown Table 1 below.
  • the Index Repository contains three unrelated indigenous American Indians (one from each of North, Central and South Ame ⁇ ca), five two- or three-generation Caucasian families from the CEPH- Utah cohort and one two-generation African- Amencan family.
  • the inventors herein Using the TNFRl genotypes identified m the Index Repository and the methodology desc ⁇ bed in the Examples below, the inventors herein also determined the haplotypes found on each chromosome for most human members of this repository.
  • the TNFRl genotypes and haplotypes found in the repository include those shown m Tables 4 and 5, respectively.
  • the polymorphism and haplotype data disclosed herem are useful for studying population diversity, anthropological lineage, the significance of diversity and lineage at the phenotypic level, paternity testmg, forensic applications, and for identifying associations between the genetic vanation and a trait such as level of drug response or susceptibility to disease.
  • Candidate Gene - A gene which is hypothesized to be responsible for a disease, condition, or the response to a treatment, or to be correlated with one of these.
  • Gene - A segment of DNA that contains all the information for the regulated biosynthesis of an
  • RNA product including promoters, exons, introns, and other untranslated regions that control expression.
  • Genotype An unphased 5 ' to 3 ' sequence of nucleotide pa ⁇ r(s) found at one or more polymorphic sites m a locus on a pair of homologous chromosomes in an individual.
  • genotype includes a full-genotype and/or a sub-genotype as descnbed below Full-genotype -
  • Sub-genotype The unphased 5 ' to 3 ' sequence of nucleotides seen at a subset of the known polymorphic sites in a locus on a pair of homologous chromosomes in a single individual.
  • Genotyping A process for determining a genotype of an individual.
  • Haplotype A 5 ' to 3 ' sequence of nucleotides found at one or more polymorphic sites m a locus on a single chromosome from a single individual
  • haplotype includes a full-haplotype and/or a sub-haplotype as descnbed below.
  • Haplotype pair The two haplotypes found for a locus in a single individual.
  • Haplotyping A process for determining one or more haplotypes m an individual and includes use of family pedigrees, molecular techniques and/or statistical inference.
  • Haplotype data Information concerning one or more of the following for a specific gene: a listing of the haplotype pairs in each individual m a population; a listing of the different haplotypes in a population; frequency of each haplotype in that or other populations, and any known associations between one or more haplotypes and a trait.
  • Isoform - A particular form of a gene, mRNA, cDNA or the protein encoded thereby, distinguished from other forms by its particular sequence and/or structure.
  • Isogene - One of the isoforms of a gene found m a population. An isogene contains all of the polymorphisms present in the particular isoform of the gene.
  • Isolated - As applied to a biological molecule such as RNA, DNA, oligonucleotide, or protein, isolated means the molecule is substantially free of other biological molecules such as nucleic acids, proteins, hpids, carbohydrates, or other matenal such as cellular debns and growth media. Generally, the term “isolated” is not intended to refer to a complete absence of such matenal or to absence of water, buffers, or salts, unless they are present in amounts that substantially interfere with the methods of the present invention.
  • Locus - A location on a chromosome or DNA molecule corresponding to a gene or a physical or phenotypic feature.
  • Naturally-occurring A term used to designate that the object it is applied to, e.g., naturally- occurring polynucleotide or polypeptide, can be isolated from a source in nature and which has not been intentionally modified by man.
  • Nucleotide pair The nucleotides found at a polymorphic site on the two copies of a chromosome from an individual.
  • phased As applied to a sequence of nucleotide pairs for two or more polymorphic sites in a locus, phased means the combination of nucleotides present at those polymorphic sites on a smgle copy of the locus is known.
  • Polymorphism The sequence vanation observed m an individual at a polymorphic site.
  • Polymo ⁇ hisms include nucleotide substitutions, insertions, deletions and microsatelhtes and may, but need not, result in detectable differences in gene expression or protein function.
  • Polymorphism data Information concerning one or more of the following for a specific gene: location of polymo ⁇ hic sites; sequence va ⁇ ation at those sites; frequency of polymo ⁇ hisms in one or more populations; the different genotypes and/or haplotypes determined for the gene; frequency of one or more of these genotypes and or haplotypes in one or more populations; any known assoc ⁇ at ⁇ on(s) between a trait and a genotype or a haplotype for the gene.
  • Polymorphism Database A collection of polymo ⁇ hism data arranged in a systematic or methodical way and capable of being individually accessed by electronic or other means.
  • Polynucleotide - A nucleic acid molecule compnsed of single-stranded RNA or DNA or comp ⁇ sed of complementary, double-stranded DNA.
  • Reference Population A group of subjects or individuals who are predicted to be representative of the genetic va ⁇ ation found in the general population.
  • the reference population represents the genetic vanation in the population at a certainty level of at least 85%, preferably at least 90%, more preferably at least 95% and even more preferably at least 99%.
  • SNP Single Nucleotide Polymorphism
  • Subject A human individual whose genotypes or haplotypes or response to treatment or disease state are to be determined.
  • PSl novel polymo ⁇ hic sites in the TNFRl gene, which are referred to as of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl l and PS12 to designate the order in which they are located in the gene (see Figures. 1, 2 and 3 and Table 3 below).
  • the invention provides an isolated polynucleotide comprising a polymo ⁇ hic va ⁇ ant of the TNFRl gene or a fragment of the gene which contains at least one of the novel polymo ⁇ hic sites desc ⁇ bed herein.
  • the nucleotide sequence of a va ⁇ ant TNFRl gene is identical to the reference genomic sequence for those portions of the gene examined, as desc ⁇ bed m the Examples below, except that it comp ⁇ ses a different nucleotide at one or more of polymo ⁇ hic sites PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS 12.
  • nucleotide sequence of a va ⁇ ant fragment of the TNFRl gene is identical to the corresponding portion of the reference sequence except for having a different nucleotide at one or more of these polymo ⁇ hic sites.
  • the invention specifically does not include polynucleotides compnsmg a nucleotide sequence identical to the reference sequence (or other reported TNFRl sequences) or to portions of the reference sequence (or other reported TNFRl sequences), except for genotypmg oligonucleotides as descnbed below.
  • the location of a polymo ⁇ hism in a va ⁇ ant gene or fragment is identified by aligning its sequence with SEQ ID NO: 1, SEQ ID NO:2 and/or and SEQ ID NO:3.
  • the polymo ⁇ hism is selected from the group consisting of thymine at PSl, adenme at PS2, guanme at PS3, adenme at PS4, thymine at PS5, thymine at PS6, aden e at PS7, cytosine at PS8, thymine at PS9, thymine at PS10, adenme at PSl 1 and cytosine at PS12.
  • the polymo ⁇ hic va ⁇ ant comp ⁇ ses a naturally-occur ⁇ ng isogene of the TNFRl gene which is defined by any one of haplotypes 1-17 shown in Table 5 below.
  • Polymo ⁇ hic variants of the invention may be prepared by isolating a clone containing the TNFRl gene from a human genomic library.
  • the clone may be sequenced to determine the identity of the nucleotides at the polymo ⁇ hic sites descnbed herein. Any particular vanant claimed herein could be prepared from this clone by performing in vitro mutagenesis using procedures well-known in the art.
  • TNFRl isogenes may be isolated using any method that allows separation of the two "copies" of the TNFRl gene present m an individual, which, as readily understood by the skilled artisan, may be the same allele or different alleles. Separation methods include targeted in vivo cloning (TIVC) in yeast as descnbed in WO 98/01573, U.S. Patent No. 5,866,404, and copendmg U.S. application Senal No. 08/987,966. Another method, which is desc ⁇ bed in copendmg U.S. Application Senal No.
  • 08/987,966 uses an allele specific oligonucleotide in combination with pnmer extension and exonuclease degradation to generate hermzygous DNA targets. Yet other methods are single molecule dilution (SMD) as desc ⁇ bed m Ruano et al., Proc. Natl. Acad. Sci. 87:6296-6300, 1990; and allele specific PCR (Ruano et al., 17 Nucleic Acids. Res. 8392, 1989; Ruano et al., 19 Nucleic Acids Res. 6877-6882, 1991; Michalatos-Belom et al., 24 Nucleic Acids Res. 4841-4843, 1996).
  • SMD single molecule dilution
  • the invention also provides TNFRl genome anthologies, which are collections of TNFRl isogenes found in a given population.
  • the population may be any group of at least two individuals, including but not limited to a reference population, a population group, a family population, a clinical population, and a same sex population.
  • a TNFRl genome anthology may compnse individual TNFRl isogenes stored m separate containers such as microtest tubes, separate wells of a microtitre plate and the like. Alternatively, two or more groups of the TNFRl isogenes in the anthology may be stored in separate containers.
  • Individual isogenes or groups of isogenes in a genome anthology may be stored m any convenient and stable form, including but not limited to in buffered solutions, as DNA precipitates, freeze-dned preparations and the like.
  • a preferred TNFRl genome anthology of the invention comp ⁇ ses a set of isogenes defined by the haplotypes shown in Table 5 below.
  • Host cells which may be used to express the vanant TNFRl sequences of the invention include, but are not limited to, eukaryotic and mammalian cells, such as animal, plant, insect and yeast cells, and prokaryotic cells, such as E. coli, or algal cells as known in the art.
  • the recombinant expression vector may be introduced into the host cell using any method known to those m the art including, but not limited to, micromjection, electroporation, particle bombardment, transduction, and transfection using DEAE-dextran, lipofection, or calcium phosphate (see e.g., Sambrook et al. (1989) "Molecular Cloning. A Laboratory Manual", Cold Spnng Harbor Press, Plamview, New York).
  • eukaryotic expression vectors that function in eukaryotic cells, and preferably mammalian cells, are used.
  • Non-limiting examples of such vectors include vaccinia virus vectors, adenovirus vectors, he ⁇ es virus vectors, and baculovirus transfer vectors.
  • Preferred eukaryotic cell lines include COS cells, CHO cells, HeLa cells, NTH/3T3 cells, and embryonic stem cells (Thomson, J. A. et al., 1998 Science 282:1145-1147). Particularly preferred host cells are mammalian cells.
  • TNFRl mRNAs varying from each other at any polymo ⁇ hic site retamed in the spliced and processed mRNA molecules.
  • mRNAs can be used for the preparation of an TNFRl cDNA compnsmg a nucleotide sequence which is a polymo ⁇ hic vanant of the TNFRl reference codmg sequence shown in Fig. 4.
  • the invention also provides TNFRl mRNAs and corresponding cDNAs which compnse a nucleotide sequence that is identical to SEQ ID NO:4, or its corresponding RNA sequence, except for having at least one va ⁇ ant nucleotide selected from the group consisting of guanme at a position corresponding to nucleotide 36, thymme at a position corresponding to nucleotide 224, thymine at a position corresponding to nucleotide 269, adenme at a position corresponding to nucleotide 362 and cytosine at a position corresponding to nucleotide 403.
  • va ⁇ ant mRNAs and cDNAs are included m the scope of the invention, provided they contam at least one of these novel polymo ⁇ hisms descnbed herein.
  • the location of a polymo ⁇ hism in a va ⁇ ant mRNA, cDNA or fragment is identified by aligning its sequence with SEQ ID NO:4.
  • the invention specifically excludes polynucleotides identical to previously identified and charactenzed TNFRl cDNAs and fragments thereof except for genotyp g o gonucleotides as descnbed below.
  • Polynucleotides compnsmg a variant RNA or DNA sequence may be isolated from a biological sample using well-known molecular biological procedures or may be chemically synthesized.
  • nucleic acid molecules containing the TNFRl gene may be complementary double stranded molecules and thus reference to a particular site on the sense strand refers as well to the corresponding site on the complementary antisense strand.
  • reference may be made to the same polymo ⁇ hic site on either strand and an oligonucleotide may be designed to hybndize specifically to either strand at a target region containing the polymo ⁇ hic site.
  • the invention also includes single-stranded polynucleotides which are complementary to the sense strand of the TNFRl genomic va ⁇ ants desc ⁇ bed herein.
  • Polynucleotides compnsmg a polymo ⁇ hic gene vanant or fragment may be useful for therapeutic pu ⁇ oses.
  • an expression vector encoding the isoform may be administered to the patient.
  • the patient may be one who lacks the TNFRl isogene encoding that isoform or may already have at least one copy of that isogene. In other situations, it may be desirable to decrease or block expression of a particular TNFRl isogene.
  • inhibition of transcnption can be achieved using ohgonucleotides that base-pair with reg ⁇ on(s) of the isogene DNA to form triplex DNA (see e.g., Gee et al. m Huber, B.E. and B.I. Carr, Molecular and Immunologic Approaches, Futura Publishing Co., Mt. Kisco, N.Y., 1994).
  • Antisense ohgonucleotides may also be designed to block translation of TNFRl mRNA transc ⁇ bed from a particular isogene. It is also contemplated that ⁇ bozymes may be designed that can catalyze the specific cleavage of TNFRl mRNA transc ⁇ bed from a particular isogene.
  • the ohgonucleotides may be delivered to a target cell or tissue by expression from a vector introduced into the cell or tissue in vivo or ex vivo.
  • the ohgonucleotides may be formulated as a pharmaceutical composition for administration to the patient.
  • Ohgo ⁇ bonucleotides and/or ohgodeoxynucleotides intended for use as antisense ohgonucleotides may be modified to increase stability and half-life.
  • Possible modifications include, but are not limited to phosphorothioate or 2' 0- methyl linkages, and the inclusion of nontraditional bases such as mosme and queosme, as well as acetyl-, methyl-, thio-, and similarly modified forms of adenme, cytosine, guanme, thymme, and uracil which are not as easily recognized by endogenous nucleases.
  • the invention also provides an isolated polypeptide compnsmg a polymo ⁇ hic vanant of the reference TNFRl ammo acid sequence shown m Fig. 5 (SEQ ID NO:5).
  • the location of a vanant ammo acid m a TNFRl polypeptide or fragment of the invention is identified by aligning its sequence with Fig. 5.
  • a TNFRl protein vanant of the invention comp ⁇ ses an ammo acid sequence identical to SEQ ID NO:4 except for having one or more of leucine at a position corresponding to amino acid position 75 (Leu75), methionine at a position corresponding to ammo acid position 90 (Met 90), glutamine at a position corresponding to ammo acid position 121 (Gin 121) and histidme at a position corresponding to ammo acid position 135 (His 135)(see Fig 5).
  • the invention specifically excludes polypeptides consisting of ammo acids identical to those previously identified for TNFRl, including SEQ ID NO:5, and previously described fragments thereof.
  • TNFRl protein variants included within the invention comprise all ammo acid sequences based on SEQ ID NO:5 and having the combination of ammo acid vanations descnbed in Table 2 below.
  • a TNFRl protein va ⁇ ant of the invention is encoded by an isogene defined by one of the haplotypes shown in Table 5. Such vanants correspond to isoforms 1-4 of Table 2.
  • the invention also includes TNFRl peptide va ⁇ ants, which are any fragments of a TNFRl protein va ⁇ ant that contains one or more of the va ⁇ ant ammo acid positions shown in Table 2.
  • a TNFRl peptide vanant is at least 6 ammo acids m length and is preferably any number between 6 an 30 ammo acids long, more preferably between 10 and 25, and most preferably between 15 and 20 ammo acids long.
  • Such TNFRl peptide vanants may be useful as antigens to generate antibodies specific for one of the above TNFRl isoforms.
  • the TNFRl peptide va ⁇ ants may be useful in drug screening assays.
  • the TNFRl protein vanant may be isolated from a biological sample of an individual having a TNFRl isogene which encodes the vanant protein.
  • a biological sample contains two different TNFRl isoforms (i.e., the individual has different TNFRl isogenes)
  • a particular TNFRl isoform of the invention can be isolated by lmmunoaffinity chromatography using an antibody which specifically binds to that particular TNFRl isoform but does not bind to the other TNFRl isoform.
  • TNFRl vanant proteins can be punfied by standard protein pu ⁇ fication procedures known m the art, including differential precipitation, molecular sieve chromatography, ion-exchange chromatography, isoelectnc focusing, gel electrophoresis, affinity and lmmunoaffinity chromatography and the like. (Ausubel et. al., 1987, In “Current Protocols in Molecular Biology” John Wiley and Sons, New York, New York). In the case of lmmunoaffinity chromatography, antibodies specific for a particular polymo ⁇ hic vanant may be used.
  • a polymo ⁇ hic vanant TNFRl gene of the invention may also be fused m frame with a heterologous sequence to encode a chime ⁇ c TNFRl protein.
  • the non-TNFRl portion of the chime ⁇ c protein may be recognized by a commercially available antibody.
  • the chime ⁇ c protein may also be engineered to contain a cleavage site located between the TNFRl and non-TNFRl portions so that the TNFRl protein may be cleaved and pu ⁇ fied away from the non-TNFRl portion.
  • An additional embodiment of the invention relates to using a novel TNFRl protein isoform or novel TNFRl peptide va ⁇ ant in any of a vanety of drug screening assays.
  • screening assays may be performed to identify agents that bind specifically to all known TNFRl protein isoforms or to only a subset of one or more of these isoforms.
  • the agents may be from chemical compound hbranes, peptide hbranes and the like.
  • the TNFRl protein or peptide va ⁇ ant may be free m solution or affixed to a solid support.
  • high throughput screening of compounds for binding to a TNFRl vanant may be accomplished using the method desc ⁇ bed m PCT application WO84/03565, in which large numbers of test compounds are synthesized on a solid substrate, such as plastic pins or some other surface, contacted with the TNFRl prote ⁇ n(s) of interest and then washed. Bound TNFRl protem(s) are then detected using methods well-known m the art.
  • the invention provides antibodies specific for and immunoreactive with the novel TNFRl va ⁇ ant protein descnbed herein.
  • the antibodies may be either monoclonal or polyclonal in o ⁇ gin.
  • the TNFRl protein or peptide va ⁇ ant used to generate the antibodies may be from natural or recombinant sources or produced by chemical synthesis using synthesis techniques known m the art. If the CMAl protein va ⁇ ant is of insufficient size to be antigemc, it may be conjugated, complexed, or otherwise covalently linked to a earner molecule to enhance the antigemcity of the peptide.
  • earner molecules include, but are not limited to, albumins (e.g., human, bovine, fish, ovme), and keyhole limpet hemocyanm ("Basic and Clinical Immunology", 1991, Eds. D.P. Stites, and A.I. Terr, Appleton and Lange, Norwalk Connecticut, San Mateo, California).
  • an antibody specifically immunoreactive with a novel TNFRl protein isoform is administered to an individual to neutralize activity of the TNFRl isoform expressed by that individual.
  • the antibody may be formulated as a pharmaceutical composition which includes a pharmaceutically acceptable earner.
  • Antibodies specific for and immunoreactive with the novel TNFRl protein isoform desc ⁇ bed herein may be used to lmmunoprecipitate the TNFRl protein va ⁇ ant from solution as well as react with TNFRl protein isoforms on Western or lmmunoblots of polyacrylamide gels on membrane supports or substrates.
  • the antibodies will detect TNFRl protein isoforms m paraffin or frozen tissue sections, or in cells which have been fixed or unfixed and prepared on slides, coverslips, or the like, for use in immunocytochemical, immunohistochemical, and immunofluorescence techniques.
  • an antibody specifically immunoreactive with the novel TNFRl protein vanant descnbed herein is used in immunoassays to detect this vanant in biological samples.
  • an antibody of the present invention is contacted with a biological sample and the formation of a complex between the TNFRl protein vanant and the antibody is detected.
  • suitable immunoassays include radioimmunoassay, Western blot assay, immunofluorescent assay, enzyme linked immunoassay (ELISA), chemilummescent assay, immunohistochemical assay, immunocytochemical assay, and the like (see, e.g., Principles and Practice of Immunoassay, 1991, Eds. Ch ⁇ stopher P. P ⁇ ce and David J. Neoman, Stockton Press, New York, New York; Current Protocols in Molecular Biology, 1987, Eds. Ausubel et al., John Wiley and Sons, New York, New York). Standard techniques known m the art for ELISA are descnbed in Methods in Immunodiagnosis, 2nd Ed., Eds.
  • Such assays may be direct, indirect, competitive, or noncompetitive as descnbed in the art (see, e.g., Principles and Practice of Immunoassay, 1991, Eds. Chnstopher P. Pnce and David J. Neoman, Stockton Pres, NY, NY; and Oelh ⁇ ch, M., 1984, J Chn Chem Chn Biochem., 22:895-904).
  • Protems may be isolated from test specimens and biological samples by conventional methods, as descnbed m Current Protocols in Molecular Biology, supra.
  • Exemplary antibody molecules for use in the detection and therapy methods of the present invention are mtact immunoglobulin molecules, substantially intact lmmunoglobulm molecules, or those portions of immunoglobulin molecules that contain the antigen binding site.
  • Polyclonal or monoclonal antibodies may be produced by methods conventionally known in the art (e.g., Kohler and Milstem, 1975, Nature, 256:495-497; Campbell “Monoclonal Antibody Technology, the Production and Charactenzation of Rodent and Human Hybndomas", 1985, In: “Laboratory Techniques in Biochemistry and Molecular Biology," Eds. Burdon et al., Volume 13, Elsevier Science Publishers, Amsterdam).
  • the antibodies or antigen binding fragments thereof may also be produced by genetic engmee ⁇ ng.
  • the technology for expression of both heavy and light chain genes in E. coli is the subject of PCT patent applications, publication number WO 901443, WO 901443 and WO 9014424 and in Huse et al., 1989, Science, 246:1275-1281.
  • the antibodies may also be humanized (e.g., Queen, C. et al. 1989 Proc. Natl. Acad. Sci. 86; 10029).
  • effect(s) of the polymo ⁇ hisms identified herein on expression of TNFRl may be investigated by prepanng recombinant cells and/or organisms, preferably recombinant animals, contammg a polymo ⁇ hic va ⁇ ant of the TNFRl gene.
  • expression includes but is not limited to one or more of the following: transcnption of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into TNFRl protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.
  • the desired TNFRl isogene may be introduced into the cell m a vector such that the isogene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location.
  • the TNFRl isogene is introduced into a cell in such a way that it recombmes with the endogenous TNFRl gene present m the cell.
  • Examples of cells into which the TNFRl isogene may be introduced include, but are not limited to, continuous culture cells, such as COS, NIH 3T3, and pnmary or culture cells of the relevant tissue type, i.e., they express the TNFRl isogene. Such recombinant cells can be used to compare the biological activities of the different protein va ⁇ ants.
  • Recombinant organisms i.e., transgemc animals, expressing a va ⁇ ant TNFRl gene are prepared using standard procedures known in the art.
  • a construct compnsmg the va ⁇ ant gene is introduced into a nonhuman animal or an ancestor of the animal at an embryonic stage, i.e., the one-cell stage, or generally not later than about the eight-cell stage.
  • Transgemc animals carrying the constructs of the invention can be made by several methods known to those having skill in the art.
  • One method involves transfecting into the embryo a retrovirus constructed to contain one or more insulator elements, a gene or genes of interest, and other components known to those skilled m the art to provide a complete shuttle vector harbo ⁇ ng the insulated gene(s) as a transgene, see e.g., U.S. Patent No. 5,610,053.
  • Another method involves directly injecting a transgene into the embryo.
  • a third method involves the use of embryonic stem cells. Examples of animals into which the TNFRl isogenes may be introduced include, but are not limited to, mice, rats, other rodents, and nonhuman p ⁇ mates (see "The Introduction of Foreign Genes into Mice" and the cited references therein, In: Recombinant DNA, Eds.
  • Transgemc animals stably expressing a human TNFRl isogene and producing human TNFRl protein can be used as biological models for studying diseases related to abnormal TNFRl expression and/or activity, and for screenmg and assaying vanous candidate drugs, compounds, and treatment regimens to reduce the symptoms or effects of these diseases.
  • An additional embodiment of the invention relates to pharmaceutical compositions for treating disorders affected by expression or function of a novel TNFRl isogene descnbed herein.
  • the pharmaceutical composition may compnse any of the following active ingredients: a polynucleotide compnsmg one of these novel TNFRl isogenes; an antisense oligonucleotide directed against one of the novel TNFRl isogenes, a polynucleotide encoding such an antisense oligonucleotide, or another compound which inhibits expression of a novel TNFRl isogene desc ⁇ bed herein.
  • the composition contains the active ingredient in a therapeutically effective amount.
  • therapeutically effective amount is meant that one or more of the symptoms relating to disorders related to the expression or function of a novel TNFRl isogene is reduced and/or eliminated.
  • the composition also compnses a pharmaceutically acceptable earner, examples of which include, but are not limited to, saline, buffered saline, dextrose, and water.
  • a pharmaceutically acceptable earner examples of which include, but are not limited to, saline, buffered saline, dextrose, and water.
  • Those skilled in the art may employ a formulation most suitable for the active ingredient, whether it is a polynucleotide, oligonucleotide, protein, peptide or small molecule antagonist.
  • the pharmaceutical composition may be administered alone or m combination with at least one other agent, such as a stabilizing compound.
  • Administration of the pharmaceutical composition may be by any number of routes including, but not limited to oral, intravenous, intramuscular, mtra-artal, mtramedullary, mtrathecal, intravent ⁇ cular, mtradermal, transdermal, subcutaneous, mtrapentoneal, tranasal, enteral, topical, sublmgual, or rectal. Further details on techniques for formulation and administration may be found m the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, PA).
  • the dose can be estimated initially either m cell culture assays or in animal models.
  • the animal model may also be used to determine the appropnate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • the exact dosage will be determined by the practitioner, in light of factors relating to the patient requinng treatment, including but not limited to seventy of the disease state, general health, age, weight and gender of the patient, diet, time and frequency of administration, other drugs being taken by the patient, and tolerance/response to the treatment.
  • the invention also provides compositions and methods for detecting the novel TNFRl polymo ⁇ hisms identified herein.
  • compositions compnse at least one TNFRl genotyp g oligonucleotide.
  • a TNFRl genotypmg oligonucleotide is a probe or p ⁇ mer capable of hybndizmg to a target region that is located close to, or that contains, one of the novel polymo ⁇ hic sites desc ⁇ bed herein.
  • the term "oligonucleotide” refers to a polynucleotide molecule having less than about 100 nucleotides.
  • a preferred oligonucleotide of the invention is 10 to 35 nucleotides long.
  • the oligonucleotide is between 15 and 30, and most preferably, between 20 and 25 nucleotides in length.
  • the oligonucleotide may be comp ⁇ sed of any phosphorylation state of nbonucleotides, deoxynbonucleotides, and acyclic nucleotide denvatives, and other functionally equivalent denvatives.
  • ohgonucleotides may have a phosphate-free backbone, which may be comp ⁇ sed of linkages such as carboxymethyl, acetamidate, carbamate, polyamide (peptide nucleic acid (PNA)) and the like (Varma, R. in Molecular Biology and Biotechnology, A Comprehensive Desk Reference, Ed. R.
  • specific hybndization means the oligonucleotide forms an anti-parallel double-stranded structure with the target region under certain hybndizmg conditions, while failing to form such a structure when incubated with a non-target region or a non-TNFRl polynucleotide under the same hybndizmg conditions.
  • the oligonucleotide specifically hybndizes to the target region under conventional high st ⁇ ngency conditions.
  • a nucleic acid molecule such as an oligonucleotide or polynucleotide is said to be a "perfect” or “complete” complement of another nucleic acid molecule if every nucleotide of one of the molecules is complementary to the nucleotide at the corresponding position of the other molecule.
  • a nucleic acid molecule is "substantially complementary” to another molecule if it hybndizes to that molecule with sufficient stability to remain m a duplex form under conventional low-st ⁇ ngency conditions. Conventional hybndization conditions are descnbed, for example, by Sambrook J.
  • an oligonucleotide pnmer may have a non-complementary fragment at its 5 ' end, with the remainder of the p ⁇ mer being complementary to the target region.
  • non-complementary nucleotides may be interspersed into the oligonucleotide probe or p ⁇ mer as long as the resulting probe or p ⁇ mer is still capable of specifically hybndizmg to the target region.
  • allele-specificity will depend upon a vanety of readily optimized stnngency conditions, including salt and formamide concentrations, as well as temperatures for both the hybndization and washing steps.
  • hybndization and washing conditions typically used for ASO probes are found m Kogan et al., "Genetic Prediction of Hemophilia A” in PCR Protocols, A Guide to Methods and Applications, Academic Press, 1990 and Ruano et al, 87 Proc. Natl. Acad. Sci. USA 6296-6300, 1990.
  • an allele-specific oligonucleotide will be perfectly complementary to one allele while contammg a single mismatch for another allele.
  • a preferred ASO probe for detecting TNFRl gene polymo ⁇ hisms comp ⁇ ses a nucleotide sequence selected from the group consisting of: CAGACAGGTTCAGTT 3 (SEQ ID NO:6) and its complement, CAGACAGTTTCAGTT 3 (SEQ ID NO:7) and its complement, TTCATTTGTGTGTCC 3 (SEQ ID NO:8) and its complement,
  • 5 AGGCGCTCCTCCTTT 3 (SEQ ID NO:24) and its complement
  • 5 AGGCGCTTCTCCTTT 3 (SEQ ED NO:25) and its complement
  • 5 GAGGAGAGGTGACCT 3 (SEQ ID NO:26) and its complement
  • 5 GAGGAGAAGTGACCT 3 (SEQ ID NO:27) and its complement
  • 5 CTTTCTTTTTCCTCA 3 (SEQ ID NO:28) and its complement
  • a preferred ASO forward pnmer for detecting TNFRl gene polymo ⁇ hisms comp ⁇ ses a nucleotide sequence selected from the group consisting of: 5 CAGATCCAGACAGGT 3 (SEQ ID NO:30), 5 CAGATCCAGACAGTT 3 (SEQ ID NO:31), 5 GAGAAGTTCATTTGT 3 (SEQ ID NO:32), 5 GAGAAGTTCATTTAT 3 (SEQ ID NO:33), 5 ACCTGCTGCTGCCAC 3 (SEQ ID NO : 34),
  • genotypmg ohgonucleotides of the invention hyb ⁇ dize to a target region located one to several nucleotides downstream of one of the novel polymo ⁇ hic sites identified herem. Such ohgonucleotides are useful in polymerase-mediated p ⁇ mer extension methods for detecting one of the novel polymo ⁇ hisms desc ⁇ bed herein.
  • the 3 '-terminus of the genotypmg oligonucleotide is a deoxynucleotide complementary to the nucleotide located immediately adjacent to the polymo ⁇ hic site.
  • a particularly preferred oligonucleotide p ⁇ mer for detecting TNFRl gene polymo ⁇ hisms by p ⁇ mer extension terminates in a nucleotide sequence selected from the group consisting of:
  • a composition contains two or more differently labeled genotypmg ohgonucleotides for simultaneously probing the identity of nucleotides at two or more polymo ⁇ hic sites. It is also contemplated that p ⁇ mer compositions may contain two or more sets of allele-specific p ⁇ mer pairs to allow simultaneous targeting and amplification of two or more regions containing a polymo ⁇ hic site.
  • the mvention provides a kit compnsmg at least two genotypmg ohgonucleotides packaged in separate containers.
  • the kit may also contain other components such as hybndization buffer (where the ohgonucleotides are to be used as a probe) packaged m a separate container.
  • the kit may contain, packaged in separate containers, a polymerase and a reaction buffer optimized for pnmer extension mediated by the polymerase, such as PCR.
  • the additional polymo ⁇ hic sites may be currently known polymo ⁇ hic sites or sites that are subsequently discovered.
  • genotypmg method involves isolating from the individual a nucleic acid mixture compnsmg the two copies of the TNFRl gene, or a fragment thereof, that are present in the individual, and determining the identity of the nucleotide pair at one or more of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS12 m the two copies to assign a TNFRl genotype to the individual.
  • the two "copies" of a gene m an individual may be the same allele or may be different alleles.
  • the genotypmg method comp ⁇ ses determining the identity of the nucleotide pair at each of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl l and PS12.
  • the nucleic acid mixture is isolated from a biological sample taken from the individual, such as a blood sample or tissue sample.
  • tissue samples include whole blood, semen saliva, tears, unne, fecal mate ⁇ al, sweat, buccal, skm and hair.
  • the nucleic acid mixture may be compnsed of genomic DNA, mRNA, or cDNA and, in the latter two cases, the biological sample must be obtained from an organ in which the TNFRl gene is expressed.
  • mRNA or cDNA preparations would not be used to detect polymo ⁇ hisms located m mtrons or in 5 ' and 3 ' nontransc ⁇ bed regions.
  • a TNFRl gene fragment If a TNFRl gene fragment is isolated, it must contain the polymo ⁇ hic s ⁇ te(s) to be genotyped.
  • One embodiment of the haplotyping method compnses isolating from the individual a nucleic acid molecule contammg only one of the two copies of the TNFRl gene, or a fragment thereof, that is present m the individual and determining in that copy the identity of the nucleotide at one or more of polymo ⁇ hic sites PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS12 in that copy to assign a TNFRl haplotype to the individual.
  • the nucleic acid may be isolated using any method capable of separating the two copies of the TNFRl gene or fragment such as one of the methods desc ⁇ bed above for prepa ⁇ ng TNFRl isogenes, with targeted in vivo cloning being the preferred approach.
  • any individual clone will only provide haplotype information on one of the two TNFRl gene copies present m an individual. If haplotype information is desired for the individual's other copy, additional TNFRl clones will need to be examined. Typically, at least five clones should be examined to have more than a 90% probability of haplotyping both copies of the TNFRl gene in an individual.
  • the nucleotide at each of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS12 is identified.
  • a TNFRl haplotype pair is determined for an individual by identifying the phased sequence of nucleotides at one or more polymo ⁇ hic sites selected from the group consisting of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS12 in each copy of the TNFRl that is gene present m the individual.
  • the haplotyping method compnses identifying the phased sequence of nucleotides at each of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS12 in each copy of the TNFRl gene.
  • the identifying step is preferably performed with each copy of the gene being placed m separate containers.
  • the two copies are labeled with different tags, or are otherwise separately distinguishable or identifiable, it could be possible in some cases to perform the method in the same container.
  • first and second copies of the gene are labeled with different first and second fluorescent dyes, respectively, and an allele-specific oligonucleotide labeled with yet a third different fluorescent dye is used to assay the polymo ⁇ hic s ⁇ te(s), then detecting a combination of the first and third dyes would identify the polymo ⁇ hism the first gene copy while detecting a combination of the second and third dyes would identify the polymo ⁇ hism in the second gene copy.
  • the identity of a nucleotide (or nucleotide pair) at a polymo ⁇ hic s ⁇ te(s) may be determined by amplifying a target reg ⁇ on(s) containing the polymo ⁇ hic s ⁇ te(s) directly from one or both copies of the TNFRl gene, or fragment thereof, and the sequence of the amplified reg ⁇ on(s) determined by conventional methods It will be readily appreciated by the skilled artisan that only one nucleotide will be detected at a polymo ⁇ hic site individuals who are homozygous at that site, while two different nucleotides will be detected if the individual is heterozygous for that site.
  • the polymo ⁇ hism may be identified directly, known as positive-type identification, or by inference, referred to as negative-type identification.
  • a site may be positively determined to be either guanme or cytosine for an individual homozygous at that site, or both guanme and cytosine, if the individual is heterozygous at that site.
  • the site may be negatively determined to be not guanme (and thus cytosme/cytosme) or not cytosine (and thus guanme/guanme).
  • the target reg ⁇ on(s) may be amplified using any ohgonucleotide-directed amplification method, including but not limited to polymerase chain reaction (PCR) (U.S. Patent No. 4,965,188), hgase chain reaction (LCR) (Barany et al., Proc. Natl. Acad. Sci. USA 88:189-193, 1991; WO90/01069), and oligonucleotide ligation assay (OLA) (Landegren et al., Science 241:1077-1080, 1988).
  • PCR polymerase chain reaction
  • LCR hgase chain reaction
  • OLA oligonucleotide ligation assay
  • Ohgonucleotides useful as p ⁇ mers or probes m such methods should specifically hyb ⁇ dize to a region of the nucleic acid that contains or is adjacent to the polymo ⁇ hic site.
  • the ohgonucleotides are between 10 and 35 nucleotides in length and preferably, between 15 and 30 nucleotides m length. Most preferably, the ohgonucleotides are 20 to 25 nucleotides long. The exact length of the oligonucleotide will depend on many factors that are routinely considered and practiced by the skilled artisan.
  • nucleic acid amplification procedures may be used to amplify the target region including transc ⁇ ption-based amplification systems (U.S. Patent No. 5,130,238; EP 329,822; U.S. Patent No. 5,169,766, WO89/06700) and isothermal methods (Walker et L., Proc. Natl. Acad. Sci. USA 89:392- 396, 1992.
  • a polymo ⁇ hism m the target region may also be assayed before or after amplification using one of several hybndization-based methods known m the art.
  • allele-specific ohgonucleotides are utilized in performing such methods.
  • the allele-specific ohgonucleotides may be used as differently labeled probe pairs, with one member of the pair showing a perfect match to one vanant of a target sequence and the other member showing a perfect match to a different vanant.
  • more than one polymo ⁇ hic site may be detected at once using a set of allele-specific ohgonucleotides or oligonucleotide pairs.
  • the members of the set have melting temperatures within 5°C, and more preferably withm 2°C, of each other when hybndizmg to each of the polymo ⁇ hic sites bemg detected.
  • Hybndization of an allele-specific oligonucleotide to a target polynucleotide may be performed with both entities in solution, or such hybridization may be performed when either the oligonucleotide or the target polynucleotide is covalently or noncovalently affixed to a solid support.
  • Attachment may be mediated, for example, by antibody-antigen interactions, poly-L-Lys, streptavid or avidm-biotm, salt b ⁇ dges, hydrophobic interactions, chemical linkages, UV cross-linking baking, etc.
  • Allele-specific ohgonucleotides may be synthesized directly on the solid support or attached to the solid support subsequent to synthesis.
  • Solid-supports suitable for use m detection methods of the invention include substrates made of silicon, glass, plastic, paper and the like, which may be formed, for example, into wells (as in 96-well plates), slides, sheets, membranes, fibers, chips, dishes, and beads.
  • the solid support may be treated, coated or de ⁇ vatized to facilitate the immobilization of the allele-specific oligonucleotide or target nucleic acid.
  • the genotype or haplotype for the TNFRl gene of an individual may also be determined by hybndization of a nucleic sample containing one or both copies of the gene to nucleic acid arrays and subarrays such as descnbed in WO 95/11995.
  • the arrays would contain a battery of allele-specific ohgonucleotides representing each of the polymo ⁇ hic sites to be included m the genotype or haplotype.
  • polymo ⁇ hisms may also be determined using a mismatch detection technique, including but not limited to the RNase protection method using ⁇ boprobes (Winter et al., Proc. Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science 230:1242, 1985) and proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modnch, P. Ann. Rev. Genet. 25:229-253 (1991).
  • a mismatch detection technique including but not limited to the RNase protection method using ⁇ boprobes (Winter et al., Proc. Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science 230:1242, 1985) and proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modnch, P. Ann. Rev. Genet. 25:229-253 (1991).
  • vanant alleles can be identified by single strand conformation polymo ⁇ hism (SSCP) analysis (Onta et al., Genomics 5:874-879, 1989; Humph ⁇ es et al., in Molecular Diagnosis of Genetic Diseases, R. Elles, ed.. pp 321-340, 1996) or denatu ⁇ ng gradient gel electrophoresis (DGGE) (Wartell et al , Nucl. Acids Res 18:2699-2706, 1990; Sheffield et al., Proc. Natl. Acad. Sci. USA 86:232- 236, 1989).
  • SSCP single strand conformation polymo ⁇ hism
  • DGGE denatu ⁇ ng gradient gel electrophoresis
  • a polymerase-mediated pnmer extension method may also be used to identify the polymo ⁇ h ⁇ sm(s).
  • Several such methods have been descnbed m the patent and scientific literature and include the "Genetic Bit Analysis” method (W092/15712) and the hgase/polymerase mediated genetic bit analysis (U.S. Patent 5,679,524.
  • Related methods are disclosed in WO91/02087, WO90/09455,
  • Extended p ⁇ mers containing a polymo ⁇ hism may be detected by mass spectrometry as desc ⁇ bed in U S Patent No 5,605,798.
  • An other p ⁇ mer extension method is allele-specific PCR (Ruano et al., Nucl. Acids Res. 17:8392, 1989; Ruano et al., Nucl. Acids Res. 19, 6877-6882, 1991; WO 93/22456; Turki et al., J. Chn. Invest. 95:1635-1641, 1995).
  • multiple polymo ⁇ hic sites may be investigated by simultaneously amplifying multiple regions of the nucleic acid using sets of allele-specific pnmers as descnbed in Wallace et al. (WO89/10414).
  • an individual's TNFRl haplotype pair is predicted from its TNFRl genotype using information on haplotype pairs known to exist m a reference population.
  • the haplotyping prediction method compnses identifying a TNFRl genotype for the individual at two or more polymo ⁇ hic sites selected from the group consisting of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS12, enumerating all possible haplotype pairs which are consistent with the genotype, accessing data containing TNFRl haplotype pairs identified in a reference population, and assigning a haplotype pair to the individual that is consistent with the data.
  • a preferred reference population allows the detection of any haplotype whose frequency is at least 10% with about 99% certainty and compnses about 20 unrelated individuals from each of the four population groups named above.
  • a particularly preferred reference population includes a 3-generation family representmg one or more of the four population groups to serve as controls for checking quality of haplotyping procedures.
  • the haplotype frequency data for each ethnogeographic group is examined to determine whether it is consistent with Hardy- Wemberg equihb ⁇ um. Hardy- Weinberg equihb ⁇ um (D.L.
  • a statistically significant difference between the observed and expected haplotype frequencies could be due to one or more factors including significant inbreeding m the population group, strong selective pressure on the gene, sampling bias, and/or errors in the genotypmg process. If large deviations from ⁇ ardy- Wemberg equihb ⁇ um are observed in an ethnogeographic group, the number of individuals m that group can be increased to see if the deviation is due to a sampling bias. If a larger sample size does not reduce the difference between observed and expected haplotype pair frequencies, then one may wish to consider haplotyping the individual using a direct haplotyping method such as, for example, CLASPER System technology (U.S. Patent No. 5,866,404), SMD, or allele-specific long-range PCR (Michalotos-Belom et al., Nucleic Acids Res. 24:4841-4843, 1996)
  • the assigning step involves performing the following analysis. First, each of the possible haplotype pairs is compared to the haplotype pairs in the reference population. Generally, only one of the haplotype pairs in the reference population matches a possible haplotype pair and that pair is assigned to the individual. Occasionally, only one haplotype represented m the reference haplotype pairs is consistent with a possible haplotype pair for an individual, and m such cases the individual is assigned a haplotype pair containing this known haplotype and a new haplotype denved by subtracting the known haplotype from the possible haplotype pair.
  • the individual is preferably haplotyped using a direct molecular haplotyping method such as, for example, CLASPER System TM technology (U.S. Patent No. 5,866,404), SMD, or allele-specific long-range PCR (Michalotos-Belom et al., Nucleic Acids Res. 24:4841-4843, 1996).
  • a direct molecular haplotyping method such as, for example, CLASPER System TM technology (U.S. Patent No. 5,866,404), SMD, or allele-specific long-range PCR (Michalotos-Belom et al., Nucleic Acids Res. 24:4841-4843, 1996).
  • the invention also provides a method for determining the frequency of a TNFRl genotype or TNFRl haplotype in a population.
  • the method compnses determining the genotype or the haplotype pair for the TNFRl gene that is present in each member of the population, wherein the genotype or haplotype compnses the nucleotide pair or nucleotide detected at one or more of PSl, PS2, PS3, PS4, PS5, PS6, PS7, PS8, PS9, PS10, PSl 1 and PS12 m the TNFRl gene; and calculating the frequency any particular genotype or haplotype is found m the population.
  • the population may be a reference population, a family population, a same sex population, a population group, a trait population (e.g., a group of individuals exhibiting a trait of interest such as a medical condition or response to a therapeutic treatment).
  • frequency data for TNFRl genotypes and/or haplotypes found m a reference population are used in a method for identifying an association between a trait and a TNFRl genotype or a TNFRl haplotype.
  • the trait may be any detectable phenotype, including but not limited to susceptibility to a disease or response to a treatment.
  • the method involves obtaining data on the frequency of the genotype(s) or haplotype(s) of interest in a reference population as well as m a population exhibiting the trait.
  • Frequency data for one or both of the reference and trait populations may be obtained by genotypmg or haplotyping each individual in the populations using one of the methods desc ⁇ bed above.
  • the haplotypes for the trait population may be determined directly or, alternatively, by the predictive genotype to haplotype approach desc ⁇ bed above.
  • the frequency data for the reference and/or trait populations is obtained by accessing previously determined frequency data, which may be in wntten or electronic form.
  • the frequency data may be present in a database that is accessible by a computer. Once the frequency data is obtained, the frequencies of the genotype(s) or haplotype(s) of interest in the reference and trait populations are compared. In a preferred embodiment, the frequencies of all genotypes and/or haplotypes observed in the populations are compared.
  • the trait is predicted to be associated with that TNFRl genotype or haplotype.
  • the TNFRl genotype or haplotype being compared in the trait and reference populations is selected from the full-genotypes and full- haplotypes shown in Tables 3 and 4, respectively, or from sub-genotypes and sub-haplotypes denved from these genotypes and haplotypes.
  • the trait of interest is a clinical response exhibited by a patient to some therapeutic treatment, for example, response to a drug targeting TNFRl or response to a therapeutic treatment for a medical condition.
  • medical condition includes but is not limited to any condition or disease manifested as one or more physical and/or psychological symptoms for which treatment is desirable, and includes previously and newly identified diseases and other disorders.
  • clinical response means any or all of the following: a quantitative measure of the response, no response, and adverse response (i.e., side effects).
  • clinical population In order to deduce a correlation between clinical response to a treatment and a TNFRl genotype or haplotype, it is necessary to obtain data on the clinical responses exhibited by a population of individuals who received the treatment, hereinafter the "clinical population".
  • This clinical data may be obtained by analyzing the results of a clinical trial that has already been run and/or the clinical data may be obtained by designing and carrying out one or more new clinical trials.
  • the term "clinical trial” means any research study designed to collect clinical data on responses to a particular treatment, and includes but is not limited to phase I, phase II and phase HI clinical trials. Standard methods are used to define the patient population and to enroll subjects.
  • the individuals included in the clinical population have been graded for the existence of the medical condition of interest. This is important in cases where the symptom(s) being presented by the patients can be caused by more than one underlying condition, and where treatment of the underlying conditions are not the same. An example of this would be where patients experience breathing difficulties that are due to either asthma or respiratory infections. If both sets were treated with an asthma medication, there would be a spurious group of apparent non-responders that did not actually have asthma. These people would affect the ability to detect any correlation between haplotype and treatment outcome.
  • This grading of potential patients could employ a standard physical exam or one or more lab tests. Alternatively, grading of patients could use haplotyping for situations where there is a strong correlation between haplotype pair and disease susceptibility or severity.
  • the therapeutic treatment of interest is administered to each individual in the trial population and each individual's response to the treatment is measured using one or more predetermined criteria. It is contemplated that in many cases, the trial population will exhibit a range of responses and that the investigator will choose the number of responder groups (e.g., low, medium, high) made up by the various responses.
  • the TNFRl gene for each individual in the trial population is genotyped and/or haplotyped, which may be done before or after administering the treatment.
  • correlations between individual response and TNFRl genotype or haplotype content are created. Correlations may be produced in several ways. In one method, individuals are grouped by their TNFRl genotype or haplotype (or haplotype pair) (also referred to as a polymo ⁇ hism group), and then the averages and standard deviations of clinical responses exhibited by the members of each polymo ⁇ hism group are calculated.
  • the most-common and least common nucleotides at the polymo ⁇ hic site are first defined. Then, for each individual in the trial population, one calculates a "dose" as the number of least- common nucleotides the individual has at the polymo ⁇ hic site of interest. This value can be 0 (homozygous for the least-common nucleotide), 1 (heterozygous), or 2 (homozygous for the most common nucleotide).
  • An individual's "response” is the value of the clinical measurement. Standard linear regression methods are then used to fit all the individuals' doses and responses to a single model (see e.g., L.D. Fisher and G.
  • the outputs of the regression calculation are the intercept r 0 , the slope S, and the va ⁇ ance (which measures how well the data fits this simple linear model).
  • the Students t-test value and the level of significance can then be calculated for each of the polymo ⁇ hic sites.
  • a second method for finding correlations between TNFRl haplotype content and clinical responses uses predictive models based on error-mmimizmg optimization algo ⁇ thms.
  • One of many possible optimization algo ⁇ thms is a genetic algonthm (R. Judson, "Genetic Algonthms and Their Uses in Chemistry” in Reviews m Computational Chemistry, Vol. 10, pp. 1-73, K. B. Lipkowitz and D. B. Boyd, eds. (VCH Publishers, New York, 1997).
  • Simulated annealing Press et al., "Nume ⁇ cal Recipes in C: The Art of Scientific Computing", Camb ⁇ dge University Press (Camb ⁇ dge) 1992, Ch. 10), neural networks (E. Rich and K.
  • C is the measured clinical outcome, l goes over all polymo ⁇ hic sites, over all candidate genes, C 0 , w ⁇ a and w' are vanable weight values, R, a is equal to 1 if site l in gene ⁇ in the first haplotype takes on the most common nucleotide and -1 if it takes on the less common nucleotide.
  • L x a is the same as R, a except for the second haplotype.
  • the constant term C 0 and the weights w. a and w a are vaned by the genetic algonthm dunng a search process that minimizes the error between the measured value of C and the value calculated from Equation 1.
  • Models other than the one given in Equation 1 can be readily mco ⁇ orated by those skilled in the art for analyzing the clinical and polymo ⁇ hism data.
  • the genetic algonthm is especially suited for searching not only over the space of weights m a particular model but also over the space of possible models (Judson, supra).
  • Correlations may also be analyzed usmg analysis of vanation (ANOVA) techniques to determine how much of the vanation m the clinical data is explained by different subsets of the polymo ⁇ hic sites m the TNFRl gene.
  • ANOVA is used to test hypotheses about whether a response vanable is caused by or correlated with one or more traits or vanables that can be measured (Fisher and vanBelle, supra, Ch. 10). These traits or vanables are called the independent vanables.
  • the independent vanable(s) are measured and individuals are placed into groups based on their values for these vanables.
  • the independent variable(s) refers to the combination of polymo ⁇ hisms present at a subset of the polymo ⁇ hic sites, and thus, each group contains those individuals with a given genotype or haplotype pair.
  • the variation in response within the groups and also the variation between groups is then measured. If the within-group response variation is large (people in a group have a wide range of responses) and the response variation between groups is small (the average responses for all groups are about the same) then it can be concluded that the independent variables used for the grouping are not causing or correlated with the response variable. For instance, if people are grouped by month of birth (which should have nothing to do with their response to a drug) the ANOVA calculation should show a low level of significance.
  • the calculated F-ratio is preferably compared with the critical F-distribution value at whatever level of significance is of interest. If the F- ratio is greater than the Critical F-distribution value, then one may be confident that the individual's genotype or haplotype pair for this particular subset of polymo ⁇ hic sites in the TNFRl gene is at least partially responsible for, or is at least strongly correlated with the clinical response.
  • a mathematical model may be readily constructed by the skilled artisan that predicts clinical response as a function of TNFRl genotype or haplotype content.
  • the model is validated in one or more follow-up clinical trials designed to test the model.
  • the identification of an association between a clinical response and a genotype or haplotype (or haplotype pair) for the TNFRl gene may be the basis for designing a diagnostic method to determine those individuals who will or will not respond to the treatment, or alternatively, will respond at a lower level and thus may require more treatment, i.e., a greater dose of a drug.
  • the diagnostic method may take one of several forms: for example, a direct DNA test (i.e., genotyping or haplotyping one or more of the polymo ⁇ hic sites in the TNFRl gene), a serological test, or a physical exam measurement.
  • a direct DNA test i.e., genotyping or haplotyping one or more of the polymo ⁇ hic sites in the TNFRl gene
  • serological test i.e., a serological test
  • a physical exam measurement i.e., a physical exam measurement.
  • this diagnostic method uses the predictive haplotyping method described above.
  • any or all analytical and mathematical operations involved in practicing the methods of the present invention may be implemented by a computer.
  • the computer may execute a program that generates views (or screens) displayed on a display device and with which the user can interact to view and analyze large amounts of information relating to the TNFRl gene and its genomic variation, including chromosome location, gene structure, and gene family, gene expression data, polymo ⁇ hism data, genetic sequence data, and clinical data population data (e.g., data on ethnogeographic origin, clinical responses, genotypes, and haplotypes for one or more populations).
  • the TNFRl polymo ⁇ hism data described herein may be stored as part of a relational database (e.g., an instance of an Oracle database or a set of ASCII flat files).
  • polymo ⁇ hism data may be stored on the computer's hard drive or may, for example, be stored on a CD ROM or on one or more other storage devices accessible by the computer.
  • the data may be stored on one or more databases in communication with the computer via a network.
  • This example illustrates examination of the TNFRl gene for polymo ⁇ hic sites from about 790 base pairs upstream of the ATG start site to about 860 base pairs upstream of the termination codon.
  • Va ⁇ ous regions of the TNFRl gene were amplified using the following PCR pnmer pairs, with the indicated positions corresponding to GenBank Accession Nos. X69810, M75865 and M75866.
  • PCR product 269 nt Fragment 4 (exon 3) Forward pnmer 367-393 5'- GAATCGGCCCTGGCTGTTGTCCCT AGC-3'(SEQ ID NO:84) Reverse pnmer complement of 702-675 5'- ACATCCATGCAGTGTCCCACCAAAAC-3'(SEQ ID NO:85) PCR product 336 nt
  • Amplification profile 94°C - 2 mm. 1 cycle
  • PCR products were pu ⁇ f ⁇ ed by Solid Phase Reversible Immobilization using the protocol developed by the Whitehead Genome Center. A detailed protocol can be found at http://www.genome.wi.mit.edu sequencing/protocols/pure/SPRI_pcr.html.
  • Fragment 2 (exon 1) Forward pnmer 531-554 5'- TGTTGCAACACT GCCTCACTCTTC -3'(SEQ ID NO:98) Reverse p ⁇ mer complement of 1022-997 5'-GGATGAATGGGGAACCCCACACTG-3'(SEQ ID NO:99)
  • Fragment 5 (exon 4) Forward primer 741-764 5'-GAAGGGGATGCAGGGACAGGAGGA-3' (SEQ ID NO: 104) Reverse primer complement of 1031-1007 5'- AAGGAAAGGAAGTGCCACCGCATG -3' (SEQ ID NO: 105)
  • Fragment 8 (exon 7) Forward primer 226-249 5'- CACCCATCCATCTATCCCTGCGGC -3 '(SEQ ID NO: 110) Reverse primer complement of 480-458 5'- CATGTCGATCGCACCCACCCATG -3 '(SEQ ID NO: 111)
  • Fragment 9 (exon 8) Forward primer 638-660 5'- GCCAGCTGAGTCCAGGGTGCCAG-3' (SEQ ID NO:l 12) Reverse primer complement of 806-784 5'- TCTGAGCATTAGGCAATTATAAG-3' (SEQ ID NO: 113)
  • This example illustrates analysis of the TNFRl polymo ⁇ hisms identified in the Index Repository for human genotypes and haplotypes.
  • TNFRl haplotypes were denved or inferred from these genotypes using the following haplotype denvation protocol.
  • genotype data determined for the gene of interest are organized as a spreadsheet with one row per individual and one column per variable site.
  • the pattern of segregation of each SNP m a genotype is followed in the family pedigrees m the Index Repository to authenticate it as a Mendehan va ⁇ ant. For instance, if both grandparents are homozygous G, a child or grand child should not be homozygous A
  • haplotype 1 is a genetic sequence that corresponds to the genetic sequence of the haplotype.
  • haplotype pair of one or more children is found to consist of haplotypes 1 and 5
  • the other parent, and at least one grandparent must also have haplotype 5.
  • haplotype 5 can be subtracted from their unphased genotypes to resolve their second haplotype, and subtract this new parental haplotype from the unresolved children and grandparent.
  • any homozygote m the pedigree is a reasonable place to start, but even "known" genotypes should be inspected for Mendehan transmission to detect potential errors.
  • a 1-3 child is inconsistent with a 1-1 father and a 2-2 mother, even if all polymo ⁇ hic sites were individually consistent with Mendehan transmission.
  • Such cases can generally be resolved by identifying the source of error with respect to the rest of the pedigree — grandparents and siblings in this case.
  • a single-site heterozygote can usually be chosen to begin resolution of all haplotypes m the family. For instance, a 1 -2 heterozygous child must have one parent with a 1 and the other with a 2. Although theoretically both parents could be consistent with either 1 or 2 (e.g., both parents are also 1-2's) this rarely happens m practice. As above, known haplotypes can be subtracted from the unphased genotypes to determine all haplotypes for the remainder of the family.
  • haplotypes Because resolution of a multiply heterozygous genotype from an unrelated individual is completely unreliable without some idea of which haplotypes exist for the population, it is essential to directly determine at least some of the haplotypes from the population, e.g., by Mendehan analysis of genotypes in three-generation families and/or by a molecular haplotyping technique. Generally, only one combination of known haplotypes is consistent with each individual's genotype, and that combination is inferred to be correct. Occasionally, only one known haplotype is consistent with one of these individuals, and so it is assumed present along with a new haplotype inferred from subtracting the known haplotype. Rarely, either no haplotypes or multiple pairs of haplotypes can be inferred, in which case the individual is not included m the haplotype data set.
  • Resolution proceeds among the unrelated individuals by using the growing list of known haplotypes to resolve phase as m the paragraph above.
  • An additional rule is utilized in the case of polymo ⁇ hisms that appear specific to a particular population group. If a new haplotype is required because of the occurrence of a previously unobserved vanant, all individuals m that population group with the new va ⁇ ant are inspected to see if a single new haplotype will explain this vanant. This is usually the case, and presumably represents an ethnogeographic-specific polymo ⁇ hism.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne des polynucléotides comprenant un ou plusieurs polymorphismes parmi douze nouveaux polymorphismes de nucléotides uniques dans le gène du récepteur 1 du facteur de nécrose des tumeurs (TNFR1). L'invention a pour objet des compositions et des procédés pour détecter un ou plusieurs de ces polymorphismes. En outre, l'invention concerne divers génotypes et haplotypes pour le gène TNFR1 qui existent dans la population.
PCT/US2000/004606 1999-02-23 2000-02-23 Isogenes de recepteur: polymorphismes dans le recepteur du facteur de necrose tissulaire WO2000050436A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2000236029A AU2000236029A1 (en) 1999-02-23 2000-02-23 Receptor isogenes: polymorphisms in the tissue necrosis factor receptor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12131499P 1999-02-23 1999-02-23
US60/121,314 1999-02-23

Publications (1)

Publication Number Publication Date
WO2000050436A1 true WO2000050436A1 (fr) 2000-08-31

Family

ID=22395880

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/004606 WO2000050436A1 (fr) 1999-02-23 2000-02-23 Isogenes de recepteur: polymorphismes dans le recepteur du facteur de necrose tissulaire

Country Status (2)

Country Link
AU (1) AU2000236029A1 (fr)
WO (1) WO2000050436A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003079241A1 (fr) * 2002-03-18 2003-09-25 Diatech Pty Ltd Evaluation d'ensembles de donnees
US7488576B2 (en) * 2000-07-06 2009-02-10 The Regents Of The University Of California Methods for diagnosis and treatment of psychiatric disorders
US8722615B2 (en) 2009-12-02 2014-05-13 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
US8883982B2 (en) 2011-06-08 2014-11-11 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993019777A1 (fr) * 1992-03-30 1993-10-14 Immunex Corporation Proteines de fusion comprenant un recepteur de facteur de necrose tumorale
EP0606869A1 (fr) * 1993-01-10 1994-07-20 Yeda Research And Development Company, Ltd. Séquence promotrice du récepteur p55 du facteur de nécrose de tumeur
US5491075A (en) * 1990-10-24 1996-02-13 The Mount Sinai School Of Medicine Of The City University Of New York Cloning and expression of biologically active α-N-acetylgalactosaminidase

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5491075A (en) * 1990-10-24 1996-02-13 The Mount Sinai School Of Medicine Of The City University Of New York Cloning and expression of biologically active α-N-acetylgalactosaminidase
WO1993019777A1 (fr) * 1992-03-30 1993-10-14 Immunex Corporation Proteines de fusion comprenant un recepteur de facteur de necrose tumorale
EP0606869A1 (fr) * 1993-01-10 1994-07-20 Yeda Research And Development Company, Ltd. Séquence promotrice du récepteur p55 du facteur de nécrose de tumeur

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LUCKENBACH ET. AL.: "Restriction fragment length polymorphism: Molecular weight analysis and calculation with a scanner-based computer system", ELECTROPHORESIS, vol. 15, no. 2, February 1994 (1994-02-01), pages 149 - 152, XP002929438 *
STUBER ET. AL.: "A genomic polymorphism within the tumor necrosis factor locus influences plasma tumor necrosis factor-alpha concentrations and outcome of patients with severe sepsis", CRITICAL CARE MEDICINE, vol. 24, no. 3, December 1996 (1996-12-01), pages 381 - 384, XP002929439 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7488576B2 (en) * 2000-07-06 2009-02-10 The Regents Of The University Of California Methods for diagnosis and treatment of psychiatric disorders
WO2003079241A1 (fr) * 2002-03-18 2003-09-25 Diatech Pty Ltd Evaluation d'ensembles de donnees
US8722615B2 (en) 2009-12-02 2014-05-13 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
US8883982B2 (en) 2011-06-08 2014-11-11 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life

Also Published As

Publication number Publication date
AU2000236029A1 (en) 2000-09-14

Similar Documents

Publication Publication Date Title
AU2000278349A1 (en) Drug target isogenes: polymorphisms in the interleukin 13 gene
WO2000050436A1 (fr) Isogenes de recepteur: polymorphismes dans le recepteur du facteur de necrose tissulaire
WO2001004270A1 (fr) Isogenes de ciblage de medicaments: polymorphismes dans le gene alpha du recepteur de l'interleukine 4
US20030175710A1 (en) Haplotypes of the TNFRSF11B gene
WO2001005832A1 (fr) Isogenes cibles de medicament: polymorphismes dans le gene d2 du recepteur de dopamine
WO2001090123A2 (fr) Haplotypes du gene agtrl1
WO2002012497A2 (fr) Haplotypes du gene nfkbib
WO2001027312A2 (fr) Isogenes cibles pour medicaments: polymorphismes dans le gene recepteur de l'acetylcholine muscarinique m1
EP1208112A1 (fr) Isogenes cibles pour medicament: polymorphismes dans le gene recepteur 1a de la 5-hydroxytryptamine
EP1208194A2 (fr) Isogenes cibles de medicaments : polymorphismes dans le gene de la sous-unite alpha du recepteur i de l'immunoglobuline e
WO2001079224A2 (fr) Haplotypes du gene cyp8b1
WO2001029176A2 (fr) Isogenes cibles de medicaments: polymorphismes dans le gene 3 muscarinique, de recepteur cholinergique
WO2001079232A2 (fr) Haplotypes du gene mpl
US20040072161A1 (en) Haplotypes of the F2RL1 gene
WO2001079240A2 (fr) Haplotypes du gene rangap1
WO2002050098A2 (fr) Haplotypes du gene du recepteur de la prolactine (prlr)
WO2002062820A2 (fr) Haplotypes du gene cyp27b1
WO2001090127A2 (fr) Haplotypes du gene de hoxd3
WO2001014588A1 (fr) Isogenes cibles de medicament: polymorphismes dans le gene de la chaine beta du recepteur e d'immunoglobuline
WO2002063045A1 (fr) Isogenes cibles de medicament: polymorphismes dans le gene du recepteur 2 de l'angiotensine
WO2001027313A2 (fr) Isogenes cibles pour medicaments: polymorphisme dans le gene muscarinique 2 recepteur cholinergique
WO2002030949A2 (fr) Haplotypes du gene ltb4r
WO2001018232A2 (fr) Isogenes cibles de medicaments: polymorphismes dans le gene de proteine bruleuse de graisses excedentaires (mitochondriale, porteuse de protons)
WO2001025194A2 (fr) Isogenes cibles de medicaments: polymorphismes dans le gene du recepteur 1b de 5-hydroxytryptamine (serotonine)
WO2002026766A2 (fr) Haplotypes du gene sstr4

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase