WO2000047713A2

WO2000047713A2 - Genes encoding the 5h7 antibody and methods for conferring programmed cell death properties to cells

Info

Publication number: WO2000047713A2
Application number: PCT/US2000/003234
Authority: WO
Inventors: E. Steve Woodle; Jean Maguire Van Seventer; Sanjay Kulkarni; David Kranz; Philmore Holman
Original assignee: Arch Development Corporation; The Board Of Trustees Of The University Of Illinois
Priority date: 1999-02-09
Filing date: 2000-02-08
Publication date: 2000-08-17
Also published as: AU2985800A; WO2000047713A9

Abstract

The present invention relates to isolated and purified polynucleotides encoding for the light and heavy variable regions of a 5H7 antibody and methods for using these genes to confer programmed cell death properties to a cell.

Description

GENES ENCODING THE 5H7 ANTIBODY AND METHODS FOR CONFERRING PROGRAMMED CELL DEATH PROPERTIES TO CELLS

Technical Field of the nvention The present invention relates to genes which encode a single chain antibody specific for a monomoφhic determinant expressed by the α3 domain of human class I major histocompatibility complex molecules and methods for using said genes to confer programmed cell death properties to cells.

Background of the Invention

Prokaryotic and eukaryotic cells possess the ability to commit suicide via a distinct form of cellular death, referred to as "programmed cell death" (PCD). Woodle, E.S., et al., Transplantation, 66(6):681-691 (1998). Ligation of several membrane receptors mediate PCD including Fas (CD95), TNFR1, CD40, DR3, DR4, DR5, p75 nerve growth factor (NGF), T cell receptor complex (TCR) and class I major histocompatibility complex (MHC). Ashkenazi, A., et al., Science, 281 :1305 (1998) and Woodle. E.S., et al., Transplantation, 66(6):681-691 (1998). The morphologic features of PCD are common to a wide variety of cells and include a decrease in cell size, cell membrane blebbing, cytoplasmic vacuolization, DNA condensation, and breakup of the cell into cell membrane-bound remnants called "apoptotic bodies". Id. The formation of cell membrane-bound apoptotic bodies prevents spillage of intracellular contents within the intercellular space, which prevents inflammatory changes. Id. These distinctive moφhologic features, combined with internucleosomal DNA degradation and the absence of inflammation serve to distinguish PCD from necrosis.

PCD has been shown to play a central role in several fundamental immunologic processes including thymic T-cell selection and T-cell-mediated cytotoxicity. Woodle, E.S., et al., Transplantation, 64(1): 140- 146 (1997). Additionally, PCD is thought to play a principal role in down-regulation of immune responses and is also believed to be the primary form of cell death in the development of tolerance via clonal deletion. Id. Several studies have examined a potential role for PCD in the rejection of transplanted organs. Id. These studies have demonstrated that PCD occurs in the rejection of the liver, kidney, and intestinal allografts. Id. Although these studies have demonstrated that PCD can occur during allograft rejections, the significance of PCD in mediating allograft injury during rejection remains to be resolved. Id. Furthermore, PCD alone cannot explain the marked degree of inflammation that is observed on histologic examination of rejecting allografts. Id.

There are several sites in the body which are considered to be immunologically "'privileged". Traditionally, immune-privileged sites are locations where allogenic or xenogeneic tissue grafts enjoy prolonged survival relative to other areas. Griffith. T.S., et al., Science, 270: 1189- 1192 ( 1995). Thus, these sites have been defined as regions in the body where the immune system appears not to function. Id. The Fas ligand (FasL) has been the most intensively studied death-signaling molecule used to protect cells from immune-mediated destruction and to confer "immune privilege". Despite the ability of FasL to induce PCD in vitro following FasL gene transfer, in vivo studies have not provided consistent results (See, Lau, H.T., et al., Science, 273:109 (1996), Allison, J., et al., Proc. Natl. Acad. Sci., 94:3943 (1997) and Kang, S-M., et al.,

Nature Medicine, 3:738 (1997)). FasL gene transfer studies in islet allografts have provided inconsistent graft survival (See Lau, H.T., et al., Science, 273:109 (1996) and Allison, J., et al., Proc. Natl. Acad. Sci, 94:3943 (1997)) and in some instances, enhanced graft destruction has been observed in association with dense neutrophilic infiltrates (See, Kang, S-M.. et al., Nature Medicine, 3:738 (1997)).

5H7 is an anti-human class I MHC monoclonal antibody (mAb) which recognizes a monomoφhic determinant of the α3 domain and possesses potent T cell inhibitory properties (see Smith, D.M., et al.. J. Immunol. 153:1054 (1994)). Studies have found that the 5H7 monoclonal antibody demonstrates a variety of effects, including the ability to inhibit anti-CD3- mediated T cell activation. The 5H7 mAb has been shown to induce PCD in lymphoid tumors, peripheral blood mononuclear cells (PBMC), and B6 mouse splenocytes transgenic for class I HLA-B27. Cells treated with 5H7 demonstrate typical histologic features of PCD, including increased cytoplasmic granularity and vacuolization, membrane blebbing and apoptotic body formation. The potency of 5H7 in inducing PCD is comparable to that of anti-Fas mAbs (See Woodle. E.S., et al., J. Immunol, 158:2156 (199 )). In addition to PCD signals. 5H7 induces growth inhibition of lymphoid tumors and inhibition of TCR mediated T cell activation (See, Smith, D.M., et al., J. Immunol, 153:1054 (1994)). Intracellular pathways involved in 5H7- mediated PCD have not been fully elucidated, however, the pathway appears to be distinct from that of the Fas pathway (See Woodle, E.S., et al., J. Immunol, 158:2156 (199 )).

Single-chain variable immunoglobulin domains (scFv) are genetically engineered, antigen-binding proteins composed of physically linked light and heavy variable (N_L and N_H) regions of antibody. Potential uses of scFv's include delineation of fine epitope specificity, imaging of neoplastic tissues, removal of plasma toxins and targeting effector functions to specific cells (See, Raag, R., et al., FASEB, J. 9:73 (1995)). Tumors have been targeted for destruction by an anti-tumor scFv coupled to the cytotoxic domains of Pseudomonas exotoxin (See Brinkman, U., et al., J. Immunol, 150:2774 (1993)), and cytotoxic T cell (CTL)-mediated lysis has been directed to tumors via an anti-TCR/anti-fluorescein bispecific scFv (See, Gruber,

M., et al., J. Immunol, 152:5368 (1994)).

Early limitation of scFv^'s included their univalency and requirement for physical attachment of effector domains. However, bivalent scFv's have subsequently been described (See. Mallender, WD, J. Biol Chem. 269:199 (1994)) and cell surface expression of scFv^'s via membrane anchors may provide sufficient receptor aggregation to initiate intercellular signals, even for the univalent scFv. Cell surface expression of a scFv has been achieved using a glycosylphosphotidylinostitol (GPI) (See. Winberg, G., et al., Immunol. Rev., 153:20 (1996)). Cell surface expression of one such molecule, anti-CD28 scFv, allowed effective crosslinking of CD28 receptors and cell-mediated delivery of potent co-stimulatory signals. Id.

There presently exists a need in the art for scFv's which can be used to confer PCD- inducing properties to cells. Summary of the Invention

The present invention relates to an isolated and purified polynucleotide having the nucleotide sequence of SEQ ID NO: 1 which codes for the light variable region of the 5H7 antibody. The present invention also relates to an isolated and purified polynucleotide having the nucleotide sequence of SEQ ID NO:3 which codes for the heavy variable region of the 5H7 antibody.

The present invention also relates to isolated and purified polypeptides encoded by the polynucleotide sequences described above. Specifically, the present invention relates to isolated and purified polypeptides having the amino acid sequences of SEQ ID NOS: 2 and 4.

The present invention further relates to a chimeric recombinant DNA molecule. The chimeric recombinant DNA molecule of the present invention contains the nucleotide sequence of SEQ ID NO:l, the nucleotide sequence of SEQ ID NO:3, a first linker and a second linker. The nucleotide sequence of SEQ ID NO: 1 is operably linked to the first linker, the first linker is operably linked to the nucleotide sequence of SEQ ID NO:3 and the nucleotide sequence of SEQ ID NO:3 is operably linked to the second linker. Preferably, the recombinant DNA molecule further contains a leader sequence which is operably linked to SEQ ID NO:l . The leader sequence preferably has the nucleotide sequence of SEQ ID NO: 5. The recombinant DNA molecule also preferably contains a nucleotide sequence which is operably linked to the second linker and which allows for the expression of the recombinant DNA molecule on the surface of a cell. This nucleotide sequence can be glycosylphosphotidylinostitol. The nucleotide sequence of glycosylphosphotidylinostitol is shown in SEQ ID NO:l 1. Additionally, the present invention also relates to a vector containing this chimeric recombinant DNA molecule and to bacterial and mammalian cells containing the vector.

Finally, the present invention relates to a method for conferring programmed cell death inducing properties to a cell. The method involves transforming a cell with the recombinant DNA molecule hereinbefore described. Brief Description of the Figures

Fig. 1 shows the primers (SEQ ID NOS: 15-23) used in the construction of 5H7scFv and 5H7scFv-GPI.

Fig. 2 shows a schematic representation of the 5H7scFv and 5H7scFv-GPI genes.

Fig. 3 A shows an analysis of purified 5H7scFv on an SDS-PAGE gel with standard molecular weight markers. 5H7scFN is about 30 kd in size under reduced and non-reduced conditions. Fig. 3B shows that 5H7scFv binds to BeND(ii), but not to a class I MHC deficient Baudi cell line (i).

Fig. 4 shows the surface expression of 5H7scFv-GPI on CHO cells and its binding to Ig- HLA-A2 fusion protein.

Fig. 5 A shows CHO-neo cells stained with anti-idiotypic monoclonal antibody A2.4. Fig.

5B shows CHO v5 cells stained with anti-idiotypic monoclonal antibody A2.4. Fig. 5C shows phospholipase C treated CHO v5 cells anti-idiotypic monoclonal antibody A2.4.

Fig. 6 shows that 5H7scFv-GPI PCD in human lymphoid tumor cells. Specifically, human lymphoid-derived tumor lines Daudi, Jurkat and BeND were co-cocultured with CHO-v5 and CHO-neo cells. After 72 hours, cells were stained with ethidium bromide/acridine orange solution and PCD quantitated by immunofluorescence microscopy. Co-cultures were incubated with A2.4 or isotype control antibody. Moφhologic features of apoptosis were observed in the human lymphoid-derived tumor lines, BeND and Jurkat, but not in Daudi lines. Inhibition of PCD was observed in co-cultures containing saturating levels of A2.4.

Fig. 7 shows Annexin N-FITC analysis confirming cell death. An increased mean fluorescence was noted with samples consisting of CHO-v5 cells with Jurkat and BeND lines. An inhibition of Annexin N-FITC was noted with the addition of the anti-5H7 monoclonal antibody, A2.4.

Fig. 8 shows the induction of PCD in human PBMC with 5H7scFv-GPI. Human donor PBMC were tested for susceptibility to 5H7scFv-GPI mediated PCD. CHO-v5 and CHO-neo cells were cultured with PBMC and stained with ethidium bromide/acridine orange (after 48 hours of culture) and PCD determined by fluorescence microscopy. PBMC underwent PCD at significantly higher levels when co-cultured with CHO-v5 than with CHO-neo. Augmentation of PCD was noted when PBMC was pre-activated with immobilized anti-CD28 and anti-CD3 for 48 ours prior to culture with CHO cells.

Fig. 9 shows the nucleotide sequence and corresponding amino acid sequence of the chimeric scFv of the present invention (SEQ ID NOS: 13 and 14, respectively).

Detailed Description of the Invention 1. The Present Invention

The present invention relates to isolated and purified polynucleotide sequences which encode for the light and heavy variable regions of the 5H7 antibody. In another embodiment, the present invention relates to polypeptides for the light and heavy variable regions of the 5H7 antibody. In yet another embodiment, the present invention relates to a chimeric recombinant DNA molecule which, upon expression, produces a single-chain variable immunoglobulin domain (scFv). The DNA molecule of the present invention contains a polynucleotide sequence encoding the light variable region of a 5H7 antibody which is operably linked to a first linker. This first linker is operably linked to a polynucleotide encoding the heavy variable region of the 5H7 antibody. The polynucleotide sequence encoding the heavy variable region of the 5H7 antibody is operably linked to a second linker. Optionally, the second linker may also be operably linked to a polynucleotide which encodes glycophophotidylinostitol. The present invention also relates to vectors containing this recombinant DNA molecule and host cells transformed with this vector. In a final embodiment, the present invention relates to a method for conferring programmed cell death properties to a cell using the recombinant DNA molecules of the present invention.

II Sequence Listing

The present application also contains a sequence listing that contains 23 sequences. The sequence listing contains nucleotide sequences and amino acid sequences. For the nucleotide sequences, the base pairs are represented by the following base codes:

Svmbol Meaning

A A; adenine

C C; cytosine

G G; guanine

T T; thymine u U; uracil

M A or C

R A or G

W A or T/U

S C or G

Svmbol Meaning

Y C or T/U

K G or T/U

N A or C or G; not T U

H A or C or T/U; not G

D A or G or T/U; not C

B C or G or T U: not A

Ν (A or C or G or T/U)

The amino acids shown in the application are in the L-form and are represented by the following amino acid-three letter abbreviations:

Abbrevial ion Amino acid name

Ala L-Alanine

Arg L-Arginine

Asn L-Asparagine

Asp L-Aspartic Acid

Asx L-Aspartic Acid or Asparagine

Cys L-Cysteine

Glu L-Glutamic Acid

Gin L-Glutamine

Glx L-Glutamine or Glutamic Acid Gly L-Glycine

His L-Histidine lie L-Isoleucine

Leu L-Leucine

Lys L-Lysine

Met L-Methionine

Phe L-Phenylalanine

Pro L-Proline

Ser L-Serine

Thr L-Threonine

Tφ L-Tryptophan

Tyr L-Tyrosine

Nal L-Naline

Xaa L-Unknown or other

III. Polvnucleotides

In one aspect, the present invention provides isolated and purified polynucleotides which encode the light and heavy variable regions of the 5H7 antibody. These polynucleotides can be DΝA molecules, such as gene sequences or cDΝAs, or RΝA molecules such as mRΝAs.

The present invention also provides non-coding strands which are complementary to the coding sequences as well as RΝA sequences identical to or complementary to those coding sequences. One of ordinary skill in the art will readily appreciate that corresponding RΝA sequences contain uracil (U) in place of thymidine (T).

In one embodiment, a polynucleotide of the present invention is an isolated and purified DΝA molecule that contains a coding sequence of the light variable region of the 5H7 antibody. An exemplary DΝA molecule for the light variable region is shown as SEQ ID NO: 1. In another embodiment, the polynucleotide of the present invention is an isolated and purified DNA molecule that contains a coding sequence of the heavy variable region of the 5H7 antibody. An exemplary DNA molecule for the heavy variable region is shown as SEQ ID NO:3.

The present invention also contemplates DNA sequences which hybridize under stringent hybridization conditions to the DNA sequences set forth above. Stringent hybridization conditions are well known in the art and define a degree of sequence identity greater than about 70%-80%. The present invention also contemplates naturally occurring allelic variations and mutations of the DNA sequences set forth above so long as those variations and mutations code, on expression, for the light or heavy variable regions of the 5H7 antibody.

As is well known in the art, because of the degeneracy of the genetic code, there are numerous other DNA and RNA molecules that can code for the same polypeptides as those encoded by SEQ ID NOS: 1 and 2, or portions thereof. The present invention, therefore, contemplates those other DNA and RNA molecules, which, on expression, encode for a polypeptide which contains one or more polypeptides encoded by the polynucleotide sequences of SEQ ID NOS: 1 or 3, or portions thereof. With knowledge of all triplet codons for each particular amino acid residue, it is possible to describe all such encoding RNA and DNA sequences. DNA and RNA molecules other than those specifically disclosed herein and, which molecules are characterized simply by a change in a codon for a particular amino acid are within the scope of this invention. A table of codons representing particular amino acids is set forth below in Table 1.

TABLE 1

First Position S Seeccoonndd PPoossiittiioonn Third Position

(5' end) (3' end)

T/U C A G

Phe Ser Tyr Cys T/U

Phe Ser Tyr Cys

T/U L Leeuu S Seerr S Sttoopp S Sttoopp A

L Leeuu S Seerr S Sttoopp S Sttoopp G

Leu Pro His Arg T/U

Leu Pro His Arg C

C L Leeuu P Prroo G Giinn A Arrgg A

Leu Pro Gin Arg G

He Thr Asn Ser TU H Hee T Thhrr A Assnn S Seerr C

He Thr Lys Arg A

Met Thr Lys Arg G

N Naall A Allaa A Asspp G Gllyy T/U

Nal Ala Asp Gly C

Nal Ala Glu Gly A

Nal Ala Glu Gly G

IN Polypeptides

The present invention also provides for polypeptides which encode the light and heavy variable regions of the 5H7 antibody. The amino acid sequence for the polypeptide for the light variable region of the 5H7 antibody is provided in SEQ ID ΝO:2 and contains 107 amino acid residues. The amino acid sequence for the polypeptide for the heavy variable region of the 5H7 antibody is provided in SEQ ID NO:4 and contains 121 amino acid residues.

The present invention also contemplates amino acid residue sequences that are substantially duplicative of the sequences set forth herein such that those sequences demonstrate like biological activity to the disclosed sequences. Such contemplated sequences include those sequences characterized by a minimal change in amino acid residue sequence or type (e.g., conservatively substituted sequences) which insubstantial change does not alter the basic nature and biological activity of the polypeptides.

It is well known in the art that modifications and changes can be made in the structure of a polypeptide without substantially altering the biological function of that peptide. For example, certain amino acids can be substituted for other amino acids in a given polypeptide without any appreciable loss of function. In making such changes, substitutions of like amino acid residues can be made on the basis of relative similarity of side-chain substitutents, for example, their size, charge, hydrophobicity, hydrophilicity, and the like.

As detailed in United States Patent No. 4,554,101, incoφorated herein by reference, the following hydrophilicity values have been assigned to amino acid residues: Arg (+3.0); Lys (+3.0); Asp (+3.0); Glu (+3.0); Ser (+0.3); Asn (+0.2); Gin (+0.2); Gly (0); Pro (-0.5); Thr (-0.4);

Ala (-0.5); His (-0.5); Cys (-1.0); Met (-1.3); Nal (-1.5); Leu (-1.8); lie (-1.8); Tyr (-2.3); Phe (- 2.5); and Tφ (-3.4). It is understood that an amino acid residue can be substituted for another having a similar hydrophilicity value (e.g., within a value of plus or minus 2.0) and still obtain a biologically equivalent polypeptide.

In a similar manner, substitutions can be made on the basis of similarity in hydropathic index. Each amino acid residue has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics. Those hydropathic index values are: He (+4.5); Nal (+4.2); Leu (+3.8); Phe (+2.8); Cys (+2.5); Met (+1.9); Ala (+1.8); Gly (-0.4); Thr (-0.7); Ser (-0.8); Tφ (-0.9); Tyr (-1.3); Pro (-1.6); His (-3.2); Glu (-3.5); Gin (-3.5); Asp (-3.5); Asn (-3.5);

Lys (-3.9); and Arg (-4.5). In making a substitution based on the hydropathic index, a value of within plus or minus 2.0 is preferred. N. Recombinant DΝA Molecules

In another embodiment, the present invention contemplates a chimeric recombinant DΝA molecule which contains the hereinbefore described polynucleotides of the light and heavy variable regions of the 5H7 antibody operably linked together. Upon expression, this recombinant DΝA molecule produces a chimeric, recombinant single-chained variable immunoglobulin domain (scFv) which possesses the following characteristics: (i) is membrane- anchored; (ii) is specific for a monomoφhic determinant expressed by α3 domain of human class I MHC molecules; and (iii) confers programmed cell death-inducing properties to cells.

Preferably, the recombinant DΝA molecule is constructed by operably linking or associating the polynucleotide of the light variable region with one or more leader sequences. As used herein, the phrase "operably linked" means that the polynucleotides being linked are contiguous and, where necessary to joint two protein coding regions, contiguous and in the same reading frame. As used herein, the term "leader sequence" refers to the non-translated segment of mRΝA from its 5' end to the start codon. A leader sequence is not translated into protein.

Preferably, the leader sequence is from the mRΝA of the light variable region of the 5H7 antibody. The leader sequence can have a length of from about 10 to about 150 nucleotide pairs. An leader sequence from the light variable region of the 5H7 antibody is shown in SEQ ID NO: 5. The leader sequence is used to facilitate the targeting of the encoded chimeric scFv to a secretory pathway.

In addition to being operably linked to the leader sequence, the polynucleotide of the light variable region is further operatively linked to a linker. As used herein, the term "linker^"' means a region of DNA having a length of from about 10 to about 300 nucleotide pairs, preferably from about 30 to about 150 nucleotide pairs. The polynucleotide and amino acid sequence of an exemplary linker is shown in SEQ ID NOS:7 and 8. Upon expression, the linker allows the chimeric scFv to assume the appropriate tertiary conformation required for reconstitution of the antigen binding site. In addition to being operatively linked to the polynucleotide of the light variable region, the linker is operably linked to the polynucleotide of the heavy variable region. The polynucleotide of the heavy variable region is also operatively linked to a linker, provides sufficient space from the membrane to allow binding of Class I MHC molecules. The polynucleotide and amino acid sequence of an exemplary second linker is shown in SEQ ID

NOS: 9 and 10. Optionally, the second linker is operatively linked to a gene which allows for cell surface expression of the scFv. Examples of genes which allow for the cell surface expression of the scFv include glycosylphosphotidylinostitol (GPI) and B 7-1 transmembrane region (See, Winberg, G., et al., Immunol. Rev., 153:20 (1996)). The polynucleotide and amino acid sequences of glycosylphosphotidylinostitol is shown in SEQ ID NOS: 11 and 12.

SEQ ID NO: 13 shows the polynucleotide sequences of the leader, the light variable region of the 5H7 antibody, the first linker, the heavy variable region of the 5H7 antibody, the second linker and GPI operably linked as hereinbefore described. The corresponding amino acid sequence is shown in SEQ ID NO: 14.

The recombinant DNA molecule hereinbefore described can then be placed into a variety of expression systems and hosts for the production of the scFv of the present invention. A variety of prokaryotic hosts and appropriate vectors are known in the art.

Similarly, a large number of recombinant systems have been developed for expression in eukaryotic hosts, including yeasts, insect cells, mammalian cells, and plant cells. These systems are well characterized and well known in the art.

VI. Methods for Conferring Programmed Cell Death Properties to Cells

The present invention also relates to a method for conferring programmed cell death inducing properties to cells. The method involves transforming a cell with a recombinant DNA molecule which contains the hereinbefore described polynucleotides of the light and heavy variable regions and which upon expression, produces a chimeric, recombinant scFv which confers programmed cell death-inducing properties to cells. Preferably, the recombinant DNA molecule contains the hereinbefore described polynucleotides of the light and heavy variable regions, leader sequence, linkers and gene which allows for cell surface expression of the scFv. The chimeric scFv hereinbefore described has been shown to provide for programmed cell death signaling in B and T lymphocyte tumor cells. Peripheral blood mononuclear cells have also been found susceptible to induced programmed cell death using the chimeric recombinant scFv described herein. As used herein, the term "programmed cell death inducing properties" means that after a cell is transformed with the recombinant DNA molecule hereinbefore described that the cell will induce one or more of the following conditions in other cells: a decrease in cell size, cell membrane blebbing, cytoplasmic vacuolization, DNA condensation and the breakup of the cell into apoptotic bodies.

V. Methods for Conferring Graft-Mediated Immune Protection to Cells, Tissues and Organs The present invention also relates to a method for conferring graft-mediated immune protection (GMIP) to individual cells, tissues or organs. Preferably, the method of the present invention is used to confer GMIP to transplanted organs. The method of the present invention involves transforming a cell, tissue or organ with the recombinant DNA molecule of the. present invention.

By way of example, and not of limitation, an example of the present invention will now be given.

EXAMPLE a. Cell lines

CHO-neo and CHO-v5 cell lines were maintained in RPMI supplemented with 10% fetal calf serum (FCS), 1.5 mM L-glutamine, 1% penicillin/streptomycin (Biowhitaker. Wakersville, MD) 10 mM HEPES and lmg/ml G418 (Biowhitaker, Wakersville. MD). The Daudi, BeVD and

Jurkat cell lines were maintained in RPMI 1640 supplemented with 10% FCS. 1.5mM L- glutamine, 1% penicillin/streptomycin, and 10 mM Hepes. 5H7 hybridoma was maintained in RPMI 1640 supplemented with 20% FCS, 1.5 mM L-glutamine, 1% penicillin streptomycin. 2- mercaptoethanol and 1 X MOPPS. The A2.4 hybridoma was maintained in RPMI supplemented with 20%) FCS. 1.5 mM L-glutamine, 1%> penicillin/streptomycin, 2-mercaptoethanal and IX

MOPPS.

b. Construction of single-chain 5H7 (5H7scFv)

The 5H7 hybridoma was used to create 5H7 cDNA. RNA was prepared by the guanidinium/isothiocyanate CsCl method, and cDNA was synthesized using the First Strand cD A synthesis kit (Novagen, Madison, WI). Amplification of the V_H gene from cDNA was done in two steps: The first round of PCR was performed with 200 nM primers: CGAATGATGCATCC(C/G)AGGTG(C/A)AGCTG(C/G/A)(A/T)G(G/C)AGTC (SEQ ID NO: 15) and GGAAATAAGCTTTTGTTCGGCTGAGGAGACGGT(G/A)C (SEQ ID NO: 16) (see Fig.l) for 35 cycles for 1 minute at 93 °C, 1 minute at 50°C. and 1 minute at 72 °C with 2.5 units

Pfu (Stratagene, La Jolla, CA). The PCR product was purified and subjected to a second round of PCR in order to add a carboxy-terminus 6xHis tag using 200 nM primers: CGAATGATGCATCC(C/G)AGGTG(C/A)AGCTG(C/G/A)(A T)G(C/C)AGTC (SEQ ID NO: 15) and GCGGATCCGAGCTCTTACTAGTGATGGTGAATGGTGGTGCAGATCTTCTTCG GAAATAAGCTTTTGTTC (SEQ ID NO: 17) for 35 cycles for 1 minute at 93 °C. 1 minute at

50°C, and 1 minute at 72°C with 2.5 units Pfu. Amplification of the N_L gene was performed with 200 nM primers: CGAATGGACGTCGT(G/T)CTCACCCAGTCTCCAGCAATCATGTCT (SEQ ID NO: 18) andTATGATCCGCGGAGGAACGTTT(T/G)ATTTCCAGCTTGGTCCC (SEQ ID NO: 19) (see Fig. 1) for 35 cycles for 1 minute at 93°C, 1 minute at 60°C. and 1 minute at 72 °C with 6 units Taq (Fisher Scientific, Pittsburg, PA). The PCR products if the N_Land N_H genes were cloned as a single chain Fv into expression vector Genex in the orientation ΝH₂-N_L- linker-N_H-6xHis-COOH (See Fig. la).

c. Construction of GPI-anchored, single chain 5H7 (5H7scFv-GPI)

Modification of the pGenex 5H7scFv gene included additions of a 5' 23 bp N_L leader (Jost, C.R., et al., J. Biol Chem. 269:26267 (1994), herein incoφorated by reference), 3' 66 bp linker2 (Jost C.R., et al., Mol. Jmmunol. 33:211(1996), herein incoφorated by reference), and a 3' 96 bp GPI (Seed, B., Nature. 329:840 (1987), herein incoφorated by reference). The N_L leader sequence was added to target the gene product to the cell secretory pathway and the c-myc and

6xHis tags were excluded by primer design. The 5H7 scFv portion of pGenex 5H7 scFv was PCR amplified with 200nM of primers: ATCTAGCTAGCCTTATGAGGACCCCTGCTCAGT TTCTTGGAATCTTGTTGCTCTGGTTTCCAGGTATCAAATGTGACGTCGTGCTCACCCA GTCTCCA (SEQ ID NO: 20) and ATAGTTTAGCGGCCGCGCTTCCGCTACC ACTAGACACAGGGGCCAGTGGATAGACCGATGGGGCTGTTGTTTTGGCGGCTGAGG

AGACTATGAGAGT (SEQ ID NO: 21) (see Fig. 1) for 35 cycles for 1 minute at 93 °C, 1 minute at 68°C, and 1 minute at 72°C using 2.5 units Pfu. Linker2 and GPI were derived from the vector construct pCTLA4sclg (Jeffrey Bluestone. University of Chicago) with 200nM of primers: ATAAGAATGCGGCCGCTAGCCCAAGCAGCGGTCATTCA (SEQ ID NO: 22) and ACGCTCGAGTTAAAGAACATTCATATACAG (SEQ ID NO: 23) (see Fig. 1) for 35 cycles for 1 minute at 93 °C, 1 minute at 64°C, and 1 minute at 72 °C using 2.5 units Pfu. PCR products of the 5H7scFv and GPI were cloned into pCDNA 3.1+ (Invitrogen) by double ligation. The final product was in the orientation - NH₂-N_L-linkerl-V_H-linker2-GPI-COOH.

d. Expression and Insolation of5H7scFv in Escherichia coli

The pGenex 5H7scFv was introduced into electrocompetent E. coli (Genex) and carried on LB agar plates supplemented with 50ug ml of ampicillin. Genex cells containing the 5H7scFv vector were grown to an A₆₀₀ of 1.0 at 30 °C and protein expression induced by a temperature shift to 42 °C for 1 hour. The cells were harvested and resuspended in 50 mM Tris, 2 mM EDTA (pH 8.0) and lysed by microfluidizing (Microfluidics Coφ, Newton, MA). The inclusion bodies were pelleted at 16,000 φm for 30 minutes then washed with 50mM Tris, 2mM EDTA (pH 8.0)/0.5% Triton X-100. followed by two successive washes without Triton X-100. The inclusion bodies were solubilized in 6M Guanidine-HCl/20 M Tris (pH 7.9) and purified over a denaturing Ni^2÷ column according to the manufacturer's protocol (Novagen, Madison,

WI). 5H7 scFv was eluted with 1 M imidazole and protein refolded by dialysis against 100 mM Tris (pH 8.0), 2mM EDTA. 0.4 M Arginine at 4°C.

e. SDS-PAGE and Binding analysis of5H7scFv SDS-PAGE analysis on purified 5H7scFv fractions were performed under reducing and non-reducing conditions. Twelve percent SDS-PAGE gels were stained with Comassie blue dye and sample wells were compared to low-range protein standards (Bio-rad, Hercules, CA).

FACS analysis was performed on the Daudi and BeVD tumor cell lines. One hundred thousand cells were washed in FACS media (IX PBS supplemented with 1%FCS and 0.01% sodium azide) and incubated for 30 minutes at 4°C with 5H7scFv. CT14 (anti-c-myc) and goat anti-mouse FITC were used as secondary and tertiary antibodies, respectively. Samples were analyzed on a Becton Dickinson FACScan utilizing Lysis II software (Becton Dickinson, San Jose. CA).

Expression of5H7scFv-GPI and its binding to Ig-HLA-A2

CHO cells (provided by Dr. Andrea Sant, University of Chicago) were grown on 10mm culture treated dishes (Fisher Scientific. Pittsburgh, PA) and underwent calcium phosphate precipitation (Chen, C, et al., Mol. Cell Biol. 17:2745 (1987). Gene transfer with either pCDNA 3.1 or p5H7scFv-GPI. Post-transfection, cells were allowed to grow for 48 hours after which selective pressure was initiated by the addition of 2 mg/ml G418 (Life Technologies, Gaithersburg, MD) supplemented media. Cell strains resistant to G418 were placed in limiting dilution for 3 weeks and subsequently expanded in 24 well culture plates. Transfectants were screened A2.4, (IgGl mAb that possesses anti-idiotype activity to 5H7) and GαM-FITC. FACS analysis demonstrated a high expressing clone, designated CHO-v5.

Reconstitution of ligand binding was tested by staining CHO cell transfectants with 10 ug/ml of soluble (s)HLA-A2-Ig fusion protein (Dr. Jonathen Shneck. John Hopkins University) followed by GaM-FITC. Mean fluorescence was measured by flow cytometry on a Becton

Dickenson FACScan.

Phospholipase C (PLC) (Boehringer Mannheim) treatment of CHO cell transfectants was performed to confirm integrity of the GPI segment and surface expression of 5H7scFv-GPI. 1 xl0⁶CHO-v5 and CHO-neo were incubated with 10 u of PLC in TRIS (pH 8.0) buffer for one hour at 37°C. Cells were washed with FACS media and underwent fluorescence staining as described above.

g. PCD Detection Assays CHO-neo and CHO-v5 cells were plated in 10 mm culture plates at a density of 2x10⁵ cells per 5 ml media for 2 hours at 37°C/5%CO₂. Responder cells (Daudi, Jurkat or BeVD) were co-cultured with CHO cells for 48-72 hours at a density of 2x10⁵ cells per 5 ml media.

PBMC were isolated from heparinized tubes taken from human donors. Standard Ficoll gradients were run to isolate PBMC populations utilizing standard techniques. Pre-activation of

PBMC was performed in 10 mm culture dishes coated with 1 μ/ml of murine OKT3 and anti- CD28. After 48 hours of stimulation, activated PBMC were harvested, rinsed with fresh media and rested in 30 ml of RPM1/10%FCS for 12 hours at 37°C. Preactivated PBMC were transferred to CHO cell co-cultures at stimulator to responder ratios of 1 : 1.

Analysis of responder cell populations required release of responder cells from CHO- v5/single-chain interactions. After aspiration of supematants of co-cultures, culture dishes were incubated with 10 μg/ml of A2.4 for 2 hours at 37°C. Released cells were pooled with original supematants, pelleted and resuspended in 1 ml of cold PBS for analysis. Efficiency of tumor cell release was determined by a conjugate assay, in which 10 g/ml of A2.4 effectively separated CHO-v5 BeND conjugates.

Moφhologic determination of PCD was performed by ethidium bromide/acridine orange staining (Cloligan. J.E., et al.. Current Protocols in Immunology. John Wiley & Sons. Inc.

7:317.1 (1992)) and 100X visualization with FITC/TRITC emission filters. Moφhologic criteria for PCD included nuclear fragmentation and condensation, cytoplasmic vacuolization and apoptotic body formation.

Cell death was confirmed by Annexin N-FITC (Pharmingin, San Diego. CA) assays, performed per manufactures protocol. Briefly, A2.4 treated co-cultures and original co-culture supematants were pooled, washed twice in cold PBS, once in Annexin N buffer, followed by Annexin N-FITC staining for 15 minutes protected from light. Flow cytometry was performed immediately following addition of Annexin N buffer on a Becton Dickenson FACScan and percentage of cell deaths was measured using Lysis II analysis software.

h. RESULTS

The 5h7 scFv was constructed by PCR amplification of 5H7 hybridoma cDΝA and the inteφosition of a 72 bp linker 1 to allow refolding of N_Land V_H immunoglobulin domains (See Fig. 2a). Genes for c-myc and 6-His were added to the 3' end of the V_H region for detection and purification. Expression of 5H7 scFv was performed in electrocompetent E. coli (Genex) and detection of crude lysates with CT14 (anti-c-myc) demonstrated positive expressing bacterial colonies. A higher expressing colony was selected for large scale fermentation. Previous studies using similar bacterial expression systems have demonstrated that scFv expression is mostly in the form of intracellular inclusion bodies. Inclusion bodies were isolated from bacterial cultures and purified for further protein characterization.

SDS-PAGE analysis of purified 5H7 scFv demonstrated predominately monomers of the expected 30 kD size (See Fig. 3a). Purified 5H7 scFv was tested for ability to bind class I MHC- expressing cell lines. Figure 3b shows that 5H7 scFv binds the class I MHC-expressing cell line BeVD, but not to Daudi cells (class I MHC deficient).

Construction of 5H7 scFv-GPI entailed the addition of a 23 bp V_L leader sequence to target expression into an intracellular secretory pathway and a 66 bp linker 2 designed to provide space for the V_L-V_H binding region from the cellular membrane surface (See Fig. 2b). The 96 bp GPI anchor was derived from CD58 and engineered onto linker2 to allow cell surface expression of the 5H7 idiotype. The c-myc and 6-His tags were excluded from the final construct by primer design.

CHO cells that underwent gene transfer of either p5H7scFv-GPI or pCDNA 3.1 alone were placed in limiting dilution to obtain clonal transfectants under G418 selection. A high expresser clone (CHO-v5) and a control pCDNA 3.1 clone (CHO-neo) were assessed by FACS analysis for binding IgG-HLA-A2 fusion protein (Jonathen Shneck. Johns Hopkins University). Figure 4 demonstrates that CHO-v5 cells bind to IgG-HLA-A2, confirming reconstitution of the

5H7 antigen binding domain. CHO cell transfectants were assessed for binding A2.4 (a mAb specific for the 5H7 idiotype as demonstrated by its ability to inhibit 5H7-FITS binding to class I HLA bearing cells. CHO-v5, but not CHO-neo, demonstrated ability to bind A2.4 thereby demonstrating that the 5H7 idiotype was conserved in membrane-expressed of 5H7scFv-GPl (See Fig. 5a and 5b). Phospholipase C treatment of CHO-v5 cells demonstrated reduction in

5H7Fv-GPI expression (i.e. A2.4 binding) to background levels secondary to GPI cleavage (See Fig. 5c).

The ability of 5H7scFv-GPI to induce PCD was assessed by co-culturing CHOv5 or CHO-new cells with the lymphoid-derived tumor cell lines Jurkat, BeVD, and Daudi.

Fluorescence microscopy after staining with ethidium bromide and acridine orange was employed for detecting PCD Typical features of PCD were observed included DNA condensation, apoptotic body formation, cytoplasmic vacuolization and increased cytoplasmic granularity. Seventy -two hours after co-culture, non-adherent cells were aspirated and lymphoid cells adherent to CHO-v5 cells were competitively removed with excess A2.4 (as described earlier). Pooled samples were analyzed and demonstrated PCD in lymphoid tumor cells expressing class I MHC, but not control Daudi cells (See Fig. 6). Responder cell PCD was noted as early as 24 hours post co-culture with maximal levels noted at 72 hours, a kinetic profile that is similar to plastic immobilized 5H7 mAb.

The specificity of 5H7Fv-GPI PCD signaling was addressed by the addition of the excess A2.4 in co-culture experiments. Light microscopic inspection of these cultures confirmed inhibition of lymphoid tumor cell binding to CHO-v5 cells. Appreciable inhibition of PCD was noted with the addition of A2.4. but not isotypic control antibody (See Fig. 6).

Confirmation of PCD was obtained by Annexin V analysis. Annexin V binds to phosphotidylserine residues of cells undergo death. Lymphoid cells were harvested from co- culture experiments as described above and stained with Annexin V-FITC, and PCD was measured by flow cytometry. Increased Annexin V-FITC binding was observed in Jurkat and

BeVD, but not Daudi, when co-cultured with CHO-v5, but not with CHO-neo (See Fig. 7). Inhibition of PCD was also observed in cultures with had A2.4 added (See Fig. 7).

The ability of 5H7Fv-GPI to induce PCD in human PBMC was assessed by co-culturing CHO-v5 or CHO-neo with human PBMC. Forty-eight hours after co-culture, non-adherent cells were aspirated and lymphoid cells adherent to CHO-v5 cells were competitively removed with excess A2.4. Ethidium bromide/acridine orange staining at 48 hours demonstrated PCD in 49.2% of PBMC, while background PCD, with CHO-neo, was measured at 10% (See Fig. 8). Since augmentation of 5H7 mAb-induced PCD has been observed with concomitant TCR signals, similar studies were conducted with CHO-v5 cells. PBMC pre-activated with immobilized anti-CD3 and anti-CD28 for 48 demonstrated increased PCD induction by CHO-v5 cells (See Fig. 8).

Claims

WHAT IS CLAIMED IS:

1. An isolated and purified polynucleotide comprising a nucleotide sequence of SEQ ID NO:l coding for a light variable region of a 5H7 antibody.

2. An isolated and purified polynucleotide comprising a nucleotide sequence of SEQ ID NO:3 coding for a heavy variable region of a 5H7 antibody.

3. An isolated and purified polypeptide comprising an amino acid sequence of SEQ ID NO: 2.

4. An isolated and purified polypeptide comprising an amino acid sequence of SEQ ID NO:4.

5. A chimeric recombinant DNA molecule comprising a nucleotide sequence of SEQ ID

NO:l encoding a light variable region of a 5H7 antibody, a nucleotide sequence of SEQ ID NO:3 encoding a heavy variable region of a 5H7 antibody, a first linker and a second linker wherein the nucleotide sequence of SEQ ID NO: 1 is operably linked to a first linker, the first linker is operably linked to nucleotide sequence of SEQ ID NO:3 and SEQ ID NO:3 is operably linked to the second linker.

6. The chimeric recombinant DNA molecule of claim 5 further comprising a leader sequence, wherein the leader sequence is operably linked to the nucleotide sequence of SEQ ID NO: 5.

7. The chimeric recombinant DNA molecule of claim 6 further comprising a nucleotide sequence which allows for expression of the recombinant DNA molecule on the cell surface, wherein said nucleotide sequence is operably linked to the second linker.

8. The chimeric recombinant DNA molecule of claim 7 wherein the nucleotide sequence encodes glycosylphosphotidylinostitol .

9. The chimeric recombinant DNA molecule of claim 8 wherein the glycosylphosphotidylinostitol has the nucleotide sequence of SEQ ID NO: 1 1.

10. A vector comprising the chimeric recombinant DNA molecule of claim 5.

11. A bacterial cell comprising the vector of claim 10.

12. A mammalian cell transformed with the vector of claim 10.

13. A method for conferring programmed cell death inducing properties to a cell, the method comprising the step of transforming a cell with the recombinant DNA molecule of claim 5.

14. The method of claim 13 wherein the cell is a mammalian cell.