WO2000042205A2 - Herbicide target gene and methods - Google Patents
Herbicide target gene and methods Download PDFInfo
- Publication number
- WO2000042205A2 WO2000042205A2 PCT/EP2000/000246 EP0000246W WO0042205A2 WO 2000042205 A2 WO2000042205 A2 WO 2000042205A2 EP 0000246 W EP0000246 W EP 0000246W WO 0042205 A2 WO0042205 A2 WO 0042205A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- activity
- plant
- protein
- group
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
Definitions
- the invention relates to genes isolated from Arabidopsis that code for proteins essential for seedling growth.
- the invention also includes the methods of using these proteins as an herbicide target, based on the essentiality of the gene for normal growth and development.
- the invention is also useful as a screening assay to identify inhibitors that are potential herbicides.
- the invention may also be applied to the development of herbicide tolerant plants, plant tissues, plant seeds, and plant cells.
- Herbicides that exhibit greater potency, broader weed spectrum, and more rapid degradation in soil can also, unfortunately, have greater crop phytotoxicity.
- One solution applied to this problem has been to develop crops that are resistant or tolerant to herbicides. Crop hybrids or varieties tolerant to the herbicides allow for the use of the herbicides to kill weeds without attendant risk of damage to the crop. Development of tolerance can allow application of a herbicide to a crop where its use was previously precluded or limited (e.g. to pre-emergence use) due to sensitivity of the crop to the herbicide.
- U.S. Patent No. 4,761 ,373 to Anderson et al. is directed to plants resistant to various imidazolinone or sulfonamide herbicides.
- acetohydroxyacid synthase (AHAS) enzyme confers the resistance.
- U.S. Patent No. 4,975,374 to Goodman et al. relates to plant cells and plants containing a gene encoding a mutant glutamine synthetase (GS) resistant to inhibition by herbicides that were known to inhibit GS, e.g. phosphinothricin and methionine sulfoximine.
- U.S. Patent No. 5,013,659 to Bedbrook et al. is directed to plants expressing a mutant acetolactate synthase that renders the plants resistant to inhibition by sulfonylurea herbicides.
- U.S. Patent No. 5,162,602 to Somers et al. discloses plants tolerant to inhibition by cyclohexanedione and aryloxyphenoxypropanoic acid herbicides. The tolerance is conferred by an altered acetyl coenzyme A carboxylase (ACCas
- Chimeric is used to indicate that a DNA sequence, such as a vector or a gene, is comprised of more than one DNA sequences of distinct origin which are fused together by recombinant DNA techniques resulting in a DNA sequence, which does not occur naturally, and which particularly does not occur in the plant to be transformed.
- Co-factor natural reactant, such as an organic molecule or a metal ion, required in an enzyme-catalyzed reaction.
- a co-factor is e.g. NAD(P), riboflavin (including FAD and FMN), folate, molybdopterin, thiamin, biotin, lipoic acid, pantothenic acid and coenzyme A, S- adenosylmethionine, pyridoxal phosphate, ubiquinone, menaquinone.
- a co- factor can be regenerated and reused.
- DNA shuffling is a method to rapidly, easily and efficiently introduce mutations or rearrangements, preferably randomly, in a DNA molecule or to generate exchanges of DNA sequences between two or more DNA molecules, preferably randomly.
- the DNA molecule resulting from DNA shuffling is a shuffled DNA molecule that is a non- naturally occurring DNA molecule derived from at least one template DNA molecule.
- the shuffled DNA encodes an enzyme modified with respect to the enzyme encoded by the template DNA, and preferably has an altered biological activity with respect to the enzyme encoded by the template DNA.
- Enzyme activity means herein the ability of an enzyme to catalyze the conversion of a substrate into a product.
- a substrate for the enzyme comprises the natural substrate of the enzyme but also comprises analogues of the natural substrate, which can also be converted, by the enzyme into a product or into an analogue of a product.
- the activity of the enzyme is measured for example by determining the amount of product in the reaction after a certain period of time, or by determining the amount of substrate remaining in the reaction mixture after a certain period of time.
- the activity of the enzyme is also measured by determining the amount of an unused co-factor of the reaction remaining in the reaction mixture after a certain period of time or by determining the amount of used co-factor in the reaction mixture after a certain period of time.
- the activity of the enzyme is also measured by determining the amount of a donor of free energy or energy-rich molecule (e.g. ATP, phosphoenolpyruvate, acetyl phosphate or phosphocreatine) remaining in the reaction mixture after a certain period of time or by determining the amount of a used donor of free energy or energy-rich molecule (e.g. ADP, pyruvate, acetate or creatine) in the reaction mixture after a certain period of time.
- a donor of free energy or energy-rich molecule e.g. ATP, phosphoenolpyruvate, acetyl phosphate or phosphocreatine
- Expression refers to the transcription and/or translation of an endogenous gene or a transgene in plants.
- expression may refer to the transcription of the antisense DNA only.
- Gene refers to a coding sequence and associated regulatory sequences wherein the coding sequence is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA.
- regulatory sequences are promoter sequences, 5' and 3' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.
- Herbicide a chemical substance used to kill or suppress the growth of plants, plant cells, plant seeds, or plant tissues.
- Heterologous DNA Sequence a DNA sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring DNA sequence; and genetic constructs wherein an otherwise homologous DNA sequence is operatively linked to a non-native sequence.
- Homologous DNA Sequence a DNA sequence naturally associated with a host cell into which it is introduced.
- Inhibitor a chemical substance that causes abnormal growth, e.g., by inactivating the enzymatic activity of a protein such as a biosynthetic enzyme, receptor, signal transduction protein, structural gene product, or transport protein that is essential to the growth or survival of the plant.
- a protein such as a biosynthetic enzyme, receptor, signal transduction protein, structural gene product, or transport protein that is essential to the growth or survival of the plant.
- an inhibitor is a chemical substance that alters the enzymatic activity encoded by the 245 gene, the 5283 gene, the 2490 gene, the 3963 gene or the 4036 gene from a plant. More generally, an inhibitor causes abnormal growth of a host cell by interacting with the gene product encoded by the 245gene, the 5283 gene, the 2490 gene, the 3963 gene or the 4036 gene.
- Iso ⁇ enic plants which are genetically identical, except that they may differ by the presence or absence of a heterologous DNA sequence.
- an isolated DNA molecule or an isolated enzyme in the context of the present invention, is a DNA molecule or enzyme that, by the hand of man, exists apart from its native environment and is therefore not a product of nature.
- An isolated DNA molecule or enzyme may exist in a purified form or may exist in a non-native environment such as, for example, in a transgenic host cell.
- Marker gene a gene encoding a selectable or screenable trait
- Mature protein protein which is normally targeted to a cellular organelle, such as a chloroplast, and from which the transit peptide has been removed.
- Minimal Promoter promoter elements, particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation. In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription.
- Modified Enzyme Activity enzyme activity different from that which naturally occurs in a plant (i.e. enzyme activity that occurs naturally in the absence of direct or indirect manipulation of such activity by man), which is tolerant to inhibitors that inhibit the naturally occurring enzyme activity.
- Plant refers to any plant, particularly to seed plants
- Plant cell structural and physiological unit of the plant, comprising a protoplast and a cell wall.
- the plant cell may be in form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, a plant tissue, or a plant organ.
- Plant material refers to leaves, stems, roots, flowers or flower parts, fruits, pollen, pollen tubes, ovules, embryo sacs, egg cells, zygotes, embryos, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant
- Pre-protein protein which is normally targeted to a cellular organelle, such as a chloroplast, and still comprising its transit peptide.
- Recombinant DNA molecule a combination of DNA sequences that are joined together using recombinant DNA technology
- Selectable marker gene a gene whose expression does not confer a selective advantage to a transformed cell, but whose expression makes the transformed cell phenotypically distinct from untransformed cells.
- Significant Increase an increase in enzymatic activity that is larger than the margin of error inherent in the measurement technique, preferably an increase by about 2-fold or greater of the activity of the wild-type enzyme in the presence of the inhibitor, more preferably an increase by about 5-fold or greater, and most preferably an increase by about 10-fold or greater.
- the term “substantially similar”, when used herein with respect to a nucleotide sequence, means a nucleotide sequence corresponding to a reference nucleotide sequence, wherein the corresponding sequence encodes a polypeptide having substantially the same structure and function as the polypeptide encoded by the reference nucleotide sequence, e.g. where only changes in amino acids not affecting the polypeptide function occur.
- the substantially similar nucleotide sequence encodes the polypeptide encoded by the reference nucleotide sequence.
- the term “substantially similar” is specifically intended to include nucleotide sequences wherein the sequence has been modified to optimize expression in particular cells.
- the percentage of identity between the substantially similar nucleotide sequence and the reference nucleotide sequence desirably is at least 65%, more desirably at least 75%, preferably at least 85%, more preferably at least 90%, still more preferably at least 95%, yet still more preferably at least 99%.
- Sequence comparisons are carried out using a Smith-Waterman sequence alignment algorithm (see e.g. Waterman, M.S. Introduction to Computational Biology: Maps, sequences and genomes. Chapman & Hall. London: 1995. ISBN 0-412-99391-0,).
- the locals program, version 1.16 is used with following parameters: match: 1 , mismatch penalty: 0.33, open-gap penalty: 2, extended-gap penalty: 2.
- a nucleotide sequence "substantially similar" to reference nucleotide sequence hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 2X SSC, 0.1% SDS at 50°C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 1X SSC, 0.1% SDS at 50°C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1% SDS at 50°C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 0.1X SSC
- the term "245 gene”, “5283 gene”, “2490 gene”, “3963 gene” or “4036 gene” refers to a DNA molecule comprising SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:9, respectively, or comprising a nucleotide sequence substantially similar to SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9, respectively.
- Homologs of the 245 gene , the 5283 gene, the 2490 gene, the 3963 gene or the 4036 gene include nucleotide sequences that encode an amino acid sequence that is at least 30% identical to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO: 10, respectively, as measured, using the parameters described below, wherein the amino acid sequence encoded by the homolog has the biological activity of the 245, 5283, 2490, 3963, or 4036 protein, respectively.
- substantially similar when used herein with respect to a protein, means a protein corresponding to a reference protein, wherein the protein has substantially the same structure and function as the reference protein, e.g. where only changes in amino acids sequence not affecting the polypeptide function occur.
- the percentage of identity between the substantially similar and the reference protein or amino acid sequence desirably is at least 65%, more desirably at least 75%, preferably at least 85%, more preferably at least 90%, still more preferably at least 95%, yet still more preferably at least 99%, using default BLAST analysis parameters.
- the term "245 protein”, “5283 protein”, “2490 protein”, “3963 protein” or “4036 protein” refers to an amino acid sequence encoded by a DNA molecule comprising a nucleotide sequence substantially similar to SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:9, respectively.
- Homologs of the 245 protein , the 5283 protein, the 2490 protein, the 3963 protein or the 4036 protein are amino acid sequences that are at least 30% identical to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10, respectively, as measured using the parameters described below, wherein the homologs have the biological activity of the 245, 5283, 2490, 3963, or 4036 protein, respectively.
- GAP analysis to determine the percentage of identity between the "substantially similar” and the reference nucleotide sequence, or protein or amino acid sequence.
- “substantially similar” is therefore also determined using default GAP analysis parameters with the University of Wisconsin GCG, SEQWEB application of GAP, based on the algorithm of Needleman and Wunsch (Needleman and Wunsch (1970) J Mol. Biol. 48: 443- 453).
- substantially similar refers to nucleotide sequences that encode a protein having at least 47% identity, more preferably at least 60% identity, still more preferably at least 75% identity, still more preferably at least 85% identity, still more preferably at least 95% identity, yet still more preferably at least 99% identity to SEQ ID NO:2.
- substantially similar refers to nucleotide sequences that encode a protein having at least 74% identity, more preferably at least 80% identity, still more preferably at least 85% identity, still more preferably at least 90% identity, still more preferably at least 95% identity, yet still more preferably at least 99% identity to SEQ ID NO:4. Also, “substantially similar” preferably also refers to nucleotide sequences having at least 80% identity, more preferably at least 90% identity, still more preferably 95% identity, yet still more preferably at least 99% identity, to SEQ ID NO:3, wherein said nucleotide sequence comparisons are conducted using GAP analysis as described above.
- substantially similar refers to nucleotide sequences that encode a protein having at least 82% identity, more preferably at least 85% identity, more preferably at least 90% identity, still more preferably at least 95% identity, yet still more preferably at least 99% identity to SEQ ID NO:6. Also, “substantially similar” preferably also refers to nucleotide sequences having at least 87% identity, more preferably at least 90% identity, still more preferably 95% identity, yet still more preferably at least 99% identity, to SEQ ID NO:5, wherein said nucleotide sequence comparisons are conducted using GAP analysis as described above.
- substantially similar refers to nucleotide sequences that encode a protein having at least 40% identity, more preferably at least 60% identity, more preferably at least 80% identity, still more preferably at least 90% identity, still more preferably at least 95% identity, yet still more preferably at least 99% identity to SEQ ID NO:8.
- substantially similar preferably also refers to nucleotide sequences having at least 49% identity, more preferably at least 60% identity, still more preferably 80% identity, more preferably at least 90% identity, more preferably at least 95% identity, yet still more preferably at least 99% identity, to SEQ ID NO:7, wherein said nucleotide sequence comparisons are conducted using GAP analysis as described above.
- substantially similar refers to nucleotide sequences that encode a protein having at least 67% identity, more preferably at least 80% identity, more preferably at least 85% identity, still more preferably at least 90% identity, still more preferably at least 95% identity, yet still more preferably at least 99% identity to SEQ ID NO:10.
- homologs of the 245 gene include nucleotide sequences that encode an amino acid sequence that has at least 24% identity to SEQ ID NO:2, more preferably at least 30% identity, still more preferably at least 40% identity, still more preferably at least 45% identity, yet still more preferably at least 55% identity, still more preferably at least 65% identity, yet still more preferably at least 75% identity to SEQ ID NO:2, wherein the amino acid sequence encoded by the homolog has the biological activity of the 245 protein.
- homologs of the 5283 gene include nucleotide sequences that encode an amino acid sequence that has at least 23% identity to SEQ ID NO:4, more preferably at least 40% identity, still more preferably at least 50% identity, still more preferably at least 60% identity, yet still more preferably at least 74% identity to SEQ ID NO:4, wherein the amino acid sequence encoded by the homolog has the biological activity of the 5283 protein.
- homologs of the 2490 gene include nucleotide sequences that encode an amino acid sequence that has at least 30% identity to SEQ ID NO:6, more preferably at least 30% identity, still more preferably at least 50% identity, still more preferably at least 60% identity, yet still more preferably at least 80% identity to SEQ ID NO:6, wherein the amino acid sequence encoded by the homolog has the biological activity of the 2490 protein.
- homologs of the 3963 gene include nucleotide sequences that encode an amino acid sequence that has at least 34% identity to SEQ ID NO:8, more preferably at least 40% identity, still more preferably at least 50% identity, still more preferably at least 60% identity, yet still more preferably at least 75% identity to SEQ ID NO:8, wherein the amino acid sequence encoded by the homolog has the biological activity of the 3963 protein.
- homologs of the 4036 gene include nucleotide sequences that encode an amino acid sequence that has at least 44% identity to SEQ ID NO:10, more preferably at least 50% identity, still more preferably at least 60% identity, yet still more preferably at least 75% identity to SEQ ID NO:10, wherein the amino acid sequence encoded by the homolog has the biological activity of the 4036 protein.
- the percentage of identity between the "substantially similar" protein or amino acid sequence and the reference protein or amino acid sequence is at least 47%, more preferably at least 60%, still more preferably at least 75%, still more preferably at least 85%, still more preferably at least 95%, yet still more preferably at least 99%.
- “Homologs of the 245 protein” include amino acid sequences that are at least 24% identical to SEQ ID NO:2, more preferably at least 30% identical, still more preferably at least 40% identical, still more preferably at least 45% identical, yet still more preferably at least 55% identical, still more preferably at least 65% identical, yet still more preferably at least 75% identical to SEQ ID NO:2, wherein homologs of the 245 protein have the biological activity of the 245 protein.
- the percentage of identity between the substantially similar protein or amino acid sequence and the reference protein or amino acid sequence is at least 74%, more preferably at least 80%, still more preferably at least 85%, still more preferably at least 90%, still more preferably at least 95%, yet still more preferably at least 99%.
- “Homologs of the 5283 protein” include amino acid sequences that at least 23% identity to SEQ ID NO:4, more preferably at least 40% identity, still more preferably at least 50% identity, still more preferably at least 60% identity, yet still more preferably at least 74% identity to SEQ ID NO:4, wherein homologs of the 5283 protein have the biological activity of the 5283 protein.
- the percentage of identity between the substantially similar protein or amino acid sequence and the reference protein or amino acid sequence is at least 82%, more preferably at least 85%, more preferably at least 90%, still more preferably at least 95%, yet still more preferably at least 99%.
- "Homologs of the 2490 protein” include amino acid sequences that have at least 30% identity to SEQ ID NO:6, more preferably at least 30% identity, still more preferably at least 50% identity, still more preferably at least 60% identity, yet still more preferably at least 80% identity to SEQ ID NO:6, wherein the homologs of the 2490 protein have the biological activity of the 2490 protein.
- the percentage of identity between the substantially similar protein or amino acid sequence and the reference protein or amino acid sequence is at least 40%, more preferably at least 60%, more preferably at least 80%, still more preferably at least 90%, still more preferably at least 95%, yet still more preferably at least 99%.
- "Homologs of the 3963 protein” include amino acid sequences that has at least 34% identity to SEQ ID NO:8, more preferably at least 40% identity, still more preferably at least 50% identity, still more preferably at least 60% identity, yet still more preferably at least 75% identity to SEQ ID NO:8, wherein the homologs of the 3963 protein have the biological activity of the 3963 protein.
- the percentage of identity between the substantially similar reference protein or amino acid sequence and the reference protein or amino acid sequence is at least 67%, more preferably at least 80%, more preferably at least 85%, still more preferably at least 90%, still more preferably at least 95%, yet still more preferably at least 99%.
- "Homologs of the 4036 protein” include amino acid sequences that have at least 44% identity to SEQ ID NO:10, more preferably at least 50% identity, still more preferably at least 60% identity, yet still more preferably at least 75% identity to SEQ ID NO:10, wherein the homologs of the 4036 protein has the biological activity of the 4036 protein.
- a substrate is the molecule that an enzyme naturally recognizes and converts to a product in the biochemical pathway in which the enzyme naturally carries out its function, or is a modified version of the molecule, which is also recognized by the enzyme and is converted by the enzyme to a product in an enzymatic reaction similar to the naturally-occurring reaction.
- Tolerance the ability to continue essentially normal growth or function when exposed to an inhibitor or herbicide in an amount sufficient to suppress the normal growth or function of native, unmodified plants.
- Transformation a process for introducing heterologous DNA into a cell, tissue, or plant.
- Transformed cells, tissues, or plants are understood to encompass not only the end product of a transformation process, but also transgenic progeny thereof.
- Transgenic stably transformed with a recombinant DNA molecule that preferably comprises a suitable promoter operatively linked to a DNA sequence of interest.
- SEQ ID NO:12 partial genomic sequence of the Arabidopsis 245 gene
- SEQ ID NO:14 genomic sequence of the Arabidopsis 5283 gene
- SEQ ID NO:19 genomic sequence of the Arabidopsis 2490 gene
- SEQ ID NO:24 genomic sequence of the Arabidopsis 3963 gene
- SEQ ID NO:27 genomic sequence of the Arabidopsis 4036 gene
- SEQ ID NO:28 cDNA coding sequence for the Arabidopsis 4036 gene including variations between the cDNA and genomic sequence from cultivars Landsberg and Columbia
- SEQ ID NO:29 amino acid sequence encoded by the Arabidopsis 4036 DNA sequence shown in SEQ ID NO.28 Encompassed by the invention is an isolated DNA molecule comprising a nucleotide sequence substantially similar to any one of the sequences selected from the group consisting of SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9._ Preferred is the DNA molecule according to the invention, wherein the sequence encodes an amino acid sequence substantially similar to any one of the sequences selected from the group consisting of SEQ ID NO: 2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.
- DNA molecule according to the invention wherein the sequence is any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9. Further preferred is the DNA molecule according to the invention, wherein the sequence encodes the amino acid sequence of any one of the sequences selected from the group consisting of SEQ ID NO: 2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10. Further preferrred is a DNA molecule according to the invention, wherein said nucleotide sequence is a plant nucleotide sequence. More prefered is the DNA molecule according to the invention, wherein the plant is Arabidopsis thaliana.
- DNA molecule according to the invention, wherein the protein has any one of the activities selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 396 activity and 4036 activity.
- an amino acid sequence comprising an amino acid sequence encoded by a nucleotide sequence substantially similar to any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9.
- amino acid sequence according to the invention comprising an amino acid sequence encoded by any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9.
- a further object of the invention is an amino acid sequence comprising an amino acid sequence substantially similar to any one of the sequences selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.
- amino acid sequence according to the invention wherein the sequence is any one of the sequences selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.
- amino acid sequence wherein the protein has any one of the activities selected from the group consisting of 245, 5283, 2490, 3963 and 4036 activity.
- amino acid sequence comprising at least 20 consecutive amino acid residues of the amino acid sequence encoded by any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9.
- amino acid sequence comprising at least 20 consecutive amino acid residues of the amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID - NO:8 and SEQ ID NO:10.
- An object of the invention is an expression cassette comprising a promoter operatively linked to a DNA molecule according to the invention.
- a recombinant vector comprising an expression cassette according to the invention, wherein said vector is capable of being stably transformed into a host cell.
- a host cell comprising an expression cassette according to the invention, wherein said nucleotide sequence is expressible in said cell.
- Preferred is a host cell according to the invention, wherein said host cell is an eukaryotic cell. More preferred is a host cell according to the invention, wherein said host cell is selected from the group consisting of an insect cell, a yeast cell, and a plant cell.
- a host cell according to the invention wherein said host cell is a prokaryotic cell. Also more preferred is a host cell according to the invention, wherein said host cell is a bacterial cell.
- a plant or seed comprising a plant cell according to the invention. Preferred is a plant according to the invention, wherein said plant is tolerant to an inhibitor of any one of the activities selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 3963 activity and 4036 activity.
- a method comprising obtaining a host cell comprising a heterologous DNA molecule encoding a protein having 245, 5283, 2490, 3963, or 4036 activity; and expressing said protein in said host cell.
- the host cell is a bacterial cell, a yeast cell or an insect cell.
- nucleotides sequences encoding gene products having altered activity selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 3963 activity and 4036 activity comprising, a) shuffling a nucleotide sequence of claim 1 , b) expressing the resulting shuffled nucleotide sequences and c) selecting for altered activity selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 3963 activity and 4036 activity as compared to the activity selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 3963 activity and 4036 activity of the gene product of said unmodified nucleotide sequence.
- nucleotide sequence is any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9.
- the nucleotide sequence is any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9.
- Encompassed by the invention is a shuffled DNA molecule obtainable by the process according to the invention.
- Encompassed by the invention is a shuffled DNA molecule produced by the process according to the invention.
- a shuffled DNA molecule obtained by the according to the invention, wherein said shuffled DNA molecule encodes a gene product having enhanced tolerance to an inhibitor of any one of the activities selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 3963 activity and 4036 activity.
- a further object of the invention is an expression cassette comprising a promoter operatively linked to a nucleotide sequence according to the invention.
- a recombinant vector comprising an expression cassette according to the invention, wherein said vector is capable of being stably transformed into a host cell.
- a further object of the invention is a host cell comprising an expression cassette according the invention, wherein said nucleotide sequence is expressible in said cell.
- a host cell according to the invention wherein said host cell is an eukaryotic cell.
- a host cell according to the invention wherein said host cell is selected from the group consisting of an insect cell, a yeast cell, and a plant cell.
- a host cell according to the invention wherein said host cell is a prokaryotic cell.
- said host cell is a bacterial cell.
- An object of the invention is a plant or seed comprising a plant cell according to the invention.
- a plant according to the invention wherein said plant is tolerant to an inhibitor selected from the group consisting of 245, 5283, 2490, 3963 and 4036 activity.
- a method for selecting compounds that interact with the protein encoded by any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9 comprising: a) expressing a DNA molecule comprising any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9, respectively, or a sequence substantially similar to any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9 to generate the corresponding protein, b) testing a compound suspected of having the ability to interact with the protein expressed in step (
- a further object of the invention is a process of identifying an inhibitor of any one of the activities selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 3963 activity and 4036 activity comprising: a) introducing a DNA molecule comprising a nucleotide sequence of any one of the sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9, respectively, and having any one of the activities selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 3963 activity and 4036 activity, or nucleotide sequences substantially similar thereto, or a homolog thereof, into a plant cell, such that said sequence is functionally expressible at levels that are higher than wild-type expression levels, b) combining said plant cell with a compound to be tested for the ability to inhibit any one of the activities selected from the group consisting of 245 activity, 5283 activity, 2490 activity, 3963 activity and 4036 activity under conditions
- a compound having herbicidal activity identifiable according to the process according to the invention is a compound having herbicidal activity identifiable according to the process according to the invention. Further encompassed is a process of identifying compounds having herbicidal activity comprising: a) combining a protein according to the invention and a compound to be tested for the ability to interact with said protein, under conditions conducive to interaction, b) selecting a compound identified in step (a) that is capable of interacting with said protein, c) applying identified compound in step (b) to a plant to test for herbicidal activity, and d) selecting compounds having herbicidal activity.
- a further object of the invention is a method for suppressing the growth of a plant comprising, applying to said plant a compound that inhibits the activity of the amino acid sequence according to the invention in an amount sufficient to suppress the growth of said plant.
- a method of improving crops comprising, applying to a herbicide tolerant plant or seed according to the invention, a compound having herbicidal activity identifiable according to a process according to the invention, in an amount that inhibits the growth of undesired vegetation without significantly suppressing the growth of the herbicide tolerant plant or seed.
- An object of the invention is a DNA molecule comprising a nucleotide sequence substantially similar to any one of the sequences selected from the group consisting of SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 , SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29.
- a feature of the invention is the identification of a gene in Arabidopsis, herein referred to as the 245 gene, which shows sequence similarity to peptide release factor 2 (Craigen et al. (1985) Proc. Natl. Acad. Sci, 82: 3616-3620; Craigen and Caskey (1987) Biochimie 69: 1031-1041 ; Ito et al. (1998) Proc. Natl. Acad. Sci., 95: 8165-8169).
- Another feature of the invention is the discovery that the 245 gene is essential for seedling growth and development.
- An advantage of the present invention is that the newly discovered essential gene containing a novel herbicidal mode of action enables one skilled in the art to easily and rapidly identify novel herbicides.
- a further feature of the invention is the identification of a gene in Arabidopsis, herein referred to as the 5283 gene, which shows sequence similarity to the following: an uncharacterized gene from Schizosaccharomyces pombe; the Saccharomyces cerevisiae PRP31 gene that encodes a factor essential for pre-mRNA splicing (Weidenhammer et al. (1996) Nucleic Acids Res. 24: 1164-1170; Weidenhammer et al. (1997) Mol. Cell. Biol., 17: 3580-3585); the Pisum satlvum SARBP-1 and SARBP-2 genes that encode Scaffold Attachment Region (SAR) DNA-binding proteins (Rzepecki et al.
- SAR Scaffold Attachment Region
- SIK1 gene product is also referred to as Nop56, which is shown to be an essential nucleolar protein (Gautier et al. (1997) Mol. Cell. Biol. 17: 7088- 7098).
- Another feature of the invention is the discovery that the 5283 gene is essential for seedling growth and development.
- An advantage of the present invention is that the newly discovered essential gene containing a novel herbicidal mode of action enables one skilled in the art to easily and rapidly identify novel herbicides.
- a further feature of the invention is the identification of a gene in Arabidopsis, herein referred to as the 2490 gene, which encodes a protein with sequence similarity to a chloroplast envelope protein (Ko et al. (1995) The Journal of Biological Chem. 270: 28601- 28608; Wu et al. (1994) The Journal of Biological Chem. 269: 32264-32271 ; Pang et al. (1997) The Journal of Biological Chem. 272: 25623-25627).
- Another feature of the invention is the discovery that the 2490 gene is essential for seedling growth and development.
- An advantage of the present invention is that the newly discovered essential gene containing a novel herbicidal mode of action enables one skilled in the art to easily and rapidly identify novel herbicides.
- a further feature of the invention is the identification of a gene in Arabidopsis, herein referred to as the 3963 gene, which encodes a protein with sequence similarity to a number of DNA repair proteins, including Rad32p from Schizosaccharomyces pombe (Genbank accession numberQ09683); hMre11 from Homo sapiens (Genbank accession number U37359); and Mre11p from Saccharomyces cerevislae (Genbank accession number U60829) (Johzuka and Ogawa (1995) Genetics, 139: 1521-1532; Paull and Gellert (1998) Molecular Cell, 1 : 969-979).
- Another feature of the invention is the discovery that the 3963 gene is essential for seedling growth and development.
- An advantage of the present invention is that the newly discovered essential gene containing a novel herbicidal mode of action enables one skilled in the art to easily and rapidly identify novel herbicides.
- a further feature of the invention is the identification of a gene in Arabidopsis, herein referred to as the 4036 gene, which encodes a protein with sequence similarity to 1 -deoxy- D-xylulose 5-phosphate reductoisomerase from a number of organisms including Synechocystis sp. (SWISS-PROTQ55663), Bacillus subtilis (SWISS-PROT 031753), and Escherichia coll (SWISS-PROT P45568) (Takahashi et al. (1998) Proc. Natl. Acad. Sci.
- An important and unexpected feature of the invention is the discovery that the 4036 gene is essential for seedling growth and development.
- An advantage of the present invention is that the newly discovered essential gene containing a novel herbicidal mode of action enables one skilled in the art to easily and rapidly identify novel herbicides.
- One object of the present invention is to provide an essential gene in plants for assay development for inhibitory compounds with herbicidal activity. Genetic results show that when the 245 gene, the 5283 gene, the 2490 gene, the 3963 gene or the 4036 gene is mutated in Arabidopsis, the resulting phenotype is seedling lethal in the homozygous state. This suggests a critical role for the gene product encoded by the mutated gene.
- the inventors of the present invention have demonstrated that the activity encoded by the Arabidopsis 245 gene, the Arabidopsis 5283 gene, the Arabidopsis 2490 gene, the Arabidopsis 3963 gene or the Arabidopsis 4036 gene (herein referred to as 245, 5283, 2490, 3963 or 4036 activity) is essential in Arabidopsis seedlings. This implies that chemicals that inhibit the function of the protein in plants are likely to have detrimental effects on plants and are potentially good herbicide candidates.
- the present invention therefore provides methods of using a purified protein encoded by the gene sequences described below to identify inhibitors thereof, which can then be used as herbicides to suppress the growth of undesirable vegetation, e.g.
- crops in fields where crops are grown, particularly agronomically important crops such as maize and other cereal crops such as wheat, oats, rye, sorghum, rice, barley, millet, turf and forage grasses, and the like, as well as cotton, sugar cane, sugar beet, oilseed rape, and soybeans.
- agronomically important crops such as maize and other cereal crops such as wheat, oats, rye, sorghum, rice, barley, millet, turf and forage grasses, and the like, as well as cotton, sugar cane, sugar beet, oilseed rape, and soybeans.
- the present invention discloses a nucleotide sequence derived from Arabidopsis, designated the 245 gene.
- the nucleotide sequence of the cDNA clone is set forth in SEQ ID NO:1
- the corresponding amino acid sequence is set forth in SEQ ID NO:2.
- the nucleotide sequence of the partial genomic DNA sequence is set forth in SEQ ID NO:12.
- the present invention also includes nucleotide sequences substantially similar to those set forth in SEQ ID NO:1.
- the present invention also encompasses plant proteins whose amino acid sequence are substantially similar to the amino acid sequences set forth in SEQ ID NO:2. Such proteins can be used in a screening assay to identify inhibitors that are potential herbicides.
- the present invention further discloses a nucleotide sequence derived from Arabidopsis, designated the 5283 gene.
- the nucleotide sequence of the cDNA clone is set forth in SEQ ID NO:3, and the corresponding amino acid sequence is set forth in SEQ ID NO:4.
- the nucleotide sequence of the genomic DNA sequence is set forth in SEQ ID NO:14.
- the present invention also includes nucleotide sequences substantially similar to those set forth in SEQ ID NO:3.
- the present invention also encompasses plant proteins whose amino acid sequence are substantially similar to the amino acid sequences set forth in SEQ ID NO:4. Such proteins can be used in a screening assay to identify inhibitors that are potential herbicides.
- the present invention further discloses a nucleotide sequence derived from Arabidopsis, designated the 2490 gene.
- the nucleotide sequence of the cDNA clone is set forth in SEQ ID NO:5, and the corresponding amino acid sequence is set forth in SEQ ID NO:6.
- the nucleotide sequence of the genomic DNA sequence is set forth in SEQ ID NO:19.
- the present invention also includes nucleotide sequences substantially similar to those set forth in SEQ ID NO:5.
- the present invention also encompasses plant proteins whose amino acid sequence are substantially similar to the amino acid sequences set forth in SEQ ID NO:6. Such proteins can be used in a screening assay to identify inhibitors that are potential herbicides.
- the present invention further discloses a nucleotide sequence derived from Arabidopsis, designated the 3963 gene.
- the nucleotide sequence of the cDNA clone is set forth in SEQ ID NO:7, and the corresponding amino acid sequence is set forth in SEQ ID NO:8.
- the nucleotide sequence of the genomic DNA sequence is set forth in SEQ ID NO:24, which contains genomic DNA sequences from both the portion of the MDK4 clone annotated as MDK4.6 and added sequences on the 3' end based on the inventors' reported cDNA clone.
- the present invention also includes nucleotide sequences substantially similar to those set forth in in SEQ ID NO:7.
- the present invention also encompasses plant proteins whose amino acid sequence are substantially similar to the amino acid sequences set forth in SEQ ID NO:8. Such proteins can be used in a screening assay to identify inhibitors that are potential herbicides.
- the present invention further discloses a nucleotide sequence derived from Arabidopsis, designated the 4036 gene.
- the nucleotide sequence of the cDNA clone is set forth in SEQ ID NO:9, and the corresponding amino acid sequence is set forth in SEQ ID NO:10.
- the nucleotide sequence of the genomic DNA sequence is set forth in SEQ ID NO:27. Thirteen nucleotide differences are observed by comparing the cDNA clone, derived from cv. Landsberg, and the genomic sequence, derived from cv. Columbia; and Table 1 , below, further identifies these differences.
- SEQ ID NO:28 is the same as SEQ ID NO:9, but with these thirteen nucleotide differences.
- the corresponding amino acid sequence of SEQ ID NO:28 is set forth in SEQ ID NO:29.
- the present invention also includes nucleotide sequences substantially similar to those set forth in SEQ ID NO:9.
- the present invention also encompasses plant proteins whose amino acid sequence are substantially similar to the amino acid sequences set forth in SEQ ID NO:10 and SEQ ID NO:29. Such proteins can be used in a screening assay to identify inhibitors that are potential herbicides.
- the present invention relates to a method for identifying chemicals having the ability to inhibit 245, 5283, 2490, 3963 or 4036 activity in plants preferably comprising the steps of: a) obtaining transgenic plants, plant tissue, plant seeds or plant cells, preferably stably transformed, comprising a non-native nucleotide sequence encoding an enzyme having 245, 5283, 2490, 3963 or 4036 activity and capable of overexpressing an enzymatically active 245, 5283, 2490, 3963 or 4036 gene product (either full length or truncated but still active); b) applying a chemical to the transgenic plants, plant cells, tissues or parts and to the isogenic non-transformed plants, plant cells, tissues or parts; c) determining the growth or viability of the transgenic and non-transformed plants, plant cells, tissues after application of the chemical; d) comparing the growth or viability of the transgenic and non-transformed plants, plant cells, tissues after application of the chemical; and e) selecting chemicals that
- the enzyme having 245, 5283, 2490, 3963 or 4036 activity is encoded by a nucleotide sequence derived from a plant, preferably Arabidopsis thaliana, desirably identical or substantially similar to the nucleotide sequence set forth in SEQ ID WO- 00/42205 PCT/EPOO/00246
- the enzyme having 245, 5283, 2490, 3963 or 4036 activity is encoded by a nucleotide sequence capable of encoding the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10 respectively.
- the enzyme having 245, 5283, 2490, 3963 or 4036 activity has an amino acid sequence identical or substantially similar to the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10 respectively.
- the present invention further embodies plants, plant tissues, plant seeds, and plant cells that have modified 245, 5283, 2490, 3963 or 4036 activity and that are therefore tolerant to inhibition by a herbicide at levels normally inhibitory to naturally occurring 245, 5283, 2490, 3963 or 4036 activity.
- Herbicide tolerant plants encompassed by the invention include those that would otherwise be potential targets for normally inhibiting herbicides, particularly the agronomically important crops mentioned above.
- plants, plant tissue, plant seeds, or plant cells are transformed, preferably stably transformed, with a recombinant DNA molecule comprising a suitable promoter functional in plants operatively linked to a nucleotide coding sequence that encodes a modified 245, 5283, 2490, 3963 or 4036 gene that is tolerant to inhibition by a herbicide at a concentration that would normally inhibit the activity of wild-type, unmodified 245, 5283, 2490, 3963 or 4036 gene product.
- Modified 245, 5283, 2490, 3963 or 4036 activity may also be conferred upon a plant by increasing expression of wild-type herbicide-sensitive 245, 5283, 2490, 3963 or 4036 protein by providing multiple copies of wild-type 245, 5283, 2490, 3963 or 4036 genes to the plant or by overexpression of wild-type 245, 5283, 2490, 3963 or 4036 genes under control of a stronger-than-wild-type promoter.
- the transgenic plants, plant tissue, plant seeds, or plant cells thus created are then selected by conventional selection techniques, whereby herbicide tolerant lines are isolated, characterized, and developed. Alternately, random or site-specific mutagenesis may be used to generate herbicide tolerant lines.
- the present invention provides a plant, plant cell, plant seed, or plant tissue transformed with a DNA molecule comprising a nucleotide sequence isolated from a plant that encodes an enzyme having 245, 5283, 2490, 3963 or 4036 activity, wherein the DNA expresses the 245, 5283, 2490, 3963 or 4036 activity and wherein the DNA molecule confers upon the plant, plant cell, plant seed, or plant tissue tolerance to a herbicide in amounts that normally inhibits naturally occurring 245, 5283, 2490, 3963 or 4036 activity.
- the enzyme having 245, 5283, 2490, 3963 or 4036 activity is encoded by a nucleotide sequence identical or substantially similar to the nucleotide sequence set forth in SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:9, respectively, or has an amino acid sequence identical or substantially similar to the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, or SEQ ID NO:10, respectively.
- the invention also provides a method for suppressing the growth of a plant comprising the step of applying to the plant a chemical that inhibits the naturally occurring 245, 5283, 2490, 3963 or 4036 activity in the plant.
- the present invention is directed to a method for selectively suppressing the growth of undesired vegetation in a field containing a crop of planted crop seeds or plants, comprising the steps of: (a) optionally planting herbicide tolerant crops or crop seeds, which are plants or plant seeds that are tolerant to a herbicide that inhibits the naturally occurring 245, 5283, 2490, 3963 or 4036 activity; and (b) applying to the herbicide tolerant crops or crop seeds and the undesired vegetation in the field a herbicide in amounts that inhibit naturally occurring 245, 5283, 2490, 3963 or 4036 activity, wherein the herbicide suppresses the growth of the weeds without significantly suppressing the growth of the crops.
- Arabidopsis insertional mutant lines segregating for seedling lethal mutations are identified as a first step in the identification of essential proteins. Starting with T2 seeds collected from single T1 plants containing T-DNA insertions in their genomes, those lines segregating homozygous seedling lethal seedlings are identified. These lines are found by placing seeds onto minimal plant growth media, which contains the fungicides benomyl and maxim, and screening for inviable seedlings after 7 and 14 days in the light at room temperature. Inviable phenotypes include altered pigmentation or altered morphology. These phenotypes are observed either on plates directly or in soil following transplantation of seedlings.
- a line When a line is identified as segregating a seedling lethal, it is determined if the resistance marker in the T-DNA co-segregates with the lethality (Errampalli et al. (1991) The Plant Cell, 3:149-157). Co-segregation analysis is done by placing the seeds on media containing the selective agent and scoring the seedlings for resistance or sensitivity to the agent. Examples of selective agents used are hygromycin or phosphinothricin. About 35 resistant seedlings are transplanted to soil and their progeny are examined for the segregation of the seedling lethal.
- Southern analysis is performed as an initial step in the characterization of the molecular nature of each insertion. Southerns are done with genomic DNA isolated from heterozygotes and using probes capable of hybridizing with the T-DNA vector DNA. Using the results of the Southern analysis, appropriate restriction enzymes are chosen to perform plasmid rescue in order to molecularly clone Arabidopsis genomic DNA flanking one or both sides of the T-DNA insertion. Plasmids obtained in this manner are analyzed by restriction enzyme digestion to sort the plasmids into classes based on their digestion pattern. For each class of plasmid clone, the DNA sequence is determined.
- the resulting sequences are analyzed for the presence of non-T-DNA vector sequences. When such sequences are found, they are used to search DNA and protein databases using the BLAST and BLAST2 programs (Altschul et al. (1990) J Mol. Biol. 215: 403-410; Altschul et al (1997) Nucleic Acid Res. 25:3389-3402). Additional genomic and cDNA sequences for each gene are identified by standard molecular biology procedures.
- the Arabidopsis 245 gene was identified by isolating DNA flanking the T-DNA border from the tagged seedling-lethal line #245. A region of the Arabidopsis DNA, flanking the T-DNA border, is 99% identical to the genomic survey sequence F17K7TR (accession # B24357). The inventors are the first to demonstrate that the 245 gene product is essential for normal growth and development in plants, as well as defining the function of the 245 gene product through protein homology.
- the present invention discloses the cDNA nucleotide sequence of the Arabidopsis 245 gene as well as the amino acid sequence of the Arabidopsis 245 protein.
- the nucleotide sequence corresponding to the cDNA clone is set forth in SEQ ID NO:1
- the amino acid sequence encoding the protein is set forth in SEQ ID NO:2.
- The, UTR sequence found 3' to SEQ ID NO:1 is set forth in SEQ ID NO:13.
- the nucleotide sequence corresponding to the partial genomic DNA is set forth in SEQ ID NO: 12.
- the present invention also encompasses an isolated amino acid sequence derived from a plant, wherein said amino acid sequence is identical or substantially similar to the amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 1 , wherein said amino acid sequence has 245 activity.
- the sequence of the 245 gene shows similarity to peptide release factor 2 from numerous prokaryotic species. Notable species similarities include: Escherichia coll (RF-2) [Swiss-Prot accession #P07012]; Salmonella typhimurium (RF-2 Salty)[Swiss-Prot accession # P28353]; and Mycobacterium tuberculosis (RF-2: prfB)[Swiss-Prot accession #005782].
- Escherichia coll [Swiss-Prot accession #P07012]
- Salmonella typhimurium RF-2 Salty
- RF-2: prfB Mycobacterium tuberculosis
- Synechocystis (GenPept accession #BAA18577) (31.5% identity); and P1 clone MAB16, chromosome 5 of Arabidopsis thaliana (Accession #AB018112NID) (46.2% identity).
- the Arabidopsis 5283 gene was identified by isolating DNA flanking the T-DNA border from the tagged seedling-lethal line #5283. A region of the Arabidopsis DNA, flanking the T-DNA border is identical to an internal region of a sequenced BAC of Arabidopsis (BAC T13D8, chromosome 1). This BAC clone contains 116,177 bp of sequence, of which a very small portion corresponds to the genomic region that contains the 5283 gene. Notwithstanding the BAC information, the inventors are the first to demonstrate that the 5283 gene product is essential for normal growth and development in plants, as well as defining the function of the 5283 gene product through protein homology.
- the present invention discloses the cDNA nucleotide sequence of the Arabidopsis 5283 gene as well as the amino acid sequence of the Arabidopsis 5283 protein.
- the nucleotide sequence corresponding to the cDNA clone is set forth in SEQ ID NO:3, and the amino acid sequence encoding the protein is set forth in SEQ ID NO:4.
- the nucleotide sequence corresponding to the genomic DNA is set forth in SEQ ID NO: 14.
- the nucleotide sequence corresponding to the 5' UTR from the cDNA sequence is set forth in SEQ ID NO:17, and the nucleotide sequence corresponding to the 3'UTR from the cDNA sequence is set forth in SEQ ID NO:18.
- the - present invention also encompasses an isolated amino acid sequence derived from a plant, wherein said amino acid sequence is identical or substantially similar to the amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 3, wherein said amino acid sequence has 5283 activity.
- sequence of the 5283 protein shows similarity to SPBC119.13c from S. pombe [GENPEPT accession # CAA17928]; SAR DNA-binding proteins from plants [SARBP-1 ; Genbank accession # AF061962 and SARBP-2: Genbank accession # AF061963]; and prp31 and SIK1p (Nop56) from S.
- the Arabidopsis 2490 gene is identified by isolating DNA flanking the T-DNA border from the tagged seedling-lethal line #2490.
- Arabidopsis DNA flanking the T-DNA border is identical to an internal region of a sequenced P1 clone of Arabidopsis (P1 MTG13, chromosome 5). This P1 clone contains 50,641 bp of sequence, of which a small portion corresponds to the genomic region that contains the 2490 gene.
- the sequence of a 2490 cDNA containing the entire coding sequence for the 2490 protein is obtained by determining the sequence of the 144K24 EST clone (obtained from Michigan State University).
- the present invention discloses the cDNA nucleotide sequence of the Arabidopsis 2490 gene as well as the amino acid sequence of the Arabidopsis 2490 protein.
- the nucleotide sequence corresponding to the cDNA clone is set forth in SEQ ID NO:5, and the amino acid sequence encoding the protein is set forth in SEQ ID NO:6.
- the UTR sequence found 5' to SEQ ID NO:5 is set forth in SEQ ID NO:20, and the UTR sequence found 3' to SEQ ID NO:5 is set- forth in SEQ ID NO:21.
- the nucleotide sequence corresponding to the genomic DNA is set forth in SEQ ID NO:19.
- the present invention also encompasses an isolated amino acid sequence derived from a plant, wherein said amino acid sequence is identical or substantially similar to the amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 5, wherein said amino acid sequence has 2490 activity.
- the sequence of the 2490 protein shows similarity to the Toc36 (bce42B) chloroplast envelope protein from Brassica napus (Ko et al. (1995) The Journal of Biological Chem. 270: 28601-28608; Wu et al. (1994) The Journal of Biological Chem. 269: 32264-32271 ; Pang et al. (1997) The Journal of Biological Chem. 272: 25623-25627).
- GAP analysis of the 2490 protein and the Toc36 (bce42B) chloroplast envelope protein from Brassica napus results in 81.7% identity with the 2490 protein.
- the Arabidopsis 3963 gene is identified by isolating DNA flanking the T-DNA border from the tagged seedling-lethal line #3963. A region of the Arabidopsis DNA flanking the T-DNA border is 100% identical to the genomic sequence for P1 clone MDK4 on chromosome 5 (Genbank accession number AB010695). The inventors are the first to demonstrate that the 3963 gene product is essential for normal growth and development in plants, as well as defining the function of the 3963 gene product through protein homology. The present invention discloses the cDNA nucleotide sequence of the Arabidopsis 3963 gene as well as the amino acid sequence of the Arabidopsis 3963 protein.
- the nucleotide sequence corresponding to the cDNA clone is set forth in SEQ ID NO:7, and the amino acid sequence encoding the protein is set forth in SEQ ID NO:8.
- the UTR sequence found 3' to SEQ ID NO:7 is set forth in SEQ ID NO:26.
- the nucleotide sequence corresponding to the genomic DNA is set forth in SEQ ID NO:24.
- the present invention also encompasses an isolated amino acid sequence derived from a plant, wherein said amino acid sequence is identical or substantially similar to the amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO:7, wherein said amino acid sequence has 3963 activity.
- the sequence of the 3963 gene shows similarity to a number of DNA repair proteins, including Rad32p from Schizosaccharomyces pombe (Genbank accession numberQ09683); fiMrel 1 from Homo sapiens (Genbank accession number U37359); and Mre11p from Saccharomyces cerevislae (Genbank accession number U60829).
- the Arabidopsis 4036 gene is identified by isolating DNA flanking the T-DNA border from the tagged seedling-lethal line #4036.
- a region of the Arabidopsis DNA flanking the T- DNA border is 100% identical to the published genomic sequence for P1 clone MQB2, from chromosome 5 of Arabidopsis (Genbank accession # AB009053).
- the inventors are the first to demonstrate that the 4036 gene product is essential for normal growth and development in plants, as well as defining the function of the 4036 gene through protein homology.
- the present invention discloses the cDNA coding nucleotide sequence of the Arabidopsis 4036 gene as well as the amino acid sequence of the Arabidopsis 4036 protein.
- nucleotide sequences corresponding to the cDNA of cv. Landsberg and that of two cultivars are set forth in SEQ ID NO:9 and SEQ ID NO:28, respectively.
- the corresponding amino acid sequences encoding the proteins are set forth in SEQ ID NO:10 and SEQ ID NO:29.
- the nucleotide sequence corresponding to the genomic DNA is set forth in SEQ ID NO:27. Thirteen nucleotide differences are observed by comparing the cDNA clone, derived from cv. Landsberg, and the genomic sequence, derived from cv. Columbia, and these variations are listed below in Table 1.
- the present invention also encompasses an isolated amino acid sequence derived from a plant, wherein said amino acid sequence is identical or substantially similar to the amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO:9, wherein said amino acid sequence has 4036 activity.
- sequence of the 4036 gene shows similarity to 1 -deoxy-D-xylulose 5- phosphate reductoisomerase from a number of organisms including Synechocystis sp. (SWISS-PROTQ55663), Bacillus subtilis (SWISS-PROT 031753), and Escherichia coli (SWISS-PROT P45568) (Takahashi et al.
- a nucleotide sequence encoding a protein having 245, 5283, 2490, 3963 or 4036 activity is inserted into an expression cassette designed for the chosen host and introduced into the host where it is recombinantly produced.
- SEQ ID NO:1 or SEQ ID NO:1 associated with SEQ ID NO:13 as a 3' UTR nucleotide sequences substantially similar to SEQ ID NO:1 , or homologs of the 245 coding sequence can be used for the recombinant production of a protein having 245 activity.
- the choice of specific regulatory sequences such as promoter, signal sequence, 5' and 3' untranslated sequences, and enhancer appropriate for the chosen host is within the level of skill of the routineer in the art.
- the resultant molecule containing the individual elements operably linked in proper reading frame, may be inserted into a vector capable of being transformed into the host cell.
- Suitable expression vectors and methods for recombinant production of proteins are well known for host organisms such as E. coli, yeast, and insect cells (see, e.g., Luckow and Summers, Bio/Technol.
- baculovirus expression vectors e.g., those derived from the genome of Autographica califomica nuclear polyhedrosis virus (AcMNPV).
- a preferred baculovirus/insect system is pAcHLT (Pharmingen, San Diego, CA) used to transfect Spodoptera frugiperda Sf9 cells (ATCC) in the presence of linear Autographa califomica baculovirus DNA (Pharmigen, San Diego, CA).
- the resulting virus is used to infect HighFive Tricoplusia ⁇ / ' cells (Invitrogen, La Jolla, CA).
- recombinant production of 5283, 2490, 3963, or 4036 activity is obtained.
- the nucleotide sequence encoding a protein having 245, 5283, 2490, 3963 or 4036 activity is derived from an eukaryote, such as a mammal, a fly or a yeast, but is preferably derived from a plant.
- the nucleotide sequence is identical or substantially similar to the nucleotide sequence set forth in SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9 respectively or encodes a protein having 245, 5283, 2490, 3963 or 4036 activity, respectively, whose amino acid sequence is identical or substantially similar to the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10 respectively.
- the nucleotide sequence set forth in SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9 encodes the Arabidopsis 245 protein, Arabidopsis 5283 protein, Arabidopsis 2490 protein, Arabidopsis 3963 protein or Arabidopsis 4036 protein, whose amino acid sequence is set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID - BO ⁇
- nucleotide sequence is derived from a prokaryote, preferably a bacteria, e.g. E. coli.
- Recombinantly produced protein having 245, 5283, 2490, 3963 or 4036 activity is isolated and purified using a variety of standard techniques. The actual techniques that may be used will vary depending upon the host organism used, whether the protein is designed for secretion, and other such factors familiar to the skilled artisan (see, e.g. chapter 16 of Ausubel, F. et al., "Current Protocols in Molecular Biology", pub. by John Wiley & Sons, Inc. (1994).
- Recombinantly produced proteins having 245, 5283, 2490, 3963 or 4036 activity are useful for a variety of purposes. For example, they can be used in in vitro assays to screen known herbicidal chemicals whose target has not been identified to determine if they inhibit 245, 5283, 2490, 3963 or 4036 activity. Such in vitro assays may also be used as more general screens to identify chemicals that inhibit such enzymatic activity and that are therefore novel herbicide candidates. Alternatively, recombinantly produced proteins having 245, 5283, 2490, 3963 or 4036 activity may be used to elucidate the complex structure of these molecules and to further characterize their association with known inhibitors in order to rationally design new inhibitory herbicides as well as herbicide tolerant forms of the enzymes.
- the next step is to develop an assay that allows screening a large number of chemicals to determine which ones interact with the protein. Although it is straightforward to develop assays for proteins of known function, developing assays with proteins of unknown functions is more difficult.
- FCS Fluorescence Correlation Spectroscopy
- the sample size can be as low as 10 3 fluorescent molecules and the sample volume as low as the cytoplasm of a single bacterium.
- the diffusion rate is a function of the mass of the molecule and decreases as the mass increases. FCS can therefore be applied to protein-ligand interaction analysis by measuring the change in mass and therefore in diffusion rate of a molecule upon binding.
- the target to be analyzed is expressed as a recombinant protein with a sequence tag, such as a poly-histidine sequence, inserted at the N or C-terminus. The expression takes place in E. coli, yeast or insect cells. The protein is purified by chromatography.
- the poly- histidine tag can be used to bind the expressed protein to a metal chelate column such as Ni2+ chelated on iminodiacetic acid agarose.
- the protein is then labeled with a fluorescent tag such as carboxytetramethylrhodamine or BODIPY® (Molecular Probes, Eugene, OR).
- the protein is then exposed in solution to the potential ligand, and its diffusion rate is determined by FCS using instrumentation available from Carl Zeiss, Inc. (Thornwood, NY). Ligand binding is determined by changes in the diffusion rate of the protein.
- SELDI Surface-Enhanced Laser Desorption/lonization
- the purified protein is then used in the assay without further preparation. It is bound to the SELDI chip either by utilizing the poly-histidine tag or by other interaction such as ion exchange or hydrophobic interaction.
- the chip thus prepared is then exposed to the potential ligand via, for example, a delivery system capable to pipet the ligands in a sequential manner (autosampler).
- the chip is then submitted to washes of increasing stringency, for example a series of washes with buffer solutions containing an increasing ionic strength. After each wash, the bound material is analyzed by submitting the chip to SELDI-TOF. Ligands that specifically bind the target will be identified by the stringency of the wash needed to elute them.
- Biacore relies on changes in the refractive index at the surface layer upon binding of a ligand to a protein immobilized on the layer.
- a collection of small ligands is injected sequentially in a 2-5 ul cell with the immobilized protein. Binding is detected by surface plasmon resonance (SPR) by recording laser light refracting from the surface.
- SPR surface plasmon resonance
- the refractive index change for a given change of mass concentration at the surface layer is practically the same for all proteins and peptides, allowing a single method to be applicable for any protein (Liedberg et al. (1983) Sensors Actuators 4: 299-304; Malmquist (1993) Nature, 361 : 186-187).
- the target to be analyzed is expressed as described for FCS.
- the purified protein is then used in the assay without further preparation. It is bound to the Biacore chip either by utilizing the poly-histidine tag or by other interaction such as ion exchange or hydrophobic interaction.
- the chip thus prepared is then exposed to the potential ligand via the delivery system incorporated in the instruments sold by Biacore (Uppsala, Sweden) to pipet the ligands in a sequential manner (autosampler).
- the SPR signal on the chip is recorded and changes in the refractive index indicate an interaction between the immobilized target and the ligand. Analysis of the signal kinetics on rate and off rate allows the discrimination between non-specific and specific interaction.
- an assay for small molecule ligands that interact with a polypeptide is an inhibitor assay.
- an inhibitor assay useful for identifying inhibitors of essential plant genes, such as 245, 5283, 2490, 3963, or 4036 genes comprises the steps of: a) reacting a plant 245, 5283, 2490, 3963, or 4036 protein and a substrate thereof in the presence of a suspected inhibitor of the protein's function; b) comparing the rate of enzymatic activity in the presence of the suspected inhibitor to the rate of enzymatic activity under the same conditions in the absence of the suspected inhibitor; and c) determining whether the suspected inhibitor inhibits the 245, 5283, 2490, 3963, or 4036 protein .
- the inhibitory effect on plant 245, 5283, 2490, 3963, or 4036 protein may be determined by a reduction or complete inhibition of 245, 5283, 2490, 3963, or 4036 activity in the assay. Such a determination may be made by comparing, in the presence and absence of the candidate inhibitor, the amount of substrate used or intermediate or product made during the reaction.
- a suspected herbicide for example identified by in vitro screening, is applied to plants at various concentrations. The suspected herbicide is preferably sprayed on the plants. After application of the suspected herbicide, its effect on the plants, for example death or suppression of growth, is recorded.
- an in vivo screening assay for inhibitors of the 245, 5283, 2490, 3963 or 4036 activity uses transgenic plants, plant tissue, plant seeds or plant cells capable of overexpressing a nucleotide sequence having 245, 5283, 2490, 3963 or 4036 activity, wherein the 245, 5283, 2490, 3963 or 4036 gene product is enzymatically active in the transgenic plants, plant tissue, plant seeds or plant cells.
- the nucleotide sequence is preferably derived from an eukaryote, such as a yeast, but is preferably derived from a plant.
- the nucleotide sequence is identical or substantially similar to the nucleotide sequence set forth in SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:9, or encodes an enzyme having 245, 5283, 2490, 3963 or 4036 activity, whose amino acid sequence is identical or substantially similar to the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10 respectively.
- the nucleotide sequence is derived from a prokaryote, preferably a bacteria, e.g. E. coli.
- a chemical is then applied to the transgenic plants, plant tissue, plant seeds or plant cells and to the isogenic non-transgenic plants, plant tissue, plant seeds or plant cells, and the growth or viability of the transgenic and non-transformed plants, plant tissue, plant seeds or plant cells are determined after application of the chemical and compared.
- Compounds capable of inhibiting the growth of the non-transgenic plants, but not affecting the growth of the transgenic plants are selected as specific inhibitors of 245, 5283, 2490, 3963 or 4036 activity.
- the present invention is further directed to plants, plant tissue, plant seeds, and plant cells tolerant to herbicides that inhibit the naturally occurring 245, 5283, 2490, 3963 or 4036 activity in these plants, wherein the tolerance is conferred by an altered 245, 5283, 2490, 3963 or 4036 activity respectively.
- Altered 245, 5283, 2490, 3963 or 4036 activity may be conferred upon a plant according to the invention by increasing expression of wild-type herbicide-sensitive 245, 5283, 2490, 3963 or 4036 gene, for example by providing additional wild-type 245, 5283, 2490, 3963 or 4036 genes and/or by overexpressing the - 34 -
- endogenous 245, 5283, 2490, 3963 or 4036 gene respectively for example by driving expression with a strong promoter.
- Altered 245, 5283, 2490, 3963 or 4036 activity also may be accomplished by expressing nucleotide sequences that are substantially similar to SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:9 respectively or homologs thereof in a plant.
- Still further altered 245, 5283, 2490, 3963 or 4036 activity is conferred on a plant by expressing modified herbicide-tolerant 245, 5283, 2490, 3963 or 4036 genes respectively in the plant. Combinations of these techniques may also be used.
- Representative plants include any plants to which these herbicides are applied for their normally intended purpose.
- Achieving altered 245 activity or 5283, 2490, 39634036 activity respectively through increased expression results in a level of 245 activity or 5283, 2490, 3963, 4036 activity respectively in the plant cell at least sufficient to overcome growth inhibition caused by the herbicide when applied in amounts sufficient to inhibit normal growth of control plants.
- the level of expressed enzyme generally is at least two times, preferably at least five times, and more preferably at least ten times the natively expressed amount. Increased expression may be due to multiple copies of a wild-type 245 gene or 5283, 2490, 3963 or 4036 gene respectively; multiple occurrences of the coding sequence within the gene (i.e. gene amplification) or a mutation in the non-coding, regulatory sequence of the endogenous gene in the plant cell.
- Plants having such altered gene activity can be obtained by direct selection in plants by methods known in the art (see, e.g. U.S. Patent No. 5,162,602, and U.S. Patent No. 4,761 ,373, and references cited therein). These plants also may be obtained by genetic engineering techniques known in the art.
- Increased expression of a herbicide-sensitive 245 gene or 5283, 2490, 3963 or 4036 gene respectively can also be accomplished by transforming a plant cell with a recombinant or chimeric DNA molecule comprising a promoter capable of driving expression of an associated structural gene in a plant cell operatively linked to a homologous or heterologous structural gene encoding the 245 protein or the 5283, 2490, 3963 or 4036 protein respectively or a homolog thereof.
- the transformation is stable, thereby providing a heritable transgenic trait.
- plants, plant tissue, plant seeds, or plant cells are stably transformed with a recombinant DNA molecule comprising a suitable promoter functional in plants operatively linked to a coding sequence encoding a herbicide tolerant form of the 245, 5283, 2490, 3963 or 4036 protein respectively.
- a herbicide tolerant form of the enzyme has at least one amino acid substitution, addition or deletion that confers tolerance to a herbicide that inhibits the unmodified, naturally occurring form of the enzyme.
- the transgenic plants, plant tissue, plant seeds, or plant cells thus created are then selected by conventional selection techniques, whereby herbicide tolerant lines are isolated, characterized, and developed. Below are described methods for obtaining genes that encode herbicide tolerant forms of 245, 5283, 2490, 3963 or 4036 protein respectively:
- a genetically manipulatable microbe such as E. coli or S. cerevisiae may be subjected to random mutagenesis in vivo with mutagens such as U V light or ethyl or methyl methane sulfonate.
- mutagens such as U V light or ethyl or methyl methane sulfonate.
- Mutagenesis procedures are described, for example, in Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1972); Davis et al., Advanced Bacterial Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1980); Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1983); and U.S. Patent No. 4,975,374.
- the microbe selected for mutagenesis contains a normal, inhibitor-sensitive 245, 5283, 2490, 3963 or 4036 gene respectively and is dependent upon the activity conferred by this gene.
- the mutagenized cells are grown in the presence of the inhibitor at concentrations that inhibit the unmodified gene. Colonies of the mutagenized microbe that grow better than the unmutagenized microbe in the presence of the inhibitor (i.e. exhibit resistance to the inhibitor) are selected for further analysis.
- 245, 5283, 2490, 3963 or 4036 genes respectively conferring tolerance to the inhibitor are isolated from these colonies, either by cloning or by PCR amplification, and their sequences are elucidated. Sequences encoding altered gene products are then cloned back into the microbe to confirm their ability to confer inhibitor tolerance.
- a method of obtaining mutant herbicide-tolerant alleles of a plant 245, 5283, 2490, 3963 or 4036 gene involves direct selection in plants.
- the effect of a mutagenized 245, 5283, 2490, 3963 or 4036 gene on the growth inhibition of plants such as Arabidopsis, soybean, or maize is determined by plating seeds sterilized by art-recognized methods on plates on a simple minimal salts medium containing increasing concentrations of the inhibitor. Such concentrations are in the range of 0.001 , 0.003, 0.01 , 0.03, 0.1 , 0.3, 1 , 3, 10, 30, 110, 300, 1000 and 3000 parts per million (ppm).
- the lowest dose at which significant growth inhibition can be reproducibly detected is used for subsequent experiments. Determination of the lowest dose is routine in the art.
- Mutagenesis of plant material is utilized to increase the frequency at which resistant alleles occur in the selected population.
- Mutagenized seed material is derived from a variety of sources, including chemical or physical mutagenesis or seeds, or chemical or physical mutagenesis or pollen (Neuffer, In Maize for Biological Research Sheridan, ed. Univ. Press, Grand Forks, ND., pp. 61-64 (1982)), which is then used to fertilize plants and the resulting M-
- M2 seeds (Lehle Seeds, Arlington, AZ), which are progeny seeds of plants grown from seeds mutagenized with chemicals, such as ethyl methane sulfonate, or with physical agents, such as gamma rays or fast neutrons, are plated at densities of up to 10,000 seeds/plate (10 cm diameter) on minimal salts medium containing an appropriate concentration of inhibitor to select for tolerance. Seedlings that continue to grow and remain green 7-21 days after plating are transplanted to soil and grown to maturity and seed set. Progeny of these seeds are tested for tolerance to the herbicide.
- plants whose seed segregate 3:1 / resistant:sensitive are presumed to have been heterozygous for the resistance at the M2 generation. Plants that give rise to all resistant seed are presumed to have been homozygous for the resistance at the M2 generation.
- Such mutagenesis on intact seeds and screening of their M2 progeny seed can also be carried out on other species, for instance soybean (see, e.g. U.S. Pat. No. 5,084,082).
- mutant seeds to be screened for herbicide tolerance are obtained as a result of fertilization with pollen mutagenized by chemical or physical means.
- the alleles are tested for their ability to confer tolerance to the inhibitor on plants into which the putative tolerance-conferring alleles have been transformed. These plants can be either Arabidopsis plants or any other plant whose growth is susceptible to the 245, 5283, 2490, 3963 or 4036 inhibitors respectively . Second, the inserted 245, 5283, 2490, 3963 or 4036 WO-OO/42205 PCT/EP00/00246
- RFLPs restriction fragment length polymorphisms
- Another method of obtaining herbicide-tolerant alleles of a 245, 5283, 2490, 3963 or 4036 gene is by selection in plant cell cultures.
- Explants of plant tissue e.g. embryos, leaf disks, etc. or actively growing callus or suspension cultures of a plant of interest are grown on medium in the presence of increasing concentrations of the inhibitory herbicide or an analogous inhibitor suitable for use in a laboratory environment. Varying degrees of growth are recorded in different cultures. In certain cultures, fast-growing variant colonies arise that continue to grow even in the presence of normally inhibitory concentrations of inhibitor. The frequency with which such faster-growing variants occur can be increased by treatment with a chemical or physical mutagen before exposing the tissues or cells to the inhibitor.
- Putative tolerance-conferring alleles of the 245, 5283, 2490, 3963 or 4036 gene respectively are isolated and tested as described in the foregoing paragraphs. Those alleles identified as conferring herbicide tolerance may then be engineered for optimal expression and transformed into the plant. Alternatively, plants can be regenerated from the tissue or cell cultures containing these alleles.
- Still another method involves mutagenesis of wild-type, herbicide sensitive plant 245, 5283, 2490, 3963 or 4036 genes respectively in bacteria or yeast, followed by culturing the microbe on medium that contains inhibitory concentrations (i.e. sufficient to cause abnormal growth, inhibit growth or cause cell death) of the inhibitor, and then selecting those colonies that grow normally in the presence of the inhibitor.
- a plant cDNA such as the Arabidopsis cDNA encoding the 245, 5283, 2490, 3963 or 4036 protein respectively, is cloned into a microbe that otherwise lacks the 245 5283, 2490, 3963 or 4036 activity respectively.
- the transformed microbe is then subjected to in vivo mutagenesis or to in vitro mutagenesis by any of several chemical or enzymatic methods known in the art, e.g. sodium bisulfite (Shortle et al., Methods Enzymol. 100:457-468 (1983); methoxylamine (Kadonaga et al., Nucleic Acids Res. 13 ⁇ 733-1745 (1985); oligonucleotide-directed saturation mutagenesis (Hutchinson et al, Proc. Natl. Acad. Sci. USA, S3:710-714 (1986); or various polymerase misincorporation strategies (see, e.g. Shortle et al., Proc. Natl.
- Herbicide resistant 245, 5283, 2490, 3963 or 4036 proteins respectively are also obtained using methods involving in vitro recombination, also called DNA shuffling.
- DNA shuffling mutations, preferably random mutations, are introduced into nucleotide sequences encoding 245, 5283, 2490, 3963 or 4036 activity respectively.
- DNA shuffling also leads to the recombination and rearrangement of sequences within a 245, 5283, 2490, 3963 or 4036 gene respectively or to recombination and exchange of sequences between two or more different of 245, 5283, 2490, 3963 or 4036 genes respectively. These methods allow for the production of millions of mutated 245, 5283, 2490, 3963 or 4036 coding sequences respectively.
- mutated genes are screened for desirable properties, e.g. improved tolerance to herbicides and for mutations that provide broad spectrum tolerance to the different classes of inhibitor chemistry. Such screens are well within the skills of a routineer in the art.
- a mutagenized 245, 5283, 2490, 3963 or 4036 gene respectively is formed from at least one template 245, 5283, 2490, 3963 or 4036 gene respectively, wherein the template 245 5283, 2490, 3963 or 4036 gene respectively has been cleaved into double-stranded random fragments of a desired size, and comprising the steps of adding to the resultant population of double-stranded random fragments one or more single or double-stranded oligonucleotides, wherein said oligonucleotides comprise an area of identity and an area of heterology to the double-stranded random fragments; denaturing the resultant mixture of double-stranded random fragments and oligonucleotides into single-stranded fragments; incubating the resultant population of single-stranded fragments with a polymerase under conditions which result in the annealing of said single- stranded fragments at said areas of identity to form pairs of annealed fragments, said
- the resultant mixture in the second step of a further cycle includes the mutagenized double-stranded polynucleotide from the third step of the previous cycle, and the further cycle forms a further mutagenized double-stranded polynucleotide, wherein the mutagenized polynucleotide is a mutated 245, 5283, 2490, 3963 or 4036 gene respectively having enhanced tolerance to a herbicide which inhibits naturally occurring 245, 5283, 2490, 3963 or 4036 activity respectively.
- the concentration of a single species of double-stranded random fragment in the population of double-stranded random fragments is less than 1 % by weight of the total DNA.
- the template double-stranded polynucleotide comprises at least about 100 species of polynucleotides.
- the size of the double-stranded random fragments is from about 5 bp to 5 kb.
- the fourth step of the method comprises repeating the second and the third steps for at least 10 cycles. Such method is described e.g. in Stemmer et al.
- any combination of two or more different 245 genes are mutagenized in vitro by a staggered extension process (StEP), as described e.g. in Zhao et al. (1998) Nature Biotechnology 16: 258-261.
- the two or more 245 genes are used as template for PCR amplification with the extension cycles of the PCR reaction preferably carried out at a lower temperature than the optimal polymerization temperature of the polymerase.
- the StEP is performed with the 5283,2490, 3963, or 4036 genes.
- the temperature for the extension reaction is desirably below 72°C, more desirably below 65°C, preferably below 60°C, more preferably the temperature for the extension reaction is 55°C.
- the duration of the extension reaction of the PCR cycles is desirably shorter than usually carried out in the art, more desirably it is less than 30 seconds, preferably it is less than 15 seconds, more preferably the duration of the extension reaction is 5 seconds. Only a short DNA fragment is polymerized in each extension reaction, allowing template switch of the extension products between the starting DNA molecules after each cycle of denaturation and annealing, thereby generating diversity among the extension products.
- the optimal number of cycles in the PCR reaction depends on the length of the 245, 5283, 2490, 3963 or 4036 genes respectively to be mutagenized but desirably over 40 cycles, more desirably over 60 cycles, preferably over 80 cycles are used.
- Optimal extension conditions and the optimal number of PCR cycles for every combination of 245, 5283, 2490, 3963 or 4036 genes respectively are determined as described in using procedures well-known in the art.
- the other parameters for the PCR reaction are essentially the same as commonly used in the art.
- the primers for the amplification reaction are preferably designed to anneal to DNA sequences located outside of the 245, 5283, 2490, 3963 or 4036 genes, e.g.
- the primers desirably anneal to sequences located less than 500 bp away from 245, 5283, 2490, 3963 or 4036 respectively sequences, preferably less than 200 bp, more preferably less than 120 bp away from the 245, 5283, 2490, 3963 or 4036 sequences respectively.
- the 245, 5283, 2490, 3963 or 4036 sequences respectively are surrounded by restriction sites, which are included in the DNA sequence amplified during the PCR reaction, thereby facilitating the cloning of the amplified products into a suitable vector.
- fragments of 245 5283, 2490, 3963 or 4036 genes respectively having cohesive ends are produced as described in WO 98/05765.
- the cohesive ends are produced by ligating a first oligonucleotide corresponding to a part of a 245, 5283, 2490, 3963 or 4036 gene respectively to a second oligonucleotide not present in the gene or corresponding to a part of the gene not adjoining to the part of the gene corresponding to the first oligonucleotide, wherein the second oligonucleotide contains at least one ribonucleotide.
- a double-stranded DNA is produced using the first oligonucleotide as template and the second oligonucleotide as primer.
- the ribonucleotide is cleaved and removed.
- the nucleotide(s) located 5' to the ribonucleotide is also removed, resulting in double-stranded fragments having cohesive ends. Such fragments are randomly reassembled by ligation to obtain novel combinations of gene sequences.
- any 245, 5283, 2490, 3963 or 4036 gene respectively or any combination of 245 5283, 2490, 3963 or 4036 genes is used for in vitro recombination in the context of the present invention, for example, a 245, 5283, 2490, 3963 or 4036 gene respectively derived from a plant, such as, e.g. Arabidopsis thaliana, e.g. a 245, 5283, 2490, 3963 or 4036 gene respectively set forth in SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:9 respectively, or a 245-like, 5283-like, 2490-like, 3963-like or 4036-like gene respectively from E.
- a 245, 5283, 2490, 3963 or 4036 gene respectively derived from a plant such as, e.g. Arabidopsis thaliana, e.g. a 245, 5283, 2490, 3963 or 4036 gene respectively
- An appropriate host is preferably a host that otherwise lacks 245, 5283, 2490, 3963 or 4036 activity, for example E. coli.
- Host cells transformed with the vectors comprising the library of mutated 245, 5283, 2490, 3963 or 4036 genes respectively are cultured on medium that contains inhibitory concentrations of the inhibitor and those colonies that grow in the presence of the inhibitor are selected. Colonies that grow in the presence of normally inhibitory concentrations of inhibitor are picked and purified by repeated restreaking. Their plasmids are purified and the DNA sequences of cDNA inserts from plasmids that pass this test are then determined.
- An assay for identifying a modified 245, 5283, 2490, 3963 or 4036 gene respectively that is tolerant to an inhibitor may be performed in the same manner as the assay to identify inhibitors of the 245, 5283, 2490, 3963 or 4036 activity respectively (Inhibitor Assay, above) with the following modifications: First, a mutant 245, 5283, 2490, 3963 or 4036 protein respectively is substituted in one of the reaction mixtures for the wild-type 245 5283, 2490, 3963 or 4036 protein respectively of the inhibitor assay. Second, an inhibitor of wild-type enzyme is present in both reaction mixtures.
- mutated activity activity in the presence of inhibitor and mutated enzyme
- unmutated activity activity in the presence of inhibitor and wild-type enzyme
- genes encoding herbicide tolerant 245, 5283, 2490, 3963 or 4036 protein respectively can also be used as selectable markers in plant cell transformation methods.
- plants, plant tissue, plant seeds, or plant cells transformed with a heterologous DNA sequence can also be transformed with a sequence encoding an altered 245, 5283, 2490, 3963 or 4036 activity respectively capable of being expressed by the plant.
- the transformed cells are transferred to medium containing an inhibitor of the enzyme in an amount sufficient to inhibit the growth or survivability of plant cells not expressing the modified coding sequence, wherein only the transformed cells will grow.
- the method is applicable to any plant cell capable of being transformed with a modified 245, 5283, 2490, 3963 or 4036 gene, and can be used with any heterologous DNA sequence of interest.
- Expression of the heterologous DNA sequence and the modified gene can be driven by the same promoter functional in plant cells, or by separate promoters.
- a wild type or herbicide-tolerant form of the 245, 5283, 2490, 3963 or 4036 gene respectively, or homologs thereof, can be incorporated in plant or bacterial cells using conventional recombinant DNA technology. Generally, this involves inserting a DNA molecule encoding the 245, 5283, 2490, 3963 or 4036 gene respectively into an expression system to which the DNA molecule is heterologous (i.e., not normally present) using standard cloning procedures known in the art.
- the vector contains the necessary elements for the transcription and translation of the inserted protein-coding sequences in a host cell containing the vector.
- a large number of vector systems known in the art can be used, such as plasmids, bacteriophage viruses and other modified viruses.
- the components of the expression system may also be modified to increase expression. For example, truncated sequences, nucleotide substitutions, nucleotide optimization or other modifications may be employed.
- Expression systems known in the art can be used to transform virtually any crop plant cell under suitable conditions.
- a heterologous DNA sequence comprising a wild-type or herbicide-tolerant form of the 245, 5283, 2490, 3963 or 4036 gene respectively is preferably stably transformed and integrated into the genome of the host cells.
- self-replicating vectors are viruses, in particular gemini viruses.
- Transformed cells can be regenerated into whole plants such that the chosen form of the 245, 5283, 2490, 3963 or 4036 gene respectively confers herbicide tolerance in the transgenic plants.
- Gene sequences intended for expression in transgenic plants are first assembled in expression cassettes behind a suitable promoter expressible in plants.
- the expression cassettes may also comprise any further sequences required or selected for the expression of the heterologous DNA sequence.
- Such sequences include, but are not restricted to, transcription terminators, extraneous sequences to enhance expression such as introns, vital sequences, and sequences intended for the targeting of the gene product to specific organelles and cell compartments.
- the selection of the promoter used in expression cassettes will determine the spatial and temporal expression pattern of the heterologous DNA sequence in the plant transformed with this DNA sequence.
- Selected promoters will express heterologous DNA sequences in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example) and the selection will reflect the desired location of accumulation of the gene product.
- the selected promoter may drive expression of the gene under various inducing conditions. Promoters vary in their strength, i.e., ability to promote transcription. Depending upon the host cell system utilized, any one of a number of suitable promoters known in the art can be used.
- the CaMV 35S promoter for constitutive expression, the CaMV 35S promoter, the rice actin promoter, or the ubiquitin promoter may be used.
- the chemically inducible PR-1 promoter from tobacco or Arabidopsis may be used (see, e.g., U.S. Patent No. 5,689,044).
- transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the heterologous DNA sequence and its correct polyadenylation. Appropriate transcriptional terminators are those that are known to function in plants and include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator and the pea rbcS E9 terminator. These can be used in both onocotyledonous and dicotyledonous plants.
- intron sequences such as introns of the maize Adhl gene have been shown to enhance expression, particularly in monocotyledonous cells.
- non-translated leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells.
- the coding sequence of the selected gene optionally is genetically engineered by altering the coding sequence for optimal expression in the crop species of interest.
- Methods for modifying coding sequences to achieve optimal expression in a particular crop species are well known (see, e.g. Perlak et al., Proc. Natl. Acad. Sci. USA 88: 3324 (1991); and Koziel et al., Bio/technol. 11: 194 (1993); Fennoy and Bailey-Serres. Nucl. Acids Res. 21 : 5294- 5300 (1993).
- the cDNAs encoding these products can also be manipulated to effect the targeting of heterologous products encoded by DNA sequences to these organelles.
- sequences have been characterized which cause the targeting of products encoded by DNA sequences to other cell compartments.
- Amino terminal sequences are responsible for targeting to the ER, the apoplast, and extracellular secretion from aleurone cells (Koehler & Ho, Plant Cell 2: 769-783 (1990)). Additionally, amino terminal sequences in conjunction with carboxy terminal sequences are responsible for vacuolar targeting of gene products (Shinshi et al. Plant Molec. Biol. 14: 357-368 (1990)).
- transformation vectors available for plant transformation are known to those of ordinary skill in the plant transformation arts, and the genes pertinent to this invention can be used in conjunction with any such vectors.
- the selection of vector w ⁇ l depend upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra.
- vectors are available for transformation using Agrobacterium tumefaciens. These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, Nucl. Acids Res. (1984)). Typical vectors suitable for Agrobacterium transformation include the binary vectors pCIB200 and pCIB2001 , as well as the binary vector pCIB10 and hygromycin selection derivatives thereof. (See, for example, U.S. Patent No. 5,639,949).
- Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation) and microinjection. The choice of vector depends largely on the preferred selection for the species being transformed. Typical vectors suitable for non- Agrobacterium transformation include pCIB3064, pSOG19, and pSOG35. (See, for example, U.S. Patent No. 5,639,949).
- the coding sequence of interest Once the coding sequence of interest has been cloned into an expression system, it is transformed into a plant cell.
- Methods for transformation and regeneration of plants are well known in the art.
- Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake, liposomes, electroporation, micro-injection, and microprojectiles.
- bacteria from the genus Agrobacterium can be utilized to transform plant cells.
- Transformation techniques for, dicotyledons are well known in the art and include Agrobacterium-based techniques and techniques that do not require Agrobacterium.
- Non- Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This can be accomplished by PEG or electroporation mediated uptake, particle bombardment-mediated delivery, or microinjection. In each case the transformed cells are regenerated to whole plants using standard techniques known in the art.
- Transformation of most monocotyledon species has now also become routine.
- Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, particle bombardment into callus tissue, as well as Agro acfer/ m-mediated transformation.
- a nucleotide sequence encoding a polypeptide having 245, 5283, 2490, 3963, or 4036 activity is directly transformed into the plastid genome.
- Plastid expression in which genes are inserted by homologous recombination into the several thousand copies of the circular plastid genome present in each plant cell, takes advantage of the enormous copy number advantage over nuclear-expressed genes to permit expression levels that can readily exceed 10% of the total soluble plant protein.
- the nucleotide sequence is inserted into a plastid targeting vector and transformed into the plastid genome of a desired plant host. Plants homopiasmic for plastid genomes containing the nucleotide sequence are obtained, and are preferentially capable of high expression of the nucleotide sequence.
- Plastid transformation technology is for example extensively described in U.S. Patent Nos. 5,451 ,513, 5,545,817, 5,545,818, and 5,877,462 in PCT application no. WO 95/16783 and WO 97/32977, and in McBride et al. (1994) Proc. Natl. Acad. Sci. USA 91 , 7301-7305, all inco orated herein by reference in their entirety.
- the basic technique for plastid transformation involves introducing regions of cloned plastid DNA flanking a selectable marker together with the nucleotide sequence into a suitable target tissue, e.g., using biolistics or protoplast transformation (e.g., calcium chloride or PEG mediated transformation).
- the 1 to 1.5 kb flanking regions facilitate homologous recombination with the plastid genome and thus allow the replacement or modification of specific regions of the plastome.
- point mutations in the chloroplast 16S rRNA and rps12 genes conferring resistance to spectinomycin and/or streptomycin are utilized as selectable markers for transformation (Svab, Z., Hajdukiewicz, P., and Maliga, P. (1990) Proc. Natl. Acad. Sci. USA 87, 8526-8530; Staub, J. M., and Maliga, P. (1992) Plant Cell 4, 39-45).
- the wild-type or altered form of a 245, 5283, 2490, 3963 or 4036 gene respectively of the present invention can be utilized to confer herbicide tolerance to a wide variety of plant cells, including those of gymnosperms, monocots, and dicots.
- the gene can be inserted into any plant cell falling within these broad classes, it is particularly useful in crop plant cells, such as rice, wheat, barley, rye, com, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum and sugarcane.
- crop plant cells such as rice, wheat, barley, rye, com, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple,
- the high-level expression of a wild-type 245, 5283, 2490, 3963 or 4036 gene respectively and/or the expression of herbicide-tolerant forms of a 245, 5283, 2490, 3963 or 4036 gene respectively conferring herbicide tolerance in plants, in combination with other characteristics important for production and quality, can be incorporated into plant lines through breeding approaches and techniques known in the art.
- a herbicide tolerant 245, 5283, 2490, 3963 or 4036 gene allele respectively is obtained by direct selection in a crop plant or plant cell culture from which a crop plant can be regenerated, it is moved into commercial varieties using traditional breeding techniques to develop a herbicide tolerant crop without the need for genetically engineering the allele and transforming it into the plant.
- Example 1 Sequence Analysis of Tagged Seedling - Lethal Line #245 From the T-DNA Mutagenized Population of Arabidopsis
- the plasmid rescue technique is used to moleculariy clone Arabidopsis genomic DNA flanking one or both sides of T-DNA insertions resulting from T-DNA mutagenesis. Plasmids obtained in this manner are analyzed by restriction enzyme digestion to sort the plasmids into classes based on their digestion pattern. For each class of plasmid clone, the DNA sequence is determined. The resulting sequences are analyzed for the presence of non-T-DNA vector sequences. The plasmids recovered from the plasmid rescue protocol are sequenced using the slp346for primer (SEQ ID NO:11). Primer slp346for provides information on the flanking sequence immediately adjacent to the left T-DNA border.
- Plasmid rescue is validated by PCR of genomic DNA from a homozygote for the 245 mutation.
- This PCR experiment uses a primer anchored in the predicted flanking sequence and the slp346for primer (anchored in the T-DNA insertion). Finding a PCR product of the size expected based on the sequence of the plasmid rescued clone confirms a valid rescue.
- the sequence obtained from primer slp346for is used in a BLASTx search against nucleotide sequence databases (Altschul et al. (1990) J Mol. Biol.215:403-410; Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402.).
- the BLAST search results show that the recovered plant flanking sequence shows a high level of similarity to numerous prokaryotic peptide release factor two proteins.
- the BLAST results indicate that the T-DNA insertion has occurred in the ORF of the first identified plant derived peptide release factor two.
- a DNA fragment that includes peptide release factor sequence similarity is isolated by amplification of Arabidopsis genomic DNA using the polymerase chain reaction. This fragment is used to probe an Arabidopsis cDNA library in the ⁇ YES vector (Elledge et al. (1991) Proc. Natl. Acad. Sci. 88:1731-1735). Positive phage clones are isolated and characterized using standard molecular biology techniques.
- the resultant cDNA clones are excised from the phage and the nucleotide sequence is determined.
- the DNA sequence is shown in SEQ ID NO:1.
- the deduced amino acid sequence is analyzed using the BLASTx search against nucleotide sequence databases (Altschul etal. (1990) J Mol. Biol. 215:403- 410; Altschul etal. (1997) Nucleic Acids Res. 25: 3389-3402).
- the BLAST search results show that the recovered 245 cDNA shows sequence similarity to the same set of prokaryotic peptide release factors.
- the plasmid rescue technique is used to molecularly clone Arabidopsis genomic DNA flanking one or both sides of T-DNA insertions resulting from T-DNA mutagenesis. Plasmids obtained in this manner are analyzed by restriction enzyme digestion to sort the plasmids into classes based on their digestion pattern. For each class of plasmid clone, the DNA sequence is determined. The resulting sequences are analyzed for the presence of non-T-DNA vector sequences. The plasmids recovered from the plasmid rescue protocol are sequenced using the slp346for primer (SEQ ID NO:11). Primer slp346for provides information on the flanking sequence immediately adjacent to the left T-DNA border.
- Plasmid rescue is validated by PCR of genomic DNA from a heterozygote for the 5283 mutation. This PCR experiment uses a primer anchored in the predicted flanking sequence and the slp328 primer (SEQ ID N0:15) (anchored in the T-DNA insertion). Finding a PCR product of the size expected based on the sequence of the plasmid rescued clone confirms a valid rescue.
- primer SLP346for The sequence obtained from primer SLP346for is used in a BLASTn search against nucleotide sequence databases (Altschul etal. (1990) J Mol. Biol. 215:403-410; Altschul et al. (1997) Nucleic Acids Res.25: 3389-3402.).
- the BLAST search results show that the recovered sequence is identical to genomic DNA located in Arabidopsis chromosome I, BAC T13D8 (Genbank accession number AC004473).
- Primer LW60 (SEQ ID NO:16), the reverse complement to nucleotides #32,964-32,987 in the BAC T13D8 sequence (5'- aaacgcttaccatatctctttcta-3'), is designed and used to determine the sequence downstream - of the T-DNA insert; this experiment identifies the junction of the right border.
- the region of genomic DNA where the T-DNA insertion occurred includes bases #32,879 through #32,885 of the annotated BAC T13D8 sequence, resulting in a six-base deletion. This insertion occurs 90 nucleotides upstream of the sequence annotated on BAC T13D8 as encoding a protein similar to S.
- a DNA fragment that includes bases #33,025 through bases #34,338 of the BAC T13D8 sequence is isolated by amplification of Arabidopsis genomic DNA using the polymerase chain reaction. This fragment is used to probe an Arabidopsis cDNA library in the IYES vector (Elledge etal. (1991) Proc. Natl. Acad. Sci. 88:1731-1735). Positive phage clones are isolated and characterized using standard molecular biology techniques. The resultant cDNA clones are excised from the phage and the nucleotide sequence is determined. One full-length clone is identified.
- the deduced amino acid sequence is analyzed using the tBLASTn search against nucleotide sequence databases (Altschul et al. (1990) J Mol. Biol. 215:403-410; Altschul etal. (1997) Nucleic Acids Res. 25: 3389-3402).
- the BLAST search results show that the recovered 5283 cDNA sequence is derived from the same genomic sequence located in Arabidopsis chromosome I, BAC T13D8.
- the intron/exon boundaries of the cDNA sequence are the same as those predicted for the Arabidopsis SIK1 P homolog (Genbank accession number AC004473), with the following exceptions.
- the initiator codon for the 5283 cDNA is encoded by bases #32975 through #32977, followed immediately by an intron at bases #32978 through #33199.
- the plasmid rescue technique is used to moleculariy clone Arabidopsis genomic DNA flanking one or both sides of T-DNA insertions resulting from T-DNA mutagenesis. Plasmids obtained in this manner are analyzed by restriction enzyme digestion to sort the plasmids into classes based on their digestion pattem. For each class of plasmid clone, the DNA sequence is determined. The resulting sequences are analyzed for the presence of non-T-DNA vector sequences. The plasmids recovered from the plasmid rescue protocol are sequenced using the SLP346for primer (5' GCGGACATCTACA I I I I I I GA 3': SEQ ID NO:11).
- Primer SLP346for provides information on the flanking sequence immediately adjacent to the left T-DNA border. Clones for both ends of the T-DNA insertion are recovered as plasmids containing left T-DNA border. Plasmid rescue is validated by Southern blot analysis comparing genomic DNA from a plant heterozygous for the 2490 mutation with genomic DNA from a plant homozygous for the wild-type 2490 gene.
- the probe for the Southern blot is prepared from a PCR product generated with the SLP369 (5' CAGACCACAATACCTTCAAAAATA 3': SEQ ID NO:22) and SLP370 (5' CCATTGTGTCTCCCTCCCGCTGTT 3': SEQ ID NO:23) primers. Finding an additional ⁇ amH1 fragment in the 2490 heterozygote confirms a valid rescue.
- sequences obtained from the above clones are used in a BLASTn search against nucleotide sequence databases (Altschul et al. (1990) J Mol. Biol. 215: 403-410; Altschul et al (1997) Nucleic Acids Res. 25: 3389-3402).
- the search results show that the recovered sequences are identical to genomic DNA from Arabidopsis chromosome 5 P1 clone MTG13 (Genbank # AB008270).
- the Toc36 protein has also been referred to as bce44B, Com44, and Cim44. Because the genomic DNA that contains the 2490 ORF was not annotated correctly until now, the inventors are the first to provide experimental documentation of the correct ORF and sequence similarity for the 2490 gene.
- Example 4 Sequence Analysis of Tagged Seedling - Lethal Line #3963 From the T-DNA Mutagenized Population of Arabidopsis
- the plasmid rescue technique is used to moleculariy clone Arabidopsis genomic DNA flanking one or both sides of T-DNA insertions resulting from T-DNA mutagenesis. Plasmids obtained in this manner are analyzed by restriction enzyme digestion to sort the plasmids into classes based on their digestion pattern. For each class of plasmid clone, the- DNA sequence is determined. The resulting sequences are analyzed for the presence of non-T-DNA vector sequences.
- the plasmids recovered from the plasmid rescue protocol are sequenced using the -21 primer (5 * TGTAAAACGACGGCCAGT 3'; SEQ ID NO:25).
- Primer -21 provides information on the flanking sequence immediately adjacent to the right T-DNA border. Plasmid rescue is validated by PCR of genomic DNA from a heterozygote for the 3963 mutation. This PCR experiment uses a primer anchored in the predicted flanking sequence and the -21 primer (anchored in the T-DNA insertion). Finding a PCR product of the size expected based on the sequence of the plasmid rescued clone confirms a valid rescue.
- the sequence obtained from primer -21 is used in a BLASTn search against nucleotide sequence databases (Altschul etal.
- the BLAST search results show that the recovered plant flanking sequence is 100% identical to the genomic sequence for P1 clone MDK4 on chromosome 5 (Genbank accession number AB010695).
- the T-DNA insertion occurred at base # 36342 of the annotated P1 clone MDK4 sequence, in the gene identified as MDK4.6.
- a tBLASTX analysis of the recovered flanking sequence shows sequence similarity to Mre11 p, a DNA repair protein from Sacchromyces cerevisiae (Genbank accession number U60829).
- a fragment that encodes part of the Arabidopsis 3963 protein is isolated by amplification of Arabidopsis genomic DNA using the polymerase chain reaction. This fragment is used to probe an Arabidopsis cDNA library in the ⁇ YES vector (Elledge etal. (1991) Proc. Natl. Acad. Sci. 88:1731-1735). Positive phage clones are isolated and characterized using standard molecular biology techniques. The resultant cDNA clones are excised from the phage and the nucleotide sequence is determined. One cDNA clone is identified. The cDNA sequence is shown in SEQ ID NO:7.
- the deduced amino acid sequence is analyzed using the BLASTx search against nucleotide sequence databases (Altschul etal. (1990) J Mol. Biol.215:403-410; Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402).
- the BLAST search results show that the recovered 3963 cDNA shows sequence similarity to a number of DNA repair proteins, including Rad32p from Schizosaccharomyces pombe (Genbank accession numberQ09683); hMrel 1 from Homo sapiens (Genbank accession number U37359); and Mre11 p from Saccharomyces cerevisiae (Genbank accession number U60829).
- exon/intron boundaries corresponding to the partial cDNA disclosed herein are: missing 5' end (first known base at 36147), 36147-36172, 36315-36405, 36528-36647, 36728-36796, 36865-36956, 37045-37147, 37247-37354, 37476-37538, 37610-37681, 37785-39092, 39212-39290, 39377-39445, 39532-39776, 39879-40002, 40161-40363, 40478-40508 (stop begins at 40509).
- the plasmid rescue technique is used to molecularly clone Arabidopsis flanking DNA from one or both sides of the T-DNA insertions resulting from T-DNA mutagenesis. Plasmids obtained in this manner are analyzed by restriction enzyme digestion to sort the plasmids into classes based on their digestion pattern. For each class of plasmid clone, the DNA sequence is determined. The resulting sequences are analyzed for the presence of non-T-DNA vector sequences. The plasmids recovered from the plasmid rescue protocol are sequenced using the slp346 primer (5' GCGGACATCTACA I I I I I I GA 3'; SEQ ID NO:11).
- Primer slp346 provides information on the flanking sequence immediately adjacent to the left T-DNA border.
- the plasmid rescue is validated via PCR of template genomic DNA from a heterozygote for the 4036 insertion mutation.
- the experiment uses a primer anchored in the predicted flanking sequence and the slp328 primer (5' ACCTTAGGCGACTTTTGAAC 3'; SEQ ID NO:15; anchored in the T-DNA insertion). Finding a PCR product of the size expected based on the sequence of the plasmid rescue clone confirms a valid rescue.
- the sequence obtained from the above clone is used in a BLASTn search against nucleotide databases (Altschul et al. (1990) J Mol. Biol. 215:403-410; Altschul et al. (1997) Nucleic Acids Res. 25;3389-3402).
- the BLAST results show that the plant flanking sequence is 100% identical to published genomic sequence of P1 MQB2, from chromosome 5 of Arabidopsis (Genbank accession # AB009053).
- the T-DNA insertion occurred at base 31 ,380 of the annotated P1 clone and interrupts a gene identified as MQB2.6.
- the protein encoded by the interrupted open reading frame shows similarity to 1 -deoxy-D-xylulose 5-phosphate reductoisomerase from a number of organisms including Synechocystis sp. (SWISS-PROTQ55663), Bacillus subtilis (SWISS-PROT 031753), and Escherichia coli (SWISS-PROT P45568) (Takahashi et al. (1998) Proc. Natl. Acad. Sci. USA, 95: 9879-9884).
- the genomic region encompassing the ORF is re- annotated with Web GeneMark software (Borodovsky, M. and Mclninch J. (1993) Computers & Chemistry, 17: 123-133).
- Primers are then designed to the 5' and 3' ends of the predicted ORF, and PCR is performed using DNA from the pFL61 Arabidopsis cDNA library (Minet et al. (1992) Plant J. 2: 417-422) as the template.
- the resulting PCR product is TA-ligated and cloned (Original TA Cloning Kit, Invitrogen), and sequenced. Because the genomic DNA that contains the 4036 ORF was not annotated correctly in the prior art with respect to the exon/intron boundaries, the inventors are the first to provide experimental documentation of the correct ORF for the 4036 gene.
- the internal exon/intron boundaries for the cDNA disclosed herein are: 31640.. 31448, 31294..31202, 30965..30843, 30777..30722, 30636..30473, 30355..30287, 30193..30082, 29995..29891, 29804..29684, 29394..29247.
- the coding region of the protein corresponding to the cDNA clone SEQ ID NO: 1 , is subcloned into previously described expression vectors, and transformed into E. coli using the manufacturer's conditions. Specific examples include plasmids such as pBluescript (Stratagene, La Jolla, CA), pFLAG (International Biotechnologies, Inc., New Haven, CT), and pTrcHis (Invitrogen, La Jolla, CA). E. coli is cultured, and expression of the 245 activity is confirmed. Protein conferring 245 activity is isolated using standard techniques.
- the coding region of the protein is subcloned into previously described expression vectors, and transformed into E. coli using the manufacturer's conditions. Specific examples include plasmids such as pBluescript (Stratagene, La Jolla, CA), pFLAG (International Biotechnologies, Inc., New Haven, CT), and pTrcHis (Invitrogen, La Jolla, CA). E. coli is cultured, and expression of the 5283 activity is confirmed. Protein conferring 5283 activity is isolated using standard techniques.
- the coding region of the protein is subcloned into previously described expression vectors, and transformed into E. coli using the manufacturer's conditions.
- Specific examples include plasmids such as pBluescript (Stratagene, La Jolla, CA), pFLAG (International Biotechnologies, Inc., New Haven, CT), and pTrcHis (Invitrogen, La Jolla, CA).
- E. coli is cultured, and expression of the 2490 activity is confirmed. Protein conferring 2490 activity is isolated using standard techniques.
- the coding region of the protein corresponding to the cDNA clone SEQ ID NO: 7, is subcloned into previously described expression vectors, and transformed into E. coli using the manufacturer's conditions. Specific examples include plasmids such as pBluescript (Stratagene, La Jolla, CA), pFLAG (International Biotechnologies, Inc., New Haven, CT), and pTrcHis (Invitrogen, La Jolla, CA). E. coli is cultured, and expression of the 3963 activity is confirmed. Protein conferring 3963 activity is isolated using standard techniques.
- the coding region of the protein is subcloned into previously described expression vectors, and transformed into E. coli using the manufacturer's conditions.
- Specific examples include plasmids such as pBluescript (Stratagene, La Jolla, CA), pFLAG (International Biotechnologies, Inc., New Haven, CT), and pTrcHis (Invitrogen, La Jolla, CA).
- E. coli is cultured, and expression of the 4036 activity is confirmed. Protein conferring 4036 activity is isolated using standard techniques.
- the nucleotide sequence of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:9, respectively, is amplified by PCR.
- the resulting DNA fragment is digested by DNasel treatment essentially as described (Stemmer et al. (1994) PNAS 91 : 10747- 10751) and the PCR primers are removed from the reaction mixture.
- a PCR reaction is carried out without primers and is followed by a PCR reaction with the primers, both as described (Stemmer et al. (1994) PNAS 91 : 10747-10751).
- the resulting DNA fragments are cloned into pTRC99a (Pharmacia, Cat no: 27-5007-01) for use in bacteria, or into pESC vectors (Stratagene Catalog) for use in yeast; and transformed into a bacterial or yeast strain deficient in 245, 5283, 2490, 3963, or 4036 activity, respectively, by electroporation using the Biorad Gene Pulser and the manufacturer's conditions.
- the transformed bacteria or yeast are grown on medium that contains inhibitory concentrations of an inhibitor of 245, 5283, 2490, 3963, or 4036 activity and those colonies that grow in the presence of the inhibitor are selected. Colonies that grow in the presence of normally inhibitory concentrations of inhibitor are picked and purified by repeated restreaking. Their plasmids are purified and the DNA sequences of cDNA inserts from plasmids that pass this test are then determined.
- PCR-amplified DNA fragments comprising the A. thaliana 245, 5283, 2490, 3963, or 4036 gene, respectively, encoding the protein and PCR-amplified DNA fragments comprising the 245, 5283, 2490, 3963, or 4036 gene, respectively, from E. coli are recombined in vitro and resulting variants with improved tolerance to the inhibitor are recovered as described above.
- Example 8a In vitro Recombination of 245 Genes by Staggered Extension Process WO DO/42205 PCT/EPOO/00246
- the A. thallana 245 gene encoding the 245 protein and the E.coll 245 gene are each cloned into the polylinker of a pBluescript vector.
- a PCR reaction is carried out essentially as described (Zhao et al. (1998) Nature Biotechnology 16: 258-261) using the "reverse primer” and the "M13 -20 primer” (Stratagene Catalog). Amplified PCR fragments are digested with appropriate restriction enzymes and cloned into pTRC99a and mutated 245 genes are screened as described in Example 7.
- the A. thaliana 5283 gene encoding the 5283 protein and the E.coll 5283 gene are each cloned into the polylinker of a pBluescript vector.
- a PCR reaction is carried out essentially as described (Zhao et al. (1998) Nature Biotechnology 16: 258-261) using the "reverse primer” and the "M13 -20 primer” (Stratagene Catalog). Amplified PCR fragments are digested with appropriate restriction enzymes and cloned into pTRC99a and mutated 5283 genes are screened as described in Example 7.
- the A. thallana 2490 gene encoding the 2490 protein and the E.coll 2490 gene are each cloned into the polylinker of a pBluescript vector.
- a PCR reaction is carried out essentially as described (Zhao et al. (1998) Nature Biotechnology 16: 258-261) using the "reverse primer” and the "M13 -20 primer” (Stratagene Catalog). Amplified PCR fragments are digested with appropriate restriction enzymes and cloned into pTRC99a and mutated 2490 genes are screened as described in Example 7.
- the A. thaliana 3963 gene encoding the 3963 protein and the E.coll 3963 gene are each cloned into the polylinker of a pBluescript vector.
- a PCR reaction is carried out essentially as described (Zhao et al. (1998) Nature Biotechnology 16: 258-261) using the "reverse primer” and the "M13 -20 primer” (Stratagene Catalog). Amplified PCR fragments are digested with appropriate restriction enzymes and cloned into pTRC99a and mutated 3963 genes are screened as described in Example 7.
- the A. thaliana 4036 gene encoding the 4036 protein and the E.coli 4036 gene are each- cloned into the polylinker of a pBluescript vector.
- a PCR reaction is carried out essentially as described (Zhao et al. (1998) Nature Biotechnology 16: 258-261) using the "reverse primer” and the "M13 -20 primer” (Stratagene Catalog). Amplified PCR fragments are digested with appropriate restriction enzymes and cloned into pTRC99a and mutated 4036 genes are screened as described in Example 7.
- Recombinant 245, 5283, 2490, 3963, or 4036 protein is obtained, for example, according to Example 6a,6b,6c,6d,or 6e, respectively.
- the protein is immobilized on chips appropriate for ligand binding assays using techniques which are well known in the art.
- the protein immobilized on the chip is exposed to sample compound in solution according to methods well know in the art. While the sample compound is in contact with the immobilized protein measurements capable of detecting protein-ligand interactions are conducted. Examples of such measurements are SELDI, biacore and FCS, described above. Compounds found to bind the protein are readily discovered in this fashion and are subjected to further characterization.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU22909/00A AU2290900A (en) | 1999-01-15 | 2000-01-13 | Herbicide target gene and methods |
JP2000593762A JP2002534128A (en) | 1999-01-15 | 2000-01-13 | Genes targeted by herbicides and methods for targeting the genes |
CA002362484A CA2362484A1 (en) | 1999-01-15 | 2000-01-13 | Herbicide target gene and methods |
EP00901557A EP1141344A2 (en) | 1999-01-15 | 2000-01-13 | Herbicide target gene and methods |
HK02101120.9A HK1041287A1 (en) | 1999-01-15 | 2002-02-15 | Herbicide target gene and methods |
Applications Claiming Priority (10)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US23276099A | 1999-01-15 | 1999-01-15 | |
US23747999A | 1999-01-26 | 1999-01-26 | |
US24428899A | 1999-02-03 | 1999-02-03 | |
US25233699A | 1999-02-18 | 1999-02-18 | |
US28137699A | 1999-03-30 | 1999-03-30 | |
US09/281,376 | 1999-03-30 | ||
US09/252,336 | 1999-03-30 | ||
US09/244,288 | 1999-03-30 | ||
US09/237,479 | 1999-03-30 | ||
US09/232,760 | 1999-03-30 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2000042205A2 true WO2000042205A2 (en) | 2000-07-20 |
WO2000042205A3 WO2000042205A3 (en) | 2000-12-07 |
Family
ID=27540005
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2000/000246 WO2000042205A2 (en) | 1999-01-15 | 2000-01-13 | Herbicide target gene and methods |
Country Status (7)
Country | Link |
---|---|
EP (1) | EP1141344A2 (en) |
JP (1) | JP2002534128A (en) |
CN (1) | CN1341151A (en) |
AU (1) | AU2290900A (en) |
CA (1) | CA2362484A1 (en) |
HK (1) | HK1041287A1 (en) |
WO (1) | WO2000042205A2 (en) |
Cited By (21)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000065036A2 (en) * | 1999-04-27 | 2000-11-02 | Basf Aktiengesellschaft | Overexpression of a dna sequence coding for a 1-desoxy-d-xylulose-5-phosphate reductoisomerase in plants |
EP1072683A1 (en) * | 1998-04-14 | 2001-01-31 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing isoprenoid compounds by using microorganisms and method for detecting compounds having antibacterial or herbicidal activity |
WO2001009341A2 (en) * | 1999-07-30 | 2001-02-08 | Bayer Aktiengesellschaft | Method of determining the activity of 1-deoxy-d-xylulose-5-phosphate reductoisomerase and 1-deoxy-d-xylulose-5-phosphate synthase |
WO2001081602A2 (en) * | 2000-04-19 | 2001-11-01 | Pioneer Hi-Bred International, Inc. | Mre11 orthologue and uses thereof |
WO2002012273A2 (en) * | 2000-08-03 | 2002-02-14 | Syngenta Participations Ag | Herbicide target genes and methods |
EP1217074A1 (en) * | 2000-12-22 | 2002-06-26 | Universiteit Leiden | Nucleic acid integration in eukaryotes |
WO2002064794A2 (en) * | 2001-01-11 | 2002-08-22 | Syngenta Participations Ag | Herbicide target genes and methods |
WO2003008440A2 (en) * | 2001-07-16 | 2003-01-30 | Syngenta Participations Ag | Nucleic acid molecules encoding proteins essential for plant growth |
GB2392444A (en) * | 2002-08-29 | 2004-03-03 | Syngenta Participations Ag | Nucleic acid molecules encoding proteins essential for plant growth and development and uses thereof |
WO2004022780A2 (en) * | 2002-08-16 | 2004-03-18 | Metanomics Gmbh & Co. Kgaa | Method for identifying substances having a herbicide action |
US6841717B2 (en) | 2000-08-07 | 2005-01-11 | Monsanto Technology, L.L.C. | Methyl-D-erythritol phosphate pathway genes |
US6872815B1 (en) | 2000-10-14 | 2005-03-29 | Calgene Llc | Nucleic acid sequences to proteins involved in tocopherol synthesis |
JP2005532790A (en) * | 2002-03-20 | 2005-11-04 | ビーエーエスエフ アクチェンゲゼルシャフト | Serine hydroxymethyltransferase as a herbicide target |
US7067647B2 (en) | 1999-04-15 | 2006-06-27 | Calgene Llc | Nucleic acid sequences to proteins involved in isoprenoid synthesis |
US7112717B2 (en) | 2002-03-19 | 2006-09-26 | Monsanto Technology Llc | Homogentisate prenyl transferase gene (HPT2) from arabidopsis and uses thereof |
US7161061B2 (en) | 2001-05-09 | 2007-01-09 | Monsanto Technology Llc | Metabolite transporters |
US7230165B2 (en) | 2002-08-05 | 2007-06-12 | Monsanto Technology Llc | Tocopherol biosynthesis related genes and uses thereof |
US7238855B2 (en) | 2001-05-09 | 2007-07-03 | Monsanto Technology Llc | TyrA genes and uses thereof |
US7244877B2 (en) | 2001-08-17 | 2007-07-17 | Monsanto Technology Llc | Methyltransferase from cotton and uses thereof |
US7262339B2 (en) | 2001-10-25 | 2007-08-28 | Monsanto Technology Llc | Tocopherol methyltransferase tMT2 and uses thereof |
EP2833712A4 (en) * | 2012-04-05 | 2015-10-21 | Mendel Biotechnology Inc | Herbicidal compound screening |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5013659A (en) * | 1987-07-27 | 1991-05-07 | E. I. Du Pont De Nemours And Company | Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase |
US5162602A (en) * | 1988-11-10 | 1992-11-10 | Regents Of The University Of Minnesota | Corn plants tolerant to sethoxydim and haloxyfop herbicides |
EP0154204B1 (en) * | 1984-03-06 | 1994-01-12 | Mgi Pharma, Inc. | Herbicide resistance in plants |
WO2000015809A2 (en) * | 1998-09-15 | 2000-03-23 | Syngenta Participations Ag | Uracil permease from arabidopsis as herbicidal target gene |
-
2000
- 2000-01-13 EP EP00901557A patent/EP1141344A2/en not_active Withdrawn
- 2000-01-13 JP JP2000593762A patent/JP2002534128A/en active Pending
- 2000-01-13 CA CA002362484A patent/CA2362484A1/en not_active Abandoned
- 2000-01-13 AU AU22909/00A patent/AU2290900A/en not_active Abandoned
- 2000-01-13 CN CN00803955A patent/CN1341151A/en active Pending
- 2000-01-13 WO PCT/EP2000/000246 patent/WO2000042205A2/en not_active Application Discontinuation
-
2002
- 2002-02-15 HK HK02101120.9A patent/HK1041287A1/en unknown
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0154204B1 (en) * | 1984-03-06 | 1994-01-12 | Mgi Pharma, Inc. | Herbicide resistance in plants |
US5013659A (en) * | 1987-07-27 | 1991-05-07 | E. I. Du Pont De Nemours And Company | Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase |
US5162602A (en) * | 1988-11-10 | 1992-11-10 | Regents Of The University Of Minnesota | Corn plants tolerant to sethoxydim and haloxyfop herbicides |
WO2000015809A2 (en) * | 1998-09-15 | 2000-03-23 | Syngenta Participations Ag | Uracil permease from arabidopsis as herbicidal target gene |
Non-Patent Citations (11)
Title |
---|
AZPIROZ-LEEHAN R ET AL: "T-DNA insertion mutagenesis in Arabidopsis: going back and forth" TRENDS IN GENETICS,NL,ELSEVIER SCIENCE PUBLISHERS B.V. AMSTERDAM, vol. 13, no. 4, 1 April 1997 (1997-04-01), pages 152-156, XP004056902 ISSN: 0168-9525 * |
DATABASE EMBL NUCLEOTIDE AND PROTEIN SEQUENCES,1 April 1998 (1998-04-01), XP002140499 HINXTON, GB cited in the application * |
DATABASE EMBL NUCLEOTIDE AND PROTEIN SEQUENCES,1 December 1992 (1992-12-01), XP002140497 HINXTON, GB cited in the application * |
DATABASE EMBL NUCLEOTIDE AND PROTEIN SEQUENCES,1 February 1997 (1997-02-01), XP002140500 HINXTON, GB cited in the application * |
DATABASE EMBL NUCLEOTIDE AND PROTEIN SEQUENCES,1 November 1997 (1997-11-01), XP002140498 HINXTON, GB cited in the application * |
DATABASE EMBL NUCLEOTIDE AND PROTEIN SEQUENCES,13 October 1997 (1997-10-13), XP002140496 HINXTON, GB * |
FELDMANN K A ET AL: "A DWARF MUTANT OF ARABIDOPSIS GENERATED BY T-DNA INSERTION MUTAGENESIS" SCIENCE,US,AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,, vol. 243, 10 March 1989 (1989-03-10), pages 1351-1354, XP002036944 ISSN: 0036-8075 * |
ITO KOICHI ET AL: "Single amino acid substitution in prokaryote polypeptide release factor 2 permits it to terminate translation at all three stop codons." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA JULY 7, 1998, vol. 95, no. 14, 7 July 1998 (1998-07-07), pages 8165-8169, XP002140501 ISSN: 0027-8424 cited in the application * |
KONCZ ET AL: "isolation of a gene encoding a novel chloroplast protein by T-DNA tagging in Arabidopsis thaliana" EMBO JOURNAL,GB,OXFORD UNIVERSITY PRESS, SURREY, vol. 5, no. 9, 1 January 1990 (1990-01-01), pages 1337-1346, XP002076478 ISSN: 0261-4189 * |
TOPPING JENNIFER F ET AL: "Mutations in the HYDRA1 gene of Arabidoposis perturb cell shape and disrupt embryonic and seedling morphogenesis." DEVELOPMENT (CAMBRIDGE) NOV., 1997, vol. 124, no. 21, November 1997 (1997-11), pages 4415-4424, XP000920674 ISSN: 0950-1991 * |
ZHOU D -X ET AL: "COP1b, an isoform of COP1 generated by alternative splicing, has a negative effect on COP1 function in regulating light-dependent seedling development in Arabidopsis." MOLECULAR & GENERAL GENETICS FEB., 1998, vol. 257, no. 4, February 1998 (1998-02), pages 387-391, XP000920653 ISSN: 0026-8925 * |
Cited By (47)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1072683A4 (en) * | 1998-04-14 | 2004-10-06 | Kyowa Hakko Kogyo Kk | Process for producing isoprenoid compounds by using microorganisms and method for detecting compounds having antibacterial or herbicidal activity |
EP1072683A1 (en) * | 1998-04-14 | 2001-01-31 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing isoprenoid compounds by using microorganisms and method for detecting compounds having antibacterial or herbicidal activity |
US7208298B2 (en) | 1998-04-14 | 2007-04-24 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing isoprenoid compounds by microorganisms and a method for screening compounds with antibiotic or weeding activity |
US7364885B2 (en) | 1998-04-14 | 2008-04-29 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing isoprenoid compounds by microorganisms and a method for screening compounds with antibiotic or weeding activity |
US7531333B2 (en) | 1998-04-14 | 2009-05-12 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing isoprenoid compounds by microorganisms and a method for screening compounds with antibiotic or weeding activity |
US7132268B2 (en) | 1998-04-14 | 2006-11-07 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing isoprenoid compounds by microorganisms and a method for screening compounds with antibiotic or weeding activity |
US7265207B2 (en) | 1999-04-15 | 2007-09-04 | Calgene Llc | Nucleic acid sequences to proteins involved in tocopherol synthesis |
US7335815B2 (en) | 1999-04-15 | 2008-02-26 | Calgene Llc | Nucleic acid sequences to proteins involved in isoprenoid synthesis |
US7067647B2 (en) | 1999-04-15 | 2006-06-27 | Calgene Llc | Nucleic acid sequences to proteins involved in isoprenoid synthesis |
US7141718B2 (en) | 1999-04-15 | 2006-11-28 | Calgene Llc | Nucleic acid sequences to proteins involved in tocopherol synthesis |
WO2000065036A3 (en) * | 1999-04-27 | 2001-04-19 | Basf Ag | Overexpression of a dna sequence coding for a 1-desoxy-d-xylulose-5-phosphate reductoisomerase in plants |
WO2000065036A2 (en) * | 1999-04-27 | 2000-11-02 | Basf Aktiengesellschaft | Overexpression of a dna sequence coding for a 1-desoxy-d-xylulose-5-phosphate reductoisomerase in plants |
WO2001009341A3 (en) * | 1999-07-30 | 2001-08-23 | Bayer Ag | Method of determining the activity of 1-deoxy-d-xylulose-5-phosphate reductoisomerase and 1-deoxy-d-xylulose-5-phosphate synthase |
WO2001009341A2 (en) * | 1999-07-30 | 2001-02-08 | Bayer Aktiengesellschaft | Method of determining the activity of 1-deoxy-d-xylulose-5-phosphate reductoisomerase and 1-deoxy-d-xylulose-5-phosphate synthase |
US7060480B2 (en) | 2000-04-19 | 2006-06-13 | Pioneer Hi-Bred International, Inc. | MRE11 orthologue and uses thereof |
WO2001081602A3 (en) * | 2000-04-19 | 2002-04-11 | Pioneer Hi Bred Int | Mre11 orthologue and uses thereof |
US6646182B2 (en) | 2000-04-19 | 2003-11-11 | Pioneer Hi-Bred International, Inc. | Mre11 orthologue and uses thereof |
WO2001081602A2 (en) * | 2000-04-19 | 2001-11-01 | Pioneer Hi-Bred International, Inc. | Mre11 orthologue and uses thereof |
WO2002012273A2 (en) * | 2000-08-03 | 2002-02-14 | Syngenta Participations Ag | Herbicide target genes and methods |
WO2002012273A3 (en) * | 2000-08-03 | 2003-05-30 | Syngenta Participations Ag | Herbicide target genes and methods |
US7405343B2 (en) | 2000-08-07 | 2008-07-29 | Monsanto Technology Llc | Methyl-D-erythritol phosphate pathway genes |
US6841717B2 (en) | 2000-08-07 | 2005-01-11 | Monsanto Technology, L.L.C. | Methyl-D-erythritol phosphate pathway genes |
US6872815B1 (en) | 2000-10-14 | 2005-03-29 | Calgene Llc | Nucleic acid sequences to proteins involved in tocopherol synthesis |
US7420101B2 (en) | 2000-10-14 | 2008-09-02 | Calgene Llc | Nucleic acid sequences to proteins involved in tocopherol synthesis |
US8362324B2 (en) | 2000-10-14 | 2013-01-29 | Monsanto Technology Llc | Nucleic acid sequences to proteins involved in tocopherol synthesis |
WO2002052026A3 (en) * | 2000-12-22 | 2002-09-06 | Univ Leiden | Nucleic acid integration in eukaryotes |
WO2002052026A2 (en) * | 2000-12-22 | 2002-07-04 | Universiteit Leiden | Nucleic acid integration in eukaryotes |
EP1217074A1 (en) * | 2000-12-22 | 2002-06-26 | Universiteit Leiden | Nucleic acid integration in eukaryotes |
WO2002064794A3 (en) * | 2001-01-11 | 2003-10-02 | Syngenta Participations Ag | Herbicide target genes and methods |
WO2002064794A2 (en) * | 2001-01-11 | 2002-08-22 | Syngenta Participations Ag | Herbicide target genes and methods |
US7238855B2 (en) | 2001-05-09 | 2007-07-03 | Monsanto Technology Llc | TyrA genes and uses thereof |
US7161061B2 (en) | 2001-05-09 | 2007-01-09 | Monsanto Technology Llc | Metabolite transporters |
WO2003008440A3 (en) * | 2001-07-16 | 2004-04-01 | Syngenta Participations Ag | Nucleic acid molecules encoding proteins essential for plant growth |
WO2003008440A2 (en) * | 2001-07-16 | 2003-01-30 | Syngenta Participations Ag | Nucleic acid molecules encoding proteins essential for plant growth |
US7553952B2 (en) | 2001-08-17 | 2009-06-30 | Monsanto Technology Llc | Gamma tocopherol methyltransferase coding sequence identified in Cuphea and uses thereof |
US7244877B2 (en) | 2001-08-17 | 2007-07-17 | Monsanto Technology Llc | Methyltransferase from cotton and uses thereof |
US7605244B2 (en) | 2001-08-17 | 2009-10-20 | Monsanto Technology Llc | Gamma tocopherol methyltransferase coding sequence from Brassica and uses thereof |
US7595382B2 (en) | 2001-08-17 | 2009-09-29 | Monsanto Technology Llc | Gamma tocopherol methyltransferase coding sequences from Brassica and uses thereof |
US7262339B2 (en) | 2001-10-25 | 2007-08-28 | Monsanto Technology Llc | Tocopherol methyltransferase tMT2 and uses thereof |
US7112717B2 (en) | 2002-03-19 | 2006-09-26 | Monsanto Technology Llc | Homogentisate prenyl transferase gene (HPT2) from arabidopsis and uses thereof |
JP2005532790A (en) * | 2002-03-20 | 2005-11-04 | ビーエーエスエフ アクチェンゲゼルシャフト | Serine hydroxymethyltransferase as a herbicide target |
US7230165B2 (en) | 2002-08-05 | 2007-06-12 | Monsanto Technology Llc | Tocopherol biosynthesis related genes and uses thereof |
WO2004022780A2 (en) * | 2002-08-16 | 2004-03-18 | Metanomics Gmbh & Co. Kgaa | Method for identifying substances having a herbicide action |
WO2004022780A3 (en) * | 2002-08-16 | 2004-07-01 | Metanomics Gmbh & Co Kgaa | Method for identifying substances having a herbicide action |
GB2392444A (en) * | 2002-08-29 | 2004-03-03 | Syngenta Participations Ag | Nucleic acid molecules encoding proteins essential for plant growth and development and uses thereof |
EP2833712A4 (en) * | 2012-04-05 | 2015-10-21 | Mendel Biotechnology Inc | Herbicidal compound screening |
US9612235B2 (en) | 2012-04-05 | 2017-04-04 | Koch Biological Solutions, Llc | Herbicidal compound screening |
Also Published As
Publication number | Publication date |
---|---|
HK1041287A1 (en) | 2002-07-05 |
CN1341151A (en) | 2002-03-20 |
CA2362484A1 (en) | 2000-07-20 |
JP2002534128A (en) | 2002-10-15 |
AU2290900A (en) | 2000-08-01 |
EP1141344A2 (en) | 2001-10-10 |
WO2000042205A3 (en) | 2000-12-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2000042205A2 (en) | Herbicide target gene and methods | |
CA2918565A1 (en) | Improved yield and stress tolerance in transgenic plants with overexpressing polypeptides comprising a b-box zinc-finger domain | |
US6387637B1 (en) | Herbicide target genes and method | |
WO2000015809A2 (en) | Uracil permease from arabidopsis as herbicidal target gene | |
EP1621614A2 (en) | Herbicide target genes and methods | |
WO2000053782A2 (en) | Herbicide target genes and methods | |
AU744487B2 (en) | Riboflavin biosynthesis genes from plants and uses thereof | |
US6300091B1 (en) | Herbicide target genes and methods | |
US20020120963A1 (en) | Herbicide target genes and methods | |
US20020127537A1 (en) | Herbicide target genes and methods | |
EP1240185A2 (en) | Herbicide target genes and methods | |
US6294345B1 (en) | Genes encoding proteins essential for plant growth and methods of use | |
EP1093520A1 (en) | Hmp-p kinase and tmp-ppase from arabidopsis thaliana and their use in herbicide screening | |
US20030200569A1 (en) | Amino acid:glyoxylate aminotransferase genes from plants and uses thereof | |
WO2001079514A2 (en) | Amino acid:glyoxylate aminotransferase genes from plants and uses thereof | |
WO2002064794A2 (en) | Herbicide target genes and methods | |
US20020157142A1 (en) | Herbicide target genes and methods | |
US6271445B1 (en) | Nucleic acid molecules encoding 5′-phosphoribosyl-5-aminoimidazole (AIR) synthetase | |
EP1090135A2 (en) | Methods to screen herbicidal compounds utilizing air synthetase from arabidopsis thaliana |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 00803955.0 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: 22909/00 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2362484 Country of ref document: CA Ref document number: 2362484 Country of ref document: CA Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: IN/PCT/2001/975/CHE Country of ref document: IN |
|
ENP | Entry into the national phase |
Ref document number: 2000 593762 Country of ref document: JP Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000901557 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2000901557 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000901557 Country of ref document: EP |