WO2000046370A1 - P37ing1 compositions and methods of use - Google Patents

Abstract

Disclosed herein are novel ing1 nucleic acids and proteins and methods of using them. In characterizing the mouse ing1 gene, the inventors discovered an alternative promoter expressing a longer version of the gene (p37ING1). Expression of this longer version coincides with transformation of cells. Thus, p37ING1 has the characteristics of an oncogene.

Description

_P37 ^{ING I} COMPOSITIONS AND METHODS OF USE

RELATED APPLICATION

This application claims priority to United States Provisional Application 60/118,941, filed February 4, 1999, incorporated herein by reference in its entirety.

FEDERALLY SPONSORED RESEARCH ORDEVELOPMENT

The United States government may have certain rights to the present invention pursuant to National Institutes of Health grants (CA60730 and CA75179) and a grant from the Department of the Army (DAMD17-97-1-7293).

BACKGROUND OF THE INVENTION

Mutations in or loss of the p53 gene occur in more than 50% of human tumors and tumor cell lines, but functional inactivation of the p53 pathway occurs in a much larger proportion of tumors. For example, the majority of cervical carcinomas express the E6 gene of papilloma virus that mediates, in cooperation with the cellular gene E6-AP, rapid degradation of the p53 protein. There are numerous examples of tumors with an amplified MDM2 gene, a feedback regulator of p53, which also mediates p53 inactivation and degradation. Thus, in instances where tumors cells maintain wild-type p53 expression, it is common that the cells use a mechanism to functionally inactivate p53. In many cases, the mechanism of functional inactivation of p53 remains unknown. For example, p53 is rarely mutated and, moreover, expressed at very high levels in a large proportion of human melanomas and neuroblastomas. The fact that abnormally high levels of wild type p53 are often detected in melanomas suggests the existence of some mechanism of p53 pathway inactivation in these highly aggressive tumors that is often resistant to therapy. Melanoma cell lines are surprisingly sensitive to the retrovirus-transduced p53 and are capable of transcriptional activation of two p53-responsive promoters in transient transfection CAT assays. This indicates that the p53 pathway is active but strongly attenuated in melanomas. p53 has been found to act in cooperation with INGL ING1 was originally identified through the genetic suppressor element (GSE) approach. The GSE encoding an antisense RNA demonstrated properties of a dominant oncogene, promoting transformation, inhibiting senescence, and attenuating apoptosis. Consistently, ectopic expression of the GSE-corresponding cDNA in sense orientation inhibited growth of several cell types. It was found to encode an evolutionary conserved nuclear PHD-finger protein named pSS¹¹"¹⁰¹. ING1 cooperates with p53 since: (i) biological effects of p53 and 1NG1 were mutually dependent; (ii) anύ-INGl GSE inhibited the transactivation function of p53; and (iii) these proteins interact as judged by co-immunoprecipitation. Functional cooperation between ING1 and p53 suggested that ING1 encoded a tumor suppressor protein that functioned within the p53 pathway. This data suggested a possible role of ING1 in head and neck cancers, cancers that frequently are wild-type for p53. Furthermore, chromosomal localization of ING1 (13q34; the sub-telomeric region of chromosome 13) places it within a region that is frequently rearranged in head and neck cancer. Large-scale screening of tumors, using SSCP analysis, has not revealed mutations of INGL Thus, there is still only one example of a mutation in ING1 in a neuroblastoma cell line. Large-scale analysis of tumors and tumor cell lines for ING1 mRNA expression using quantitative PCR assays has not revealed significant variations in its expression. These results showed no indications of mutations or transcriptional inactivation of ING1 associated with naturally occurring cancer. Therefore, the prior art would suggest that ING1 is not a useful gene to analyze in cancer research or clinical diagnostics of tumor samples.

BRIEF SUMMARY OF THE INVENTION

The invention disclosed herein explains the shortcomings of the prior art in regards to the role of ING1 in cancer. The inventors have discovered alternative initiation exons of the ingl gene each having its own promoter. A schematic of the location of the promoters and exons relative to that previously known is shown in FIG. 4. Although expression of one such promoter (la) produces a protein that is identical to the ING1 protein of the prior art, another promoter (lb) expresses a protein that has a C-terminus identical to the ING1 protein of the prior art but has an additional 104 N-terminal amino acids. The inventors refer to the protein of the prior art as pSS^⁰¹ and the newly discovered protein as p37^ING1.

Surprisingly, p37^ING1 has the opposite effect on cells that pSS¹¹^⁰¹ does. In other words, p37^ING1 has the characteristics of an oncogene. When over expressed in cells, even cells expressing wild-type p53, p37^ING1 is able to cause proliferation or transformation of the cells. In light of this discovery, it becomes evident why the prior art fails to show a correlation between ING1 mutation or expression and cancer. The prior art was unaware of the oncogenic product of the gene, p37^ING1.

As disclosed herein, the inventors have shown that the expression of p37^1NG1 and particularly the ratio of expression of p37^ING1 to pSS^⁰¹ is indicative of cell transformation. When comparing transformed cells to normal or less transformed cells, the transformed or more transformed cells will express a higher ratio of p37^ING1 to p33^ING1. Thus, the compositions and methods of the present invention may be particularly useful in treating, studying, detecting, and diagnosing cancers. Types of cancers include, but are not limited to, brain, head, neck, mammary, lung, colon, skin, melanoma, testicular, ovarian, cervical, prostate, bone or leukemia. Although the cancer may be of essentially any type, the inventors contemplate that the compositions and methods of the present invention will be particularly useful in treating, studying, detecting and diagnosing cancers that are known to be or are frequently wild-type for p53, such as papillomas or cancers of the head and neck in humans. Other such cancers and methods of determining p53 status are well known to those of skill in the art.

BRIEF DESCRIPTION OF SEVERAL VIEWS OF THE DRAWINGS

FIG. 1A and FIG. IB. Schematic alignment of cDNA sequences isolated by the cDNA library screening and 5' RACE with human ING1 cDNA. FIG. 1A. Mouse ingl cDNA, isolated from the library of senescent mouse embryonic fibroblasts, aligned with human INGl cDNA. Open reading frame for the human INGl clone is indicated. FIG. IB. Alignment of mouse and human INGl cDNAs with the products synthesized by 5 '-RACE. The position of the gene-specific PCR primers used for the RACE reaction is indicated in panel A.

FIG. 2. Analysis of ingl transcription by northern hybridization. Ingl expression in mouse liver heart and testis was analyzed using a Multiple Tissue Northern blot (CLONTECH laboratories) which was hybridized with the probe corresponding to the common part of ingl (1), the 5' end of isoform la (2), the 5' end of isoform lb (3) or the 5' end of isoform lc (4). Probes were obtained by

PCR using gi-specific primers. Arrow shows the position of the RNA marker, 2.37 kb in size.

FIG. 3. Mapping of the ingl exons in the mouse genomic region containing ingl cDNA-related sequences. Three ing 1 -positive genomic clones were isolated from the mouse genomic library using ingl cDNA as a probe. To determine the position of ingl exons, DNA was cut with the indicated combination of restriction enzymes and analyzed by Southern blot hybridization with the indicated probes representing the alternative 5' ends of three ingl transcripts (la, lb and lc) or the common part of the gene (3'). The results of hybridization in combination with the PCR data and with partial sequencing of the genomic clones allowed us to determine positions of the ingl exons.

FIG. 4. Determination of transcription initiation and termination sites in the ingl gene. The upper panel shows genomic map with the positions of the ingl exons, and the structure of ingl cDNA clones as determined after cDNA library screening and 5 '-RACE analysis. The structure of two human INGl cDNA variants is indicated and their relation to mouse ingl sequences. The lower panel demonstrates the final structure of the ingl gene determined as a result of precise mapping of transcription initiation and termination sites. In the upper panel, the position of the G/C rich region in the 5' end of clone lb and the poly(A) region in the 3' part of the ingl transcripts are indicated, which interfered with the polymerase reaction during the original 5'- RACE. FIG. 5A and FIG. 5B. Sequences of the promoter areas of the ingl gene. FIG. 5A. Sequence (SEQ ID NO: 17) of the genomic region with the promoter areas of isoforms la and lb, the start sites of transcription of these two variants are shown by arrows. The initiator sequence of the la isoform, including multiple initiation start sites, is underlined; TATA-like sequence for the lb isoform is shown in bold. Underlined bold sequence is CAAT box positioned about lOObp upstream from the lb transcript initiation site. Sp-1 binding sites are displayed in bold italic. FIG. 5B. Sequence (SEQ ID NO:18) of the promoter area of the lc isoform, with the underlined initiator sequence overlapping the two transcription start sites. Multiple sp-1 binding sites are also indicated.

FIG. 6. Sequences of ingl cDNAs and their predicted protein products. Sequences of the alternative la (SEQ ID NO:4), lb (SEQ ID NO:l), and lc (SEQ ID NO:5) first exons as well as the common ingl exon (SEQ ID NO:3) are shown. The first ATG codon of isoform lb is underlined, as well as the ATG codon in the common exon that is used as the initiation codon for la and lc translation. Stop codons, indicating the end of translation, are also underlined.

FIG. 7 A and FIG 7B. Comparison of mouse and human Ingl genes. FIG. 7 A. Alignment of amino acid sequences of mouse ingl lb isoform and its human orthologue (SEQ ID NO:9 and SEQ ID NO:7, respectively). Numbers of amino acids are indicated; numbers in parenthesis indicate the size of the truncated protein product of la and lc ingl isoforms. The underlined methionine in the mouse sequence indicates the beginning of the protein product encoded by la and lc isoforms. Asterisks indicate identical amino acids, while dots indicate conserved changes in amino acid sequence. Amino acids number 1-94 make up the novel amino terminus of the mouse and human p37^ING1 proteins (SEQ ID NO:2 and SEQ ID NO: 10, respectively. FIG. 7B. Alignment of the 3 '-untranslated regions of human (SEQ ID NO: 19) and mouse Ingl (SEQ ID NO:20) mRNAs.

FIG. 8A and FIG. 8B. ingl expression in adult mouse tissues and embryos analyzed by northern hybridizations. FIG. 8A. Hybridization result with the indicated probes with total mouse RNAs isolated from the indicated organs; photograph of ethidium bromide stained gel is shown as loading control. FIG. 8B. Northern hybridization with the same probes of RNA on CLONTECH' s mouse embryonic Multiple Tissue Northern blot. Here, mRNA was isolated from mouse embryos at 7, 11, 15, and 17 days of development. Arrows indicate positions of the 1.35kb, 2.37kb, and 4.4kb RNA markers as well as the positions of 28S and 18S rRNAs.

FIG. 9. ingl mRNA expression varies depending on cell growth conditions. RNA was isolated from dividing 10(1) (a) and NMuMG (e) cell lines, as well as from the dividing, young mouse embryonic fibroblasts (h). RNA was also isolated from contact-inhibited 10(1) (b) and NMuMG cells (f); serum starved 10(1) cells (c) (64 hours at 0.5% FBS); γ-irradiated 10(1) cells (d) and NMuMG cells (g); and senescent MEFs (i). Filters were probed with total ingl probe. Bottom panels show RNA gels from which northern blots were made. Arrows indicate positions of the 2.37kb RNA marker (upper panels) or 28S and 18S rRNAs. FIG. 10A-D. Characteristics of structure and biological effects of INGl gene. FIG. 10A - genomic organization and transcription of human INGl gene. Western blot shows INGl -encoded proteins translated from the indicated cDNAs. Main and alternative initiator codons are shown by circles. FIG. 10B - Overexpression of p37^ING1 in C8 cells reduces their sensitivity to etoposide- induced apoptosis (cells were incubated in the indicated concentrations of etoposide for 24 hrs; cell number was estimated by MTT assay. FIG. 10C - p37-^N<3i _SUpp_{ress an(}j p3i ^ING1 enhance p53 and p21 activation by gamma irradiation (10 Gy). FIG. 10D - Northern analysis of ingl mRNA expression in the indicated mouse skin tumors; normal skin and TPA-induced hyperplasias were used as controls.

FIG. 11. Complete sequence of cDNA for the mouse trasncript encoding p37^ING1 protein (SEQ ID NO:8). Initiating and terminating codons are underlined. FIG. 12. Amino acid sequence of mouse p37^ING1 protein (SEQ ID NO:9). DETAILED DESCRIPTION OF THE INVENTION

Although there appears to be some cooperation between Ingl and p53, to date there is no evidence linking alterations in Ingl to cancer. The present invention, for the first time, demonstrates that Ingl is subject to complex regulation. Using structure and expression analyses, the inventors demonstrate that ingl has at least three promoters that encode three transcripts sharing a long common region encoded by a common 3 '-exon and differing in their 5 '-exons. Only one of the 5'- exons contains protein-coding sequence; translation of two other transcripts starts from the initiator codon within the common region. Thus, three alternative transcripts of ingl encode two proteins (p37^ιngl and p33^ιngl), one of which is a truncated version of the other lacking 94 N-terminal amino acids. Both translation proteins can be found in cells both as products of the endogenous ingl gene and after transduction with the appropriate expression construct.

All of the previous published data on the biological activities of INGl was obtained using cDNA constructs expressing the shorter versions of the protein.

Comparison of the biological activities of the long and short proteins encoded by INGl led to an unexpected observation. The long product, p37^ING1, neither showed growth inhibitory activity, nor cooperated with p53 in transactivation of p21/wafl. On the contrary, overexpression of p37^ING1 in human fibrosarcoma HT1080 cells suppressed both p53 accumulation and induction of p21^wafl in response to gamma irradiation; the base level of p21^wafl was also reduced. This data indicated that different protein products encoded by one gene, INGl, have opposite biological activity with respect to the p53 signaling pathway.

The connection between the long protein product of INGl and cancer development was made when the inventors determined INGl mRNA expression in a large number of primary mouse skin tumors induced by a classical two-step carcinogenesis (DMBA-TPA treatment). High levels of mRNA for the longer product of the ingl gene (p53 antagonist) were found in RNA tumor samples isolated from papillomas and carcinomas in comparison with normal or hyperplastic TPA-treated skin. The expression of mRNAs encoding the shorter ingl product (p53 cooperator) was not elevated in the tumors. It is noteworthy that DMBA-induced skin tumors in the vast majority of cases retain wild type p53. Consistently, Western analysis of INGl protein products in a number of tumor cell lines revealed that the majority of them, unlike normal cells, expressed, almost exclusively, the longer variant of the INGl protein.

The discovery of the longer version of INGl (p37^ING1) encoded by the lb exon and the common exon has led to the surprising observation that expression of the longer version has the opposite effect on a cell than the shorter version encoded by only the common exon ^33""°'). Thus, in contrast to the tumor suppressor effect of p33^ING1, p37^ING1 has the characteristics of an oncogene. Therefore, the inventors contemplate that, in light of the present disclosure, one of skill in the art would understand that the compositions of the present invention may be used in essentially any known method utilizing an oncogenic composition. Many such embodiments are described herein. Nucleic Acids

Important aspects of the present invention concern isolated nucleic acid segments and recombinant vectors encoding the newly discovered promoters and exons of ingl. Because the ingl gene encodes both a tumor suppressor and an oncogene, the promoter regions of the present invention may be particularly useful in studies of gene expression and transformation, for example, determination of compounds or conditions that decrease expression of the lb promoter and/or increase expression of the lc promoter. Although the following discussion will focus on exon lb, it will be understood that this discussion also applies to the other novel nucleic acid segments disclosed herein. In one aspect, the invention concerns the creation and use of recombinant host cells through the application of DNA technology that express exon lb of ingl. In specific embodiments, these technologies using exon lb of ingl may comprise the sequence of SEQ ID NO: 1. In some embodiments the nucleic acid is a DNA segment. The DNA segment may be genomic or a cDNA segment. Further, it is contemplated that RNA and protein nucleic acids encoding exon lb of ingl also are within the scope of the present invention. In preferred embodiments, the isolated nucleic acid segments and recombinant vectors further comprise the common exon of ingl.

In one embodiment, the present invention concerns DNA segments, isolatable from mammalian and human cells, that are free from total genomic DNA. It is comtemplated that such DNA segments are capable of expressing a protein or polypeptide that leads to the transformation of the cell expressing the

DNA segment.

As used herein, the term "DNA segment" refers to a DNA molecule that has been isolated free of total genomic DNA of a particular species. Therefore, a DNA segment encoding exon lb of ingl refers to a DNA segment that contains exon lb of ingl coding sequences yet is isolated away from, or purified free from, total mammalian or human genomic DNA. Included within the term "DNA segment", are DNA segments and smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like.

Similarly, a DNA segment comprising an isolated or purified exon lb of ingl refers to a DNA segment including exon lb of ingl coding sequences and, in certain aspects, regulatory sequences, isolated substantially away from other naturally occurring genes or protein encoding sequences. As will be understood by those in the art, this includes both genomic sequences, cDNA sequences and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins and mutants.

"Isolated substantially away from other coding sequences" means that the segment of interest, for example, exon lb of ingl, forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or cDNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to the segment by the hand of man. In particular embodiments, the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences that encode a p37^1NG1 protein or polypeptide that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially as set forth in, SEQ ID NO:2. Moreover, in other particular embodiments, the invention concerns isolated DNA segments and recombinant vectors that encode a p37^ING1 protein or polypeptide that includes within its amino acid sequence the substantially full length polypeptide sequence of SEQ ID NO:2.

The term "a sequence essentially as set forth in SEQ ID NO:2" means that the sequence substantially corresponds to a portion of SEQ ID NO:2 and has relatively few amino acids that are not identical to, or a biologically functional equivalent of, the amino acids of SEQ ID NO:2.

The term "biologically functional equivalent" is well understood in the art and is further defined in detail herein. Accordingly, sequences that have between about 70% and about 80%; or more preferably, between about 81% and about 90%; or even more preferably, between about 91% and about 99%; of amino acids that are identical or functionally equivalent to the amino acids of SEQ ID NO:2 will be sequences that are "essentially as set forth in SEQ ID NO:2", provided the biological activity of the protein is maintained.

In certain other embodiments, the invention concerns isolated DNA segments and recombinant vectors that include within their sequence a nucleic acid sequence essentially as set forth in SEQ ID NO:l. The term "essentially as set forth in SEQ ID NO:l, is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a portion of SEQ ID NO: l and has relatively few codons that are not identical, or functionally equivalent, to the codons of SEQ ID NO:l. DNA segments that encode proteins capable of causing the transformation of cells expressing the DNA segment will be most preferred.

The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids (see Table 1). Table 1 - Preferred Human DNA Codons

Amino Acids Codons

Alanine Ala A GCC GCT GCA GCG

Cysteine Cys C TGC TGT

Aspartic acid Asp D GAC GAT

Glutamic acid Glu E GAG GAA

Phenylalanine Phe F TTC TTT

Glycine Gly G GGC GGG GGA GGT

Histidine His H CAC CAT

Isoleucine He I ATC ATT ATA

Lysine Lys K AAG AAA

Leucine Leu L CTG CTC TTG CTT CTA TTA

Methionine Met M ATG

Asparagine Asn N AAC AAT

Proline Pro P CCC CCT CCA CCG

Glutamine Gin Q CAG CAA

Arginine Arg R CGC AGG CGG AGA CGA CGT

Serine Ser S AGC TCC TCT AGT TCA TCG

Threonine Thr T ACC ACA ACT ACG

Valine Val V GTG GTC GTT GTA

Tryptophan Trp w TGG

Tyrosine Tyr Y TAC TAT

It will also be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.

Excepting intronic or flanking regions, and allowing for the degeneracy of the genetic code, sequences that have between about 70% and about 79%; or more preferably, between about 80% and about 89%; or even more preferably, between about 90%, and 92%, and about 99%; of nucleotides that are identical to the nucleotides of SEQ ID NO:l will be sequences that are "essentially set forth in SEQ ID NO: 1."

Sequences that are essentially the same as those set forth in SEQ ID NO: 1 may also be functionally defined as sequences that are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO: 1 under relatively stringent conditions. Suitable relatively stringent hybridization conditions will be well known to those of skill in the art, as disclosed herein.

Naturally, the present invention also encompasses DNA segments that are complementary, or essentially complementary, to the sequence set forth in SEQ ID

NO: l. Nucleic acid sequences that are "complementary" are those that are capable of base-pairing according to the standard Watson-Crick complementarity rules. As used herein, the term "complementary sequences" means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO:l under relatively stringent conditions such as those described herein.

The nucleic acid segments of the present invention, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may very considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol. For example, nucleic acid fragments may be prepared that include a short contiguous stretch identical to or complementary to SEQ ID NO:l, such as about 8, about 10 to about 14, about 15 to about 20 nucleotides, about 20 to about 25, or about 25 to about 30 nucleotides. DNA segments with total lengths of about 1,000, about 500, about 200, about 100 and about 50 base pairs in length

(including all intermediate lengths) are also contemplated to be useful.

It will be readily understood that "intermediate lengths", in these contexts, means any length between the quoted ranges, such as 10, 11, 12, 13, 14, 15, 16,

17, 18, 19, 20, 21, 22, 23, etc.; 30, 31, 32, 33, etc.; 50, 51, 52, 53, etc.; 100, 101, 102, 103, etc.; 150, 151, 152, 153, etc.; including all integers through the 200-

500; 500-1000; 1,000-2,000; 2,000-3,000; 3,000-5,000; 5,000-10,000 ranges.

The various probes and primers designed around the disclosed nucleotide sequences of the present invention may be of any length. By assigning numeric values to a sequence, for example, the first residue is 1, the second residue is 2, etc., an algorithm defining all primers can be proposed;

n to n + y

where n is an integer from 1 to the last number of the sequence and y is the length of the primer minus one, where n + y does not exceed the last number of the sequence. Thus, for a 10-mer, the probes correspond to bases 1 to 10, 2 to 11, 3 to

12 ... and so on. For a 15-mer, the probes correspond to bases 1 to 15, 2 to 16, 3 to 17... and so on. For a 20-mer, the probes correspond to bases 1 to 20, 2 to 21, 3 to 22... and so on. It will also be understood that this invention is not limited to the particular nucleic acid sequence of SEQ ID NO: l. Recombinant vectors and isolated DNA segments may therefore variously include this coding region themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include such coding regions or may encode biologically functional equivalent proteins or polypeptides that have variant amino acids sequences. The DNA segments of the present invention encompass biologically functional equivalent proteins and polypeptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally with nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or polypeptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity of the protein or to test mutants in order to examine transformation activity at the molecular level. Methods of site-directed mutagenesis are discussed herein.

One may also prepare fusion proteins and polypeptides, e.g. where the exon lb of ingl coding region is aligned within the same expression unit with other proteins or polypeptides having desired functions, such as for purification or immunodetection purposes (e.g., proteins that may be purified by affinity chromatography and enzyme label coding regions, respectively). In one embodiment, exon lb of ingl is aligned within the same expression unit with the common exon of ingl such that the open reading frame that is initiated in exon lb continues into the common exon and encodes p37^INGI or a functional equivalent thereof. In another embodiment, exon lb of ingl is aligned within the same expression unit with a 5' region of the common exon of ingl such that the open reading frame that is initiated in exon lb continues into the common exon and encodes the 94 amino acids of the amino terminus of p37^ING1. Recombinant Vectors, Host Cells and Expression

Recombinant vectors form further aspects of the present invention. The term "expression vector or construct" means any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. Thus, in certain embodiments, expression includes both transcription of a gene and translation of an RNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid, for example, to generate antisense constructs.

Particularly useful vectors are contemplated to be those vectors in which the coding portion of the DNA segment, whether encoding a full length protein or smaller polypeptide, is positioned under the transcriptional control of a promoter.

A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrases "operatively positioned", "under control" or "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.

The promoter may be in the form of the promoter that is naturally associated with a exon lb of ingl, as may be obtained by isolating the 5' non- coding sequences located upstream of the coding segment or exon, for example, using recombinant cloning and/or PCR technology, in connection with the compositions disclosed herein.

Important aspects of the present invention concern isolated nucleic acid segments and recombinant vectors encoding the newly discovered promoters. Because the ingl gene encodes both a tumor suppressor and an oncogene, the promoter regions of the present invention may be particularly useful in studies of gene expression and transformation. For example, the promoters disclosed herein may be used in expression vectors to express heterologous genes in a manner that is similar to the expression of that promoter in the endogenous ingl gene. To direct expression in transformed cells, the lb exon promoter would be used. On the other hand, to direct expression in non-transformed cells the la or lc promoter would be used. Furthermore, compounds or conditions that are shown to decrease expression of the lb promoter and/or increase expression of the lc or la promoter may be useful in decreasing or stopping the proliferation of cells.

In other embodiments, it is contemplated that certain advantages will be gained by positioning the coding DNA segment under the control of a recombinant, or heterologous, promoter. As used herein, a recombinant or heterologous promoter is intended to refer to a promoter that is not normally associated with exon lb of ingl in its natural environment. Such promoters may include promoters normally associated with other genes, and/or promoters isolated from any other bacterial, viral, eukaryotic, or mammalian cell. Naturally, it will be important to employ a promoter that effectively directs the expression of the DNA segment in the cell type, organism, or even animal, chosen for expression. The use of promoter and cell type combinations for protein expression is generally known to those of skill in the art of molecular biology, for example, see Sambrook et al. (1989), incorporated herein by reference. The promoters employed may be constitutive, or inducible, and can be used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or polypeptides.

At least one module in a promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynecleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.

Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription.

The particular promoter that is employed to control the expression of a nucleic acid is not believed to be critical, so long as it is capable of expressing the nucleic acid in the targeted cell. Thus, where a human cell is targeted, it may be preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of being expressed in a human cell. Generally speaking, such a promoter might include a human or viral promoter.

In various other embodiments, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter and the Rous sarcoma virus long terminal repeat can be used to obtain high-level expression of transgenes. The use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a transgene is contemplated as well, provided that the levels of expression are sufficient for a given purpose. Tables 2 and 3 below list several elements/promoters which may be employed, in the context of the present invention, to regulate the expression of exon lb of ingl. This list is not intended to be exhaustive of all the possible elements involved in the promotion of transgene expression but, merely, to be exemplary thereof. Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.

The basic distinction between enhancers and promoters are operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specifications. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.

Additionally, any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of a transgene.

Use of a T3, T7 or SP6 cytoplasmic expression system is another possible embodiment. Eukaryotic cells can support cytoplasmic transcription from certain bacterial and viral promoters if the appropriate bacterial or viral polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.

Table 2 - Promoter and Enhancer Elements

Promoter/Enhancer References

Immunoglobin Heavy Chain Banerji et al, 1983; Gilles et al., Grosschedl and Baltimore, 1985; Atchinson and Perry,

1986, 1987; Imler et αb, 1987; Weinberger et al, 1984; Kiledjian et al, 1988; Porton et αb

1990

Immunoglobin Light Chain Queen and Baltimore, 1983; Picard and

Schaffner, 1984

T-Cell Receptor Luria et al, 1987; Winoto and Baltimore,

1989; Redondo et al, ; 1990

HLA DQ and DQ β Sullivan and Peterlin, 1987 β-Interferon Goodbourn et al., 1986; Fujita et b, 1987;

Goodbourn and Maniatis, 1988

Interleukin-2 Greene et al, 1989

Interleukin-2 Receptor Greene et al, 1990

MHC Class 115 Koch et al, 1989

MHC Class II HLD-Dra Sherman et al, 1989 β-Actin Kawamoto et al., 1988; Ng et al, 1989

Muscle Creatine Kinase Jaynes et al., 1988; Horlikc and Benfield, 1989;

Johnson

Prealbumin (Transthyretin) Costa et al, 1988 Elastase II Omitz et b, 1987 Metallothiionein Karin et al, 1987; Culotta and Hamer, 1989 Table 2 - Promoter and Enhancer Elements

Promoter/Enhancer References

SV 40 Banerji et al, 1981; Moreau et al, 1981; Sleigh and Lockett, 1985; Firak and Subramanian, 1986; Herr and Clarke, 1986; Imbra and Karin, 1986; Kadesch and Berg, 1986; Wang and Calame, 1986; Ondek et al, 1987; Kuhl et al, 1987; Schaffner et al, 1988

Polyoma Swartzendruber and Lehman, 1975; Vasseur et al, 1980; Katinka et αb, 1980, 1981; Tyndell et al, 1981; Dandolo et al., 1983; de Villiers et al., 1984; Hen et b, 1986; Satake et al, 1988; Campbell and Villarreal, 1988

Retroviruses Kriegler and Botchan, 1982, 1983; Levinson et al., 1986; Miksicek et al, 1986; Celander and Haseltine, 1987; Thiesen et al., 1988; Celander et al, 1988; Chol et b, 1988; Reisman and Rotter, 1989

Papilloma Virus Campo et al., 1983; Lusky et al., 1983; Spandidos and Wilkie, 1983; Spalholz et al., 1985; Lusky and Botchan, 1986; Cripe et al., 1987; Gloss et al, 1987; Hirochika et al, 1987; Stephens and Hentschel, 1987; Glue et al., 1988

Hepatitis B Virus Bulla and Siddiqui, 1986; Jameel and Siddiqui, 1986; Shaul and Ben-Levy, 1987; Spandau and Lee, 1988; Vannice and Levinson, 1988 Table 2 - Promoter and Enhancer Elements

Promoter/Enhancer References

Human Immunodeficiency Virus Muesing et al, Hauber and Cullan, 1988; Jakobovits et al., 1988; Feng and Holland, 1988; Takebe et αb, 1988; Rosen et al., 1988; Berkhout et al, 1989; Laspia et αb, 1989; Sharp and Marciniak, 1989; Braddock et.al, 1989

Cytomegalovirus Weber et al, 1984; Boshart et αb, 1985; Foecking and Hofstetter, 1986

Gibbon Ape Leukemia Virus Holbrook et al., 1987; Quinn et αb, 1989

Table 3 Inducible Elements

Promoter/Enhancer Inducer References

MT II Phorbol Ester (TFA) Palmiter et al, 1982; Halinger

Heavy metals and Karin, 1985; Searle et al, 1985; Stuart et al, 1985; Imagawa et al.,1987, Karin et al, 1987; Angel et al, 1987b; McNeall et al, 1989

MMTV (mouse mammary Glucocorticoids Huang et al, 1981; Lee 1981; tumor virus) Majors and Varmus, 1983; Chandler et al, 1983; Lee et b, 1984; Ponta et al, 1985; Sakai et αb, 1988 Table 3 Continued

Promoter/Enhancer Inducer References β-Interferon poly(rI)x Tavernier et al, 1983 poly (re)

Advenovius 5 E2 Ela Imperiale and Nevins, 1984

Collagenase Phorbol Ester (TPA) Angel et al, 1987a

Stromelysin Phorbol Ester (TPA) Angel et al, 1987b

SV 40 Phorbol Ester (TPA) Angel et al, 1987b

Murine MX Gene Interferon,

Newcastle Disease

Virus

GRP78 Gene A23187 Resendez et al, 1988 -2-Macroglobulin IL-6 Knnz et al, 1989

Vimentin Scrum Rittling et al., 1989

MHC Class I Gene H-2κb Interferon Blanar et αb, 1989

HSP70 Ela, SV40 Large T Taylor et al, 1989; Taylor and

Antigen Kingston, 1990a, b

Proliferin Phorbol Ester-TPA Mordacq and Linzer, 1989

Tumor Necrosis Factor FMA Hensel et al., 1989 Thyroid Stimulating Thyroid Hormone Chatterjee et al, 1989 Hormone A Gene

As indicated, it is contemplated that one may use any regulatory element to express the exon lb of ingl disclosed by the present invention; however, under certain circumstances it may be desirable to use the innate promoter region associated with the gene of interest to control its expression, such as the exon lb of ingl promoter with the 5' flanking region of a exon lb of ingl genomic clone. As noted above, in most cases, genes are regulated at the level of transcription by regulatory elements that are located upstream, or 5' to the genes. In general, to identify regulatory elements for the gene of interest, one would obtain a genomic DNA segment corresponding to the region located between about 10 to 50 nucleotides up to about 2000 nucleotides or more upsteam from the transcriptional start site of the gene, i.e. the nucleotides between positions -10 and -2000. A convenient method used to obtain such a sequence is to utilize restriction enzyme(s) to excise an appropriate DNA fragment. Restriction enzyme technology is commonly used in the art and will be generally known to the skilled artisan. For example, one may use a combination of enzymes from the extensive range of known restriction enzymes to digest the genomic DNA. Analysis of the digest fragments would determine which enzyme(s) produce the desired DNA fragment. The desired region may then be excised from the genomic DNA using the enzyme(s). If desired, one may even create a particular restriction site by genetic engineering for subsequent use in ligation strategies.

Alternatively, one may choose to prepare a series of DNA fragments differentiated by size through the use of a deletion assay with linearized DNA. In such an assay, enzymes are also to digest the genomic DNA; however, in this case, the enzymes do not recognize specific sites within the DNA but instead digest the DNA from the free end(s). In this case, a series of size differentiated DNA fragments can be achieved by stopping the enzyme reaction after specified time intervals. Of course, one may also choose to use a combination of both restriction enzyme digestion and deletion assay to obtain the desired DNA fragment(s).

Once the desired DNA fragment has been isolated, its potential to regulate a gene and determine the basic regulatory unit may be examined using any one of several conventional techniques. It is recognized that once the core regulatory region is identified, one may choose to employ a longer sequence which comprises the identified regulatory unit. This is because although the core region is all that is ultimately required, it is believed that particular advantages accrue, in terms of regulation and level of induction achieved where one employs sequences which correspond to the natural control regions over longer regions, e.g. from around 25 or so nucleotides to as many as 1000 to 1500 or so nucleotides in length. The preferred length will be in part determined by the type of expression system used and the results desired.

Numerous methods are known in the art for precisely locating regulatory units within larger DNA sequences. Most conveniently, the desired control sequence is isolated within a DNA fragment(s) which is subsequently modified using DNA synthesis techniques to add restriction site linkers to the fragment(s) termini. This modification readily allows the insertion of the modified DNA fragment into an expression cassette which contains a reporter gene that confers on its recombinant host cell a readily detectable phenotype that is either expressed or inhibited, as may be the case.

Generally reporter genes encode a polypeptide not otherwise produced by the host cell; or a protein or factor produced by the host cell but at much lower levels; or a mutant form of a polypeptide not otherwise produced by the host cell. Preferably the reporter gene encodes an enzyme which produces a colorimetric or fluorometic change in the host cell which is detectable by in situ analysis and is a quantitative or semi-quantitative function of transcriptional activation. Exemplary reporter genes encode esterases, phosphatases, proteases and other proteins detected by activity which generates a chromophore or fluorophore as will be known to the skilled artisan. Well-known examples of such a reporter genes are E. coli β-galactosidase, luciferase, and chloramphenicol-acetyl-transferase (CAT).

Alternatively, a reporter gene may render its host cell resistant to a selection agent. For example, the gene neo renders cells resistant to the antibiotic neomycin. It is contemplated that virtually any host cell system compatible with the reporter gene cassette may be used to determine the regulatory unit. Thus mammalian or other eukaryotic cells, insect, bacterial or plant cells may be used.

Once a DNA fragment containing the putative regulatory region is inserted into an expression cassette which is in turn inserted into an appropriate host cell system, using any of the techniques commonly known to those of skill in the art, the ability of the fragment to regulate the expression of the reporter gene is assessed. By using a quantitive reporter assay and analyzing a series of DNA fragments of decreasing size, for example produced by convenient restriction endonuclease sites, or through the actions of enzymes such as BAL31, E. coli exonuclease III or mung bean nuclease, and which overlap each other a specific number of nucleotides, one may determine both the size and location of the native regulatory unit.

Of course, once the core regulatory unit has been determined, one may choose to modify the regulatory unit by mutating certain nucleotides within the core unit. The effects of these modifications may be analyzed using the same reporter assay to determine whether the modifications either enhance or reduce transcription. Thus key nucleotides within the core regulatory sequence can be identified.

It is recognized that regulatory units often contain both elements that either enhance or inhibit transcription. In the case that a regulatory unit is suspected of containing both types of elements, one may use competitive DNA mobility shift assays to separately identify each element. Those of skill in the art will be familiar the use of DNA mobility shift assays.

It may also be desirable to modify the identified regulatory unit by adding additional sequences to the unit. The added sequences may include additional enhancers, promoters or even other genes. Thus one may, for example prepare a DNA fragment that contains the native regulatory elements positioned to regulate one or more copies of the native gene and/or another gene or prepare a DNA fragment which contains not one but multiple copies of the promoter region such that transcription levels of the desired gene are relatively increased.

Turning to the expression of exon lb of ingl encoded proteins, preferably proteins comprise the amino acid sequence of SΕQ ID NO:2. Of course, it is understood that a portion of SΕQ ID NO:2 is encoded by exon lb of ingl and the remaining portion is encoded by the common exon of ingl . Once a suitable clone or clones have been obtained, whether they be cDNA based or genomic, one may proceed to prepare an expression system. Both cDNA and genomic sequences are suitable for eukaryotic expression, as the host cell will generally process the genomic transcripts to yield functional mRNA for translation into protein. Generally speaking, it may be more convenient to employ as the recombinant gene a cDNA version of the gene. It is believed that the use of cDNA version will provide advantages in that the size of the gene will generally be much smaller and more readily employed to transfect the targeted cell than will be a genomic gene, which will typically be up to an order of magnitude larger than the cDNA gene.

However, the inventor does not exclude the possibility of employing a genomic version of a particular gene where desired.

In expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed. Preferred embodiments include the SV40 polyadenylation signal and the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells. Also contemplated as an element of the expression cassette is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.

A specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.

It is proposed that exon lb of ingl, preferably the gene encoding p37^ING1 , may be co-expressed with another gene, wherein the proteins may be co-expressed in the same cell or wherein exon lb of ingl may be provided to a cell that already expresses exon lb of ingl. Co-expression may be achieved by co-transfecting the cell with two distinct recombinant vectors, each bearing a copy of either the respective DNA. Alternatively, a single recombinant vector may be constructed to include the coding regions for both of the proteins, which could then be expressed in cells transfected with the single vector. In either event, the term "co- expression" herein refers to the expression of both the polypeptide comprising the amino acid sequence SEQ ID NO: 2 and other protein in the same recombinant cell.

It is proposed that a gene comprising exon lb of ingl may be co-expressed with genes encoding selected tumor suppressor proteins or polypeptides. Tumor suppressor proteins contemplated for use include, but are not limited to, the retinoblastoma, p53, Wilms tumor (WT-1), DCC, neurofibromatosis type 1 (NF-

1), von Hippel-Lindau (VHL) disease tumor suppressor, Maspin, Brush- 1, BRCA- 2, and the multiple tumor suppressor (MTS) or pi 6 proteins or polypeptides. Further particularly, contemplated is co-expression with a selected wild-type version of a selected oncogene. Wild-type oncogenes contemplated for use include, but are not limited to, tyrosine kinases, both membrane-associated and cytoplasmic forms, such as members of the Src family, serine/threonine kinases, such as Mos, growth factor and receptors, such as platelet derived growth factor (PDDG), SMALL GTPases (G proteins) including the ras family, cyclin- dependent protein kinases (cdk), members of the myc family members including c-myc, N-myc, and L-myc and bcl-2 and family members.

As used herein, the terms "engineered" and "recombinant" cells are intended to refer to a cell into which an exogenous DNA segment or gene, such as a cDNA or gene encoding exon lb of ingl has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells that do not contain a recombinantly introduced exogenous DNA segment or gene.

Engineered cells are thus cells having a gene or genes introduced through the hand of man. Recombinant cells include those having an introduced cDNA or genomic gene, and also include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene. To express a recombinant exon lb of ingl in accordance with the present invention one would prepare an expression vector that comprises an exon lb of ingl -encoding nucleic acid under the control of one or more promoters. To bring a coding sequence "under the control of a promoter, one positions the 5' end of the transcription initiation site of the transcriptional reading frame generally between about 1 and about 50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter. The "upstream" promoter stimulates transcription of the DNA and promotes expression of the encoded recombinant protein. This is the meaning of "recombinant expression" in this context.

Many standard techniques are available to construct expression vectors containing the appropriate nucleic acids and transcriptional/translational control sequences in order to achieve protein or polypeptide expression in a variety of host-expression systems. Cell types available for expression include, but are not limited to, bacteria, such as E. coli and B. subtilis transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expresson vectors.

In addition to micro-organism, cultures of cells derived from multicellular organisms may also be used as hosts. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture. In addition to mammalian cells, these include insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus); and plant cells systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing one or more exon lb of ingl coding sequences.

In a useful insect system, Autograph californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodeptera frugiperda cells. The exon lb of ingl is cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of the coding sequences results in the inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed (e.g., U.S. Patent No. 4,215,051, Smith).

Example of useful mammalian host cell lines are VERO and HeLA cells, Chinese hamster ovary (CHO) cell lines, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines. In addition, a host cell strain may be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g. glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cells lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.

Expression vectors for use in mammalian cells ordinarily include an origin of replication (as necessary), a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences. The origin of replication may be provided either by construction of the vector to include exogenous origin, such as may be derived from SV40 or other viral (e.g., polyoma, adenovirus, VSV, or BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the later is often is sufficient.

The promoters may be from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., CMV immediate early, the adenovirus late promoter; the vaccinia virus 7.5K promoter). Further, it is also possible, and may be desirable, to utilize promoter or control sequences normally associated with the desired exon lb of ingl sequence, provided such control sequences are compatible with the host cell systems.

A number of viral based expression systems may be utilized, for example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 origin of replication. Smaller or larger SV40 fragments may also be used, providing there is included the approximately 250 bp sequence extending from the H dIII site toward the BgR site located in the viral origin of replication.

In cases where an adenovirus is used as an expression vector, the coding sequence may be ligated to an adenovirus transcription/ translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing exon lb of ingl in infected hosts.

Specific initiation signals may also be required for efficient translation of exon lb of ingl sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may additionally need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be in-frame (or in-phase) with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational coding signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators.

In eukaryotic expression, one will also typically desire to incorporate into the transcriptional unit an appropriate polyadenylation site (e.g., 5'-AATAAA-3') if one was not contained within the original cloned segment. Typically, the poly A addition site is placed about 30 to 2000 nucleotides "downstream" of the termination codon of the protein at a position prior to transcription termination.

For long-term, high-yield production of recombinant exon lb of ingl, stable expression is preferred. For example, cell lines that stably express constructs encoding exon lb of ingl may be engineered. Rather than using expression vectors that contain viral origins of replication, host cells can be transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, introns, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. A number of selection systems may be used, including, but not limited, to the herpes simplex virus thymidine kinase, hypoxanthine-guanine phosphoribosyltransferase and adenine phosphoribosyltransferase genes. Also, antimetabolite resistance can be used as the basis of selection for dhfr, that confers resistance to methotrexate; gpt, that confers resistance to mycophenolic acid; neo, that confers resistance to the amonoglycoside G-418; and hygro, that confers resistance to hygromycin.

Animal cells can be propagated in vitro in two modes: as non-anchorage dependent cells growing in suspension throughout the bulk of the culture or as anchorage-dependent cells requiring attachment to a solid substrate for their propagation (i.e., a monolayer type of cell growth).

Non-anchorage dependent or suspension cultures from continuous established cell lines are the most widely used means of large scale production of cells and cell products. However, suspension cultured cells have limitations, such as tumorigenic potential and lower protein production than adherent cells. Large scale suspension culture of mammalian cells in stirred tanks is a common method for production of recombinant proteins. Two suspension culture reactor designs are in wide use - the stirred reactor and the airlift reactor. The stirred design has successfully been used on an 8000 liter capacity for the production of interferon. Cells are grown in a stainless steel tank with a height-to- diameter ratio of 1: 1 to 3: 1. The culture is usually mixed with one or more agitators, based on bladed disks or marine propeller patterns. Agitator systems offering less shear forces than blades have been described. Agitation may be driven either directly or indirectly by magnetically coupled drives. Indirect drives reduce the risk of microbial contamination through seals on stirrer shafts.

The airlift reactor, also initially described for microbial fermentation and later adapted for mammalian culture, relies on a gas stream to both mix and oxygenate the culture. The gas stream enters a riser section of the reactor and drives circulation. Gas disengages at the culture surface, causing denser liquid free of gas bubbles to travel downward in the downcomer section of the reactor. The main advantage of this design is the simplicity and lack of need for mechanical mixing. Typically, the height-to-diameter ratio is 10:1. The airlift reactor scales up relatively easy, has good mass transfer of gases, and generates relatively low shear forces.

It is contemplated that a exon lb of ingl encoding a polypeptide of the invention may be "overexpressed", i.e., expressed in increasing levels of relative to its natural expression in cells. Such overexpression may be assessed by a variety of methods, including radio-labeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or western blotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein or polypeptide in comparison to the level in natural cells is indicative of overexpression, as is a relative abundance of the specific protein in relation to the other proteins produced by the host cell and, e.g., visible on a gel. Nucleic Acid Detection In addition to their use in directing the expression exon lb of ingl encoded polypeptides, the nucleic acid sequences disclosed herein also have a variety of other uses. For example, they also have utility as probes or primers in nucleic acid hybridization embodiments. They may be particularly useful in methods and kits for the diagosis or detection of cancer. Hybridization

The use of a hybridization probe of between 17 and 300 nucleotides in length allows the formation of a duplex molecule that is both stable and selective. Molecules having complementary sequences over stretches greater than 20 bases in length are generally preferred, in order to increase stability and selectivity of the hybrid, and thereby improve the quality and degree of particular hybrid molecules obtained. One will generally prefer to design nucleic acid molecules having stretches of 20 to 30 nucleotides, or even longer where desired. Such fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.

Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of genes or RNAs or to provide primers for amplification of DNA or RNA from tissues. Depending on the application envisioned, one would desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of probe towards target sequence.

For applications requiring high selectivity, one would typically desire to employ relatively stringent conditions to form the hybrids, e.g., one will select relatively low salt and/or high temperature conditions, such as provided by about

0.02 M to about 0.10 M NaCl at temperatures of about 50°C to about 70°C. Such high stringency conditions tolerate little, if any, mismatch between the probe and the template or target strand, and would be particularly suitable for isolating specific genes or detecting specific mRNA transcripts. It is appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.

For certain application, for example, substitution of nucleotides by site- directed mutagenesis, it is appreciated that lower stringency conditions are required. Under these conditions, hybridization may occur even though the sequences of probe and target strand are not perfectly complementary, but are mismatched at one or more positions. Conditions may be rendered less stringent by increasing salt concentration and decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25 M NaCl at temperatures of about 37°C to about 55°C, while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20°C to about 55°C. Thus, hybridization conditions can be readily manipulated depending on the desired results.

In other embodiments, hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KC1, 3 mM MgCl_2, 1.0 mN dithiothreitol, at temperatures between approximately 20°C to about 37°C. Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 1.5 mM MgCl₂ at temperatures ranging from approximately 40°C to about 72°C.

In certain embodiments, it will be advantageous to employ nucleic acid sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization. A wide variety of appropriate indicator means are known in the art, including fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected. In preferred embodiments, one may desire to employ a fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmentally undesirable reagents. In the case of enzyme tags, colorimetric indicator substrates are known that can be employed to provide a detection means visible to the human eye or spectrophotometrically, to identify specific hybridization with complementary nucleic acid-containing samples. In general, it is envisioned that the hybridization probes described herein will be useful both as reagents in solution hybridization, as in PCR, for detection of expression of corresponding genes, as well as in embodiments employing a solid phase. In embodiments involving a solid phase, the test DNA (or RNA) is absorbed or otherwise affixed to a selected matrix or surface. This fixed, single- stranded nucleic acid is then subjected to hybridization with selected probes under desired conditions. The selected conditions will depend on the particular circumstances based on the particular criteria required (depending, for example, on the G+C content, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.). Following washing of the hybridized surface to remove non-specifically bound probe molecules, hybridization is detected, or even quantified, by means of the label. Amplification and PCR

Nucleic acid used as a template for amplification is isolated from cells contained in the biological sample, according to standard methodologies (Sambrook et al., 1989). The nucleic acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used, it may be desired to convert the RNA to a complementary DNA. In one embodiment, the RNA is whole cell RNA and is used directly as the template for amplification.

Pairs of primers that selectively hybridize to nucleic acids corresponding to exon lb of ingl are contacted with the isolated nucleic acid under conditions that permit selective hybridization. In a preferred embodiment, one primer corresponds to exon lb of ingl and the other primer corresponds to the common exon of ingl. The term "primer", as defined herein, is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process. Typically, primers are oligonucleotides from ten to twenty base pairs in length, but longer sequences can be employed. Primers may be provided in double- stranded or single-stranded form, although the single- stranded form is preferred.

Once hybridized, the nucleic acid:primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also referred to as "cycles," are conducted until a sufficient amount of amplification product is produced.

Next, the amplification product is detected. In certain applications, the detection may be performed by visual means. Alternatively, the detection may involve indirect identification of the product via chemiluminescence, radioactive scintography of incorporated radiolabel or fluorescent label or even via a system using electrical or thermal impulse signals (Affymax technology).

A number of template dependent processes are available to amplify the marker sequences present in a given template sample. One of the best known amplification methods is the polymerase chain reaction (referred to as PCR) which is described in detail in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159, and each incorporated herein by reference in entirety.

Briefly, in PCR, two primer sequences are prepared that are complementary to regions on opposite complementary strands of the marker sequence. An excess of deoxynucleoside triphosphates are added to a reaction mixture along with a DNA polymerase, e.g., Taq polymerase. If the marker sequence is present in a sample, the primers will bind to the marker and the polymerase will cause the primers to be extended along the marker sequence by adding on nucleotides. By raising and lowering the temperature of the reaction mixture, the extended primers will dissociate from the marker to form reaction products, excess primers will bind to the marker and to the reaction products and the process is repeated.

A reverse transcriptase PCR amplification procedure may be performed in order to quantify the amount of mRNA amplified. Methods of reverse transcribing RNA into cDNA are well known and described in Sambrook et al.,

1989. Alternative methods for reverse transcription utilize thermostable, RNA- dependant DNA polymerases. These methods are described in WO 90/07641, filed December 21, 1990, incorporated herein by reference. Polymerase chain reaction methodologies are well known in the art. Another method for amplification is the ligase chain reaction ("LCR"), disclosed in EPA No. 320 308, incorporated herein by reference in its entirety. In LCR, two complementary probe pairs are prepared, and in the presence of the target seequence, each pair will bind to opposite complementary strands of the target such that they abut. In the presence of a ligase, the two probe pairs will link to form a single unit. By temperature cycling, as in PCR, bound ligated units dissociate from the target and then serve as "target sequences" for ligation of excess probe pairs. U.S. Patent 4,883,750 describes a method similar to LCR for binding probe pairs to a target sequence.

Qbeta Replicase, described in PCT Application No. PCT/US 87/00880, incorporated herein by reference, may also be used as still another amplification method in the present invention. In this method, a replicative sequence of RNA that has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase. The polymerase will copy the replicative sequence that can then be detected.

An isothermal amplification method, in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide 5'-[alpha-thio]-triphosphates in one strand of a restriction site may be useful in the amplification of nucleic acids in the present invention.

Strand Displacement Amplification (SDA) is another method of carrying out isothermal amplification of nucleic acids which involves multiple rounds of strand displacement and synthesis, be., nick translation. A similar method, called

Repair Chain Reaction (RCR), involves annealing several probes throughout a region targeted for amplification, followed by a repair reaction in which only two of the four bases are present. The other two bases can be added as biotinylated derivatives for easy detection. A similar approach is used in SDA. Target specific sequences can also be detected using a cyclic probe reaction (CPR). In CPR, a probe having 3' and 5' sequences of non-specific DNA and a middle sequence of specific RNA is hybridized to DNA that is present in a sample. Upon hybridization, the reaction is treated with RNase H, and the products of the probe identified as distinctive products that are released after digestion. The original template is annealed to another cycling probe and the reaction is repeated.

Still another amplification methods described in GB Application No. 2 202 328, and in PCT Application No. PCT/US 89/01025, each of which is incorporated herein by reference in its entirety, may be used in accordance with the present invention. In the former application, "modified" primers are used in a PCR-like, template- and enzyme-dependent synthesis. The primers may be modified by labelling with a capture moiety (e.g., biotin), and/or a detector moiety (e.g., enzyme). In the latter application, an excess of labeled probes is added to a sample. In the presence of the target sequence, the probe binds and is cleaved catalytically. After cleavage, the target sequence is released intact to be bound by excess probe. Cleavage of the labeled probe signals the presence of the target sequence.

Other nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR Gingeras et al., PCT Application WO 88/10315, incorporated herein by reference. In NASBA, the nucleic acids can be prepared for amplification by standard phenol/chloroform extraction, heat denaturation of a clinical sample, treatment with lysis buffer and minispin columns for isolation of DNA and RNA or guanidinium chloride extraction of RNA. These amplification techniques involve annealing a primer which has target specific sequences. Following polymerization, DNA/RNA hybrids are digested with RNase H while double stranded DNA molecules are heat denatured again. In either case the single stranded DNA is made fully double-stranded by addition of second target specific primer, followed by polymerization. The double-stranded DNA molecules are then multiply transcribed by an RNA polymerase such as T7 or SP6. In an isothermal cyclic reaction, the RNA's are reverse transcribed into single stranded DNA, which is then converted to double stranded DNA, and then transcribed once again with an RNA polymerase such as T7 or SP6. The resulting products, whether truncated or complete, indicate target specific sequences.

Davey et al., EPA No.329 822 (incorporated herein by reference in its entirety) disclose a nucleic acid amplification process involving cyclically synthesizing single-stranded RNA ("ssRNA"), ssDNA, and double-stranded DNA

(dsDNA), which may be used in accordance with the present invention. The ssRNA is a template for a first primer oligonucleotide, which is elongated by reverse transcriptase (RNA-dependent DNA polymerase). The RNA is then removed from the resulting DNA:RNA duplex by the action of ribonuclease H (RNase H, an RNase specific for RNA in duplex with either DNA or RNA). The resultant ssDNA is a template for a second primer, which also includes the sequence of an RNA polymerase promoter (exemplified by T7 RNA polymerase) 5' to its homology to the template. This primer is then extended by DNA polymerase (exemplified by the large "Klenow" fragment of E. coli DNA polymerase I), resulting in a double-stranded DNA ("dsDNA") molecule, having a sequence identical to that of the original RNA between the primers and having additionally, at one end, a promoter sequence. This promoter sequence can be used by the appropriate RNA polymerase to make many RNA copies of the DNA. These copies can then re-enter the cycle leading to very swift amplification. With proper choice of enzymes, this amplification can be done isothermally without addition of enzymes at each cycle. Because of the cyclical nature of this process, the starting sequence can be chosen to be in the form of either DNA or RNA.

Miller et al, PCT Application WO 89/06700 (incorporated herein by reference in its entirety) disclose a nucleic acid sequence amplification scheme based on the hybridization of the promoter/primer sequence to a target single- stranded DNA ("ssDNA") followed by transcription of many RNA copies of the sequence. This scheme is not cyclic, be., new templates are not produced from the resultant RNA transcripts. Other amplification methods include "RACE" and "one-sided PCR".

Methods based on ligation of two (or more) oligonucleotides in the presence of nucleic acid having the sequence of the resulting "di-oligonucleotide", thereby amplifying the di-oligonucleotide, may also be used in the amplification step of the present invention.

Following any amplification, it may be desirable to separate the amplification product from the template and the excess primer for the purpose of determining whether specific amplification has occurred. In one embodiment, amplification products are separated by agarose, agarose-acrylamide, or polyacrylamide gel electrophoresis using standard methods. See Sambrook et al, 1989.

Alternatively, chromatographic techniques may be employed to effect separation. There are many kinds of chromatography which may be used in the present invention: absorption, partition, ion-exchange, and molecular sieve, and many specialized techniques for using them including column, paper, thin-layer, and gas chromatography.

Amplification products must be visualized in order to confirm amplification of the marker sequences. One typical visualization method involves staining of a gel with ethidium bromide and visualization under UV light.

Alternatively, if the amplification products are integrally labeled with radio- or fluorometrically-labeled nucleotides, the amplification products can then be exposed to x-ray film or visualized under the appropriate stimulating spectra, following separation. In one embodiment, visualization is achieved indirectly. Following separation of amplification products, a labeled, nucleic acid probe is brought into contact with the amplified marker sequence. The probe preferably is conjugated to a chromophore but may be radiolabeled. In another embodiment, the probe is conjugated to a binding partner, such as an antibody or biotin, and the other member of the binding pair carries a detectable moiety.

In one embodiment, detection is by Southern blotting and hybridization with a labeled probe. The techniques involved in Southern blotting are well known to those of skill in the art and can be found in many standard books on molecular protocols. See Sambrook et al., 1989. Briefly, amplification products are separated by gel electrophoresis. The gel is then contacted with a membrane, such as nitrocellulose, permitting transfer of the nucleic acid and non-covalent binding. Subsequently, the membrane is incubated with a chromophore- conjugated probe that is capable of hybridizing with a target amplification product. Detection is by exposure of the membrane to x-ray film or ion-emitting detection devices.

One example of the foregoing is described in U.S. Patent No. 5,279,721, incorporated by reference herein, which discloses an apparatus and method for the automated electrophoresis and transfer of nucleic acids. The apparatus permits electrophoresis and blotting without external manipulation of the gel and is ideally suited to carrying out methods according to the present invention. All the essential materials and reagents required for detecting exon lb of ingl markers in a biological sample may be assembled together in a kit. This generally will comprise preselected primers for specific markers. Also included may be enzymes suitable for amplifying nucleic acids including various polymerases (RT, Taq., etc.), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification.

Such kits generally will comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each marker primer pair. In some embodiments, pairs of primers for amplifying nucleic acids are selected to amplify the sequences specified in SEQ ID NO:l. In a preferred embodiment, primers are selected to simultaneously amplify sequences comprising either SEQ ID NO:l and SEQ ID NO:3 or SEQ ID NO:3 and SEQ ID NO:4 or SEQ ID NO:3 and SEQ ID NO:5.

In other embodiment, such kits will comprise hybridization probes specific for exon lb of ingl chosen from a group including nucleic acids corresponding to the sequence specified in SEQ ID NO:l. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each marker hybridization probe. Other Assays Historically, a number of different methods have been used to detect point mutations, including denaturing gradient gel electrophoresis ("DGE"), restriction enzyme polymorphism analysis, chemical and enzymatic cleavage methods, and others. The more common procedures currently in use include direct sequencing of target regions amplified by PCR™ (see above) and single-strand conformation polymorphism analysis ("SSCP").

Another method of screening for point mutations is based on RNase cleavage of base pair mismatches in RNA DNA and RNA/RNA heteroduplexes. As used herein, the term "mismatch" is defined as a region of one or more unpaired or mispaired nucleotides in a double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This definition thus includes mismatches due to insertion/deletion mutations, as well as single and multiple base point mutations. U.S. Patent No. 4,946,773 describes an RNase A mismatch cleavage assay that involves annealing single-stranded DNA or RNA test samples to an RNA probe, and subsequent treatment of the nucleic acid duplexes with RNase. After the RNase cleavage reaction, the RNase is inactivated by proteolytic digestion and organic extraction, and the cleavage products are denatured by heating and analyzed by electrophoresis on denaturing polyacrylamide gels. For the detection of mismatches, the single- stranded products of the RNase A treatment, electrophoretically separated according to size, are compared to similarly treated control duplexes. Samples containing smaller fragments (cleavage products) not seen in the control duplex are scored as +.

Currently available RNase mismatch cleavage assays, including those performed according to U.S. Patent No. 4,946,773, require the use of radiolabeled RNA probes. Myers and Maniatis in U.S. Patent No. 4,946,773 describe the detection of base pair mismatches using RNase A. Other investigators have described the use of E. coli enzyme, RNase I, in mismatch assays. Because it has broader cleavage specificity than RNase A, RNase I would be a desirable enzyme to employ in the detection of base pair mismatches if components can be found to decrease the extend of non-specific cleavage and increase the frequency of cleavage of mismatches. The use of RNase I for mismatch detection is described in literature from Promega Biotech. Promega markets a kit containing RNase I that is shown in their literature to cleave three out of four known mismatches, provided the enzyme level is sufficiently high.

The RNase protection assay was first used to detect and map the ends of specific mRNA targets in solution. The assay relies on being able to easily generate high specific activity radiolabeled RNA probes complementary to the mRNA of interest by in vitro transcription were recombinant plasmids containing bacteriophage promoters. The probes are mixed with total cellular RNA samples to permit hybridization to their complementary targets, then the mixture is treated with RNase to degrade excess unhybridized probe. Also, as originally intended, the RNase used is specific for single-stranded RNA, so that hybridized double- stranded probe is protected from degradation. After inactivation and removal of the RNase, the protected probe (which is proportional in amount to the amount of target mRNA that was present) is recovered and analyzed on a polyacrylamide gel. The Rnase Protection assay was adapted for detection of single base mutations. In this type of Rnase A mismatch cleavage assay, radiolabeled RNA probes transcribed in vitro from wild-type sequences, are hybridized to complementary target regions derived from test samples. The test target generally comprises DNA (either genomic DNA or DNA amplified by cloning in plasmids or by PC™ ), although RNA targets (endogenous mRNA) have occasionally been used. If single nucleotide (or greater) sequence differences occur between the hybridized probe and target, the resulting disruption in Watson-Crick hydrogen bonding at that position ("mismatch") can be recognized and cleaved in some cases by single-strand specific ribonuclease. To date, Rnase A has been used almost exclusively for cleavage of single-base mismatches, although Rnase I has recently been shown as useful also for mismatch cleavage. There are recent descriptions of using the MutS protein and other DNA-repair enzymes for detection of single-base mismatches. p37^ING1 Proteins and Polypeptides

The present invention provides purified, and in preferred embodiments, substantially purified, proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2. The term "purified protein or polypeptide" as used herein, is intended to refer to a aqueous composition, isolatable from mammalian cells or recombinant host cells, wherein the protein or polypeptide is purified to any degree relative to its naturally-obtainable state, i.e., relative to its purity within a cellular extract. A purified protein or polypeptide therefore also refers to a protein or polypeptide free from the environment in which it naturally occurs.

Proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 may be full length proteins, preferably p37^ING1. Proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 may also be less then full length proteins, such as individual domains, regions or even epitopic peptides. Where less than full length proteins are concerned the most preferred will be those containing predicted immunogenic sites and/or those containing the functional domains.

Generally, "purified" will refer to a protein or polypeptide composition that has been subjected to fractionation to remove various protein or polypeptide components not comprising the amino acid sequence of SEQ ID NO:2, and which composition substantially retains its activity, as may be assessed by binding to amino acid sequence of SEQ ID NO:2-specific antibodies.

Where the term "substantially purified" is used, this will refer to a composition in which the protein or polypeptide forms the major component of the composition, such as constituting about 50% of the proteins in the composition or more. In preferred embodiments, a substantially purified protein will constitute more than 60%, 70%, 80%, 90%, 95%, 99% or even more of the proteins in the composition.

A polypeptide or protein that is "purified to homogeneity," as applied to the present invention, means that the polypeptide or protein has a level or purity where the polypeptide or protein is substantially free from other proteins and biological components. For example, a purified polypeptide or protein will often be sufficiently free of other protein components so that degradative sequencing may be performed successfully. Various methods for quantifying the degree of purification of proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 will be known to those of skill in the art in light of the present disclosure. These include, for example, assessing the number of polypeptides within a fraction by gel electrophoresis. Assessing the number of polypeptides within a fraction by SDS/PAGE analysis will often be preferred in the context of the present invention as this is straightforward.

To purify a protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2, a natural or recombinant composition comprising at least some a protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2 will be subjected to fractionation to remove various components not comprising the amino acid sequence of SEQ ID NO:2 from the composition. Various techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite, lectin affinity and other affinity chromatography steps; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques.

Although preferred for use in certain embodiments, there is no general requirement that the protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2 always be provided in their most purified state. Indeed, it is contemplated that less substantially purified proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2, which are nonetheless enriched in protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2 compositions, relative to the natural state, will have utility in certain embodiments. These include, for example, antibody generation where subsequent screening assays using purified protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2.

Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein. Inactive products also have utility in certain embodiments, such as, e.g., in antibody generation.

Modifications and changes can be made in the structure of a polypeptide of the present invention and still obtain a molecule having like characteristics and function. For example, certain amino acids can be substituted for other amino acids in a sequence without appreciable loss of structure or activity. Because it is the interactive capacity and nature of a polypeptide that defines that polypeptide' s biological functional activity, certain amino acid sequence substitutions can be made in a polypeptide sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a polypeptide with like properties.

In making such changes, the hydropathic index of amino acids can be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a polypeptide is generally understood in the art (Kyte and Doolittle, 1982). It is known that certain amino acids can be substituted for other amino acids having a similar hydropathic index or score and still result in a polypeptide with similar biological activity. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics. Those indices are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine

(+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4) threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-0.3); proline (-1.6) histidine (-3.2); glummate (-3.5); asparatate (-3.5); asparagine (-3.5); lysine (-3.9) and arginine (-4.5). It is believed that the relative hydropathic character of the amino acid determines the secondary structure of the resultant polypeptide, which in turn defines that interaction of the polypeptide with other molecules, such as enzymes, substrates, receptors, antibodies, antigens, and the like. It is known in the art that an amino acid can be substituted by another amino acid having a similar hydropathic index and still obtain a functionally equivalent polypeptide. In such changes, the substitution of amino acids whose hydropathic indices are within +/- 2 is preferred, those which are within +/- 1 are particularly preferred, and those within +/- 0.5 are even more particularly preferred.

Substitution of like amino acids can also be made on the basis of hydrophilicity, particularly where the biological functional equivalent polypeptide or peptide thereby created is intended for use in immunological embodiments. U.S. Pat. No. 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a polypeptide, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigenicity, i.e. with a biological property of the polypeptide.

As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 +/- 1); glutamate (+3.0 +/- 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); proline (-0.5 +/- 1); threonine (-0.4); alanine (-0.5); histidine (- 0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-

1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an immunologically equivalent polypeptide. In such changes, the substitution of amino acids whose hydrophilicity values are within +/- 2 is preferred, those which are with in +/- 1 are particularly preferred, and those within +/- 0.5 are even more particularly preferred.

As outlined above, amino acid substitution are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine (See Table 4, below).

Mutagenesis

Site-specific mutagenesis is a technique useful in the preparation of individual polypeptides, or biologically functional equivalent proteins or polypeptides, through specific mutagenesis of the underlying DNA. The technique further provides a ready ability to prepare and test sequence variants, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 17 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered. In general, the technique of site-specific mutagenesis is well known in the art. As will be appreciated, the technique typically employs a bacteriophage vector that exists in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage. These phage vectors are commercially available and their use is generally well known to those skilled in the art. Double stranded plasmids are also routinely employed in site directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid.

In general, site-directed mutagenesis is performed by first obtaining a single-stranded vector, or melting of two strands of a double stranded vector that includes within its sequence a DNA sequence encoding the desired protein. An oligonucleotide primer bearing the desired mutated sequence is synthetically prepared. This primer is then annealed with the single-stranded DNA preparation, and subjected to DNA polymerizing enzymes such as E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells, such as E. coli cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement.

The preparation of sequence variants of the selected gene using site- directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting, as there are other ways in which sequence variants of genes may be obtained. For example, recombinant vectors encoding the desired gene may be treated with mutagenic agents, such s hydroxylamine, to obtain sequence variants.

Antibodies to Εpitopic Core Sequences

Polypeptides corresponding to one or more antigenic determinants, or

"epitopic core regions", of a polypeptide comprising the amino acid sequence of

SΕQ ID NO:2 can also be prepared. Such polypeptides should generally be at least five or six amino acid residues in length, will preferably be about 10, 15, 20,

25 or about 30 amino acid residues in length, and may contain up to about 35-50 residues or so.

Synthetic polypeptides will generally be about 35 residues long, which is the approximate upper length limit of automated polypeptide synthesis machines, such as those available from Applied Biosy stems (Foster City, CA). Longer polypeptides may also be prepared, e.g., by recombinant means.

U.S. Patent 4,554,101, (Hopp) incorporated herein by reference, teaches the identification and preparation of epitopes from primary amino acid sequences on the basis of hydrophilicity. Through the methods disclosed in Hopp, one of skill in the art would be able to identify epitopes from within an amino acid sequence such as the sequence disclosed herein (SΕQ ID NO:2).

Numerous scientific publications have also been devoted to the prediction of secondary structure, and to the identification of epitopes, from analyses of amino acid sequences (Chou & Fasman, 1974a,b; 1978a,b, 1979). Any of these may be used, if desired, to supplement the teachings of Hopp in U.S. Patent

4,554,101. Moreover, computer programs are currently available to assist with predicting antigenic portions and epitopic core regions of proteins. Examples include those programs based upon the Jameson-Wolf analysis (Jameson & Wolf, 1988; Wolf et al, 1988), the program PepPlot® (Brutlag et al., 1990; Weinberger et al, 1985), and other new programs for protein tertiary structure prediction

(Fetrow & Bryant, 1993). Further commercially available software capable of carrying out such analyses is termed Mac Vector (IBI, New Haven, CT).

In further embodiments, major antigenic determinants of a polypeptide may be identified by an empirical approach in which portion of the gene encoding the polypeptide are expressed in a recombinant host, and the resulting proteins tested for their ability to elicit an immune response. For example, PCR can be used to prepare a range of polypeptides lacking successively longer fragments of the C- terminus of the protein. The immunoactivity of each of these polypeptides is determined to identify those fragments or domains of the polypeptide that are immunodominant. Further studies in which only a small number of amino acids are removed at each iteration then allows the location of the antigenic determinants of the polypeptide to be more precisely determined.

Another method for determining the major antigenic determinants of a polypeptide is the SPOTs™ system (Genosys Biotechnologies, Inc., The Woodlands, TX). In this method, overlapping polypeptides are synthesized on a cellulose membrane, which following synthesis and deprotection, is screened using a polyclonal or monoclonal antibody. The antigenic determinants of the polypeptides which are initially identified can be further localized by performing subsequent syntheses of smaller polypeptides with larger overlaps, and by eventually replacing individual amino acids at each position along the immunoreactive polypeptide.

Once one or more such analyses are completed, polypeptides are prepared that contain at least the essential features of one or more antigenic determinants. The polypeptides are then employed in the generation of antisera against the polypeptide. Minigenes or gene fusions encoding these determinants can also be constructed and inserted into expression vectors by standard methods, for example, using PCR cloning methodology.

The use of such small polypeptides for vaccination typically requires conjugation of the polypeptide to an immunogenic carrier protein, such as hepatitis B surface antigen, keyhole limpet hemocyanin or bovine serum albumin. Methods for performing this conjugation are well known in the art. Antibody Generation

In certain embodiments, the present invention provides antibodies that bind to, or are immunoreactive with, proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2. Thus, antibodies that bind to the protein product of the isolated nucleic acid sequence of SEQ ID NO: 1 are provided, along with antibodies that bind to the amino acids encoded within the common exon of ingl that are unique to p37^ING1. By "unique to p37^ING1" it is meant those amino acids encoded by exon lb or the common exon that are upstream of the initiation codon for p33^ING1. As detailed above, in addition to antibodies generated against the full length proteins, antibodies may also be generated in response to smaller constructs comprising epitopic core regions, including wild-type, polymorphic and mutant epitopes.

As used herein, the term "antibody" is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situaion and because they are most easily made in a laboratory setting.

Monoclonal antibodies (Mabs) are recognized to have certain advantages, e.g., reproducibility and large-scale production, and their use is generally preferred. The invention thus provides monoclonal antibodies of the human, murine, monkey, rat, hamster, rabbit and even chicken origin. Due to the ease of preparation and ready availability of reagents, murine monoclonal antibodies will often be preferred. However, "humanized" antibodies are also contemplated, as are chimeric antibodies from mouse, rat, or other species, bearing human constant and/or variable region domains, bispecific antibodies, recombinant and engineered antibodies and fragments thereof. Methods for the development of antibodies that are "custom-tailored" to the patient's tumor are likewise known and such custom- tailored antibodies are also contemplated. The term "antibody" is used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')₂, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. The techniques for preparing and using various antibody-based constructs and fragments are well known in the art. Means for preparing and characterizing antibodies are well known in the art

(See, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; incorporated herein by reference).

The methods for generating monoclonal antibodies (Mabs) generally begin along the same lines as those for preparing polyclonal antibodies. Briefly, a polyclonal antibody is prepared by immunizing an animal with an immunogenic composition containing a protein and polypeptide comprising the amino acid sequence of SEQ ID NO: 2 in accordance with the present invention and collecting antisera from that immunized animal.

A wide range of animal species can be used for the production of antisera. Typically the animal used for production of antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies.

As is well known in the art, a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier.

Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bisbiazotized benzidine. As is also well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Suitable adjuvants include all acceptable immunostimulatory compounds, such as cytokines, toxins or synthetic compositions.

Adjuvants that may be used include IL-1, IL-2, IL-4, IL-7, IL-12, g- interferon, GMCSP, BCG, aluminum hydroxide, MDP compounds, such as thur- MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL). RIBI, which contains three components extracted from bacteria, MPL, trehalose dimycolate (TDM) and cell wall skeleton (CWS) in a 2% squalene/Tween 80 emulsion. MHC antigens may even be used.

Exemplary, often preferred adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum hydroxide adjuvant.

In addition to adjuvants, it may be desirable to coadminister biological response modifiers (BRM), which have been shown to upregulate T cell immunity or downregulate suppressor cell activity. Such BRMs include, but ar not limited to, Cimetidine (CIM; 1200 mg/d) (Smith/Kline, PA); or low-dose Cyclophosphamide (CYP; 300 mg/m²) (Johnson/Mead, NJ) and Cytokines such as γ-interferon, IL-2, or IL-12 or genes encoding proteins involved in immune helper functions, such as B-7.

The amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous, and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection, may also be given. The process of boosting and titering is repeated until a suitable titer is achieved. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored, and/or the animal can be used to generate MAbs. For production of rabbit polyclonal antibodies, the animal can be bled through an ear vein or alternatively by cardiac puncture. The removed blood is allowed to coagulate and then centrifuged to separate serum components from whole cells and blood clots. The serum may be used as is for various applications or else the desired antibody fraction may be purified by well-known methods, such as affinity chromatography using another antibody, a polypeptide bound to a solid matrix, or by using, e.g., protein A or protein G chromatography.

MAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference. Typically, this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a purified or partially purified p37^ING1 protein, polypeptide, peptide or domain, be it a wild-type or mutant composition. The immunizing composition is administered in a manner effective to stimulate antibody producing cells.

The methods for generating monoclonal antibodies (MAbs) generally begin along the same lines as those for preparing polyclonal antibodies. Rodents such as mice and rats are preferred animals, however, the use of rabbit, sheep frog cells is also possible. The use of rats may provide certain advantages (Goding, 1986, pp. 60-61), but mice are preferred, with the BALB/c mouse being most preferred as this is most routinely used and generally gives a higher percentage of stable fusions.

The animals are injected with antigen, generally as described above. The antigen may be coupled to carrier molecules such as keyhole limpet hemocyanin if necessary. The antigen would typically be mixed with adjuvant, such as Freund's complete or incomplete adjuvant. Booster injections with the same antigen would occur at approximately two- week intervals. Following immunization, somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol. These cells may be obtained from biopsied spleens, tonsils or lymph nodes, or from a peripheral blood sample. Spleen cells and peripheral blood cells are preferred, the former because they are a rich source of antibody- producing cells that are in the dividing plasmablast stage, and the latter because peripheral blood is easily accessible.

Often, a panel of animals will have been immunized and the spleen of animal with the highest antibody titer will be removed and the spleen lymphocytes obtained by homogenizing the spleen with a syringe. Typically, a spleen from an immunized mouse contains approximately 5xl0⁷ to 2xl0⁸ lymphocytes.

The antibody-producing B lymphocytes from the immunized animal are th en fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized. Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render then incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas).

Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984). Cites).

For example, where the immunized animal is a mouse, one may use P3-X63/Ag8, X63-Ag8.653, NSl/l.Ag 4 1, Sp210-Agl4, FO, NSO/U, MPC11-X45-GTG 1.7 and S194/5XXO Bui; for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and U-266, GM1500-GRG2, LICR-LON-Hmy2 and UC729-6 are all useful in connection with human cell fusions.

One preferred murine myeloma cell is the NS-1 myeloma cell line (also termed P3-NS-l-Ag4-l), which is readily available from the NIGMS Human Genetic Mutant Cell Repository by requesting cell line repository number GM3573. Another mouse myeloma cell line that may be used is the 8-azaguanine- resistant mouse murine myeloma SP2/0 non-producer cell line. Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually comprise mixing somatic cells with myeloma cells in a 2: 1 proportion, though the proportion may vary from about 20: 1 to about 1:1, respectively, in the presence of an agent or agents (chemical or electrical) that promote the fusion of cell membranes. Fusion methods using

Sendai virus have been described by Kohler and Milstein (1975; 1976), and those using polyethylene glycol (PEG), such as 37% (v/v) PEG, by Gefter et al. (1977). The use of electrically induced fusion methods is also appropriate (Goding pp. 71- 74, 1986) Fusion procedures usually produce viably hybrids at low frequencies, about lxlO^"6 to lxlO^"8. However, this does not pose a problem, as the viable, fused hybrids are differentiated from the parental, unfused cells (particularly the unfused myeloma cells that would normally continue to divide indefinitely) by culturing in a selective medium. The selective medium is generally one that contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture media.

Exemplary and preferred agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis as a source of nucleotides (HAT medium). Where azaserine is used, the media is supplemented with hypoxan thine.

In certain examples, the preferred selection medium is HAT. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium. The myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphoribosyl transferase (HPRT), and they cannot survive. The B cells can operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells.

This culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired reactivity. The assay should be sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays, dot immunobinding assays, and the like.

The selected hybridomas would then be serially diluted and cloned into individual antibody-producing cell lines, which clones can then be propagated indefinitely to provide MAbs. Preferred monoclonal antibody producing cell lines of the present invention are included in Table 5. The reactivity of the mABs produced by these cell lines with human p37^ING1, mouse p37^ING1, and human p3 -^NGi ^g _sj_lown Greater number of + indicates better reactivity. Whereas - is indicative of an inability to react with that protein.

TABLE 5

_P37 ^INGI _Monoclonaι Antibodies

The cell lines may be exploited for MAb production in two basic ways. First, a sample of the hybridoma can be injected (often into the peritoneal cavity) into a histocompatible animal of the type that was used to provide the somatic and myeloma cells for the original fusion (e.g., a syngeneic mouse). Optionally, the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection. The injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, can then be tapped to provide MAbs in high concentration. Second, the individual cell lines could also be cultured in vitro, where the MAbs are naturally secreted into the culture medium from which they can be readily obtained in high concentrations. MAbs produced by either means may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as HPLC of affinity chromatography. Fragments of the monoclonal antibodies of he invention can be obtained from the monoclonal antibodies so produced by methods which include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer.

It is also contemplated that molecular cloning approach may be used to generate monoclonals. For this, combinatorial immunoglubulin phagemid libraries are prepared from RNA isolated from the spleen of the immunized animal, and phagemids expressing appropriate antibodies are selected by panning using cells expressing the antigen and control cells. The advantages of this approach over conventional hybridoma techniques are that approximately 10⁴ times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies.

Alternatively, monoclonal antibody fragments encompassed by the present invention can by synthesized using an automated peptide synthesizer, or by expression of full-length gene or of gene fragment in E. coli. Antibody Conjugates

The present invention further provides antibodies against proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2, generally of the monoclonal type, that are linked to one or more other agents to form an antibody conjugate. Any antibody of sufficient selectivity, specificity and affinity may be employed as the basis for an antibody conjugate. Such properties may be evaluated using conventional immunological screening methodology known to those of skill in the art. In preferred embodiments, the monoclonal antibodies are by the cell lines of Table 5. Certain examples of antibody conjugates are those conjugates in which the antibody is linked to a detectable label. "Detectable labels" are compounds or elements that can be detected due to their specific functional properties, or chemical characteristics, the use of which allows the antibody to which they are attached to be detected, and further quantified if desired. Another such example is the formation of a conjugate comprising an antibody linked to a cytotoxic or anti- cellular agent, as may be termed "immunotoxins": In the context of the present invention, immunotoxins are generally less preferred.

Antibody conjugates are thus preferred for use as diagnostic agents. Antibody diagnostics generally fall within two classes, those for use in in vitro diagnostic protocols, generally known as "antibody-directed imaging". Again, antibody-directed imaging is less preferred for use with this invention.

Many appropriate imaging agents are known in the art, as are methods for their attachment to antibodies (see, e.g., U.S. patents 5,021,236 and 4,472,509, both incorporated herein by reference). Certain attachment methods involve the use of a metal chelate complex employing, for example, an organic chelating agent such a DTPA attached to the antibody (U.S. Patent 4,472,509). Monoclonal antibodies may also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate. Conjugates with fluorescein markers are prepared in the presence of these coupling agents or by reaction with an isothiocyanate. In the case of paramagnetic ions, one might mention by way of example ions such as chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel

(II), copper (II), neodymium (III), samarium (III), yterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) and erbium (III), with gadolinium being particularly preferred.

Ions useful in other contexts, such as X-ray imaging, include but are not limited to lanthanum (III), gold (III), lead (II), and especially bismuth (III).

In the case of radioactive isotopes for therapeutic and/or diagnostic application, one might mention astatine²¹¹, ¹⁴carbon, ⁵¹chromium, ³⁶chloring, "cobalt, ⁵⁸cobalt, copper⁶⁷, ¹⁵²Eu, gallium⁶⁷, ³hydrogen, iodine¹²³, iodine¹²⁵, iodine¹³¹, indium¹¹¹, ⁵⁹iron, ³²phosphorus, rhenium¹⁸⁶, rhenium¹⁸⁸, ⁷⁵selenium, ³⁵sulphur, technicium^99m and yttrium⁹⁰. ¹²⁵1 is often being preferred for use in certain embodiments, and technicium⁹⁹"¹ and indium¹ ' ' are also often preferred due to their low energy and suitability for long range detection. Radioactively labeled monoclonal antibodies of the present invention may be produced according to well-known methods in the art. For instance, monoclonal antibodies can be iodinated by contact with sodium or potassium iodide and a chemical oxidizing agent such as sodium hypochlorite, or an enzymatic oxidizing agent, such as lactoperoxidase. Monoclonal antibodies according to the invention may be labeled with technetium-⁹⁹m by ligand exchange process, for example, by reducing pertechnate with stannous solution, chelating the reduced technetium onto a Sephadex column and applying the antibody to this column or by direct labeling techniques, e.g., by incubating pertechnate, a reducing agent such as SNCI₂, a buffer solution such as sodium- potassium phthalate solution, and the antibody.

Intermediary functional groups which are often used to bind radioisotopes which exist as metallic ions to antibody are diethylenetriammecpentaacetic acid (DTPA) and ethylene diaminetetracetic acid (EDTA).

Fluorescent labels include rhodamine, fluorescein isothiocyanate and renograhin. The much preferred antibody conjugates of the present invention are those intended primarily for use in vitro, where the antibody is linked to a secondary binding ligand or to an enzyme (an enzyme tag) that will generate a colored product upon contact with a chromogenic substrate. Examples of suitable enzymes include urease, alkaline phosphatase, (horseradish) hydrogen peroxidase and glucose oxidase. Preferred secondary binding ligands are biotin and avidin or streptavidin compounds. The use of such labels is well known to those of skill in the art in light and is described, for example, in U.S. Patents 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241; each incorporated herein by reference.

Immunodetection Methods

In still further embodiments, the present invention concerns immunodetection methods for binding, purifying, removing, quantifying or otherwise generally detecting biological components such as components containing proteins and polypeptides comprising the amino acid sequence of SEQ

ID NO:2. The proteins or polypeptides of the present invention may be employed to detect and purify antibodies prepared in accordance with the present invention, and antibodies prepared in accordance with present invention, may be employed to detect proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2. As described throughout the present application, the use of antibodies specific to proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 is contemplated. The steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Nakamura et al. (1987), incorporated herein by reference. In general, the immunobinding methods include obtaining a sample suspected of containing a protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2, and contacting the sample with a first antibody in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes. These methods include methods for purifying proteins and polypeptides comprising the amino acid sequence of SEQ ID NO: 2, as may be employed in purifying proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 from patients' samples or for purifying recombinantly expressed proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2. In these instances, the antibody removes the antigenic component from a sample. The antibody will preferably be linked to a solid support, such as in the form of a column matrix, and the sample suspected of containing the antigenic component will be applied to the immobilized antibody. The unwanted components will be washed from the column, leaving the antigen immunocomplexed to the immobilized antibody, which antigen is then collected by removing the proteins and polypeptides comprising the amino acid sequence of SEQ ID NO: 2 from the column.

The immunobinding, or immunoreactive, methods also include methods for detecting or quantifying the amount of reactive component in a sample, which methods require the detection or quantification of any immune complexes formed during the binding process. Here, one would obtain a sample suspected of containing a protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2, and contact the sample with an antibody against proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2, and then detect or quantify the amount of immune complexes formed under the specific conditions.

In terms of antigen detection, the biological sample analyzed may be any sample that is suspected of containing a protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2, such as a cancer tissue section or specimen, a homogenized cancer tissue extract, a cancer cell, separated or purified forms of any of the above protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2-containing compositions, or even any biological fluid that comes into contact with hyperproliferative tissue, including blood and serum, although tissue samples and extracts are preferred.

Contacting the chosen biological sample with the antibody under conditions effective and for a period of time sufficient to allow the formation of immune complexes (primary immune complexes) is generally a matter of simply adding the antibody composition to the sample and incubating the mixture for a period of time lone enough for the antibodies to form immune complexes with, i.e., to bind to, any proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 present. After this time, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.

In general, the detection of immunocomplex formation is well known in the art and may be achieved through the application of numerous approaches. These methods are generally based upon the detection of a label or marker, such as any of those radioactive, fluorescent, biological or enzymatic tags. U.S. Patents concerning the use of such labels include 3,817,837; 3,850,752; 3,939,350; 4,277,437; 4,275,149 and 4,366,241, each incorporated herein by reference. Of course, one may find additional advantages through the use of a secondary binding ligand such as a second antibody or a biotin/avidin ligand binding arrangement, as is known in the art.

The antibody specific to proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 employed in the detection may itself be linked to a detectable label, wherein one would then simply detect this label, thereby allowing the amount of the primary immune complexes in the composition to be determined.

Alternatively, the first antibody that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the antibody. In these cases, the second binding ligand may be linked to a detectable label. The second binding ligand is itself often an antibody, which may thus be termed a "secondary" antibody. The primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under conditions effective and for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected.

Further methods include the detection of primary immune complexes by a two step approach. A second binding ligand, such as an antibody, that has binding affinity for the antibody is used to form secondary immune complexes, as described above. After washing, the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under conditions effective and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes). The third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed. This system may provide for signal amplification if this is desired.

The immunodetection methods of the present invention have evident utility in the diagnosis or prognosis of conditions such as forms of cancer or other hyperproliferative cell disorders involving cell transformation. Here, a biological or clinical sample suspected of containing a protein and polypeptide comprising the amino acid sequence of SEQ ID NO:2 is used. However, these embodiments also have applications to non-clinical samples, such as in the titering of antigen or antibody samples, in the selection of hybridomas, and the like. In the clinical diagnosis or monitoring of patients with cancer, the detection of proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2, or an alteration in the levels of proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2, in comparison to the levels in a corresponding biological sample from a normal subject is indicative of a patient with head, neck, breast, ovarian, uterine or another form of cancer.

However, as is known to those of skill in the art, such a clinical diagnosis would not necessarily be made on the basis of this method in isolation. Those of skill in the art are very familiar with differentiating between significant differences in types or amounts of biomarkers, which represent a positive identification, and low level or background changes of biomarkers. Indeed, background expression levels are often used to form a "cut-off above which increased detection will be scored as significant or positive.

Immunochemical methods include, but are not limited to, Western blotting, immunoaffinity purification, immunoprecipitation, ELISA, dot or slot blotting, RIA, immunohistochemical staining, immunocytochemical staining, and flow cytometry.

Western Blots

The compositions of the present invention will find use in immunoblot or Western blot analysis. Methods of Western blotting are well known to those of skill in the art. Generally, a protein sample is subjected to SDS-PAGE at such conditions as to yield an appropriate separation of proteins within the sample. The proteins are then transferred to a membrane (e.g., nitrocellulose, nylon, etc.) in such a way as to maintain the relative positions of the proteins to each other.

In preferred embodiments, visibly labeled proteins of known molecular weight are included within a lane of the gel. These proteins serve as a method of insuring that adequate transfer of the proteins to the membrane has occurred and as molecular weight markers for determining the relative molecular weight of other proteins on the blot.

Subsequent to transfer of the proteins to the membrane, the membrane is submersed in a blocking solution to prevent nonspecific binding of the primary antibody.

The primary antibody may be labeled and the presence and molecular weight of the antigen may be determined by detection of the label at a specific location on the membrane. However, in preferred embodiments, the primary antibody is not labeled and the blot is further reacted with a labeled secondary antibody. This secondary antibody is immunoreactive with the primary antibody. In preferred embodiments, the secondary antibody is antibody to rabbit immunoglobulins and labeled with alkaline phosphatase (Promega, Madison, WI; Cat. # 5373B). An apparatus for and methods of performing Western blots are described in U.S. Patent No. 5,567,595.

Immunoassays

Immunoassays of the invention include the various types of enzyme linked immunosorbent assays (ELISAs), as are known to those of skill in the art.

However, it will be readily appreciated that other useful embodiments include RIAs and other non-enzyme linked antibody binding assays and procedures.

U.S. Patent No. 5,744,319 describes the use of antibodies to human tryptase in what is commonly known as a double antibody-sandwich ELISA. The basic protocol for a double antibody- sandwich ELISA is as follows: A plate is coated with antibodies (called capture antibodies) specific for the antigen being assayed. The plate is then washed with a blocking agent, such as bovine serum albumin (BSA) to block non-specific binding of proteins (antibodies or antigens) to the test plate. The test sample is then incubated on the plate coated with the capture antibodies. The plate is then washed, incubated with detect antibodies, washed again, and incubated with a specific antibody-label conjugate. After incubation, the unbound conjugate is washed from the plate. The presence of the bound antibody-label conjugate is indicated by detection of the label.

In preferred embodiments, the capture antibody is an antibody specific to proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 and the detect antibody is an antibody that is immunoreactive with the region of INGl that is common between p37^ING1 and p33^1NG1 (such as Cabl; Garkavtsev et al., 1997). Of course, in light of the present disclosure many variations of a double antibody-sandwich ELISA will be apparent to those of skill in the art, including using the antibody specific to proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 of as the detecting antibody or the detecting antibody may be labeled.

In other ELISAs, proteins or peptides are immobilized onto a selected surface, preferably a surface exhibiting a protein affinity, such as the wells of a polystyrene microtiter plate. After washing to remove incompletely adsorbed material, one would then generally desire to bind or coat a nonspecific protein that is known to be antigenically neutral with regard to the antibodies of the present invention, such as bovine serum albumin (BSA) or casein, onto the well. This allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antibodies onto the surface. When the antibodies were created in an animal by conjugating a polypeptide to a protein (e.g., KLH), it is preferred that a different protein be used as a blocking agent, because of the possibility of the presence of antibodies to the blocking protein in the antibody composition. After binding of antigenic material to the well, coating with a non-reactive material to reduce background, and washing to remove unbound material, the immobilizing surface is contacted with an antibody composition of the present invention in a manner conducive to immune complex (antigen/antibody) formation. Such conditions preferably include diluting the antibody composition of the present invention with diluents such as BSA, bovine gamma globulin

(BGG) and phosphate buffered saline (PBS)/Tween^® 20. These added agents also tend to assist in the reduction of nonspecific background. The layered antibody composition is then allowed to incubate for, e.g., from 2 to 4 h, at temperatures preferably on the order of about 25 °C to about 37°C. Following incubation, the antibody composition-contacted surface is washed so as to remove non- immunocomplexed material. A preferred washing procedure includes washing with a solution such as PBS/ Tween^® 20, or borate buffer.

Following formation of specific immunocomplexes between the test sample and the antibody composition of the present invention, and subsequent washing, the occurrence and the amount of immunocomplex formation may be determined by subjecting the complex to a second antibody having specificity for the antibody of the present invention. To provide a detecting means, the second antibody will preferably have an associated detectable label, such as an enzyme label or fluorescent molecule that will generate a signal, such as color development upon incubating with an appropriate chromogenic, fluorescent, or luminescent substrate. Thus, for example, one will desire to contact and incubate the antibody-bound surface with a peroxidase-conjugated anti-rabbit IgG for a period of time and under conditions that favor the development of immunocomplex formation (e.g., incubation for 2h at room temperature in a PBS- containing solution such as PBS- Tween^® 20). The second antibody also may be conjugated to a hapten such as biotin that can be detected by avidin or streptavidin conjugated to an associated detectable label.

After incubation with the second enzyme-tagged antibody, and subsequent to washing to remove unbound material, the amount of label is quantified by incubation with a chromogenic substrate such as urea and bromocresol purple or 2.2' -azino-di-(3-ethylbenzthiazoline)-6 sulfonic acid (ABTS and H₂O₂, in the case of peroxidase as the enzyme label. Quantitation is then achieved by measuring the degree of color generation, e.g., using a visible spectrum spectrophotometer.

A number of immunoassays are discussed in U.S. Patent No. 5,736,348, 5,192,660, and 4,474,892. Flow Cytometry

The antibodies of the present invention may be used in methods of flow cytometry. Generally, the cells are permeabilized to allow the antibody to enter and exit the cell. After permeabilization, the cells are incubated with an antibody. In preferred embodiments, the antibody is a monoclonal antibody. It is more preferred that the monoclonal antibody be labeled with a fluorescent marker. If the antibody is not labeled with a fluorescent marker, a second antibody that is immunoreactive with the first antibody and contains a fluorescent marker is used. After sufficient washing to insure that excess or non-bound antibodies are removed, the cells are ready for flow cytometry. Of course, the staining technique described above is also appropriate for the preparation of cells for other methods

(e.g., fluorescent microscopy).

Using the antibodies of the present invention for flow cytometry, transformed cells would be indicated by an increase in the fluorescent intensity of the cell over control non-transformed cells. The transformed cells may be sorted by their increase in fluorescence and subjected to further analysis. Immunoprecipitation

The antibodies of the present invention are particularly useful for the isolation of antigens by immunoprecipitation. Methods of immunoprecipitations are described in U.S. Patent No. 5,629,197. Immunopreciptitation involves the separation of the target antigen component from a complex mixture, and is used to discriminate or isolate minute amounts of protein.

Screening Assays

In yet another aspect, the present invention provides a process of screening substances for their ability to affect transformation of cells. Utilizing the methods and compositions of the present invention, screening assays for the testing of candidate substances can be derived. A candidate substance is a substance which potentially can promote or inhibit transformation within a cell sample contacted with the substance. A screening assay of the present invention generally involves determining the ability of a candidate substance to affect cellular processes leading to an alteration in expression of p37^1NG1 and detecting this alteration using nucleic acid or antibody compositions of the present invention.

Of course, the screening assays may be used in conjunction with other known assays. Other known assays include in vitro assays such as focus forming assays, growth in soft agar, and assays that indicate changes in the morphology of the cell; also included are in vivo assays such as those involving the placement of cells intraperitoneally, subcutaneously, and intraveneously into an animal and monitoring tumor growth or metastasis. Other in vitro or in vivo assays may include contacting the cells of an animal with a vector expressing a nucleic acid.

The nucleic acid can be essentially any nucleic acid and include those that encode an oncogene such as a ras family member or a tumor suppressor gene such as p53. Screening Assays for Compounds That Induce Transformation The present invention provides processes of determining expression of a gene that is associated with transformation of cells, thus a method of detecting transformation. Therefore, such a method may be utilized to determine if a candidate substance is inducing transformation in a biological sample. A biological sample to be screened can be a biological fluid such as extracellular or intracellular fluid or a cell or tissue extract or homogenate. A biological sample can also be an isolated cell (e.g., in culture) or a collection of cells such as in a tissue sample or histology sample. A tissue sample can be suspended in a liquid medium or fixed onto a solid support such as a microscope slide.

In accordance with a screening assay process, a biological sample is exposed to a candidate compound being assayed. Typically, exposure is accomplished by contacting the biological sample with the candidate compound.

Of course, one may contact a large number of cells with the candidate compound and a biological sample may be taken from those cells. For example, one may administer the candidate compound to an animal and collect a biological sample from the animal. Administration may be orally, transdermally, superficially, by inhalation, vaginally, retroductally (such as intraductal in mammary gland), intraveneously, intranasally, subcutaneously, rectally, or intermuscularly. Methods of administering compositions to animals by these routes are well known to those of skill in the art.

The biological sample may be a blood sample or a tissue sample. The tissue sample may be a biopsy, wherein the animal may not need to be sacrificed prior to collection of the sample, or may be a tissue sample collected from an animal following euthanasia or a sample collected during autopsy.

The biological sample is exposed to the candidate compound under conditions and for a period of time sufficient for induction of transformation processes. Such conditions and time periods may be determined by using compounds known to induce transformation in a given sample. The only limit on biological reaction conditions is that the conditions do not cause a significant level of transformation in the absence of a candidate compound but allow transformation in the presence of a known inducer of transformation. Exposure time will vary inter alia with the biological conditions used, the concentration of compound and the nature of the sample (e.g., fluid or tissue sample). Means for determining exposure time are well known to one of ordinary skill in the art.

In some embodiments, the presence of transformation in the sample is detected by contacting the sample with the antibodies specific to proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2 and detecting the formation and presence of antibody-polypeptide conjugates. Means for detecting such antibody-antigen conjugates are disclosed herein. In one embodiment, detection is accomplished by detecting an indicator affixed to the antibody. Exemplary and well known such indicators include radioactive labels (e.g., P, I, C), fluorescent labels, such as fluoroscein, rhodamine, or phycoerythrin, a second antibody or an enzyme such as horseradish peroxidase, alkaline phosphatase, or luciferase. Means for affixing indicators to antibodies are well known in the art. Commercial kits are available for the purpose.

In a preferred embodiment, transformation is determined by detecting expression of p37^ING1 and p33^1NG1 and comparing the relative ratio of expressi m of the two proteins. In one embodiment, a western blot is produced using an antibody that is immunoreactive with both p37^1NG1 and p33^ING1. By comparing the intensity of the bands corresponding to the respective proteins such as by densitometry, one may determine the relative ratio of expression of the two proteins. In transformed cells, the ratio will be greater than in non-transformed cells. Thus, one may determine the relative ratio in non-transformed cells of a certain type and use this ratio as a baseline to compare to similar cells exposed to the compound. Of course, in certain instances, the inventors contemplate that cells may be considered transformed if p37^1NG1 is detectable in both transformed and non-transformed cells while pSS^{1 01} is only detectable in non-transformed cells.

In another embodiment, a similar comparison is made as that above, however, the level of mRNA encoding p37^1NG1 is compared to the level of mRNA encoding pSS ⁰¹. Such comparisons may be done using northern blot technology wherein the probe comprises the common exon of ingl and the specific transcripts are identified based on its characteristic size. In another embodiment, RT-PCR utilizing primers able to amplify either the p37^1NG1 -encoding mRNA or the pSS¹¹"⁰¹ -encoding mRNA are used. In a preferred embodiment, a primer specific to exon lb, a primer specific to la and/or a primer specific to lc, and a primer specific to the common exon are used together in a single PCR reaction. It is preferred that the primers are chosen to produce products that allows determination of the origin of the product based on size, thus allowing one to compare relative expression levels of p37^1NG1-and p33^1NG1 -encoding mRNAs.

Screening Assays for Compounds That Inhibit Transformation Similar to the above assay for screening compounds for their ability to induce transformation, the present invention also provides methods for screening compounds that inhibit transformation. Generally, such methods involve subjecting a biological sample to conditions that induce transformation. These conditions may be conditions commonly known to induce transformation or may be conditions found to induce transformation by methods described herein.

The inventors contemplate that one may contact the cells with a candidate compound suspected to inhibit transformation prior to, simultaneous with, or following induction of transformation in the biological sample. In preferred embodiments, the cells are contacted with the candidate compound following induction of transformation.

The biological sample is exposed to the candidate compound for a period of time sufficient for inhibition of transformation processes. Such time periods may be determined by using compounds known to inhibit transformation in a given sample. Exposure time will vary inter alia with the biological conditions used, the concentration of compound and the nature of the sample (e.g., fluid or tissue sample). Means for determining exposure time are well known to one of ordinary skill in the art.

The presence of transformation in the sample is detected by contacting the sample with antibodies specific to proteins and polypeptides comprising the amino acid sequence of SEQ ID NO: 2 and detecting the formation and presence of antibody-polypeptide conjugates. Means for detecting such antibody-antigen conjugates are disclosed herein. In one embodiment, detection is accomplished by detecting an indicator affixed to the antibody. Exemplary and well known such indicators include radioactive labels (e.g., ³²P, ^I25I, ¹⁴C), fluorescent labels, such as fluoroscein, rhodamine, or phycoerythrin, a second antibody or an enzyme such as horse radish peroxidase, alkaline phosphatase, or luciferase. Means for affixing indicators to antibodies are well known in the art. Commercial kits are available.

The ability to inhibit transformation is indicated by a reduced level of antibody-polypeptide conjugates in the sample as compared to a sample, subjected to the same conditions and inducer of transformation as the test sample, that was not contacted with the candidate compound. As described above for methods of screening for compounds that induce transformation of cells, one may screen for compounds that inhibit transformation of cells by comparing relative ratio of expression of p37^ING1 and p33^1NG1. Of course, level of expression can be determined by detecting the mRNA or protein products of the respective genes as described above. However, in this instance, the ability to inhibit transorfmation is indicated by a decrease in the relative ratio of expression of p37^ING1 and p33^1NG1 . Kits

In another aspect, the present invention provides for kits for detecting the presence of transcripts that encode exon lb of ingl or epitopes that are immunoreactive with the antibodies of the present invention.

Kits comprising antibodies may comprise a first container containing a first antibody being an antibody immunoreactive with proteins and polypeptides comprising the amino acid sequence of SEQ ID NO:2, with the antibody present in an amount sufficient to perform at least one assay. The assay kits of the invention may further comprise a second container containing a second antibody that immunoreacts with the first antibody. Preferably, the secondary antibody is conjugated with a label (enzymatic, fluorometric, radioactive, etc.). The secondary antibody may be from essentially any animal including, but not limited to cow, goat, sheep, horse, rabbit, chicken, or donkey. In another embodiments, kits of the present invention may further comprise an antibody recognizing an apoptosis marker. Such kits would have particular utility in techniques for determining the status of a tumor sample. In another embodiment, the kits of the present invention further comprise an antibody to a surface marker (such as antibodies to the CD antigens). Such kits would have particular utility in flow cytometry techniques allowing one to determine the type of cells transformed in a mixture of cell types. Gene Therapy

The general approach to the cell transformation and proliferation suppression aspect of the present invention is to provide a cell with a p37^ING1 or a dominant negative p37^ING1 protein, respectively, thereby permitting the proper regulatory activity of the proteins to take effect. Of course, in some embodiments, one may wish to provide a cell with a protein encoded by exon lb of ingl or a protein comprising the amino acid sequence of SEQ ID NO:2 that does not encode the entire coding sequence of p37^ING1 and such embodiments are provided herein.

While it is conceivable that the protein may be delivered directly, a preferred embodiment involves providing a nucleic acid encoding p37^1NG1or dominant negative p37^ING1 protein to the cell. Following this provision, the polypeptide is synthesized by the transcriptional and translational machinery of the cell, as well as any that may be provided by the expression construct. In providing antisense, ribozymes and other inhibitors, the preferred mode is also to provide a nucleic acid encoding the construct to the cell. All such approaches are herein encompassed within the term "gene therapy".

In various embodiments of the invention, DNA is delivered to a cell as an expression construct. Several non-viral methods for the transfer of expression constructs into cultured mammalian cells also are contemplated by the present invention. These include calcium phosphate precipitation, DEAE-dextran, electroporation, direct microinjection, DNA-loaded liposomes and lipofectamine- DNA complexes, cell sonication, gene bombardment using high velocity microprojectiles, and receptor-mediated transfection. Some of these techniques may be successfully adapted for in vivo or ex vivo use, as discussed below. In another embodiment of the invention, the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane. This is particularly applicable for transfer in vitro, but it may be applied to in vivo use as well.

Another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them. Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force. The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.

In a further embodiment of the invention, the expression construct may be entrapped in a liposome, as discussed below. Also contemplated are lipofectamine-DNA complexes. Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful. Wong et al. (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells. In certain embodiment of the invention, the liposome may be complexes with a hemugglutinating virus (HVJ). This has been shown to facilitate fusion with cell membrane and promote cell entry of liposome-encapsulated DNA. In other embodiments, the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1). In yet further embodiments, the liposome may be complexed or employed in conjunction with both HVJ and

HMG-1. In other embodiments, the delivery vehicle may comprise a ligand and a liposome. Where a bacterial promoter is employed in the DNA construct, it also will be desirable to include within the liposome an appropriate bacterial polymerase. The ability of certain viruses to enter cells via receptor-mediated endocytosis and to integrate into host cell geneome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells. Preferred gene therapy vectors of the present invention will generally be viral vectors. Retro viruses, including the lentiviruses (HIV-1, HIV-2, SIV) have promise as gene delivery vectors due to their ability to integrate their genes into the host genome, transferring a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and of being packaged in special cell-lines (Miller, 1992). Other viruses, such as adenovirus, herpes simplex viruses (HSV), cytomegalovarus (CMV), and adeno-associated virus (AAV), such as those described by U.S. Patent 5,139,941, incorporated herein by reference, may also be engineered to serve as vectors for gene transfer. Although some viruses that can accept foreign genetic material are limited in the number of nucleotides they can accommodate and in the range of cells they infect, these viruses have been demonstrated to successfully effect gene expression. However, adenoviruses do not integrate their genetic material into the host genome and therefore do not require host replication for gene expression, making them ideally suited for rapid, efficient, heterologous gene expression. Techniques for preparing replication- defective infective viruses are well known in the art.

In certain further embodiments, the gene therapy vector will be HSV. A factor that makes HSV an attractive vector is the size and organization of the genome. Because HSV is large, incorporation of multiple genes or expression cassettes is less problematic than in other smaller viral systems. In addition, the availability of different viral control sequences with varying performance

(temporal, strength, etc.) makes it possible to control expression to a greater extent than in other systems. It also is an advantage that the virus has relatively few spliced messages, further easing genetic manipulations. HSV also is relatively easy to manipulate and can be grown to high titers. Thus, delivery is less of a problem, both in terms of volumes needed to attain sufficient MOI and in a lessened need for repeat dosings. Of course, in using viral delivery systems, one will desire to purify the virion sufficiently to render it essentially free of undesirable contaminants, such as defective interfering viral particles or endotoxins and other pyrogens such that it will not cause any untoward reaction in the cell, animal or individual receiving the vector construct. A preferred means of purifying the vector involves the use of buoyant density gradients, such as cesium chloride gradient centrifugation.

Gene delivery using second generation retroviral vectors has been reported. Kasahara et al (1994) prepared an engineered variant of the Moloney murine leukemia virus, that normally infects only mouse cells, and modified an envelope protein so that the virus specifically bound to, and infected, human cells bearing the erythropoietin (EPO) receptor. This was achieved by inserting a portion of the EPO sequence into an envelope protein to create a chimeric protein with a new binding specificity. Antisense In an alternative embodiment, the exon lb comprising nucleic acids employed may actually encode antisense constructs that hybridize, under intracellular conditions, to ingl nucleic acids. The term "antisense construct" is intended to refer to nucleic acids, preferably oligonucleotides, that are complementary to the base sequence of a target DNA or RNA. Antisense oligonucleotides, when introduced into a target cell, specifically bind to their target nucleic acid and interfere with transcription, RNA processing, transport, translation and/or stability.

Antisense constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. Antisense RNA constructs, or DNA encoding such antisense RNA's, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject. Nucleic acid sequences which comprise "complementary nucleotides" are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, that the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T), in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing. As used herein, the terms "complementary" means nucleic acid sequences that are substantially complementary over their entire length and have very few base mismatches. For example, nucleic acid sequences of fifteen bases in length may be termed complementary when they have a complementary nucleotide at thirteen or fourteen positions with only a single mismatch. Naturally, nucleic acid sequences which are "completely complementary" will be nucleic acid sequences which are entirely complementary throughout their entire length and have no base mismatches.

Other sequences with lower degrees of homology also are contemplated. For example, an antisense construct which has limited regions of high homology, but also contains a nonhomologous region (e.g., a ribozyme) could be designed.

These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions.

While all or part of the exon lb sequence may be employed in the context of antisense construction, short oligonucleotides are easier to make and increase in vivo accessibility. However, both binding affinity and sequence specificty of an antisense oligonucleotide to its complementary target increases with increasing length. One can readily determine whether a given antisense nucleic acid is effective at targeting of the corresponding host cell gene simply by testing the constructs in vitro to determine whether the function of the endogenous gene is affected or whether the expression of related genes having complementary sequences is affected.

In certain embodiments, one may wish to employ antisense constructs which include other elements, for example, those which include C-5 propyne pyrimidines. Oligonucleotides which contain C-5 propyne analogues of uridine and cytidine have been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression. In preferred embodiments, the antisense construct is a protein nucleic acid. Pharmaceutical Compositions

Pharmaceutically Acceptable Carriers Aqueous compositions of the present invention comprise an effective amount of a exon lb encoding nucleic acid or a protein or polypeptide comprising the amino acid sequence of SEQ ID NO:2 agent or antibody specific thereto, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. Aqueous compositions of gene therapy vectors expressing any of the foregoing are also contemplated. The phrases "pharmaceutically or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate.

As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

For human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.

The biological material should be extensively dialyzed to remove undesired small molecular weight molecules and/or lyophilized for more ready formulation into a desired vehicle, where appropriate. The active compounds will then generally be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, subcutaneous, intralesional, or even intraperitoneal routes. The preparation of an aqueous composition that contains a exon lb encoding nucleic acid or a protein or polypeptide comprising the amino acid sequence of SEQ ID NO:2 agent as an active component or ingredient will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extempraneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

A protein, polypeptide, antibody, agonist or antagonist of the present invention can be formulated into a composition in a neutral or salt form.

Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.

The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, an liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.

The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

In terms of using polypeptide therapeutics as active ingredients, the technology of U.S. Patents 4,6-8,251 ; 4,601,903; 4,559,231; 4,559,230; 4,596,792; and 4,578,770, each incorporated herein by reference, may be used.

The preparation of more, or highly, concentrated solutions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small tumor area.

Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intrperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15^th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

The active polypeptides or agents may be formulated within a therapeutic mixture to comprise about 0.0001 to 1.0 milligrams, or about 0.001 to 0.1 milligrams, or about 0.1 to 1.0 or even about 10 milligrams per dose or so. Multiple doses can also be administered.

In addition to the compounds formulated for parenteral administration, such as intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g., tablets or other solids for oral administration; liposomal formulations; time release capsules; and any other form currently used, including cremes.

One may also use nasal solutions or sprays, aerosols or inhalants in the present invention. Nasal solutions are usually aqueous solution designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, the aqueous nasal solution usually are isotonic and slightly buffered to maintain a pH of 5.5 to 6.5.

In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, and appropriate drag stabilizers, if required, may be included in the formulation. Various commercial nasal preparations are known and include, for example, antibiotics and antihistamines and are used for asthma prophylaxis.

Additional formulatins which are suitable for other modes of administration include vaginal suppositories and pessaries. A rectal pessary or suppository may also be used.

Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum, vagina or the urethra. After insertion, suppositories soften, melt or dissolve in the cavity fluids.

In general, for suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably l%-2%.

Vaginal suppositories or pessaries are usually globular or oviform and weighing about 5 g each. Vaginal medications are available in a variety of physical forms, e.g., creams, gels or liquids, which depart from the classical concept of suppositories. Vaginal tablets, however, do meet the definition, and represent convenience both of administration and manufacture.

Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, mangesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.

In certain defined embodiments, oral pharmaceutical compositions will comprise an inert diluent or assimible edible carrier, or they may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet. For oral therapeutic administration, the active compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 75% of the weight of the unit, or preferably between 25- 60%. The amount of active compounds in such therapeutically useful composition is such that a suitable dosage will be obtained.

The tablets, troches, pills, capsules and the like may also contain the following: a binder, as gum tragacanth, acacia, cornstarch, or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid an the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin may be added or a flavoring agent, such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to material of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup of elixir may contain the active compounds sucrose as a sweetening agent methyl and propylparabens as preservatives, a dye and flavoring, such as cherry or orange flavor.

It will naturally be understood that suppositories, for example, will not generally be contemplated for use in treating breast cancer. However, in the event that the proteins, polypeptides or other agents of the invention, or those identified by the screening methods of the present invention, are confirmed as being useful in connection with other forms of cancer, then other routes of administration and pharmaceutical compositions will be more relevant. As such, suppositories may be used in connection with colon cancer, inhalants with lung cancer and such like. Liposomes and Nanocapsules In certain embodiments, the use of liposomes and/or nanoparticles is contemplated for the introduction of polypeptides or agents, or gene therapy vectors, including both wild-type and antisense vectors, into host cells. The formation and use of liposomes is generally known to those of skill in the art, and is also described below. Nanocapsules can generally entrap compounds in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles sized around 0.1 μm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use in the present invention, and such particles may be are easily made. Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously from multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs). MLVs generally have diameters of from 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 A, containing an aqueous solution in the core.

The following information may also be utilized in generating liposomal formulations. Phospholipids can form a variety of structures other than liposomes when dispersed in water, depending on the molar ratio of lipid to water. At low ratios the liposome is the preferred structure. The physical characterisics of liposomes depend on pH, ionic strength and the presence of divalent cations.

Liposomes can show low permeability to ionic and polar substances, but at elevated temperatures undergo a phase transition which markedly alters their permeability. Th phase transition involves a change from a closely packed, ordered structure, known as the gel state, to a loosely packed, less-ordered structure, known as the fluid state. This occurs at a characteristic phase-transition temperature and results in an increase in permeability to ions, sugars and drugs.

Liposomes ^'interact with cells via four different mechanisms: Endocytosis by phagocytic cells of the reticuloendothelial system such as macrophages and neutrophils; adsoprtion to the cell surface, either by nonspecific weak hydrophobic or electrostatic forces, or by specific interactions with cell-surface components; fusion with the plasma cell membrane by insertion of the lipid bilayer of the liposome into the plasma membrane, with simultaneous release of liposomal contents into the cytoplasm; and by transfer of liposomal lipids to cellular or subcellular membranes, or vice versa, without any association of the liposome contents. Varying the liposome formulation can alter which mechanism is operative, although more than one may operate at the same time. Human p37'^ngl

Although the inventors primarily describe the structure of the mouse p37^ιngl gene, the inventors also disclose herein the nucleic acid sequence of the human p37 ^gl cDNA (ATCC ACC. NO. AF044076 (SEQ ID NO:6)) along with the amino acid sequence of the encoded polypeptide (GenPept ACC. NO. 2829208

(SEQ ID NO: 7)). Furthermore, one of skill in the art would understand that the embodiments of the present invention, while described mainly as compositions and methods for utilizing or detecting mouse p37^ιngl, also includes compositions and methods for utilizing or detecting human p37^ιngl. For example, rather than utilizing a nucleic acid encoding the amino acid sequence unique to the mouse p37^mgl (SEQ ID NO:2), one may wish to instead utilize the amino acid sequence unique to the human p37^mgl (SEQ ID NO: 10).

The following examples are included to demonstrate preferred embodiments. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes of practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1

Multiple transcripts of the mouse ingl gene differ in their 5 '-end sequences

In order to isolate the mouse orthologue of the INGl gene, a cDNA library prepared from senescent mouse embryonic fibroblasts was screened using human

INGl as a probe. As a result, several clones were isolated, and the longest two were sequenced. The clones were identical to each other and highly similar to human INGl through most of their length except for the 5' ends which were different and not homologous to the human gene (FIG. 1). To determine the structure of 5 '-end sequences of ingl, a 5 '-RACE technique was used for the isolation of cDNA sequences corresponding to the 5'- termini of ingl mRNA. cDNA was synthesized from mouse spleen and brain mRNA, and ligated to synthetic adaptors. PCR was performed on the cDNA using a sense primer specific for the adaptor and an antisense primer specific for the common part of ingl located close to the divergent region. Two fragments of different size were obtained and cloned, sequenced, and compared to the clones isolated from the cDNA library. The results of this comparison are schematically presented in FIG. 1. One of the 5 '-RACE products was identical to one of the previously isolated cDNA clones. Another product revealed the third variant of ingl cDNA, which again consisted of common and unique regions with the junction located exactly at the same position as in the other sequences. FIG. 1 shows schematic alignments of the isolated mouse ingl cDNA clones and the 5' RACE products. All variants are identical to each other (and homologous to human INGl) up to the same nucleotide, and different only in their 5' ends.

In order to verify that the obtained cDNA structure reflects naturally existing transcripts, ingl mRNA species were analyzed by Northern hybridization using probes representing common or specific regions of isolated cDNAs. As shown in FIG. 2, the probe for the common region revealed multiple transcripts in

RNA isolated from mouse liver, heart, and testis. Probes specific for individual transcripts, however, showed more simple hybridization patterns, which in combination covered the whole set of transcripts found by hybridization with the common probe. These results indicated that the cloned sequences represent the majority of multiple transcripts of ingl synthesized in the thymus and spleen.

Mapping of coding regions of ingl in mouse genomic DNA

Comparison of sequences of individual cDNA clones showed differences in their 5'-regions suggesting that ingl has multiple alternative 5'-exons (FIG. 1).

Subsequently, the structure of the mouse ingl gene was determined. Phage clones carrying sequences homologous to the mouse ingl cDNA were isolated by hybridization screening of a mouse genomic library. These clones were mapped by restriction digestion analysis, in combination with Southern blot hybridization, with the probes corresponding to the different ingl parts. The interpretation of the obtained results is shown in FIG. 3. Southern blot hybridization analysis of ingl -related sequences in the mouse genome indicated that ingl is a single gene with no obvious close family members. Comparison of genomic and cDNA sequences of ingl using PCR with different ingl specific primers, as well as with the sequencing data, showed that most of the transcribed sequences of the ingl gene come from a single exon. Alternative 5' ends are encoded by different exons positioned upstream from the common exon. Comparison of the sequences of cDNA and genomic clones, as well as 5' RACE products, revealed three isoforms of mouse ingl that differ from each other only in their 5' ends.

The length of the isolated cDN A clones appeared to be significantly shorter than that of the mRNA species detected by Northern hybridization (FIG. 2), suggesting that part of the transcribed sequences were missing from the isolated cDNAs. To determine the exact start sites of ingl transcription, "SMART-based 5'RACE" was used to extend the cDNA sequences for the 5'end of isoform lb. This exon contains an extremely G/C rich region that may have resulted in the incomplete sequence obtained from the original 5 '-RACE (FIG. 4).

Comparing the 3 'ends of human and mouse INGl cDNAs showed that although the mouse transcript was flanked by a poly (A) stretch, its 3 '-untranslated region was significantly shorter than the human one. Analysis of the genomic clone with the mouse ingl sequence revealed the presence of a long poly(A) stretch that could potentially be used as a primer-binding sequence for reverse transcription initiated from oligo(dT) primers. Moreover, the alignment with the 3' end of the human INGl cDNA sequence resumes downstream from this genomic polyA stretch. The exact end of ingl transcription in mouse was determined using the same method applied for the generation of 5 '-sequences. Mouse ingl cDNA was in fact found to be longer than was originally thought

(FIG. 4). Sequence comparison showed that mouse and human INGl transcripts terminate at the same point, and share significant levels of similarity up to the very

3' ends.

Sequence analysis of ingl

Nucleotide and predicted amino acid sequences of the three mouse ingl cDNA isoforms and the promoter regions for all three alternative transcripts are shown in FIG. 5 and FIG. 6. It was found that the la and lc ingl isoforms have several tightly clustered transcription start sites. Sequences upstream of the initiation sites (putative promoters) lack TATA boxes, but they do contain a sequence corresponding to the loose initiator (Inr) consensus PyPyANT/APyPy that includes the transcription start sites (FIG. 5). In both cases, areas upstream from the Inr are extremely GC-rich with multiple Spl-binding sites. All of these features are typical for TATA-less promoters.

Transcription of the ingl isoform lb starts approximately 30 nucleotides downstream from the TATA-like box. A putative CAAT box is present 60 nucleotides upstream from the TATA-like sequence. Since the transcription initiation sites for the la and lb isoforms are only about 200 bp apart, there is a possibility that their promoters share some of the regulatory sequences including, for example, a number of Spl binding sites located upstream from this area.

All three alternative transcripts of mouse ingl contain the same long open reading frame, although the sizes of the predicted proteins are different. While isoform lb encodes a protein of 279 amino acids, the other two isoforms are encode a shorter protein product of 175 amino acids, which lacks 104 N-terminal amino acids. Translation of these two products starts from the initiation codon, which is located in the beginning of the common exon. Alignment of the predicted amino acid sequences with that of human p33^ING1 (GenBank accession number AF044076) revealed high similarity between the mouse and human proteins (89% sequence identity) (FIG. 7a). At the nucleotide level, sequence similarity between the human and mouse cDNAs was high throughout the whole coding regions and much lower in the 3 '-untranslated region that contained, however, several conserved stretches of nucleotides (FIG. 7b). Expression of ingl transcripts in adult and embryonic mouse tissues

The expression of ingl mRNA in the organs of adult mice and mouse embryos at different stages of development was analyzed by Northern blot hybridization. The probe representing the common exon of the ingl gene revealed multiple mRNA size classes that represent alternative transcripts of ingl (FIG. 8).

The overall ingl mRNA expression is most abundant in thymus and testis; much lower levels were detected in the rest of the tissues tested that also differed in the content and relative intensity of the hybridizing bands. In embryos, the highest expression was found on the 11th day of development and was characterized by changes in the relative expression of different classes of mRNA transcripts.

Patterns of ingl expression in embryogenesis were also checked by in situ hybridization. Embryonic sections were fixed on a nitrocellulose membrane, and then hybridized with the RNA probes corresponding to the common part of the ingl cDNA. Besides sense and antisense ingl specific RNA probes, an antisense probe for β-actin, a gene with ubiquitous expression, also was used as an internal standard. Sections were prepared from 10-, 12-, 16- and 18-day embryos. Ingl is uniformly expressed in the whole mouse embryo at all stages of development examined. This is in agreement with the result obtained with the adult mouse tissues, where ingl is expressed ubiquitously and at similar levels in all analyzed organs. However, at embryonic day 10 higher expression levels were observed in the yolk sac, while at day 16 and 18 of development, higher levels of expression were detected in inner compartments of bones and probably match areas of ongoing ossification.

In order to determine patterns of expression of different ingl transcripts in mouse tissues and during embryogenesis, Northern blots were hybridized with probes corresponding to the alternative starts of ingl (FIG.8). The lb and lc variants were expressed ubiquitously in all adult mouse tissues tested, with the highest levels in thymus. Both variants were expressed in the embryos at all stages of development analyzed, with the highest levels at day 7 in the case of lc, or day 11 in the case of the lb variant. Out of all adult tissues analyzed, mRNA for isoform la was expressed only in testis; it was also seen in the 11-day embryo. While there is no detectable signal with the la specific probe in the 7 day embryo, traces of hybridization could be detected in mRNA from day 15 and day 17 embryos, which indicates an extremely low expression level at these points of mouse embryogenesis.

Expression of the mouse ingl gene in cell lines depends on cell proliferation

To determine whether ingl expression was cell cycle dependent, RNA from two mouse cell lines, NMuMG and 10(1), at different stages of the cell cycle were analyzed by Northern blot hybridization using total ingl cDNA as a probe. Ingl expression was also compared in senescent versus young, dividing mouse embryonic fibroblasts. In both cell lines, ingl was expressed at higher levels in dividing compared to quiescent cells (quiescence is induced either by serum starvation, contact inhibition, or γ-irradiation). However, in 10(1) cells the difference in expression was specific only for the upper ingl specific band, which corresponds to the lb variant. In mouse embryonic fibroblasts ingl was expressed at very low levels without any differences between dividing and senescent cells.

Ingl expression in cell lines was also analyzed by Western blotting using an IgGl mouse monoclonal antibody produced against human recombinant p33^1NG1. This antibody has previously been shown to specifically detect the denatured form of mouse p33^ING1 protein in Western immunoblot protocols. Cell lysates were produced from dividing, contact inhibited, seram starved, or γ- irradiated 10(1) and NMuMG cells. Also, as a control, cell lysates were prepared from BOSC23 cells transfected with the mouse lb ingl variant or with the human truncated form of INGl that should give the protein product of the same size as mouse lc and la variants, respectively. In both cell lines, two protein products were detected, 31kD and 38kD in size, which correspond to the truncated INGl and lb ingl protein products respectively. The 38kD protein was present at the same levels in dividing and quiescent cells, while the 33kD protein was present at higher levels in dividing compared to non-dividing cells. MATERIALS AND METHODS

Animals

Organs and embryos of FVB/N mice were used for the RNA isolation and preparation of whole-body sections of embryos using cryostatic microtome for histo-blot hybridization.

Cell lines

Cultures of mouse embryonic fibroblasts were obtained from 10 day-old embryos. 10(1) cell line is a derivative of Balb 3T3 cells that spontaneously deleted both p53 alleles (Harvey and Levine, 1991). NMuMG is a pseudonormal mouse mammary gland epithelial cell line. BOSC23 is an ecotropic retroviral packaging cell line (Pear et al, 1993). All cells were maintained in Dulbecco's modified Eagle medium containing 10% fetal bovine serum supplemented with penicillin and streptomycin. For the seram starvation experiments, 10(1) and NMuMG cells were kept with 0.5% fetal bovine seram for 48 hours (NMuMG cells) or 36 hours (10(1) cells). For the contact inhibition experiments, cells cultures were used 48 hours (NmuMG) or 36 hours (10(1)) after they became confluent. NMuMG and 10(1) cells were irradiated with 10 Gy of γ-radiation and used 24 hours after treatment. Mouse embryo fibroblasts were propagated until they reached senescence. Plasmids and libraries

Retroviral vector pLXSN was used for the introduction of mouse and human INGl cDNA in NMuMG and 10(1) cells (Miller and Rosman, 1989). A cDNA library from senescent mouse embryonic fibroblasts was constructed using Superscript system (Gibco BRL) according to the manufacturer's protocol, and cloned into the lambda phage λ gt22A vector. Stratagene' s 129SVJ Mouse

Genomic Library cloned into the Lambda FIX II vector was used for the isolation of the mouse genomic, ingl containing, clones. Hybridization screening of cDNA and genomic libraries cDNA and genomic library screenings were done according to the standard protocols (Sambrook et al, 1989) using ³²P-labeled human and mouse ingl cDNA probes, respectively. 5' and 3' RACE

Alternative 5' ends of the mouse ingl were isolated from mouse spleen and mouse brain cDNAs using the Marathon-ready cDNA kit (CLONTECH Laboratories), according to the protocol suggested by the manufacturer. API adaptor- specific sense primer, provided by CLONTECH, and the ingl -specific antisense primer (5' - CCATCTGACTCACGATCTGGATCTTC - 3') (SEQ ID

NO: 11) were used for PCR. Nested PCR was performed using AP2 adaptor- specific sense primer, provided by CLONTECH, and ingl -specific antisense primer (5'-CTGCGGATCAGGGCCCTCTGGATGC-3') (SEQ ID NO: 12). Precise determination of the 5' and 3' ends of the mouse ingl transcripts was done using the Marathon-2 cDNA Amplification kit based on the new SMART PCR cDNA synthesis technology (CLONTECH). It is based on the recently identified ability of M-MLV reverse transcriptase to add several nucleotides to the 3'- terminus of first-strand cDNA during the RT reaction (Chenchik et al, 1998). Briefly, when reverse transcriptase reaches the 5 'end of the mRNA, it switches templates and continues synthesizing the SMART template- switching (TS) oligonucleotide. The resulting single-stranded cDNA contains the complete 5 'end of the mRNA as well as the sequence complementary to the TS oligonucleotide and is then selectively amplified by PCR. In these experiments, poly(A) RNA preparations isolated from the thymus and testis were used. The following sequences were used for the synthesis of antisense -specific primers:

5'-AGGTGTGGTGGGATCGGCAACGC-3' (isoform la) (SEQ ID NO: 13) 5'-CGCGGGGAGCCAGAGCAGAGAAGGT-3' (isoform lc) (SEQ ID NO: 14)

5'-GGCGTGGCCTGTCATTGTCGCTG-3' (isoform lb) (SEQ ID NO: 15) Ingl -specific sense primer 5'-GCGTGCTTCTTGCTACCAT-3' (SEQ ID NO: 16) was used for the PCR amplification of the 3' end.

Sequence analysis

Sequencing was done using a Sequenase Version 2.0 DNA Sequencing Kit (USB), or by the University of Chicago Cancer Research Center DNA Sequencing

Facility. In all cases, both strands were read using multiple vector-specific or gene-specific primers. Protein sequence database searches were performed using the gapped BLASTP program and the PSI-BLAST program that iterates the search using profiles constructed from BLAST hits as queries for subsequent iterations (Altschul et al, 1997). Multiple sequence alignments were constructed using the

Gibbs sampling option of the MACAW program (Neuwald et al, 1995; Schuler et al, 1991). Southern, Northern, and Western analysis

Southern, northern, and western analyses were done according to standard protocols. IgGl mouse monoclonal antibody against human recombinant pSS¹¹""³¹

(Garkavtsev et al, 1997) was used for the detection of ingl -encoded proteins.

In situ hybridization ("histo-blotting")

Whole-body sections, 20 μm thick, were prepared from frozen embryos embedded in blocks of Tissue-Tek O.C.T. and stored at -70°C. Sections were placed on nitrocellulose (Schleicher&Schuell) to prepare "histo-blots"( Gudkov et al, 1989). Histo-blots were hybridized with ³³P-labeled RNA probes synthesized using Ambion's MAXIscript In vitro Transcription Kit. Ingl specific sense and antisense probes were synthesized on the pBLUESCRIPT plasmid with the fragment of ingl cDNA corresponding to the PHD finger domain using T3 polymerase for the antisense and T7 polymerase for the sense probe, β-actin antisense RNA was synthesized using the template provided by Ambion. Histo- blots were incubated in pre-hybridization solution (0.75 mg/ml yeast tRNA, 0.75 mg/ml poly(A), 50% formamide, 0.3M Tris pH 8.0, lmM EDTA, 5x Denhardt's solution, 10% Dextran sulfate, lOmM DTT) at 42°C for 1-4 hours. Hybridization was carried out for 12-24 hours at 42°C in the same solution containing 1-5 x 10⁷cpm of probe per ml. After hybridization, histoblots were washed in 4x SSC at room temperature for 20 min, in 2x SSC, 0.04 μg/ml RNase A at 37°C for 30 min, in 2x SSC at 37°C for 30 min, in lx SSC at 60°C for 15-30 min and finally in 0. lx

SSC at 60°C for 15-30 min. and exposed to X-ray film for 2-7 days.

EXAMPLE 2

Direct demonstration of p53 suppressing activity of p37^ING1

Ectopic expression of p53 is cytotoxic or cytostatic for many cell types due to the induction of apoptosis or growth arrest. Experimentally, cell sensitivity to p53 can be tested by colony formation assay on target cells transfected or transduced with recombinant constructs expressing p53. To show that p37^1NG1 could suppress anti-proliferative effect of p53, p53-sensitive 10(1) cells (p53- deficient Balb/3T3 cells) were transfected with pPS-Hygro-p53wt vector carrying cDNA for wild type human p53 in combination with either pL(p37^ING1)SN (vector expressing p37^ING1 along with a hygromycin resistance gene) or pLXSN (control vector) followed by selection on hygromycin. Approximately 40 times more hygromycin resistant colonies appeared in the plates transfected with the vector expressing p37^ING1 than with control vector indicating that p37 ^G1 protects cells from growth inhibition by wild type p53.

EXAMPLE 3

p37^ING1 physically interacts with p53

Immunoprecipitation experiments were carried out in the lysates of human breast carcinoma cell line MCF7 expressing wild type p53. Methods were similar to those used in Garkavtsev et al., 1998. Briefly, p53 was precipitated from the lysate of MCF7 cells with a mixture of anti-p53 monoclonal antibodies DO-1 and

421 and protein A sepharose. The resulting precipitate was washed, dissolved in loading buffer and used for western immunoblotting. Blots were stained by monoclonal antibodies against p33^1NG1 (Garkavtsev et al., 1997). p37^ING1 was shown to be highly enriched in the precipitate indicating that it exists in the cells in the form of a complex with p53.

REFERENCES

U.S. Patent No. 4,196,265, issued Aug. 11, 1978. U.S. Patent No. 4,474,892, issued Oct. 2, 1984. U.S. Patent No. 4,554,101, issued Nov. 19, 1985. U.S. Patent No. 5,192,660, issued Mar. 9, 1993.

U.S. Patent No. 5,567,595, issued Oct. 22, 1996. U.S. Patent No. 5,629,197, issued May 13, 1997. U.S. Patent No. 5,736,348, issued Apr. 7, 1998. U.S. Patent No. 5,744,319, issued Apr. 28, 1998. Altschul et al, "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs," Nucleic Acids Res. 25:3389-3402, 1997. Antibodies: A Laboratory Manual, Cold Springs Harbor Laboratory, 1988. Bratlag et βb, CABIOS, 6:237-245, 1990.

Campbell, In: Monoclonal Antibody Technology, Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 13, Burden and Von

Knippenberg, Eds. Pp. 75-83, Amsterdam, Elsview, 1984. Chenchik et al, "Generation and use of high-quality cDNA from small amounts of total RNA by SMART™ PCR," In Gene cloning and analysis bv RT-PCR,

(ed. P. D. Siebert and J. W. Larrick), BioTechniques Books, 305-319, 1998.

Chou and Fasman, "Conformational Parameters for Amino Acids in Helical, β-

Sheet, and Random Coil Regions Calculated from Proteins," Biochemistry,

13(2):211-222, 1974b. Chou and Fasman, "Prediction of b-Turns," Biophys. J., 26:367-384, 1979. Chou and Fasman, "Prediction of Protein Conformation," Biochemistry,

13(2):222-245, 1974a. Chou and Fasman, "Prediction of the Secondary Structure of Proteins from Their

Amino Acid Sequence," Ad . Enzymol. Relat. Areas Moi. Biol, 47:45-148, 1978a.

Chou and Fasman, Empirical Predictions of Protein Conformation," Ann. Rev.

Biochem., 47:251-276, 1978b. Fetrow and Bryant, "New Programs for Protein Tertiary Structure Prediction,"

Biotech., 11:479-483, 1993 Garkavtsev et al., "Specific monoclonal antibody raised against the p33^ING1 tumor suppressor," Hybridoma 16:537-540, 1997. Garkavtsev et al, Nαtwre.391(6664):295-8, 1998. Gefter et al, Somatic Cell Genet., 3(2): 231-236, 1977.

Goding, "Monoclonal Antibodies: Principles and Practice," 2nd Edition, Academic Press, Orlando, FL, pp. 60-74, 1986.

Goding, In: Monoclonal Antibodies: Principles and Practice, 2d ed., Orlando,

Fla., Academic Press, pp. 60-61, 65-66, 71-74, 1986 Gudkov et al, "Histo-blotting: hybridization in situ detection of specific RΝAs on tissue sections transferred on nitrocellulose," Int. J. Cancer 44: 1052-1056, 1989.

Harvey and Levine, "p53 alteration is a common event in the spontaneous immortalization of primary B ALB/c murine embryo fibroblasts," Gen. Dev.

5:2375-2385, 1991. Inouye S, et al., Nucleic Acids Res., 13(9): 3101-3110, 1085. Jameson and Wolf, "The Antigenic Index: A Novel Algorithm for Predicting

Antigenic Determinants," Comput. Appl. Biosci., 4(1):181-186, 1988. Kasahara et al., "Tissue-specific targeting of retroviral vectors through ligand- receptor interactions,"Sc-ence. 266(5189):1373-6, 1994. Kyte & Doolittle, J. Moi. Biol, 157: 105-132, 1982. Miller and Rosman, "Improved retroviral vectors for gene transfer and expression," BioTechniques 7:980-986, 1989. Miller, Curr. Top. Microbiol Immunol, 158: 1, 1992.

Nakamura et al., In: Enzyme Immunoassays: Heterogeneous and Homogeneous

Systems, Chapter 27. Neuwald et al, "Gibbs motif sampling: detection of bacterial outer membrane protein repeats," Protein Sci. 8:1618-1632, 1995.

Nicholson, Nature Biotech., 14:297-301, 1996. Pear et al., "Production of high titer helper-free retrovirases by transient transfection," Proc. Natl. Acad. Sci. USA 90:8392-8396, 1993. Remington's Pharmaceutical Sciences, 15^th Edition, pages 1035-1038 and 1570- 1580.

Sambrook et al, Molecular cloning: a laboratory manual, 2^nd ed. Cold Spring

Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Schuler et al, "A workbench for multiple alignment construction and analysis,"

Proteins 9:180-190, 1991. Weinberger et al., Science, 228:740-742, 1985.

Wong et al., "Appearance of β-lactamase activity in animal cells upon liposome mediated gene transfer," Gene, 10:87-94, 1980.

Claims

1. A method of detecting a nucleic acid encoding exon lb of ingl, said method comprising:

(a) contacting a sample suspected of containing a nucleic acid encoding exon lb of ingl with an isolated nucleic acid comprising a contiguous nucleic acid sequence of exon lb of ingl, its complement, or a functional equivalent thereof;

(b) incubating the sample and the isolated nucleic acid under conditions effective to allow hybridization of substantially complementary nucleic acids; and

(c) detecting the hybridized complementary nucleic acids thus formed.

2. The method of claim 1, wherein the contiguous nucleic acid sequence of exon lb of ingl comprises a contiguous nucleic acid sequence of SEQ ID NO: l .

3. The method of claim 1, wherein the contiguous nucleic acid sequence of exon lb of ingl comprises a contiguous nucleic acid sequence of a human exon lb of ingl.

4. The method of claim 1, wherein the isolated nucleic acid comprises a label.

5. A method of detecting a polypeptide comprising amino acids unique to p37^ING1, said method comprising:

(a) contacting a sample suspected of containing a polypeptide comprising amino acids unique to p37^ING1 with an antibody that is immunoreactive with the polypeptide; and (b) detecting the antibody bound to the polypeptide comprising amino acids unique to p37^ING1.

6. The method of claim 5, wherein the antibody is immunoreactive with a polypeptide comprising a contiguous amino acid sequence of SEQ ID NO:2.

7. The method of claim 5, wherein the antibody is immunoreactive with a polypeptide comprising a contiguous amino acid sequence of SEQ ID NO:10.

8. The method of claim 5 or 6, wherein the antibody is a monoclonal antibody.

9. The method of claim 8, wherein the antibody comprises a label.

10. A method of detecting a transformed cell, said method comprising:

(a) contacting a sample comprising nucleic acid from the cell with an isolated nucleic acid comprising a contiguous nucleic acid sequence of exon lb of ingl, its complement, or a functional equivalent thereof;

(b) incubating the sample and the isolated nucleic acid under conditions effective to allow hybridization of substantially complementary nucleic acids; and

(c) detecting the hybridized complementary nucleic acids thus formed, wherein detection of the hybridized nucleic acids is indicative of a transformed cell.

11. The method of claim 10, wherein the contiguous nucleic acid sequence of exon lb of ingl comprises a contiguous nucleic acid sequence of SEQ ID NO:l.

12. The method of claim 10, wherein the contiguous nucleic acid sequence of exon lb of ingl comprises a contiguous nucleic acid sequence of a human exon lb of ingl .

13. The method of claim 10, wherein the transformed cell is of an origin selected from the group consisting of the brain, head, neck, mammary, lung, colon, skin, melanoma, testicular, ovarian, cervical, prostate, bone or blood.

14. The method of claim 14, wherein the transformed cell is leukemic.

15. The method of claim 10, wherein the transformed cell is wild-type for p53.

16. A method of detecting a transformed cell, said method comprising:

(a) contacting a sample comprising polypeptides from the cell with an antibody immunoreactive with a polypeptide comprising a contiguous amino acid sequence of SEQ ID NO:2; and

(b) detecting the antibody bound to the polypeptide comprising a contiguous amino acid sequence of SEQ ID NO:2, wherein detection of the antibody bound to a polypeptide is indicative of a transformed cell.

17. A method of detecting a transformed cell, said method comprising:

(a) contacting a sample comprising nucleic acid from the cell with:

(i) a first primer comprising a contiguous nucleic acid sequence of SEQ ID NO:l or a functional equivalent thereof;

(ii) a second primer comprising a contiguous nucleic acid sequence of a complement of SEQ ID NO:3 or a functional equivalent thereof; (iii) a third primer comprising a contiguous nucleic acid sequence of SEQ ID NO:4 or a functional equivalent thereof,

(b) performing a polymerase chain reaction to produce an amount of product of the first and second primers and an amount of product of the third and second primers; and

(c) determining a ratio between the amount of product of the first and second primers and the amount of product of the third and second primers.

18. The method of claim 17 comprising a fourth primer comprising a contiguous nucleic acid sequence of SEQ ID NO: 5 or a functional equivalent thereof.

19. A method of detecting a transformed cell, said method comprising:

(a) contacting a sample comprising nucleic acid from the cell with:

(i) a first primer comprising a contiguous nucleic acid sequence of a complement of SEQ ID NO: 1 or a functional equivalent thereof;

(ii) a second primer comprising a contiguous nucleic acid sequence of SEQ ID NO:3 or a functional equivalent thereof;

(iii) a third primer comprising a contiguous nucleic acid sequence of a complement of SEQ ID NO:4 or a functional equivalent thereof,

(b) performing a polymerase chain reaction to produce an amount of product of the first and second primers and an amount of product of the third and second primers; and (c) determining a ratio between the amount of product of the first and second primers and the amount of product of the third and second primers.

20. The method of claim 19 comprising a fourth primer comprising a contiguous nucleic acid sequence of a complement of SEQ ID NO:5 or a functional equivalent thereof.

21. A kit for detecting a transformed cell comprising:

(a) a first primer comprising a contiguous nucleic acid sequence of SEQ ID NO: 1 or a functional equivalent thereof;

(b) a second primer comprising a contiguous nucleic acid sequence of a complement of SEQ ID NO:3 or a functional equivalent thereof; and

(c) a third primer comprising a contiguous nucleic acid sequence of SEQ ID NO:4 or a functional equivalent thereof.

22. A kit for detecting a transformed cell comprising:

(a) a first primer comprising a contiguous nucleic acid sequence of a complement of SEQ ID NO:l or a functional equivalent thereof;

(b) a second primer comprising a contiguous nucleic acid sequence of SEQ ID NO:3 or a functional equivalent thereof; and

(c) a third primer comprising a contiguous nucleic acid sequence of a complement of SEQ ID NO:4 or a functional equivalent thereof.

23. An isolated nucleic acid comprising a contiguous nucleic acid sequence of exon lb of ingl, its complement, or a functional equivalent thereof.

24. An isolated polypeptide comprising a contiguous amino acid sequence unique to p37^ING1 or a functional equivalent thereof.

25. The isolated polypeptide of claim 24, wherein the contiguous amino acid sequence comprises SEQ ID NO:2.

26. The isolated polypeptide of claim 24, wherein the contiguous amino acid sequence comprises SEQ ID NO: 10.

27. A composition comprising an antibody immunoreactive with a polypeptide of claim 24, claim 25, or claim 26.

28. A kit comprising a nucleic acid of claim 23.

29. A kit comprising a polypeptide of claim 24, claim 25, or claim 26.

30. A kit comprising an antibody of claim 27.