WO2000037682A1 - Method for augmenting expression of a foreign gene - Google Patents

Abstract

A method for augmenting transient or stable expression of a foreign gene in cultured eukaryotic cells comprises transfecting a host cell with a foreign gene of interest and with a nucleic acid sequence encoding a bHLH protein or active fragment or homolog thereof, such that expression of the foreign gene is either increased or prolonged or both. The method can be used to produce large amounts of a transgenic gene product in cultured cells. Vectors for carrying out the method are also provided.

Description

METHOD FOR AUGMENTING EXPRESSION OF A FOREIGN GENE

Cross-Reference to Related Applications

This application is related to provisional application Ser. No. 60/113261 filed December 21, 1998 from which priority is claimed under 35 USC. sctn 119(e) (1) and which is incorporated herein by reference in its entirety.

Field of the Invention

The present invention relates to the field of expression of foreign nucleic acid in cultured cells, and in particular to a method of increasing expression levels or prolonging the period of expression of foreign genes of interest in cultured eukaryotic cells.

Background of the Invention

Transfection is the transfer of nucleic acid into a living cell. It is the most commonly used procedure for introducing foreign genes into living cells in culture for their subsequent expression and analysis . The expression of such transferred nucleic sequences of interest ("foreign genes") is used for a variety of purposes including confirmation that a gene of interest can direct the synthesis of a desired protein and evaluating the effect of specific mutations introduced into a gene of interest. Other uses include, but are not limited to, directly isolating a gene by screening or selecting recipient cells which produce a previously identified protein, producing large amounts of a protein that normally is available in only limited quantity, and analyzing the biological consequences of expressing a specific protein.

Studies of gene expression and methods for maximizing protein production through recombinant gene expression often rely on creation of "clonal" or "stable" cell lines, whereby a foreign gene of interest, along with regulatory sequences required for expression of the gene, are incorporated into the chromosomal DNA of a host cell and the gene is stably expressed. In transfection reactions, typically only a small percentage of the host cells take up the recombinant DNA. In a small percentage of those cells, the DNA will integrate into the host cell chromosome and be stably expressed. Creation of such stable cell lines using eukaryotic cells which include yeast, insect, and mammalian cells is time-consuming, labor intensive, and costly. In addition, the chromosomal location of an inserted foreign gene can have a significant effect on the expression level of the foreign gene. High levels of protein production are not easily obtained from stable cell lines m mammalian systems. In addition, eukaryotic host cells typically have stringent requirements for growth m culture and have slow growth rates.

Alternatively, gene expression can be obtained by introducing a foreign gene of interest, along with regulatory sequence required for expression of the gene, into cells and soon afterward measuring the resulting expression of the gene. This method is known as transient expression because the gene is not expected to integrate into the host cell genome. In this method, a plasmid containing a foreign gene of interest: and regulatory sequence required for expression of the gene are transfected into eukaryotic cells. The transfection event and subsequent transient expression typically limits the life of these cells to only several generations; thus, only limited quantitites of the desired protein encoded by the gene of interest are produced while the cells are alive. Because such transient -expression cell systems are shortlived, they are not the system of choice for commercial protein production. Transient expression of a foreign gene transfected into host cells is typically analyzed within 48 hours after transfection. Such assay systems are most frequently used to verify the identity of cloned genes based on their ability to express a protein with a particular activity, to rapidly study the effect of engineered mutations on either gene activity or protein function, and to isolate genes from cDNA libraries.

Transient assay systems are also useful for analyzing transcription activity in cells. This process often involves the use of reporter genes, whereby a reporter gene or cDNA is joined to one, or several, regulatory sequences, such as a promoter or enhancer sequence under investigation in an expression vector. The reporter gene may be any gene whose product can serve as a marker for the detection of gene expression. Following transfection of eukaryotic cells with a vector expressing a reporter gene, the cells are assayed for expression of the reporter gene by directly measuring the amount of either the reporter mRNA, the reporter protein, or the enzymatic activity of the reporter protein produced in the cells. Measurement of the reporter gene product provides an indirect estimate of the regulation of gene expression that is controlled by the regulatory sequence. Transcriptional activities investigated by the use of reporter systems include the effects of promoter and enhancer sequences and trans acting regulators such as transcription factors, as well as, mRNA processing and synthesis of the protein from the transcript. Reporter systems are also used in other contexts, such as monitoring transfection efficiencies, protein-protein interactions, and recombination events. Reporter genes may be used for these types of investigations in both in vi tro and in vivo applications . However, there are several limitations to the use of transient expression systems. It is difficult to scale up these reactions for production of large quantities of expressed protein. This is especially true for mammalian cells, where high levels of protein production are not easily obtained m culture. Such cells typically have more stringent requirements for growth m culture, as well as slower growth rates. Protein production is particularly problematic when the foreign gene codes for a protein that is poorly expressed. It is also more difficult to study the consequences of gene expression when only a portion of the total population of host cells is transformed. Furthermore, transient expression of a foreign gene generally peaks at approximately 48 hours post- transfection, and then falls to low levels. It is unclear why the expression levels decrease after more than 48 hours post-transfection. But this decrease m gene expression limits the utility of transient gene expression to the time period of 24 to 48 hours following transfection. It further limits the utility of transient transfection in many cases to those genes that are expressed at high levels .

It would therefore be advantageous to increase or prolong post-transfection gene expression m cells transiently or stably expressing a foreign gene of interest as a result of transfection. It would also be advantageous to increase the frequency of the generation of stably transfected cells, i.e. the frequency with which the foreign gene is integrated into the chromosome of the host cell. Various approaches have been attempted to solve this problem. One approach is to transfect cells with high copy numbers of an expression vector which contains the foreign gene of interest and required regulatory sequence for expression of the gene and which does not integrate into the host cell genome. However, expression of transfected genes is still short-lived, which limits commercial productivity and utility.

Another approach is to use vectors containing a viral origin of replication. An example is the SV40 replication origin m combination with the SV40 large T antigen that is required for replication from this origin. However, this approach is limited to use m cells, such as COS, that express the T antigen, or alternatively providing the cells with T antigen, which has toxic and oncogenic properties. Another approach involves inclusion of an enhancer element m the expression vector. Enhancer elements are DNA sequences that play an important role in the regulation of transcription through interactions with transcription factors. Enhancer elements often contain repeated sequences, can act at considerable distance, 5' or 3' from the gene, and m an orientation independent manner. A number of different enhancer elements have been identified from different sources, including enhancer elements of viral origin, such as from the SV40 virus, and of eukaryotic cellular origin, such as from the β-globin gene or immunoglobulin gene nitrons (e.g. U.S. Patent No. 5,371,009). Although these elements can increase the expression level of associated gene products to various degrees m different cell types, their effects are short- lived.

Augmented post-transfection expression of a foreign gene is particularly useful m several situations. For example, augmented expression of a reporter gene in a host cell results in a higher level of reporter signal, which is advantageous for high throughput screening assays, where a high signal -to-noise ratio is desired. Augmented expression of a foreign gene in a host cell is also advantageous for m vi tro applications that involve production of recombinant protein by transfection methods. Augmented expression of a foreign gene of interest in a host cell can also provide higher levels of a gene product, such as RNA, or an antigen or other protein. RNA is useful for antisense or ribozyme applications in vi tro, whereas proteins have many potential uses, including use as therapeutic agents.

It is therefore desirable to improve post- transfection expression, both transient and stable expression, of a foreign gene of interest m transfected cells, where the improvement would result m increased levels of the gene expression product or m a prolonged period of expression of the gene product or both.

Other and further aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention given for the purpose of disclosure .

Summary of the Invention

It is an object of the present invention to provide a method to improve post-transfection transient expression of an extrachromosomal foreign gene of interest in a host cell . Such an improvement results in either the increased level of expression of the foreign gene, or in the prolonged duration of the expression of the foreign gene. Preferably, the improvement is m both the level and in the duration of the gene expression. Such improved expression is referred to as augmented expression.

It is also an object of the present invention to provide a method to augment post-transfection expression of a foreign gene of interest integrated into a host cell genome. Such an improvement results in either the increased level of expression of the foreign gene, or m the increased frequency of generation of cells stably expressing the foreign gene of interest post -transfection. Preferably, the improvement is m both the level of expression of the foreign gene and m the frequency of generation of cells stably expressing the foreign gene. Such improved expression is referred to as augmented expression. It is a further object of the invention to provide a nucleic acid sequence and regulatory sequence necessary for expression of the sequence that can be used to augment foreign gene expression m a host cell transiently or stably expressing a foreign gene of interest. Such a nucleic acid sequence is referred to as an augmentor sequence, and encodes a polypeptide referred to as an augmentor factor.

An augmentor sequence, when used with a method of the invention, results m augmented post-transfection expression of a foreign gene of interest that is either extrachromosomal or integrated into a host cell genome. An augmentor sequence, when used with a method of the invention, also results in an increased frequency fo generation of clonal populations of cells stably expressing the foreign gene of interest post-transfection. An augmentor sequence, when used with a method of the invention, also results m generation of a host cell stably expressing an exogenous augmentor sequence, such that this host cell exhibits improved expression of a foreign gene transfected into this host cell; the foreign gene may be either extrachromosomal or may be stably incorporated into the host cell genome.

Thus, the invention provides a method of improving transient expression of an extrachromosomal foreign gene, comprising cotransfectmg a eukaryotic host cell with a first nucleic acid capable of transiently expressing a foreign gene and with a second nucleic acid capable of expressing an augmentor factor, such that transient expression of the foreign is augmented. In one embodiment, the first nucleic acid and the second nucleic acid are present in separate vectors. In an alternative embodiment, the first nucleic acid and the second nucleic acid are present in a single vector.

The invention also provides a method of improving expression of a foreign gene stably incorporated into a eukaryotic host cell genome, comprising cotransfecting a host cell with a first nucleic acid capable of stably expressing a foreign gene when incorporated into the host cell genome and with a second nucleic acid capable of stably expressing an augmentor factor when incorporated into the host cell genome, such that the first nucleic acid and the second nucleic acid are stably incorporated into the host cell genome, and stable expression of the foreign gene is augmented. In one embodiment, the first nucleic acid and the second nucleic acid are present in a single vector. Preferably, the vector further comprises a nucleic acid capable of expressing a eukaryotic selectable marker.

The invention also provides a method of increasing a frequency of generating eukaryotic host cells stably expressing a foreign gene, comprising cotransfecting a population of host cells with a first nucleic acid capable of stably expressing a foreign gene when incorporated into the host cell genome and with a second nucleic acid capable of expressing an augmentor factor. In one embodiment, the second nucleic acid is capable of stably expressing an augmentor sequence when incorporated into the host cell genome, and the first nucleic acid and the second nucleic acid are present in a single vector. Preferably, the vector further comprises a nucleic acid capable of expressing a eukaryotic selectable marker.

The invention also provides a method of improving expression of a foreign gene stably incorporated into a eukaryotic host cell genome, comprising transfecting a host cell that is stably expressing a foreign gene with a nucleic acid capable of expressing an augmentor factor, such that stable expression of the foreign gene is augmented.

The invention further provides a vector comprising a nucleic acid encoding an augmentor factor, wherein the augmentor factor is selected from the group consisting of an active fragment or a homologue or active fragment of a homologue of a bHLH transcription factor protein. Preferably, the bHLH transcription factor protein is selected from the group consisting of MyoD, Myf-5, myogenin, NeuroD and neurogenin. Preferably, the vector further comprises a promoter selected from the group consisting of an RSV promoter, a CMV immediate-early promoter, an HSV-tk promoter, and an SV40 promoter. In one embodiment, the vector further comprises a cloning site.

The invention also provides a vector comprising a nucleic acid encoding an augmentor factor, where the augmentor factor is a fusion protein of two protein components, of which the first component is a bHLH transcription factor protein or an active fragment or a homologue or active fragment of a homologue of a bHLH transcription factor protein, and the second component is a second protein. Preferably, the augmentor factor fusion protein is VP16/MyoD.

The invention further provides a vector comprising a first nucleic acid comprising a nucleic acid sequence encoding a foreign gene and at least one regulatory sequence required for expressing the foreign gene, and a second nucleic acid comprising an augmentor sequence and at least one regulatory sequence required for expression of the augmentor sequence. In one embodiment, the vector further comprises a cloning site. In another embodiment, the vector further comprises an internal ribosome entry site (IRES) upstream of the first nucleic acid sequence encoding the foreign gene of interest In yet another embodiment, the vector further comprises a third nucleic acid encoding a eukaryotic selectable marker and at least one regulatory sequence required for expression of the eukaryotic selectable marker; preferably, the selectable marker is the neomycin phosphotransferase gene.

The invention further provides a vector comprising a first nucleic acid comprising at least one regulatory sequence that directs gene expression m eukaryotic cells, a second nucleic acid comprising at least one cloning site located downstream of the regulatory sequence into which a foreign gene can be inserted, a third nucleic acid comprising an augmentor sequence, ana a fourth nucleic acid sequence comprising at least one regulatory sequence required for expression of the augmentor sequence. In one embodiment, a regulatory sequence of the first nucleic acid is an IRES sequence. In another embodiment, a regulatory sequence of the first nucleic acid is a promoter sequence. In another embodiment, the vector further comprises a fifth nucleic acid comprising a sequence encoding a eukaryotic selectable marker and a sequence comprising at least one regulatory sequence required for expression of the eukaryotic selectable marker; preferably, the selectable marker is the neomycin phosphotransferase gene.

The invention further provides a eukaryotic host cell stably expressing a foreign nucleic acid comprising an augmentor sequence, wherein the augmentor sequence encodes an active fragment or a homologue or active fragment of a homologue of a bHLH transcription factor protein.

Brief Description of the Figures FIGURE 1A shows a nucleic acid sequence of a murine myoDl gene cDNA (SEQ ID NO: 1) and FIGURE IB shows the predicted amino acid sequence of murine MyoDl (SEQ ID NO: 2) . FIGURE 2 shows expression levels of firefly luciferase m NIH3T3 cells at 48, 72, and 96 hours post- transfection with plasmids expressing firefly luciferase, the plasmids differ m promoter/enhancer regions, when co- transfected with or without a plasmid capable of expressing murine MyoD downstream of a CMV promoter.

FIGURE 3 shows expression levels of firefly luciferase m C2C12 cells at 48, 72, and 96 hours post- transfection with plasmids expressing firefly luciferase, the plasmids differ m promoter/ennancer regions, when co- transfected with or without a plasmid capable of expressing murine MyoD downstream of a CMV promoter.

FIGURE 4 shows expression levels of firefly luciferase m C3H10T1/2 cells at 48, 72, and 96 hours post- transfection with plasmids expressing firefly luciferase, the plasmids differ m promoter/enhancer regions, when co- transfected with or without a plasmid capable of expressing murine MyoD downstream of a CMV promoter.

FIGURE 5 shows expression levels of firefly luciferase in BHK-21 cells at 48, 72, and 96 hours post- transfection with plasmids expressing firefly luciferase, the plasmids differ m promoter/enhancer regions, when co- transfected with or without a plasmid capable of expressing murine MyoD downstream of a CMV promoter.

FIGURE 6 shows expression levels of Renilla luciferase m NIH3T3 cells at 48, 72, and 96 hours post- transfection with a plasmid containing the sequence encoding Renilla luciferase downstream of an SV40 promoter, co-transfected with or without a plasmid capable of expressing murine MyoD downstream of a CMV promoter. FIGURE 7 shows expression levels of Green Fluorescent Protein (GFP) m NIH3T3 cells, 96 hours post- transfection with a plasmid containing the sequence encoding GFP downstream of a SV40 promoter, co-transfected with or without a plasmid capable of expressing murine MyoD downstream of a CMV promoter or with only a luciferase expressing plasmid.

FIGURE 8 shows expression levels of firefly luciferase in NIH3T3 cells up to 10 days post-transfection with a plasmid containing luciferase gene downstream of a CMV promoter, co-transfected with or without a plasmid capable of expressing murine MyoD downstream of a CMV promoter.

FIGURE 9 shows expression levels of Secreted Alkaline Phosphatase (SEAP) m NIH3T3 cells up to 8 days post-transfection with a plasmid containing the SEAP gene downstream of an SV40 promoter, co-transfected with or without a plasmid capable of expressing murine MyoD downstream of a CMV promoter. FIGURE 10 shows expression levels of firefly luciferase in NIH3T3 cells at 48, 72, and 96 hours post- transfection with a plasmid capable of expressing firefly luciferase downstream of a CMV promoter co-transfected with various expression plasmids, each comprising a different augmentor sequence downstream of a CMV promoter.

Detailed Description of the Invention

All publications, patents, and patent applications cited herein, whether supra or infra, are hereby incorporated by reference m their entirety.

As used m this specification and the appended claims, the singular forms "a," "an" and "the" include plural references unless the content clearly dictates otherwise . Definitions

In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below. Increase the level of expression of the foreign gene and/or prolonged duration of the expression of the foreign gene in the presence of an augmentor nucleic acid sequence relative to expression of the foreign gene product in the absence of the augmentor nucleic acid sequence are referred to herein as "augmented" expression of the gene or "augmentation" . A more complete discussion of these terms are included herein.

"Augmentor sequence" as used herein, is the nucleic acid sequence responsible for augmenting post-transfection expression of a foreign gene of interest . An augmentor sequence is a non-native sequence that encodes any polypeptide that results m augmented expression of a foreign gene when the augmentor sequence and the foreign gene are coexpressed m a common host cell . An "augmentor factor" as used herein, is a polypeptide encoded by an augmentor sequence (as per the definition above) resulting m augmented expression of a foreign gene when coexpressed with the foreign gene m a common host cell. An "active fragment" as used herein, is also a polypeptide encoded by an augmentor sequence, it may be a complete augmentor factor occuπng naturally or a portion of the complete augmentor factor protein that retains the ability to augment expression of a foreign gene when coexpressed with the foreign gene m a common host cell. By "fragment" it is meant a bHLH protein or portion of a bHLH protein with ammo acid deletions at any one or more of the following locations: ammo terminus, carboxy terminus, or one or more locations within the ammo acid sequence of the protein. A "deletion" comprises removal of one or more contiguous ammo acids. By "active" it is meant sufficient for augmented expression of the foreign gene of interest to occur.

"Vector" as used herein, is understood to mean any nucleic acid comprising a nucleotide sequence of interest and competent to be transfected into a host cell and, when used for the generation of cells stably expressing a foreign gene, further competent to recombme with and integrate into the host cell genome. Such vectors include linear nucleic acids plasmids, phagemids, cosmids and the like. The term includes cloning and expression vectors, as well as viral vectors.

"Transfection" as used herein, refers to methods or systems for inserting foreign nucleic acid into host cells. Such methods can result in transient expression of non- integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes) , or integration of transferred genetic material into the genomic DNA of host cells. A number of systems have been developed for transfection, this definition is not limited to any specific method or system.

"DNA" as used herein, is a polymeric form of deoxyribonucleotides (aden e, guanine, thym e, or cytosine) in double-stranded or single-stranded form, either relaxed or supercoiled. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular teriary forms. Thus, this term includes single- and double-stranded DNA found, inter alia, in linear DNA molecules, plasmids, chromosomes, and viruses. In discussing the structure of particular DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having the sequence homologous to the mRNA) . The term captures molecules that include the four bases adenme, guan g, thymme, or cytosine, as well as molecules that include base analogues which are known m the art . A "gene" or "coding sequence" or a sequence which

"encodes" a particular protein, is a nucleic acid molecule that is transcribed ( the case of DNA) and translated (in the case of mRNA) nto a polypeptide in vitro or vivo when placed under the control of appropriate regulatory sequences . The boundaries of the gene are determined by a start codon at the 5' (ammo) terminus and a translation stop codon at the 3' (carboxy) terminus. A gene can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the gene sequence.

"Regulatory sequence" or "control elements" as used herein, refer collectively to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replicaiton, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence m a recipient cell. Not all of these control elements need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell, or m other words "capable of being expressed." "Promoter region" as used herein, is used in its ordinary sense to refer to a nucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding sequence. "Operably linked" as used herein, refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, control elements operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence .

For the purpose of describing the relative position of nucleotide sequences m a particular nucleic acid molecule throughout the instant application, such as when a particular nucleotide sequence is described as being situated "upstream," "downstream," "5'," or "3'" relative to another sequence, it is to be understood that it is the position of the sequences m the non-transcribed strand of a DNA molecule that is being referred to as is conventional m the art .

The invention provides a method of increasing or prolonging transient expression or stable expression of a first nucleic acid sequence comprising a foreign gene in eukaryotic cells or an increase in the frequency of generation of cells stably expressing the foreign gene. The method comprises transfection of a host cell with a first nucleic acid sequence encoding a foreign gene of interest and with a second nucleic acid sequence comprising an augmentor sequence. The transfection of the second nucleic acid sequence may occur either m the same reaction or alternatively, the DNA sequences can be transfected sequentially. For example the vector comprising the foreign gene of interest may be transfected first, and its DNA allowed to stably integrate withm the host cell genome prior to subsequent transfection with the vector comprising the augmentor sequence. Alternatively, the vector comprising the augmentor sequence may be transfected first, and its DNA allowed to stably integrate withm the host cell genome prior to subsequent transfection with the vector comprising the foreign gene of interest.

The result is augmented expression of the foreign gene or an increase in the frequency of generation of cells stably expressing the foreign gene, where the augmented expression results m increased levels of expression of the foreign gene, or a prolonged period of expression of the foreign gene, or both, when compared to the foreign gene expression m the absence of transfection with the augmentor sequence.

An augmentor sequence is a nucleic acid sequence encoding a polypeptide comprising a bHLH domain that is derived from di ferentiation or determination or "transcription" factors . An augmentor sequence includes naturally occurring sequences comprising the bHLH domain, as well as modifications to such sequences which result in expression of polypeptides comprising this domain and possessing augmentor activity as described herein. Such modifications of the naturally occurring polypeptide sequences include inclusion of ammo acid analogs, substitutions, deletions or insertions. Exemplary transcription factors from which such bHLH domains are derived include, but are not limited to, the family of myogenic factors, which includes MyoD, myogenm, Myf-5 and Myf-6, the family of neurogenic factors, which includes NeuroD and neurogenm, and other factors such as Nau and SCL. bHLH protein domain

Members of the group of proteins containing a bHLH domain typically function as transcription regulators m cell type determination and differentiation processes during development and tissue- specific gene expression of multicellular organisms and are referred to herein as "bHLH proteins" . The bHLH domain consists of a basic segment that binds to a consensus DNA sequence element termed the "E- box" , and a short alpha helix connected by a loop to a longer alpha helix. The loop is flexible and allows the two helices to fold back against each other. The alpha helices bind both to DNA and to the HLH structure of another bHLH polypeptide. The second polypeptide can be the same (producing homodimers) or different (producing heterodimers) ; the resulting protein complexes then bind to DNA m the 5 ' regulatory regions of genes . Some HLH proteins lack the basic region required for binding DNA, but they can still form heterodimers with other bHLH proteins, and thus can serve to inactivate specific regulatory proteins.

Transcription factors m the bHLH family are implicated in the regulation of differentiation m a wide variety of cell types, including trophoblast cells (Cross, et al., Development 121:2513-2523, 1995) pigment cells (Ste gπmsson, et al . , Nature Gen . 8.251-255. 1994), B- cells (Shen, et al . , Molec . & Cell . Biol . 15:3813-3822, 1995), chondrocytes and osteoblasts (Cser esi, et al . ,

Development 121:1099-1110, 1995; Tamura, et al . , J. Cell Biol . 126:773-782 , 1994), and cardiac muscle (Burgess et al., Develop. Biol . 168:296-306, 1995; Hollenberg, et al . , Molec. & Cell . Biol . 15:3813-3822, 1995). The most extensively studied sub- families of bHLH proteins are those that regulate myogenesis and neurogenesis . The myogenic bHLH factors include, but are not limited to, MyoD, myogenm, Myf-5, and Myf-6, and they appear to have unique as well as redundant functions during myogenesis (Wemtraub, H., Cell . 75:1241-1244. 1993; eintraub et al . , Science . 251 : 761-766 , 1991).

The neurogenic bHLH proteins, or NeuroD proteins, are a sub-family of bHLH proteins implicated m vertebrate neuronal , endocrine, and gastrointestinal development. The family of NeuroD proteins share a conserved bHLH region. Representative members of the NeuroD family include neuroDl , neuroD2 , and neuroD3 that is also called "neurogenm" (U.S. Patent 5,795,723). Other exemplary bHLH proteins include Nau, SCL,

E12 , E47, and c-Myc. Reviews of such factors include Buckingham, M. , Current Opinion m Genetics and Dev. 4:745- 751, 1994, and Lee, J., Current Opinion m Neurobiol . 7:13- 20, 1997. The basic portion of the bHLH proteins is a DNA- bmdmg domain that binds to a nucleic acid sequence element termed the E-box, and thereby activates transcription. The consensus polynucleotide sequence for an E-box is CANNTG where N can be any nucleotide. However, E-boxes often display gene specific and tissue specific characteristics (Dumonteil, et al . , JBC. 273:19945-19954, 1998). For example, the bHLH transcription factor AP-4 specifically binds the E-box domain CACCTG (Badmga, et al . , Endocrine . 8:281-289, 1998), whereas the bHLH protein USF specifically binds to the E-box domain CACATG (Li, et al., Nuc . Acid. Res . 26:5182-5189, 1998).

The helix-loop-helix portion of the bHLH domain is a dimerization domain that allows multimerization with other HLH-contammg proteins. There is a high level of evolutionary conservation in bHLH proteins m the sequence of their bHLH domains. The members of the myogenic family of bHLH transcription factors are known to be conserved their general developmental expression patterns, suggesting that these factors are also conserved at the level of function. MyoD and other myogenic transcription factors

The myoD gene is a master regulatory gene for skeletal myogenesis, or development of muscle cells. It is expressed only in skeletal muscle, and when transfected into a variety of cultured fibroblast cells or adipoblast cells, it converts the transfected cells to muscle cells (myogenesis) . It can also induce differentiation in a variety of other cell types, such as established cell lines of melanoma, neuroblastoma, liver, and adipocyte cells, as well as primary fibroblast cells from human, rat or chicken embryos, to express genes characteristic of muscle cells (Lassar, A.B. et al . , Cell . 47:649-656, 1986; Davis, R.L., et al . , Cell . 51:987-1000, 1987; Tapscott, S.J., et al . , Science 242:405-411, 1988; eintraub, H., et al . Proc.

Natl . Acad . Sci . 86: 5434-5438, 1989). Fibroblast cells can be exposed to environmental conditions that result in cells undergoing differentiation and morphological changes into myoblast (muscle precursor) , adipoblast (adipocyte precursor) or chondroblast (chondrocyte precursor) cells. Some cell types are resistant to myogenesis by MyoD, such as fully differentiated chondrocytes , although their less differentiated cell line counterparts are able to express muscle-specific genes (Filvaroff, E.H. and Derynck, R. (1996) Develop. Biol . 178: 459-471). The myoD gene, along with the myf -5 gene are important differentiation factors in vivo because transgenic mice lacking both these genes fail to develop skeletal muscle (Rudniki, M.A. , et al . , Cell 75: 1351-1359, 1993). The protein expressed by myoD ("MyoD") is a nuclear protein, 318 amino acids in length, and is a DNA- binding protein that binds to the enhancer elements of several muscle specific genes, such as the muscle-specific creatine phosphokinase gene (Lassar, A.B., et al . , Cell 58: 823-831, 1989; Chakraborty, T., et al . , J^". Biol . Chem. 266: 2878-2882, 1991). MyoD is also able to activate its own transcription (Thayer, J.J., et al . Cell 58: 241-248, 1989) .

MyoD is a member of a transcription factor family whose members all possess a protein structure with a bHLH domain; this domain m MyoD is necessary and sufficient for myogenesis. The bHLH proteins are key regulators of many different developmental pathways In general, a combination of multiple gene regulatory proteins, rather than a single protein, determines transcription of developmentally regulated genes. Four bHLH muscle regulatory factors (MRFs) , which include MyoD as well as myogenm, Myf-6 and Myf-5, are involved m the differentiation and maintenance of skeletal muscle. All four of these MRFs are characterized by the ability to convert a variety of non-muscle cells to myocytes expressing muscle-specific genes.

The MRFs form homodimers , but binding affinities favor heterodimerization with the widely expressed E2A gene products, E12 and E47 (Fairman, R , et al . , Proc . Natl . Acad . Sci . 90:10429-10433, 1993; Blackwell, T.K. and Wemtraub, H. , Science 250:1104-1110, 1990; Lassar, E.B., et al., Cell 66:305-315, 1991) or with the related bHLH protein HEB (Zhang Y. , et al . , Nuc . Acids Res . 19:4555, 1991; Hu, J.S., et al . , Mol . Cell . Biol . 12:10310-1042,

1992) . These heterodimeric complexes bind to a conserved DNA domain (E-box: -CANNTG-) which is present in the promoter or enhancer region of many developmentally- regulated genes, including genes involved m myogenic events. Different DNA binding preferences and transcriptional activation effects are associated with different combinations of the dimeric proteins (Blackwell, T.K. and Wemtraub, H. Science 250:1104-1110, 1990).

The MRFs are classified as myogenic "activator" proteins because each contains at least one activation domain that is able to induce gene transcription (Lemercier, C, et al . EMBO J. , 17:1412-1422, 1998). In MyoD, the activation domain appears to reside in the NH2- terminal 50 ammo acids. It also appears that the NH2 activation domain of MyoD is "hidden" from the transcπptional machinery, and that activation of transcription can be regulated independently of DNA binding. The specificity for myogenic activation appears to reside in the basic region of MyoD, which is the region that binds to DNA.

MyoD contains a number of domains that have been well-characterized. The characterization is based upon the ammo acid sequence and protein structure, as well as mutation and deletion experiments directed toward elucidating the function of the various domains. These domains include the first 60 ammo acids, of which ammo acids 10-47 form an acidic domain, and ammo acids 1-53 form a transcription activation domain. Ammo acids 102-121 contain the basic domain involved in myogenesis; it contains a nuclear localization signal (ammo acids 100- 112) . This domain binds to DNA, thus providing the specificity for transcription activation. Ammo acids 122- 136 contain the first helix, and ammo acids 130-135 contain a second nuclear localization signal. The next domain contains the loop (ammo acids 137-145) . Ammo acids 141-162 are similar to the domain found m c-Myc and contain the second helix (ammo acids 146-162) . The basic helix-loop-helix region is sufficient to activate myogenesis. An affect on cellular growth arrest was mapped to this same segment (which is necessary and sufficient for myogenesis) , although the DNA binding activity is not required for the anti-proliferative affect (Sorrentino, V. , et al., Nature 345:813-815, 1990; Crescenzi, M., et al . , Proc. Natl . Acad . Sci . 87:8442-8446, 1990). The remaining domain, from ammo acids 163-318, is often referred to as the carboxy terminus, and contains a segment rich in serine and threonine ammo acids (am o acids 189-262) and a segment rich m proline ammo acids (aa 263-311) . The MyoD protein is phosphorylated, and protein phosphatases block myogenesis, but the effect of phosphorylation of precise sites is not yet completely defined (Kim, S.J., et al . , J. Biol . Chem . 267:15140-15145, 1992) .

As described above, MyoD is a bHLH protein that is also a transcπptional activator protein. However, not all HLH-containing proteins exhibit transcription activator properties. Many function instead as negative regulators of gene transcription. For example, the protein Id (Benezra, et al . , Cell 61:49-59, 1990), which has an HLH domain but lacks a basic domain, is capable of forming heterodimers with bHLH proteins, thereby preventing the bHLH proteins from binding to DNA and also preventing myogenesis .

The ability of Id to bind to MyoD has been used as a control m a system utilized to investigate protein binding interactions (CheckMate™ Mammalian Two-Hybrid System, Promega Corporation, WI ; Schenborn, E. et al . , Promega Notes 66:2-6, 1998; Dang, C.V., et al . , Mol . Cell . Biol . 11:954-962, 1991). Interactions between proteins play critical roles m cellular regulatory events, such as transcription, signal transduction pathways and enzyme- mediated metabolic effects. Identification, verification, characterization and manipulation of discrete protein:protein interactions withm eukaryotic cells can be difficult and time-consuming. The CheckMate™ Mammalian Two-Hybrid System is a modification of an n vivo yeast genetic screening method developed by Fields and co-workers (Fields, S. and Song, 0., Nature 340:245-end, 1989) to provide a means to accelerate the rate of progress in the identification of novel protein: protein interactions. In the mammalian-based system, transcription factor activity is reconstituted from two different protein domains that are expressed from two separate vectors. The DNA binding domain of GAL4 protein and the activation domain of herpes simplex virus type 1 VP16 protein, when in close association, provide functional transcriptional activation from RNA polymerase II basal promoters with upstream GAL4 binding sites . In the CheckMate™ System, five GAL4 binding sites are positioned upstream of the firefly luciferase gene ( luc+) , providing a sensitive and quantitative reporter system for functional assessment of reconstituted GAL4:VP16 activity. Mammalian cells are co- transfected with the firefly luciferase reporter vector, along with vectors that express the GAL4 binding domain and VP16 activation domain. In the absence of interacting fusion partners to GAL4 and VP16, the level of transcription from the GAL4 element promoter is low, and consequently the luciferase expression is low. Co- transfection of mammalian cells with vectors coding for GAL4-X and VP16-Y, in which "X" and "Y" are interacting protein domains, results m close physical association of GAL4 and VP16 domains. The GAL4 promoters are then functionally activated, resulting m increased luciferase reporter activity. The control vectors provided with the CheckMate™

System contain as "Y" the murine myoD sequence corresponding to the sequence encoding ammo acids 1-318, and as "X" the murine Id sequence corresponding to the sequence encoding ammo acids 29-148; transfection with these two control vectors allows an assessment of the degree of protein interaction possible m the transfected host cells. A second type of control vector allows an assessment of the level of transcription due to the protem:protem interactions. An example of this vector is the pBIND vector, which includes the Renilla luciferase gene under transcπptional regulation of the SV40 early promoter and enhancer element . Cells transfected with this vector will express Renilla luciferase, and the levels of Renilla luciferase activity reflect the relative levels of transcription due to protein: protein interactions of the fusion proteins. However, anomalous levels of Renilla luciferase activity were observed when pBIND was transfected with the vector containing coding sequences for MyoD. Subsequent investigation revealed the unexpected discovery that the presence of a MyoD coding sequence resulted in augmented expression of a foreign gene which was co-transfected with the MyoD coding sequence. Thus, for example, co-transfection of a host cell with a coding sequence for firefly luciferase and with a MyoD coding sequence resulted m about a 25-fold greater luciferase activity 48 hours after transfection when compared to the activity in the absence of a MyoD coding sequence. Luciferase activity also increased by at least about two- fold between 48 and 96 hours after transfection m the presence of a MyoD coding sequence; m contrast, the activity m the absence of the MyoD coding sequence decreased from at least three- fold to over ten- fold in the same time period. This unexpected augmented expression in the presence of a co-transfected MyoD coding sequence was observed for different foreign genes under the control of different promoters transfected into different host cells. Furthermore, augmented expression of a foreign gene may also occur in the presence of a co-transfected nucleic acid sequence encoding polypeptides from other bHLH transcription factor families. Moreover, augmented expression of a foreign gene occurs m both transiently expressed and in stably expressed transfected host cells. Additionally, some fragments of the nucleic acid sequence encoding an entire bHLH protein, when cotransfected with a foreign gene, were demonstrated to be "active", i.e. sufficient for augmented expression of the foreign gene to occur. Thus, for example, co-transfection of a nucleic acid sequence capable of expressing luciferase with a nucleic acid sequence capable of expressing a MyoD fragment, with deletions at either the amino terminal end or the carboxy terminal end, resulted in augmented expression of luciferase. The deletions at the amino terminal spanned from amino acids 2-30, while the deletions at the carboxy terminal spanned from amino acids 263-318. Furthermore, co-transfection of nucleic acid sequence expressing luciferase with a nucleic acid sequence expressing a MyoD fragment with amino acids deleted at both the amino and the carboxy terminals also resulted in augmented expression of luciferase.

Finally, augmented expression of a foreign gene may also occur when the foreign gene is expressed in the presence of a nucleic acid sequence that encodes an active homologue of a bHLH protein or a fragment thereof . By "homologue" it is meant that the amino acid sequence is a modification of a naturally occurring amino acid sequence of a bHLH protein; such modi ications include one or more single or multi-amino acid substitutions, additions, or deletions anywhere within the bHLH protein. An active homologue is one that results in augmented expression of a foreign gene of interest when a nucleic acid capable of expressing the homologue is co-transfected with nucleic acid capable of expressing the foreign gene into a host cell.

A nucleic acid sequence that encodes a bHLH protein or an active fragment thereof, or that encodes an active homologue of a bHLH protein or fragment thereof, such that co-transfection of a nucleic acid capable of expressing a foreign gene of interest with the bHLH-domain encoding nucleic acid sequence into a host cell results in augmented expression of the foreign gene relative to expression of the foreign gene m the absence of this sequence, is referred to as "an augmentor sequence" and the polypeptide it encodes is referred to as "an augmentor polypeptide . "

The mechanism underlying the augmented expression of a foreign gene of interest as described herein is unknown. The effect could be exerted by the polypeptide product of the augmentor sequence. Alternatively, the effect could result from activity of a protein affected by the augmentor polypeptide or by some other mechanism not yet considered. The presence of the augmentor sequence alone, m the absence of its expressed protein product, is not sufficient to obtain augmented expression of a cotransfected foreign gene. This was determined by modification of an augmentor coding sequence, such that the AT nucleotides of the ATG start codon were deleted, thereby preventing expression of the protein product of the augmentor sequence. Co-transfection of cells with a nucleic acid capable of expressing a foreign gene and the augmentor sequence mutated at the start codon did not result in augmented expression of the foreign gene. Thus, it appears that the presence of the polypeptide product encoded by an augmentor sequence is necessary to obtain augmented expression of the foreign gene.

Unexpectedly, the augmentation effect exerted by an augmentor sequence does not result from binding of the polypeptide product of the augmentor sequence to an E-box consensus sequence present withm the promoter sequence initiating expression of the foreign gene of interest. However, it has not been ruled out that the augmentor polypeptide binds to a different sequence present in the host cell.

As noted previously, the basic portion of a bHLH protein binds to a nucleic acid sequence termed the E-box, which is generally located upstream of a coding region, in a promoter sequence. A promoter sequence may contain one or more than one E-box. Although the consensus sequence for an E-box is CANNTG, with N representing any nucleotide, E-boxes often display gene and tissue specific characteristics. The following table shows some E-box sequences preferred by certain bHLH proteins; preferences that are absolute are indicated by capitol letters, while incomplete preferences are indicated by lowercase letters : bHLH protein E-box.

Note: MyoD and MyoD-E complexes are known to not bind CACGTG (Blackwell, et al . 1993. Mol . Cell . Biol . 13:5216- 5224). Ref 1: Blackwell and Weintraub Science. 250:1104-10, 1990. Ref 2: Huang, J. et al . Mol . & Cell . Biol . 1996. 16:3893-3900.

Several lines of evidence demonstrate that augmented expression of a foreign gene or increase in the frequency of generation of cells stably expressing the foreign gene are not affected by binding of an augmentor polypeptide to an E-box in the promoter initiating expression of the foreign gene of interest. One line of evidence is that augmented expression is obtained for foreign genes that are under the control of promoters that do not contain an E-box to which a specific augmentor polypeptide would normally bind. Another is that modification of the consensus nucleotides of an E-box sequence to nonconsensus nucleotides in a promoter controlling expression of a foreign gene still results in augmented expression of the foreign gene under control of the modified promoter when it is co-transfected with a sequence expressing an augmentor polypeptide. Yet another is that mutation of the basic region of a bHLH domain, such that the encoded augmentor polypeptide would not be expected to bind to any E-box, nonetheless results in augmented expression of a foreign gene when it is co- transfected into a host cell with the mutant augmentor- expressing sequence .

Yet another line of evidence is that the augmented expression of a foreign gene is observed even when the augmentor polypeptide is predominantly localized to the host cell cytoplasm, instead of the nucleus. Thus, co-transfection of a host cell with a nucleic acid sequence expressing a foreign gene and with a nucleic acid sequence expressing an augmentor polypeptide resulted in augmented expression of the foreign gene for at least six days post- transfection. Augmentation was observed both the form of an increased level of expression of the foreign gene, as well as in a prolonged period of time in which the foreign gene was expressed. The augmentor polypeptide was observed to be located in both the nucleus and the cytoplasm at 2 days post-transfection. At six days and at eight days post-transfection, the augmentor polypeptide was not observed in the nucleus, but was observed m the host cell cytoplasm. If the effect of the augmentor sequence was exerted by the protein product binding to an E-box throughout the entire duration of prolonged foreign gene expression, the protein product should have been detected in the nucleus. Throughout the six day assay, using an m situ staining assay, predominant localization of the augmentor factor was observed in the cytoplasm of the host cell, even when expression of a foreign gene was augmented. There may have been MyoD m the nucleus, but below detection limits. This suggests that prolonged binding of an augmentor sequence protein product to an E-box m the promoter initiating expression of the product encoded by a foreign gene is not necessary for augmented expression of the foreign gene.

It is emphasized that the mechanism underlying the augmented expression of a foreign gene when co- transfected with a nucleic acid sequence expressing an augmentor polypeptide is not known, and the present invention is not limited to any particular mechanism.

Augmentor sequences may be derived from other members of the myogenic activator protein family; these other members include nucleic acid sequences coding for myf-5, myf-6, and myogenm. Augmentor factors may also be derived from other families and types of bHLH-containing proteins . Neurogenic transcription factors

Neurogenic transcription factors function during the development of the nervous system. This family of bHLH proteins includes, but is not limited to neurogenm (also known as NeuroD3), NeuroDl and NeuroD2. NeuroD proteins are transcπptional activators that control transcription of downstream target genes, including genes that among other activities cause neuronal progenitors to differentiate into mature neurons . NeuroD proteins are transiently expressed in differentiating neurons during embryogenesis . Certain NeuroD proteins are also detected m adult brain tissue. The expression of neurogenm peaks during embryonic development and is not detected m the mature nervous system.

NeuroD2 shows a high degree of sequence similarity to NeuroDl and is similarly expressed during embryogenesis and m the mature nervous system, demonstrating an expression pattern that partially overlaps with neuroDl .

Augmentor Sequence

A nucleic acid sequence that encodes a bHLH protein or an active fragment thereof, or that encodes an active homologue of a bHLH protein or active fragment thereof, such that co-transfection of a nucleic acid capable of expressing a foreign gene of interest with this nucleic acid sequence results m augmented expression of the foreign gene relative to expression of the foreign gene in the absence of this nucleic acid sequence is referred to as "an augmentor sequence" . Such an augmentor sequence thus encodes a fragment of a bHLH-containing protein such as a transcription factor.

A fragment of a protein comprising a bHLH domain includes such a protein with one or more deletions at one or more of the following locations: ammo terminus, carboxy terminus, or anywhere withm the ammo acid sequence of the protein. A deletion comprises removal of one or more contiguous ammo acids. Alternatively, an augmentor sequence includes a nucleic acid sequence that encodes a homologue to a polypeptide with a bHLH domain or a fragment thereof, where co-transfection with the nucleic acid sequence is effective m augmenting expression of a foreign gene. A homologue of a protein with a bHLH domain includes modification of such a polypeptide sequence with one or more single or multi-ammo acid insertions into the protein, or with one or more ammo acid substitutions in the protein ammo acid sequence, or both.

An augmentor sequence may be derived from any source. One such source is a transcription factor gene such as a myoD gene. The sequence of cDNA or a gene, or both, of myoD or a myoD-like factor has been determined for several different types of eukaryotes . These include mammals (Davis, R.L., et al . , Cell 51:987-1000, 1987, mouse MyoDl cDNA; Zmgg, J.M. , et al . Nuc . Acids Res . 19:6433- 6439, 1991, mouse myoD gene; Vadya, T.B., et al . Gene 116:223-230, 1992, rat myoD gene; Chang, K.C., et al . J^". Muscle Res . Cell Motil . 16:243-247, 1995, pig myoD gene), birds (P ney, D.F., et al . Dev. Biol . 170:21-38, 1995, quail myoD gene), fish (Semberg, E.S., et al . Development 122:271-280, 1996, zebrafish myoD gene; Rescan, R.Y. and Gauvry, L. Comp. Biochem . Mol . Biol . , 113B : 711-715 , 1996, rainbow trout MyoD cDΝA; Rescan, P.Y., et al . , Biochim . Biophys . Acta 1218:202-204, 1994, trout muscle MyoD factor cDΝA) , nematodes (Connolly, B., et al . Mol . Biochem .

Parasi tol . 81:137-149, 1996, parasitic nematode myoD-like gene) and ascidians (Araki, I., et al . Roux' s Arch . Dev. Biol . 203:320-327, 1994 , ascidian AMD1 protein myoD gene); all of the references recited herein are hereby incorporated m their entirety. Preferably, an augmentor sequence derived from a myoD gene is mammalian. In one embodiment, the augmentor sequence is derived from the mouse myoD gene. Preferably, the augmentor sequence encodes the smallest possible active polypeptide fragment. The nucleic acid sequence for murine myoD cDNA and the ammo acid sequence for the protein encoded by the cDNA are shown m FIG. 1, and may be accessed m the databases EMBL 18779 and Swiss Prot #P10085, respectively. A mouse myoD gene has been isolated using myoD cDNA and then sequenced (U.S. Patent No. 5,352,595, this reference is hereby incorporated m its entirety) . The myoD gene differs from the cDNA by the presence m the gene of three exons , and two mtrons . A vector comprising a VP16/MyoD fusion protein is available from Promega Corporation (pACT- MyoD Control Vector, component E248 of the CheckMate™ Mammalian Two-Hybrid System, Catalog #E2440) .

Thus, an augmentor sequence may comprise a nucleotide sequence coding for a VP16/MyoD fusion protein, as described in the Examples. Alternatively, it may comprise a 1.7 kilobase pair myoD clone of the VP16/MyoD fusion protein, as described in the Examples. Alternatively, and more preferably, it may comprise a discrete 957 base pair cDNA clone as described m the Examples . Alternatively, an augmentor sequence may be derived from a nucleic acid sequence encoding any protein comprising a bHLH domain. Possible sources of such bHLH polypeptides are well known m the art, and include, but are not limited to, the myogenic transcription factor family, including, but not limited to, MyoD, Myf-5, Myf-6 and myogenm, the neurogenic transcription family, including, but not limited to NeuroD and neurogenm, and related transcription factors, including Nau, SCL, E12, E47, and c-Myc. Such nucleic acid sequences include cDNA or a gene, or both and their complementary sequences. Nucleic acid sequences and ammo acid sequences encoded by several bHLH polypeptides are listed below (the Genbank number includes both an ammo acid and a nucleotide sequence for each sequence) :

Human MyoD ACCESSION X56677

Murine MyoD ACCESSION M18779 and ACCESSION M84918

Murine myogenm ACCESSION X15784 Murine Myf-5 ACCESSION X56182 Murine Myf-6 ACCESSION X59060 Human NeuroD ACCESSION ABO09997 Murine NeuroD ACCESSION U28888 Murine neurogenm ACCESSION U67776

Preferably, an augmentor sequence encodes an active polypeptide fragment containing a bHLH domain, e.g. a fragment of a transcription factor protein containing a bHLH domain. The size of an active polypeptide fragment is determined by preparing deletion mutants of the augmentor sequence encoding the full size protein, ligat g each DNA mutant into an expression vector, and then testing the effectiveness of each mutant m augmenting expression of a co-transfected foreign gene. Preparation of the deletion mutants, and ligation of the deletion mutants into expression vectors, is accomplished by techniques well known m the art .

Thus, for example, sequences coding for fragments of MyoD retaining augmentor activity have been prepared expressing MyoD polypeptides with deletions at the carboxy terminus, at the ammo terminus, or at both the carboxy and ammo termini of the full-length protein. Expression of augmentor MyoD polypeptides with deletions of ammo acids 2-20 at the N-termmus, or deletions of up to 55 C-termmal amino acids, or of both ammo acids 2 to 20 at the N- terminus and 32 C-termmal ammo acids resulted m augmented expression of a foreign gene when a plasmid capable of expressing the foreign gene was co-transfected with a plasmid capable of expressing these altered augmentor sequences . The invention also contemplates the use of an augmentor sequence that comprises a nucleic acid sequence encoding a homologue of a bHLH protein or a fragment thereof which is active in augmenting expression of a co- transfected foreign gene of interest. Homologous bHLH proteins may be synthetic, and prepared by creating mutants of such known bHLH proteins, or they may be naturally occurring. Synthetic homologous bHLH proteins are determined by preparing mutants of the gene or cDNA encoding the bHLH protein, ligat g each DNA mutant into an expression vector, and then testing the effectiveness of each mutant m augmenting expression of a co-transfected foreign gene. The mutants are ammo acid substitutions at one or more ammo acid positions withm a transcription factor protein, or one or more ammo acid additions to a transcription factor protein.

Alternatively, homologous proteins may be naturally occurring; for example, several naturally occurring homologues to MyoD have already been identified and include members of the MRFs involved m myogenesis. Naturally occurring bHLH homologues can be isolated by several methods including low hybridization stringency of a cDNA or genomic library to a nucleic acid probe of the region of interest, PCR amplification of a cDNA or genomic library using degenerate oligonucleotides to the sequence of interest, degenerate RT-PCR of mRNA from the cell-type of interest using degenerate oligonucleotides, functional protem-to-protem binding to a specified protein binding domain, as configured m the 2-hyDrιd system, and computer searching of gene or protein databases for conservation of domains of interest . Augmentor sequences thus include nucleic acid sequences encoding naturally occurring bHLH homologues or encoding synthetic homologues of naturally occurring homologs, as well as encoding active fragments of either.

Augmentor Sequence Promoters

A nucleic acid sequence that comprises an augmentor sequence may further comprise a promoter that initiates expression of the augmentor sequence m transfected cells. Such promoters are well known in the art, and include constitutive promoters, as well as regulatable promoters. Such promoters include but are not limited to viral promoters and enhancers such as cytomegalovirus immediate early (CMV) , Rous Sarcoma Virus (RSV) , Herpes Simplex Virus Thymidme Kinase (HSV-tk) and SV40 promoters, cellular promoters such as that of β- globin, and regulatable promoters such as the tetracycline- based systems and the ecdysone system (Kriegler, M. (1990) m Gene Transfer and Expression, Stockton Press, New York) . The promoter is operatively linked 5' to the augmentor sequence m a DNA based expression vector, such as plasmid DNA or viral DNA. Eukaryotic expression vectors are generally engineered to contain a multiple cloning site for insertion of the gene of interest, such as the augmentor sequence, located 3' of a promoter suitable for a particular application and cell type of interest, and located 5' of suitable transcription termination and polyadenylation signals.

Augmentor Sequence Transfection Vector

Typically, stable gene expression and transient gene expression systems are based on the use of an expression vector. Such vectors allow the shuttling of DNA between bacterial and eukaryotic cells. The expression vector minimally comprises a restriction enzyme site into which a foreign nucleic acid sequence of interest can be inserted, a bacterial origin of replication, and a marker such as an antibiotic resistance gene that allows for selection of the vector when it is grown m bacteria. Optionally, the vector further comprises regulatory sequences, including a eukaryotic promoter, that can control and direct expression of an inserted foreign gene. Alternatively, the regulatory sequences can be inserted into the vector along with the foreign gene of interest. Optionally, the expression vector for production of stably transfected cell lines further contains a marker for selection of the vector m the transfected eukaryotic cells .

The nucleic acid sequence which comprises the augmentor sequence is incorporated into such an expression vector which is then used to transfect host cells, such that the augmentor sequence is expressed m the host cell. The vector may be of bacterial or viral origin. Thus, the augmentor sequence can be inserted into host cells by viral infection, by carrier-mediated transfection, or by direct DNA uptake. Representative viral -mediated DNA transfer include adenoviruses, retroviruses , and vaccinia viruses. However, most viral expression systems have certain common limitations, which include the size of the inserted DNA sequence, the presence of cytopathic effects exerted by some viruses on the host cells, and the variability in expression of the transferred DNA sequence as expression depends upon proper translation, processing, and modification of the resulting protein. Preferably, the vector is a plasmid, which can then be transferred to eukaryotic host cells by one of several ways. These include direct injection into the cells, and more preferably transfer by transfection using calcium phosphate, DEAE-dextran, lipid- ediated, and electroporation methods. Typically, mammalian cell expression vectors contain multiple elements, including: mRNA processing signals such as mRNA cleavage and polyadenylation sequences, and frequently intervening sequence; plasmid backbone sequence to permit propagation and amplification in bacterial cells, and often selectable marker sequence to select cells that have stably incorporated the plasmid DNA. A vector of the method of the invention further comprises at least one cloning site into which the augmentor sequence is inserted. In an alternative embodiment, a vector of the method of the invention may further comprise a second cloning site into which a foreign gene can be inserted. Alternatively, a vector of the method of the invention may further comprise a foreign gene. The cloning sites typically consist of multiple restriction endonuclease sites for insertion of exogenous DNA. The promoters, enhancer elements, and RNA processing signals are functionally related, and the arrangement is critical. Techniques of preparing a vector comprising the augmentor and appropriate regulatory elements are well-known in the art. (Kriegler, M. (1990) in Gene Transfer and Expression, Stockton Press, New York.)

Foreign Gene of Interest The method of the invention is used to augment expression of a foreign gene of interest in a host cell . There are two different embodiments by which a foreign gene is transfected into a host cell. In the first embodiment, the foreign gene is present on a separate vector. In this embodiment, both the vector comprising the augmentor sequence and the vector comprising the foreign gene are transfected together, or co-transfected, into a host cell. The gene product of the augmentor sequence then acts to increase expression of the foreign gene. In an alternative embodiment, the vector comprising the augmentor sequence may further comprise a foreign gene; this vector may be a bicistronic vector or may contain separate promoters initiating expression of each gene encoded m the vector. In this embodiment, both tne augmentor sequence and the foreign gene are co-transfected into a host cell by means of a single vector, and the gene product of the augmentor sequence acts to increase expression of the foreign gene. One of the most commonly expressed foreign gene in a transient expression system is a reporter gene. As noted above, reporter genes are most frequently used as indicators of transcriptional activity m cells. The reporter gene is under control of regulatory elements, for which the activity or effectiveness m a host cell is measured by the expression of the reporter gene product. The level of transcriptional activity may be correlated to several factors, which include the efficiency of transfer of DNA into the host cell, the stability of the transferred DNA, and the efficacy of the regulatory elements, either in general or m a particular host cell or m response to changes in the physiological or biochemical environment of the host cell . The expressed reporter gene products which are measured include RNA, protein, and enzyme activity. A useful reporter gene is an easily assayed protein with minimal or no effects on the physiology of the host cell. Reporters are used in a number of applications.

These include testing of transcriptional control elements, identification of interacting proteins, monitoring of transfection efficiency, assays of viruses and viral mechanisms of action (in this case, the reporter gene is engineered into viral vectors) , and monitoring other cellular processes, including recombination events, gene targeting, RNA processing, and signal transduction. (See, for example, Groskreutz, D. and Schenborn, E. (1997) "Reporter Systems," in Recombinant Protein Protocols, Detection and Isolation (ed: Tuan, R.S.; Humana Press, Totowa, New Jersey), pp 11-30)

Detection of expression of the reporter following transfection is achieved by measuring the reporter mRNA or protein. Detection of the mRNA is a more direct measure of reporter gene expression than is detection of the protein, as the effects of transcription are measured directly, avoiding possible artifacts that may be the results of downstream processing. Reporter mRNA can be detected by Northern blot analysis, ribonuclease protection assays, or RT-PCR. However, measurement of RNA is cumbersome. Therefore, preferred assays measure the reporter gene protein product.

Reporter proteins can be assayed indirectly by detecting endogenous characteristics, such as enzymatic activity or spectrophotometric characteristics, or directly by using antibody-based assays. Enzymatic assays are generally quite sensitive due to the small amount of reporter enzyme required to generate the products of the reaction. However, endogenous enzyme activity will result in a high background. Antibody-based assays are usually less sensitive, but will detect the reporter gene protein whether it is enzymatically active or not.

Particularly useful reporter genes include, but are not limited to, firefly luciferase, Renilla luciferase, β-gal, green fluorescent protein, chloramphenicol acetyltransferase, β-glucuronidase, alkaline phosphatase, secreted alkaline phosphatase, and human growth hormone. The origin of these genes, their protein characteristics, and the assay for their detection and quantitation are all well known. (See, for example, Current Protocols in Molecular Biology (1995) , Chapter 9, "Introduction of DNA into Mammalian Cells," Section II, "Uses of Fusion Genes in Mammalian Transfection," (ed: Ausabel, F.M., et al . ; John Wiley & Sons, USA), pp. 9.6.1-9.6.12). The latter two proteins are of particular interest, as they are secreted from transfected culture cells into the culture medium. Therefore, the amount of secreted protein can be quantitated from a small sample of the culture medium. However, human growth hormone is not an enzyme, and the protein must therefore be measured directly by an antibody- based assay.

In addition to the expression of reporter genes, the method of the invention provides unexpected advantages in expressing proteins of experimental or commercial interest. The augmented expression resulting from the method of the invention results m expression levels of a foreign gene of up to an order of magnitude or more greater than that which is observed otherwise. This results in rapid, efficient production of proteins of experimental or commercial interest without the need to generate stable clones. In the past, the production of stable cell lines or clones which reliably produce a protein resulting from transfection is laborious, costly and time-consuming. In addition, such cell lines are often unstable. A protein expressed by the method of the invention can be produced and used withm a few days of co-transfecting the augmentor sequence and the gene for the foreign protein into a host cell; furthermore, with the method of the invention, expression and production of the foreign protein is stable for up to a week or more. Thus, for example, sufficiently high levels of a protein product of a new gene can be rapidly produced for subsequent analysis and use.

Expressed proteins of commercial value include therapeutic proteins that are preferably expressed in mammalian cell culture, because expression m bacteria or yeast can yield inactive protein. Examples of such protein include TPA and GM-CSF (granulocyte macrophage-cell stimulating factor) . These proteins are preferably secreted to the cell culture medium for ease of subsequent purification. However, these proteins are also localized within the transfected cells, or they are localized to the cell membranes.

Foreign gene promoters

Foreign genes are typically under control of a promoter; such promoters are well-known, and the choice of a promoter depends upon the intended purpose of the reporter gene. High level, constitutive expression in mammalian cells is achieved with CMV, SV40, and RSV promoters, which are well-known in the art. (Foeking, M.K. and Hofstetter, H. Gene 45:101, 1986; Okayama, H. and Berg P. Mol. Cell. Biol. 3:280, 1983). Other promoters include inducible promoters, such as the tetracycline inducible system, and the ecdysone inducible system suitable for mammalian cells.

Foreign gene expression vectors

The foreign gene under control of the promoter is placed into an expression vector. The characteristics of such an expression vector are well-known. (See, for example, Groskreutz, D. and Schenborn, E. (1997) "Reporter Systems," in Recombinant Protein Protocols, Detection and Isolation (ed: Tuan, R.S.; Humana Press, Totowa, New Jersey), pp. 11-30) . Typically, the expression vector contains no regulatory binding sites or sequences other than the ones knowingly inserted by the researcher. Furthermore, the expression plasmid vectors are usually propagated in E. coli , and therefore the plasmid backbone contains an origin for DNA replication (ori) and a gene for selection, often a gene for antibiotic resistance such as ampicillin resistance. Many expression vectors also contain multiple cloning sites. One is located upstream of the reporter gene, for cloning putative promoter or enhancer/promoter regions of interest. Another multiple cloning site may be located elsewhere m the plasmid for cloning regulatory elements, such as enhancer elements, that act at a distance from the regulated gene. Additional cloning sites can be used to incorporate selectable gene markers for long-term expression of the reporter gene.

Multi-expression vector with augmentor sequence and foreign gene

Eukaryotic expression vectors can be designed to express more than one protein withm a host cell of interest. Thus, in the method of the invention, an expression vector may comprise both an augmentor sequence and a foreign gene of interes . Such a vector is referred to as a multi-expression vector and offers the advantage of co-transfecting both an augmentor sequence and a foreign gene of interest with only a single vector.

In one embodiment, an expression vector comprises both an augmentor sequence and a foreign gene of interest. In a futher embodiment, expression of the augmentor sequence and of the foreign gene sequence may be under control of separate promoters. Alternatively, expression of both the augmentor sequence and of the foreign is under control of a single promoter.

In yet another embodiment, an expression vector comprises an augmentor sequence, and a multiple cloning site for insertion of a nucleic acid sequence encoding a foreign gene of interest. In a further embodiment, the expression vector comprises a second promoter that controls expression of the inserted foreign gene and which is located 5' to the multiple cloning site. In an alternative embodiment, the vector lacks a second promoter which controls expression of the inserted foreign gene, and the nucleic acid sequence encoding the foreign gene of interest further comprises a promoter which controls expression of the foreign gene. In yet another emoodiment , the vector comprises a first promoter that controls expression of both the augmentor sequence and of a foreign gene inserted into the cloning site.

In the first embodiment, expression of nucleic acid sequences encoding an augmentor sequence and a foreign gene can be obtained when two promoters are present in the vector and each nucleic acid sequence is cloned downstream of, or 3' to, its own promoter. The pACT-MyoD (pVP16/MyoD) vector is an example of such a vector construc . In the same plasmid, the CMV promoter initiates expression of a VP16/MyoD gene fusion and the SV40 promoter initiates expression of the neomycin phosphotransferase gene. A similar vector can be constructed where the CMV promoter drives expression of an augmentor sequence and the SV40 promoter drives expression of a foreign gene of interest. In an alternative er-oodiment , another type of vector construct utilizing internal πbosomal entry site (IRES) elements allows two or more genes to be expressed from a single promoter (Fussenegger, M. , et al . , Biotechnol . Prog. 13: 733-740, 1997). Transcription from the promoter provides a single multicistronic mRNA, and multiple proteins arise during the translation process through πbosome binding and translation initiation at the IRES elements. In one embodiment, such a vector has the following elements arranged a 5 ' to 3 ' orientation: a suitable promoter, an augmentor sequence, an IRES element, a foreign gene sequence, and polyadenylation signal. Preferably, the promoter is a eukaryotic promoter. In an alternative embodiment, such a vector has the following elements arranged m a 5' to 3 ' orientation: a suitable promoter, a foreign gene sequence, and IRES element, an augmentor sequence and a polyadenylation signal.

In an alternative embodiment, such a vector has the following elements arranged in a 5' to 3 ' orientation: a suitable promoter, an augmentor sequence, an IRES element, a multiple cloning site, and polyadenylation signal. An alternative embodiment has the vector elements arranged in the following 5' to 3 ' orientation: a suitable promoter, a cloning site, an IRES element, an augmentor sequence and a polyadenylation signal. Preferably, for all embodiments, the promoter is functional m eukaryotic cells. All embodiments may further comprise a sequence encoding a prokaryotic selectable marker; preferably, such a sequence is located 3' of the polyadenylation signal. All embodiments may yet further comprise a nucleic acid sequence encoding a eukaryotic selectable marker; preferably, such a vector further comprises a promoter 5' to such a sequence encoding a eukaryotic selectable marker. Thus, m a most preferred embodiment, a vector comprises in 5 ' to 3 ' order: regulatory sequence for initiating expression of an augmentor sequence; an augmentor sequence; regulatory sequence initiating expression of a eukaryotic selectable marker; a eukaryotic selectable marker sequence; an IRES element, a cloning site following the IRES; and a gene coding for a prokaryotic selectable marker.

Host Cells

The method of the present invention may be used to transfect any eukaryotic cell that is capable of being transfected. Such cells include cultured mammalian cells, such as cell lines NIH3T3 (mouse fibroblast) , C2C12 (mouse myoblast) , Neuro2A (mouse neuroblastoma) , C3H10T1/2 (mouse fibroblast) and BHK-21 (baby hamster kidney) (all cell lines obtained through ATCC, VA) . The cell lines are myogenic, or capable of developing into muscle cells; examples of myogenic cells include such cells as fibroblasts or myoblasts. Alternatively, the cell lines are neurogenic, or capable of developing into nerve cells. Especially useful are cell lines that are approved for the use of producing recombinant protein for therapeutics. Such a cell line could be repeatedly transfected with the method of the invention, and used to rapidly produce large quantities of therapeutic protein for immediate use. An example of an approved cell line is BHK- 21 (baby hamster kidney) , which is also fibroblast-like.

Although the mechanism underlying the augmented expression of a foreign gene when co-transfected with an augmentor sequence is unknown, it appears that the presence of an augmentor sequence protein product is required. It also appears that the augmentor sequence protein product is not binding to an E-box m the promoter. However, order to achieve optimal augmented expression of a foreign gene co-transfected with an augmentor sequence, it may be necessary to select an appropriate augmentor sequence for any particular host cell. Any particular augmentor sequence may result in varying degrees of augmented expression of a foreign gene m a host cell. It is a matter of routine experimentation to determine which augmentor sequence will achieve optimal expression of a foreign gene in a particular host cell.

As general guidelines, augmentor sequences which encode proteins derived from a particular tissue type generally achieve optimal augmented expression of a foreign gene in cell lines that are established from that tissue type or from progenitors of that particular tissue. Thus, augmentor sequences that encode proteins derived from myogenic transcription factors acnieve optimal augmented expression of a foreign gene in cell lines established from muscle cell tissues and muscle cell progenitors, while augmentors sequences that encode neurogenic transcription factors function similarly m cell lines established from neural tissues or neural cell progenitors. Several types of augmentor sequences that achieve augmented expression of transiently co-transfected foreign genes m particular cell lines are given m the Examples which follow.

Transfection Methods

Transfection of DNA expression vectors into eukaryotic cells is achieved by well-known techniques. The particular method of transfection utilized will depend upon both the expression vector and the host cell used. Typical methods of transfection for mammalian cells include calcium phosphate transfection, transfection using DEAE-Dextran, transfection by electroporation, and liposome-mediated transfection (Current Protocols m Molecular Biology (1995) , Chapter 9, "Introduction of DNA into Mammalian Cells," Section I, "Transfection of DNA into Eukaryotic Cells," (ed: Ausabel, F.M., et al . ; John Wiley & Sons, USA), pp. 9.1.1-9.5.6); Kπegler, M. (1990) m Gene Transfer and Expression, Stockton Press, New York) and are well known in the art.

Stable transfection requires the presence of a selectable marker m the vector used for transfection. Transfected cells are then subjected to a selection procedure; typically, selection involves growing the cells in a toxic substance, such as G418 or Hygromycm B, such that only those cells expressing a transfected marker gene conferring resistance to the toxic substance upon the transfected cell survive and grow. Such selection techniques are well known m the art. Typical selectable markers are well known, and include genes encoding resistance to G418 or hygromycm B.

Foreign Gene Assay Methods

The expression product of the foreign gene may be detected by any of several means The choice again depends upon both the type of foreign gene and the type of host cell utilized, as well as the purpose of the transfection. Either the immediate product of transcription, mRNA, or the protein product resulting from translation of the mRNA, is measured. Detection of the mRNA is a more direct measure of reporter gene expression than is detection of the protein, as the effects of transcription are measured directly, avoiding possible artifacts that may be the results of downstream processing results. However, measurement of RNA is very cumbersome. Therefore, preferred assays measure the reporter gene protein product. mRNA can be detected by Northern blot analysis, ribonuclease protection assays, or RT-PCR by methods well- known in the art . (Current Protocols in Molecular Biology (1995) , Chapter 4, "Preparation and Analysis of RNA" (ed: Ausabel, F.M., et al . ; John Wiley & Sons, USA), pp. 4.01- 4.10.11) .

The protein products of foreign gene expression can also be measured, either directly by using antibody- based assays or indirectly by detecting endogenous characteristics, such as enzymatic activity or spectrophotometric characteristics. The choice depends upon the type of protein being analyzed, and the purpose of the analysis. Techniques of protein analysis are well- known in the art (Current Protocols in Molecular Biology (1995), Chapter 10, "Analysis of Proteins" (ed: Ausabel, F.M., et al.; John Wiley & Sons, USA), pp. 10.01- 10.19.12). Antibody-based assays are usually less sensitive, but will detect the reporter protein whether it is enzymatically active or not. Enzymatic assays are generally quite sensitive, due to the low amount of enzyme required to generate the products of the reaction. However, the presence of any endogenous enzyme activity will result in a higher background. An expressed protein of commercial value is purified from cells transfected with a foreign gene expressing the protein Preferably, the protein is secreted to the cell culture medium for ease of subsequent purification. However, the protein may also be localized withm the transfected cells, or it may be localized to the cell membranes. The expressed protein is purified by well- known techniques; the particular protocol selected depends upon the protein, its localization, and its intended purpose .

Augmented Expression of a Foreign Gene

Expression of an extrachromosomal foreign gene in a eukaryotic host cell is improved by a method of the present invention. The improvement is either an increase in the level of expression of the gene, or a prolonged period of expression of the gene, or preferably both.

The amount of the increase m either the level or the duration of expression achieved depends upon the cell line used and the promoter initiating expression of the foreign gene. An increase the level of expression of the foreign gene is an increase of at least about two- fold in the presence, as compared to m the absence, of a polypeptide expressed of a co-transfected nucleic acid sequence comprising an augmentor sequence. This increase can be measured as either the amount of the polypeptide expressed, the amount of the mRNA transcribed, or the activity of the polypeptide expressed. Thus, for example, co-transfection of NIH3T3 cells with firefly luciferase under control of the CMV promoter, which is a strong promoter in this cell line, together with an augmentor sequence operatively linked to a regulatory sequence resulted in about a 25-fold greater activity of the luciferase at 48 hours post-transfection when compared to the activity at this time point in the absence of the augmentor sequence .

Luciferase activity also increased by at least twofold from 48 to 96 hourse post-transfection in the presence of the augmentor sequence and its regulatory sequence, whereas the activity in the absence of the augmentor sequence decreased by about ten-fold over the same time period.

An increase in the duration, or the prolonged period, of expression of a foreign gene is a continuation of increased expression levels at least two days beyond the day of highest expression levels in cells co-transfected with a sequence capable of expressing a foreign gene and a sequence capable of expressing an augmentor factor compared to cells transfected with a sequence capable of expressing a foreign gene, but no sequence capable of expressing an augmentor factor. Co-transfection of a sequence capable of expressing an augmentor factor maintains increased levels of expression of the foreign gene during the time period when expression levels decline in cells not transfected with sequence capable of expressing an augmentor factor. Preferably, an increase in expression of a foreign gene is expression that does not decrease after about 48 hours after transfection, and which more preferably increases after 48 hours. Expression of a foreign gene preferably continues at increased levels of expression, as defined above, up to about 10 days post-transfection.

Expression of a foreign gene stably integrated into the genome of a eukaryotic host cell is also improved by a method of the present invention. The improvement is an increase in the level of expression of the gene, as defined above. The improvement is also an increased frequency of generation of cells stably expressing the foreign gene of interest. An increased frequency is an increase by at least two fold in the number of clonal cell colonies or populations that stably express the foreign gene of interest and that were transfected with a nucleic acid sequence capable of expressing an augmentor factor when compared to the number of clonal cell colonies that stably expressing the foreign gene of interest which were not transfected with an augmentor sequence. Preferably, the increased frequency is an increase of about at least three-fold.

The following examples are provided for illustrative purposes only, and are not intended to limit the scope of the invention to the exemplified embodiments.

Examples

Example 1 : Cloning and Methods

Cloning steps used for construction of plasmids which encode protein products derived from murine MyoD: pCISM, pCILG, pCIneoSM, and pCIneoLG are described herein. This example also describes cloning steps used for construction of plasmids comprising a foreign gene and details procedures used for transfection of plasmids into eukaryotic cell lines and assays used to determine expression of foreign genes. A. Cloning Al . Augmentor Sequence Plasmids

A murine DNA encoding MyoD was inserted into two mammalian expression vectors named pCI and pCI-neo (Promega Corp., E1731, E1841) . The murine MyoD coding region plus 5' and 3' flanking sequences, or the coding region only, was obtained from the pACT-MyoD Control Vector (Promega Corp., E248A) . The murine cDNA portion of pACT-MyoD corresponds to Genbank number M84918 bases 126 through 1816. When the fusion protein of VP16/MyoD present in pACT-MyoD is expressed, there is an additional 22 amino acids (encoded by bases 126-191) 5' of the actual MyoD ATG start codon (bases 192-194) expressed. There are also 667 nucleotides (bases 1149-1816) of the 3' untranslated region of the murine MyoD cDNA present in pACT-MyoD downstream from the actual MyoD stop codon.

Polymerase chain reaction (PCR) amplification was used to generate a blunt -end amplification product of MyoD cDNA for cloning into both the pCI (Promega Corp., E1731) and pCI-neo (Promega Corp., E1841) mammalian expression vectors .

For cloning the MyoD coding region and associated 5 ' and 3 ' noncoding regions of the murine myoD cDNA present in pACT-MyoD ("Large MyoD"), the following primers were designed: forward primer (F1M) 5 ' AGCCATGCCGGAGTGGCAGAAAGTT AAG 3¹ (SEQ ID NO: 3) which corresponds to nucleotides 126- 146 of the murine myoD cDNA and furnishes a mammalian Kozak consensus translational start sequence for translation, and reverse primer (RIM) 5' ATTTCCAACACCTGACTCGCC 3' (SEQ ID NO: 4) which corresponds to nucleotides 1816-1796 of the murine myoD cDNA. The PCR amplification product generated using primers F1M and RIM in a standard PCR reaction using pACT-MyoD as the nucleic acid template, is 1690 base pairs long and corresponds to bases 126-1816 of the murine myoD cDNA and encodes a 340 amino acid product (318 amino acids of MyoD preceeded by 22 amino acids) like that found in the MyoD portion of pACT-MyoD.

For PCR amplification of the coding region only ("Small MyoD") which comprises bases 192-1148 of the murine myoD cDNA, the following primers were used: forward primer (F2M) 5' AGCCATGGAGCTTCTATCGCCGCC 3' (SEQ ID NO: 5) which corresponds to nucleotides 192-211 and furnishes a mammalian Kozak consensus sequence for efficient mammalian translation, and reverse primer (R2M) 5 ' TCAAAGCACCTGATAAATCGC 3¹ (SEQ ID NO: 6) which corresponds to nucleotides 1148-1128 of the murine myoD cDNA. The amplification product generated using primers F2M and R2M in a standard PCR reaction with pACT-MyoD as the DNA template is 957 bp long and encodes a 318 ammo acid MyoD product .

Two separate amplification reactions were performed. For each 50 μl amplification reaction, 30 ng of the pACT-MyoD vector was used with 0.2 μg of each primer, 2.5 units Pfu DNA Polymerase (Stratagene, LaJolla, CA) , 5 μl 10X Pfu Reaction Buffer, and 10 mM each dNTP . The final volume was made up with sterile water. Each reaction was overlaid with sterile mineral oil. The amplification reaction was performed using the following program: 94°C/20 seconds: 62°C/20 seconds : 72°C/l mmute (30 cycles), 72°C/10 minutes (1 cycle) , 4°C soak.

The amplification products were visualized on a 1% Low Melting Point (LMP) Agarose gel and purified using the AgarACE^® Agarose-Digestmg Enzyme (Promega Corp., M1741) as per manufacturer's instructions. The PCR fragments (250 ng) were phosphorylated for subsequent ligation into the appropriate vectors using T4 Polynucleotide Kinase (Promega Corp., M4101) as per manufacturer's instructions, ethanol precipitated, and resuspended m sterile water. The pCI and pCI-neo vectors are high copy number plasmids. The sequence present m pBR322 that has been shown to inhibit replication of SV40 origin-containing vectors in COS cells is not present in these vectors. The pCI vector is designed to promote constitutive expression of cloned DNA inserts m mammalian cells. The pCI vector contains the human cytomegalovirus (CMV) major immediate- early gene enhancer/promoter region, allowing for strong, constitutive expression in a variety of cell types. The promiscuous nature of the CMV enhancer/promoter has been demonstrated in transgenic mice, where expression of the chloramphenicol acetyltransferase (CAT) gene regulated by the CMV enhancer/promoter was observed m 24 of the 28 tissues examined (Schmidt, E.V. Mol . Cell . Biol . 10:4406, 1990) .

Downstream of the enhancer/promoter region is a chimeric mtron composed of the 5 '-donor site from the first mtron of the human β-globm gene and the branch and 3 '-acceptor site from the mtron that is between the leader and the body of an immunoglobulin gene heavy chain variable region (Bothwell, A. Cell 24: 625, 1981). In transgenic experiments, the presence of an mtron is necessary to promote a high level of expression for virtually all cDNA inserts (Brmster, R.L., et al . Proc . Natl . Acad . Sci . 85:836, 1988; Choi, T., et al . Mol . Cell . Biol . 11:3070, 1991) . The sequences of the donor and acceptor sites, along with the branchpoint site, have been changed to match the consensus sequences for splicing (Senepathy, P., et al . Meth . Enzymol . 183:252, 1990). The mtron is located 5' to the cDNA insert m order to prevent utilization of possible cryptic 5 '-donor splice sites withm the cDNA sequence (Huang, M.T.F. and D.M. Gorman. Mol . Cell . Biol . 10:1805, 1990) .

A T7 promoter is located downstream of the mtron, 5' of the multiple cloning region. This promoter can be used to synthesize RNA transcripts m vi tro using T7 RNA polymerase and these transcripts can subsequently be translated in vi tro to the corresponding protein product. The multiple cloning region is located downstream from the T7 promoter. There are no ATG sequences in either the multiple cloning region or between the transcriptional start site and the multiple cloning region. Thus, an ATG for the initiation of translation must be present in the inserted DNA. Sites m the multiple cloning region from 5' to 3' include; N e I, Xho I, EcoR I, Mlu I, Kpn I, Xba I, Sal I, Ace I, S a I, BstZ I, Not I.

A polyadenylation signal follows the multiple cloning region. The late SV40 polyadenylation signal found in the pCI vector is extremely efficient and has been shown to increase the steady-state level of RΝA (Carswell, S. and J.C. Mol. Cell . Biol . 9: 4248, 1989) . Polyadenylation signals cause termination of transcription by RNA polymerase II and signal the addition of approximately 200 to 250 adenosine residues to the 3 '-end of the RΝA transcript (Proudfoot, Ν.F. Cell 64:671, 1991). Polyadenylation has been shown to enhance RΝA stability and translation (Bernstein and Ross, Trends Biochem . Sci . 14:373, 1989, Jackson and Standar , Cell 62:15, 1990). The pCI-neo mammalian expression vector is similar to the pCI vector in respect to construction components, except for several additions and deletions as detailed hereinbelow.

In the pCI-neo vector, T7 and T3 RΝA polymerase promoters flank the multiple cloning region. These promoters can be used to synthesize RΝA from the sense and the antisense strand of the cloned DΝA insert. The unique restriction sites available in the multiple cloning region of pCI-neo are nearly identical to those found in the pCI vector with the exception that pCI-neo does not contain a unique Kpn I or BstZ I site within this region.

The neomycin phosphotransferase gene (neo) , a selectable marker for mammalian cells, is located downstream of the SV40 polyadenylation signal. Therefore, the pCI-neo vector can be used for transient expression or for stable expression of a cloned gene. A stable cell line created with this vector is selected with the antibiotic G418 (Southern and Berg, J. Molec . Appl . Genet . 1: 327, 1982) . Expression of the neo gene is directed by the SV40 enhancer and early promoter. The SV40 early promoter contains the SV40 origin of replication, that will induce transient episomal replication of the pCI-neo vector in cells expressing the SV40 large T antigen such as COS-1 or COS-7 cells (Gluzman, Y., Cell 23: 175, 1991). A synthetic polyadenylation signal based on the highly efficient polyadenylation signal of the rabbit β-globm gene (Levitt, N. , et al . Genes Dev. 3: 1019, 1989) is located downstream of the neo gene. To increase the translational efficiency of the neo gene, the upstream, out-of-frame ATG sequences present the wild-type neo gene have been eliminated. Additionally, the sequence upstream of the initiator ATG ήas been changed to match a sequence shown to improve the context for initiating translation (Kozak, M. J^". Cell . Biol . 108:229, 1989). The pCI and pCI-neo vectors were prepared for blunt-end ligation. In separate reactions, 5 μg of each vector was digested with 10 units S a I restriction enzyme for 3 hours at 25°C, yielding blunt end linear vector. The linearized vectors were visualized on a 1% LMP Agarose gel and AgarACE^® purified as previous described. The linearized vectors were dephosphorylated using Calf Intestinal Alkaline Phosphatase (Promega Corp., M1821) as per manufacturer's instructions, phenol : chloroform extracted, ethanol precipitated, and resuspended m sterile water. Large and small myoD PCR products were then ligated into these pCI and pCI-neo vectors. In a 10 μl total ligation volume, a 50:1 ratio of insert : vector pmole ends were ligated using 3 units T4 DNA ligase (Promega Corp., M1801) overnight at 14°C. Four ligation reactions were assembled:

Vector Insert Plasmid Name

1. pCI + small myoD pCISM

2. pCI + large myoD pCILG

3. pCI-neo + small myoD pCIneoSM 4. pCI-neo + large myoD pCIneoLG After an overnight incubation, each ligation reaction was separately transformed into JM109 cells (Promega Corp., L2001) . Clones were screened for correct insert incorporation by restriction digest mapping. The correct pCISM plasmid is 4969 bp m length and yields the following restriction maps: Ban II--3148 bp, 1279 bp, 542 bp; and Mlu I--4350 bp, 619 bp . The correct pCILG plasmid is 5706 bp and yields the following restriction maps: Ban 11-3148 bp, 1192 bp, 611 bp, 581 bp, 174 bp; and Mlu 1-5018 bp, 688 bp. The correct pCIneoSM plasmid is 6435 bp and yields the following restriction maps: Ban 11-3272 bp, 1316 bp, 1307 bp, 540 bp; and Mlu 1-5816 bp, 619 bp . The correct pCIneoLG plasmid is 7172 bp and yields the following restriction maps: Ban 11—3245 bp, 1316 bp, 1192 bp, 636 bp, 609bp, 174 bp; and Mlu 1-6484 bp, 688 bp .

The plasmid clones which yielded restriction maps suggesting the appropriate insertion and orientation of the MyoD coding region insert were further checked for their ability to generate the predicted MyoD protein. DNA from each clone was used m the TNT® T7 Quick Coupled Transcription/Translation System (Promega Corp., L1170) and the reaction was performed as per manufacturer's instructions to generate a ³⁵S-methιonme labeled protein. The in vitro generated proteins were separated by SDS-PAGE, transferred to a PVDF membrane by electro-blotting, and the membrane exposed to a phosphoimager screen overnight. Following overnight exposure, the screen was scanned by the Molecular Dynamics Phosphorlmager (Molecular Dynamics, CA) . The large MyoD protein was predicted to be 38kD and the small MyoD protein was predicted to be 35kD. Of the clones that yielded the predicted restriction maps and protein size, two were chosen from each construct for dideoxy sequencing. After sequence verification, one clone from each construct was chosen for all subsequent characterizations . A.2. Foreign Gene Plasmids

A.2.a. Firefly luciferase initiated by CMV promoter

The pCMVLuc reporter vector, also known as pCI- Luc, contains the luciferase gene (luc) from the firefly Photinus pyralis downstream of the human cytomegalovirus (CMV) major immediate-early gene enhancer/promoter regions. To construct the pCI-Luc reporter vector, the luc gene was removed from the pGL3Basic vector (Promega Corp., using the restriction enzymes Xho I and Xba I, whose restriction sites flank the luc gene 5' (base 32 in pGL3Basic) and 3' (base 1747 in pGL3Basic) , respectively, yielding a 1715 bp luc-containing fragment. The fragment was then ligated into pCI at the same restriction enzyme sites within the multiple cloning region. The ligation reaction was transformed into JM109 cells. Bacterial colonies were screened by harvesting plasmid DNA (Wizard® Plus Minipreps DNA Purification System, Promega Corp.,

A7100) and the DNA restriction digest mapped to confirm the predicted insertion of the luc gene in the pCI vector.

A.2 ,b. Firefly luciferase initiated by SV40 promoter

The pSV40Luc reporter vector, also known as pGL3 Control reporter vector (Promega Corp., E1741) , contains the firefly luc gene downstream of the SV40 enhancer/promoter region.

A.2. c . Firefly luciferase initiated by RSV promoter

The pRSVLuc reporter vector containing the firefly luc gene under promotion of the RSV promoter region was a kind gift from Dr. J.A. Wolff (University of Wisconsin-Madison, WI) . Construction of the pRSVLuc reporter vector, also known as pRSVL, has been previously described (Wolff, J.A. , et al . Science 247:1465-1468, 1990) . A.2.d. Green Fluorescent Protein initiated by CMV promoter

The pCIneoGFP reporter vector contains the green fluorescent protein (gfp) gene from the jellyfish Aeqruorea victoria under promotion of the human CMV major immediate- early gene enhancer/promoter regions . To construct the pCIneoGFP reporter vector, the gfp gene was excised from the vector pAlpha+GFP ^λCycle3' (Crameri, A., et al . Nat . Biotechnol . 14:315-319, 1996) using the restriction enzymes Xba I (5' of the gfp gene) and EcoR I (3' of the gfp gene) , a 730 bp fragment containing gfp was excised from pAlpha+GFP * Cycle3'. The gfp-containing restriction fragment was ligated into the Nhe I and EcoR I restriction sites in the multiple cloning region of the pCIneo vector. The ligation reaction was transformed into JM109 cells.

Bacterial colonies were screened by harvesting plasmid DΝA as described above and restriction digest mapping the DΝA to confirm the insertion of the gfp gene into the pCIneo vector. A.2 ,e . Renilla luciferase initiated by SV40 promoter

The pRL-SV40 reporter vector (Promega Corp., E2231) , contains the luciferase gene cloned from the marine organism Renilla reniformis (Lorenz, W. Proc . Natl . Acad . Sci . 88:4438, 1991), known as Renilla luciferase under promotion of the SV40 enhancer/promoter regions.

A.2. f . Secreted Alkaline Phosphatase initiated by SV40 promoter

The pSEAP2 -Control Vector (GenBank #U89938, Clontech, CA) contains the human placental alkaline phosphatase gene cloned downstream of the promoter of the early SV40 enhancer/promoter regions. The alkaline phosphatase gene containing a signal peptide and deleted of a membrane anchoring domain results in secretion of the protein from cultured cells into the culture medium. A.2 ,g. Beta-galactosidase The pCI-β-Gal reporter vector contains the lacZ gene from E. coli that codes for the β-gal enzyme under promotion of the human CMV immediate-early gene enhancer/promoter region. To construct the pCI-β-Gal vector, the lacZ gene from the pSV-β-Galactosidase Control Vector (Promega Corp., E1081) was restricted and cloned into the multiple cloning site of the pCI vector using standard techniques . B . Methods B.l. Transient Transfection

The constructs pCISM, pCILG, pCIneoSM, and pCIneoLG were used to transfect a variety of immortalized cell lines. These lines include NIH3T3 (mouse fibroblast), BHK-21 (Baby Hamster Kidney) , C2C12 (mouse myoblast) , and C3H10T1/2 (mouse fibroblast) (all cell lines were obtained through ATCC, VA) . Each construct was co-transfected with a reporter expression plasmid to assess the effect of MyoD expression on reporter gene expression. Typically, the cells were transfected with about the same amount of the MyoD expression plasmid and reporter expression plasmid, and in some cases additional carrier DNA. Control cells transfected without a MyoD expression plasmid were transfected with reporter plasmid and carrier DNA. All cell lines tested were transfected via CaP0 co- precipitation and/or lipid complexation according to standard methods well known in the art. After transfection, the cells were typically incubated at 37°C in 10% C0₂.

Typically, tissue culture cells were seeded at 5xl0⁴ cells/well of a 24 well plate the day prior to transfection to achieve approximately 70% confluency the day of transfection. The ProFection® Mammalian Transfection System-Calcium Phosphate (Promega Corp., E1200) was used and transfection was performed as per manufacturer's instructions using 0.5 μg of the MyoD- expression plasmid with 0.5 μg of the reporter plasmid for 1 μg total DNA per well. NIH3T3 cells were transfected by lipid complexation using TransFast™ Reagent (Promega Corp., E2431) according to manufacturer's instructions. The total amount of DNA and DNA: lipid ratio for each well for NIH3T3 cells was 1 μg DNA and 3 μl TransFast™ Reagent (1:1 DNA: lipid ratio) . A 0.5 μg aliquot of the MyoD expression plasmid, or vector DNA without myoD gene, and 0.5 μg of the reporter plasmid was used for a total of 1 μg total DNA per well .

For Renilla luciferase assays, cell culture and transfection was performed in 60mm dishes. NIH3T3 cells were seeded at 1.5xl0⁵ cells/60mm dish one day prior to transfection. Transfection was performed by CaP0₄ co- precipitation as described by the manufacturer (Promega Corp., E1200) , except for one procedural change; BES Buffered Saline (BBS) (Chen, C. and Okayama . Mol . Cell . Biol . 7:2745, 1987) was used for creating DNA/CaP0₄ co- precipitates in lieu of HEPES Buffered Saline (HBS) . The DNA used per 60 mm dish was 5 μg total, composed of 1 μg pRL-SV40, 1 μg pACT-MyoD, and 3 μg of pGEM3Zf ( + ) (Promega Corp., P2271) as carrier DNA. B.2. Assays for Expression of Foreign Genes B.2.a. Cell Lysis

At the indicated time points post-transfection, the cells were lysed and the supernatants were harvested and stored at -70°C. For supernatant harvest, the media was drained from the transfected cells and 100 μl of IX Cell Culture Lysis- Reagent (CCLR, Promega Corp.E1531) was added to each well of a 24 well plate, 500 μl to each well of a 6-well plate. The supernatants were stored at -70°C until all time points were collected at which time the samples were assayed for the presence of the firefly luciferase reporter gene product. Cells analyzed for Renilla luciferase were lysed with 400 μl of 1 X Passive Lysis Buffer (Promega Corp., E1941) per 60 mm dish. Cell supernatants were stored at -70°C until all time points were collected. When the reporter gene protein was secreted into the culture medium, the cell culture medium was removed, centrifuged to remove cellular debris, and a sample of the supernatant analyzed for the presence of the reporter gene product.

B .2 ,b. Luciferase

Firefly luciferase activity was measured using the Luciferase Assay System (Promega Corp. E1500) and the Labsystems Luminoskan RT luminometer (Labsystems, MA) . For each sample, 20 μl of lysate was placed into one well of a 96 well Labsystems Cliniplate (Labsystems, MA) . The luminometer was primed for autoinj ection of the luciferase assay reagent (LAR, Promega Corp., E148A) and a stop solution (25% isopropanol and 20mM EDTA) which stops luminescence of a sample to prevent adjacent samples from recording extraneous light output. The luminometer performed the following luciferase assay for each sample; inject 100 μl LAR, delay 2 seconds, measure light output for 10 seconds, inject 50 μl stop solution, move to next sample and repeat. Results are recorded as relative light units (RLU) between 0 and 9999 RLU's. Any samples yielding RLU' s over 9999 were re-assayed by adding a smaller amount of lysate to a 96 well Cliniplate, repeating the measurement, and multiplying the resultant RLU's by the appropriate dilution factor.

Renilla luciferase samples were processed one at a time with a Turner luminometer. To each cuvette was added 20 μl of lysate sample, 100 μl of Luciferase Assay Reagent II followed by 100 μl Stop&Glo^® Reagent (Dual Luciferase Assay, Promega Corp. E1910) . Light output was captured for 10 seconds and recorded.

B.2. c . Green Fluorescent Protein

Green Fluorescent Protein (GFP) was measured by well-known methods. (Current Protocols in Molecular Biology (1995) , Chapter 9, "Introduction of DNA into Mammalian Cells," Section II, "Uses of Fusion Genes in Mammalian Transfection," (ed: Ausabel, F.M., et al . ; John Wiley & Sons, USA), pp. 9.6.1-9.6.12) GFP yields a bright green fluorescence when either cells or cell lysates are excited by blue or UV light. The fluorescence does not require additional proteins, substrates, or co-factors. Cells were analyzed post-transfection for GFP using a standard fluorescent microscope equipped with a fluorescein filter. Trypsinized cells in suspension were analyzed for fluorescence intensity with a SpexFluorolog 1680 0.22m Spectrometer.

B.2.d. Secreted Alkaline Phosphatase

Secreted Alkaline Phosphatase (SEAP) was measured by well-known methods. (Current Protocols in Molecular

Biology (1995), Chapter 9, ed: Ausabel, F.M., et al.; John Wiley & Sons, USA) . SEAP is a form of the human placental alkaline phosphatase gene which lacks the 24 carboxy- terminal amino acids, which therefore prevents the enzyme from anchoring to the plasma membrane, resulting instead in its secretion from transfected cells into the culture medium. SEAP is stable to heat and to the phosphatase inhibitor L-homoarginine, whereas endogenous alkaline phosphatase is not. Therefore, treatment of cell lysates with heat or L-homoarginine inactivates background endogenous alkaline phosphatase activity, thus eliminating high background activity. Improved assay sensitivity is achieved by employing luminescent substrates, such as D- luciferin-O-phosphate, in which dephosphorylation of the luciferin by SEAP results in free luciferin which in turn is a substrate for luciferase, or 1 , 2-dιoxetone CSPD, in which dephosphorylation of CSPD results m sustained luminescence. Under non-limit g concentrations of substrate, the level of light output is proportional to the amount of alkaline phosphatase activity.

B.2. e . Beta-galactosidase β-gal activity is measured by well-known methods (Current Protocols in Molecular Biology (1995) , Chapter 9, ed: Ausabel, F.M., et al) . β-gal catalyzes the hydrolysis of beta-galactoside sugars such as lactose. The enzymatic activity in cell extracts can be assayed with various specialized substrates, such as o-nitrophenyl-β-D- galactopyranoside, that allow quantitation of the enzyme activity with a spectrophotometer, a fluorometer, or a luminometer. Intracellular levels of β-gal can be visualized by an m si tu colorimetric assay using the substrate X-Gal . The intensity of the blue stain is roughly proportional to the amount of β-gal activity.

Example 2 Effect of Augmentor Sequence on Expression of Firefly Luciferase Downstream of Different Promoters in NIH3T3 Cells

The following experiments report results observed when a foreign gene is co-transfected into a host cell with an augmentor nucleic acid sequence and both nucleic acids are expressed. Different foreign genes, under control of different promoters, were transfected into different host cells, with and without co-transfection with an augmentor nucleic acid sequence. The nucleic acid sequence of the augmentor sequence also varied.

The expression of firefly luciferase m NIH3T3 cells at 48, 72, and 96 hours post-transfection with firefly luciferase plasmids differing m promoter/enhancer regions was observed when co-transfected with or without an augmentor nucleic acid sequence.

NIH3T3 cells were seeded one day prior to transfection at 5 x 10⁴ cells per well of a 24 well plate. Cells were transfected using CaP0₄ co- precipitation and 1 μg total DNA per well. For cotransfections with an augmentor nucleic acid sequence, the plasmids used were 0.5 μg pCISM plus either: 0.5 μg pCMV- luc; 0.5 μg pSV40-luc; or 0.5 μg pRSV-luc. For control transfections in the absence of an augmentor nucleic acid sequence, the plasmids used were 0.5μg pCI as carrier DNA plus either: 0.5 μg pCMV-luc; 0.5 μg pSV40-luc; or 0.5 μg pRSV-luc. The media were changed on cells 1 hour prior to transfection. The DNA was added to 0.2M CaCl₂ solution, mixed with HBS, allowed to form DNA/CaP0₄ co-precipitation complexes for 30 minutes at room temperature, and then added to the cells. The cells were incubated overnight with DNA/CaP0₄ complexes at 37°C, 10% C0₂, after which time the media were changed. At 48, 72, and 96 hours post-transfection, the media was removed and 100 μl of IX CCLR was added to each well. To assay for firefly luciferase activity, 100 μl LAR was added to 20 μl of each lysate and the light output immediately captured for ten seconds via luminometer measurement. Data are reported as relative light units

(LU)/20μl sample volume. The data points represent the mean of n=4.

Co-transfection of NIH3T3 cells with a nucleic acid capable of expressing luciferase and with an augmentor sequence (pCISM) resulted in increased expression of luciferase when compared to transfection with luciferase expression vector alone, as is shown in FIG 2. Increased level of luciferase expression is observed when the luc gene is under control of either the CMV promoter (FIG 2A) or the SV40 promoter (FIG 2B) or the RSV promoter (FIG 2C) . The expression of luciferase m the presence of a plasmid expressing augmentor sequence is both increased and prolonged. Thus, expression of luciferase under control of the CMV promoter (FIG 2A) m the absence of an augmentor sequence decreased by about six fold from 48 hrs to 72 hrs, and by about twelve-fold by 96 hrs. In contrast, when a plasmid expressing augmentor sequence was present, luciferase expression was about twenty- fold higher at 48 hrs post-transfection, and increased from this level by about two and a half fold at 96 hours post-transfection. Thus, m the presence of a plasmid expressing augmentor sequence, the expression of luciferase was about 1300 times greater at 96 hours than m the absence of a plasmid expressing augmentor sequence.

Similar results were observed for luciferase under control of the SV40 promoter (FIG 2B) and the RSV promoter (FIG 2C) . For the SV40 promoter, luciferase expression decreased about eight -fold by 96 hours post- transfection m the absence of a plasmid expressing augmentor sequence, whereas m the presence of a plasmid expressing augmentor sequence the luciferase expression increased by about three and a half fold by 96 hours post- transfection, and was about 350 times greater than in the absence of a plasmid expressing augmentor sequence. For the RSV promoter, luciferase expression decreased about three-fold by 96 hours post-transfection m the absence of a plasmid expressing augmentor sequence, whereas m the presence of a plasmid expressing augmentor sequence luciferase expression increased by about twelve fold by 96 hours post-transfection, and was about 1500 times greater than in the absence of a plasmid expressing augmentor sequence . Similar results are also observed when NIH3T3 cells are co-transfected with a luc gene under control of each promoter and with an augmentor sequence found in either of the vectors pCILG, pCIneoSM and pCIneoLG. The plasmid expressing augmentor sequence contained within each of these three vectors, when co-transfected with a plasmid expressing the luc gene under control of each promoter, CMV, SV40, and RSV, also resulted in increased expression of luciferase for each promoter. Thus, the presence of a plasmid expressing augmentor sequence increases the expression of luciferase in transfected NIH3T3 cells, by both increasing the level of expression, and by prolonging the period of time in which high levels of luciferase are expressed compared to cells expressing luciferase in the absence of transfected augmentor sequence .

Example 3 : Effect of Augmentor Sequence on Luciferase Expression Under Control of Different Promoters in C2C12 Cells

The expression of firefly luciferase in C2C12 cells 48, 72, and 96 hours post-transfection with firefly luciferase expression plasmids differing in promoter/enhancer regions was analyzed in the presence and absence of a plasmid expressing an augmentor sequence.

C2C12 cells were seeded one day prior to transfection at 5 x 10⁴ cells per well of a 24 well plate. Cells were transfected using CaP0₄ co-precipitation and 1 μg total DNA per well. For co-transfections with a plasmid expressing augmentor sequence, the plasmids used were 0.5μg pCISM plus either: 0.5 μg pCMV-Luc, 0.5 μg pSV40-Luc, or 0.5 μg pRSV-Luc. For control transfections in the absence of a plasmid expressing augmentor sequence, the plasmids used were 0.5μg pACT (as carrier DNA) plus either: 0.5 μg pCMV-Luc; 0.5 μg pSV40-Luc; or 0.5 μg pRSV-Luc. The media were changed on the cells 1 hour prior to transfection. The DNA was added to 0.2M CaCl₂ solution, mixed with HBS, allowed to form DNA/CaP0₄ co-precipitation complexes for 30 minutes at room temperature, and then added to the cells. The cells were incubated overnight with DNA/CaP0₄ complexes at 37°C, 10% C0₂, after which time the media were changed. At 48, 72, and 96 hours post-transfection, the media were removed and 100 μl IX CCLR was added to each well. Luciferase activity was measured as previously described. Data are reported as light units (LU) /20μl sample volume. The data points represent the mean of n=4. Co-transfection of C2C12 cells with a plasmid expressing luciferase and with a plasmid expressing augmentor sequence also resulted m increased expression of luciferase when compared to transfection with a plasmid expressing luciferase alone, as is shown m FIG 3. The increased level of expression of luciferase was observed when luciferase was under the control of either the CMV promoter, the SV40 promoter or the RSV promoter. The expression of luciferase m the presence of a plasmid expressing augmentor sequence was both increased and prolonged continuing for at least four days compared to expression in the absence of transfected augmentor sequence .

Example 4: Effect of Augmentor Sequence on Luciferase Expression Under Control of Different Promoters in C3H10T1/2 cells

Luciferase expression in C3H10T1/2 cells 48, 72, and 96 hours post-transfection with firefly luciferase expressing plasmids differing m promoter/enhancer regions was observed the presence and absence of a co- transfected plasmid expressing augmentor sequence.

C3H10T1/2 cells were seeded one day prior to transfection 5 x 10⁴ cells per well of a 24 well plate. Cells were transfected using CaP0₄ co-precipitation and 1 μg total DNA per well. For co-transfection with an augmentor sequence, the plasmids used were 0.5 μg of pACT-MyoD (which contained the augmentor sequence), plus either: 0.5 μg pCMV-Luc; 0.5 μg pSV40-Luc; or 0.5 μg pRSV-Luc. For control transfections m tne absence of a plasmid expressing augmentor sequence, the plasmids used were 0.5 μg pACT as carrier DNA, plus either: 0.5 μg pCMV-Luc; 0.5 μg pSV40-Luc; or 0.5 μg pRSV-Luc. The media were changed on the cells one hour prior to transfection. The DNA was added to 0.2 M CaCl₂ solution, mixed with HBS, allowed to form DNA/CaP0₄ co-precipitation complexes for 30 minutes at room temperature, and then added to the cells. The cells were incubated overnight with DNA/CaP0 complexes at 37°C, 10% C0₂, after which time media were changed. At 48, 72, and 96 hours post-transfection, the media were removed and 100 μl IX CCLR was added to each well. Luciferase activity was measured as previously described. Data are reported as light units (LU) /20μl sample volume. The data points represent the mean of n=4. Co-transfection of C3H10T1/2 cells with a plasmid expressing luciferase and with a plasmid expressing augmentor sequence results m increased levels of expression of luciferase when compared to transfection with a plasmid expressing luciferase alone, as is shown in FIG 4. The increased expression of luciferase is observed when luciferase is under control of either the CMV promoter, the SV40 promoter or the RSV promoter. The expression of luciferase in the presence of a plasmid expressing augmentor sequence was both increased and prolonged. Example 5: Effect of Augmentor Sequence on Luciferase Expression in BHK-21 Cells

Luciferase expression BHK-21 cells 48, 72, and

96 hours post-transfection with a reporter plasmid expressing luciferase, directed by various promoter/enhancer regions, was measured m the presence and absence of a plasmid expressing an augmentor sequence. BHK-21 cells were seeded one day prior to transfection at 5 x 10⁴ cells per well of a 24 well plate. Cells were transfected using CaP0₄ co-precipitation and 1 μg total DNA per well. For co-transfection with a plasmid expressing augmentor sequence, the plasmids used included 0.5 μg of pCISM, plus pCMV-Luc. For control transfections in the absence of a plasmid expressing augmentor sequence, the plasmids used were 0.5 μg pCMV-Luc plus 0.5 μg pCI as carrier DNA. The media were changed on the cells 1 hour prior to transfection. DNA was added to 0.2 M CaCl₂ solution, mixed with HBS, allowed to form DNA/CaP0₄ co- precipitation complexes for 30 minutes at room temperature, and then added to the cells. The cells were incubated overnight with DNA/CaP0₄ complexes at 37°C, 10% C0₂, after which time media were changed. At 48, 72, and 96 hours post-transfection, the media was removed and 100 μl IX CCLR was added to each well . Luciferase activity was measured as previously described. Data are reported as light units (LU) /20 μl sample volume. The data points represent the mean of n=4. Co-transfection of BHK-21 cells with a luciferase-expressmg plasmid and with a plasmid expressing an augmentor sequence resulted enhanced expression of luciferase when compared to transfection with luciferase alone, as is shown in FIG 5. The expression of luciferase in the presence of the plasmid expressing augmentor sequence was both increased and prolonged

Example 6: Effect of Augmentor Sequence on Expression of Renilla Luciferase

Renilla luciferase expression NIH3T3 cells 48, 72, and 96 hours post-transfection with a plasmid expressing Renilla luciferase under SV40 promotion was observed in the presence and absence of a plasmid expressing augmentor sequence.

NIH3T3 cells were seeded one day prior to transfection at 15 x 10⁴ cells per 60 mm dish. Cells were transfected using CaP0₄ co-precipitation and 5 μg total DNA per dish. For co-transfection with a plasmid expressing augmentor sequence, the plasmids used included 1 μg of pACT-MyoD (which contained the augmentor sequence) and 1 μg pRL-SV40 (Renilla luciferase vector), plus 3 μg pGEM3Zf(+) as carrier DNA. For the control transfections in the absence of a plasmid expressing augmentor sequence, the plasmids used were lμg pRL-SV40 plus lμg pACT vector, plus 3 μg pGEM3Zf (+) . Media were changed on the cells 1 hour prior to transfection. A modification of the standard calcium phosphate co-precipitation method was used in which BES was used rather than HBS solution. DNA was added to

0.2M CaCl₂ solution, mixed with BES Buffered Salme, allowed to form DNA/CaP0 co-precipitation complexes for 30 minutes at room temperature, and then added to the cells. The cells were incubated overnight with DNA/CaP0₄ complexes at 37°C, 3.5% C0₂, after which time media were changed.

At 48, 72, and 96 hours post-transfection, the media were removed and 400 μl of IX Passive Lysis Buffer was added to each dish. To assay for Renilla luciferase activity, lOOμl of Luciferase Assay Reagent II followed by lOOμl Stop & Glo™ Reagent (Promega Corp. E1910) was added to 20 μl of each lysate, and the light output captured for ten seconds via luminometer measuremen . Data are reported as relative light units (LU)/20μl sample volume. The data points represent the mean of n=3.

Co-transfection of NIH3T3 cells with a plasmid expressing Renilla luciferase and with a plasmid expressing an augmentor sequence results in increased expression of luciferase when compared to transfection with a Renilla luciferase expression vector alone, as is shown in FIG 6. The data demonstrate that the expression of the luciferase protein product in the presence of a plasmid expressing an augmentor is both increased and prolonged.

Example 7: Effect of Augmentor Sequence on Expression of Green Fluorescent Protein

Green Fluorescent Protein (GFP) expression in NIH3T3 cells 96 hours post-transfection with a plasmid containing GFP under SV40 promoter control was observed in the presence and absence of a plasmid expressing an augmentor sequence .

NIH3T3 cells were seeded one day prior to transfection at 5 x 10^s cells per 60mm dish. After an overnight incubation at 37°C in 10% C0₂, the NIH3T3 cells were transfected by exposing the cells to TransFast™ Reagent transfection medium. The TransFast™ Reagent transfection medium consisted of 30 μl of TransFast™ Reagent, 10 ug of total DNA, and 2 ml of DMEM per plate. Three different sets of TransFast™ Reagent transfection media were made utilizing three different DNA components. One set consisted of pCI and pCIneoGFP (5 μg each DNA) , the second set was composed of pCISM and pCIneoGFP, and the third set, a negative control for transfection with GFP, consisted of pCI and pCI-Luc. After a one-hour incubation at 37°C in 10% C0₂, the transfection medium was diluted by addition of 10 ml of DMEM/10% calf serum. On day 4, or 96 hours post-transfection, the medium was withdrawn, the cells were briefly washed with IX PBS, and then treated with 0.05% trypsin and EDTA. DMEM/10% calf serum was added and the detached cells were collected. The cells were isolated by centrifugation, washed with IX PBS, isolated by centrifugation, and resuspended into IX PBS. The cell density was determined and adjusted to 5 x 10⁴ cells/ml to create a cell stock. One ml of the cell stock was used to determine the intensity of GFP by utilizing a Spex Fluorolog 1680 0.22 m Spectrometer.

Co-transfection of NIH3T3 cells with a GFP expression plasmid and with a plasmid expressing augmentor results in increased levels of GFP when compared to transfection with a plasmid expressing GFP alone, as is shown in FIG 7. Data demonstrate that GFP expression of in the presence of a plasmid expressing augmentor is increased at a time point 96 hours post-transfection.

Example 8: Effect of Augmentor Sequence on Expression of β-Galactosidase

The expression of β-Galactosidase (β-Gal) in

NIH3T3 cells 48 hours post-transfection with a plasmid containing β-Gal under CMV promoter control was observed in the presence and absence of a plasmid expressing augmentor sequence . Cells were seeded one day prior to transfection at 5 x 10⁴ cells per well of a 24 well plate. Cells were transfected using CaP0₄ co-precipitation and 1 μg total DNA per well. For co-transfection with an augmentor sequence expression plasmid, the plasmids used included 0.5 μg pACT- MyoD and 0.5 μg pCI-β-Gal. For the control transfections m the absence of an augmentor sequence, the plasmids used were 0.5 μg pACT (as carrier DNA for the control experiment) and 0.5 μg pCI-β-Gal DNA. The media were changed on cells 1 hour prior to transfection. The DNA was precipitated in HBS and CaCl₂ solutions (Promega Corp.) using standard conditions. The cells were incubated overnight with DNA/CaP0₄ complexes at 37°C, 10% C0₂, after which time media were changed. At 48 hours post-transfection, the cells were dispersed from the wells using 0.05% trypsm/0.53 mM EDTA (GibcoBRL) and washed twice with Dulbecco ' s phosphate buffered salme. The cells were transferred to a sterile centrifuge tube and briefly centrifuged. The pelleted cells were resuspended m a solution routinely used for in si tu staining for β-gal activity, but using 0.1% rather than 0.2% X-Gal, 2 mM MgCl₂, 5 mM each potassium ferricyanide and potassium ferrocyanide, m phosphate buffered salme. The cells were resuspended m 100 μl of staining solution and incubated overnight at 37°C. The following day, cells were rinsed with phosphate buffered sal e.

Cells co-transfected with an augmentor sequence expression vector and with a β-gal expression vector stained darker than did the cells transfected with the β- gal expression vector alone. Until a plateau level, darker blue coloration is correlated with increased levels of β- gal activity. Therefore, the presence of the augmentor sequence expression vector resulted m increased expression of the foreign β-gal gene.

Example 9: Effect of Augmentor Sequence on Duration of Expression of Firefly Luciferase Firefly luciferase expressed NIH3T3 cells up to 10 days post-transfection with a plasmid containing luciferase under control of a CMV promoter was observed the presence and m the absence of an augmentor sequence expression vector. The duration of the enhanced expression of a foreign gene co-transfected with an augmentor sequence was tested m NIH3T3 cells with an mtracellularly localized reporter gene, luciferase NIH3T3 cells were seeded into 24 well plates at a density of 5 x 10⁴ cells per well. After an overnight incubation at 37°C m 10% C0₂ the medium was withdrawn and the cells were exposed to TransFast™ Reagent transfection medium for 1 hour at 37°C m 10% C0₂. The TransFast™ Reagent transfection medium was composed of 3 μl of

TransFast™ Reagent, 0.5 μg of each DNA for a total of 1 μg, and 200 μl of Dulbecco ' s Modified Eagle Medium (DMEM). The cells were transfected with one of the following DNA combinations: pCI-Luc, also referred to as CMV-Luc, and pCI , or pCI-Luc and pCISM. After a one-hour incubation, the transfection medium was diluted with 1 ml of DMEM/10% calf serum per well. The cells were incubated at 37°C in 10% C0₂ until the time of the assay.

At the selected time points, the culture medium was removed from the cells and the cells were lysed with 100 μl of IX CCLR. A 20 μl aliquot of lysed cellular supernatant was added to a 96 well plate, and the amount of luciferase expression was determined as described previously. The data from six wells were averaged and standard deviations were calculated.

The effect of an augmentor on the expression of a luciferase gene was long-lived, as is shown m FIG 8. In this experiment, luciferase activity increased almost about two-fold from five to ten days post-transfection. Thus, the effect of an augmentor on the expression of a co- transfected foreign gene expressed protein was very stable and continued at elevated levels compared to foreign gene expression in cells not transfected with augmentor sequence .

Example 10: Effect of Augmentor Sequence on Expression of a Secreted Protein

The expression of Secreted Alkaline Phosphatase

(SEAP) in NIH3T3 cells up to 8 days post-transfection with a plasmid containing SEAP under control of SV40 promoter was tested in the presence and in the absence of expressed MyoD. The duration of the increased expression of a foreign gene co-transfected with an augmentor sequence expression plasmid was also tested with NIH3T3 cells and a secreted reporter gene, the secreted alkaline phosphatase gene .

NIH3T3 cells were seeded into 24 well plates at a density of 5 x 10⁴ cells per well. After an overnight incubation at 37°C in 10% C0₂ the medium was withdrawn and the cells were exposed to TransFast™ Reagent transfection medium for 1 hour at 37°C in 10% C0₂. The TransFast™ Reagent transfection medium was composed of 3 μl of TransFast™ Reagent, 0.5 μg of each DNA for a total of 1 μg, and 200 μl of Dulbecco ' s Modified Eagle Medium (DMEM). The cells were transfected with one cf the following DNA combinations: pSEAP2 -Control vector (Clontech, CA) and pCI, pSEAP2 -Control and pCISM, or pCI and pCISM. The pSEAP2- Control vector contains the alkaline phosphatase gene under the control of the SV40 early promoter. After a one-hour incubation in the transfection medium with TransFast™ Reagent and DNAs, the transfection medium was diluted with one ml of DMEM/10% calf serum per well. The cells were incubated at 37°C m 10% C0₂ until the time of the assay.

At 2 , 4, 6, and 8 days post-transfection, the medium from each well was withdrawn, subjected to centrifugation to remove cellular debris, and the supernatants stored at -20°C until all time points had been collected. After medium was withdrawn, one ml of pre- warmed DMEM/10% calf serum was added to each well and cells were incubated until the next time point. To begin the SEAP assay, all samples were thawed slowly on ice and 25 μl from each sample was withdrawn. The measurement of SEAP activity m cell culture media supernatants was performed accordmg to manufacturer's instructions (Great EscAPe SEAP chemilummescence detection kit, Clontech, CA) . The enzymatic SEAP data were standardized to 30 minutes post-addition of the chemilummescent substrate. The generation of chemiluminescent units were detected by a Lummoskan Luminometer. For each of the three transfected DNA combinations, six wells per DNA combination were analyzed for each time point. The data generated from the six wells were averaged and standard deviations were calculated.

The effect of an augmentor on the expression of SEAP is long-lived, as is shown m FIG 9. In this experiment, SEAP activity increased about five-fold from two to four days, post-transfection, then slowly declined by only about a total of 20% over the next 4 days. Despite the slight decline m activity from four to eight days post-transfection, the activity at eight days post- transfection m the presence of an augmentor sequence is significantly greater than m the absence of an augmentor; thus, the presence of an augmentor results m about a twenty-five fold increase m SEAP activity at eight days post-transfection . These results demonstrate that the enhanced expression of a foreign gene when co-transfected with an augmentor expression plasmid is observed for a protein which is secreted from a host cell, as well as for proteins which are intracellularly localized. These results further demonstrate that the effect of an augmentor on the expression of a co-transfected foreign gene is stable, and that this effect is observed for a secreted protein, as well as for protein that is localized within the cell for several days at expression levels several -fold above expression levels in cells not transfected with augmentor sequence .

Example 11: Effect of Various Augmentor Sequences on Expression of Firefly Luciferase

Firefly luciferase expression in NIH3T3 cells 48, 72, and 96 hours post -transfection was observed for a luciferase reporter plasmid in combination with plasmids expressing various augmentor sequences.

NIH3T3 cells were seeded one day prior to transfection at 5 x 10⁴ cells per well of a 24 well plate. Cells were transfected using CaP0₄ co-precipitation and 1 μg total DNA per well. For co-transfections with an augmentor sequence expression plasmid, the reporter gene plasmid was 0.5 μg pCMV-Luc, and the augmentor expression plasmid was either a MyoD/VP16 fusion protein in 0.5 μg pACT-MyoD, a large myoD sequence in 0.5 μg pCILG (1.7kb MyoD), or a small myoD sequence in 0.5 μg pCISM (0.96kb MyoD) . For control transfections in the absence of an augmentor sequence, the reporter gene plasmid was 0.5 μg pCMV-Luc with 0.5 μg pGEM3Zf (+) as carrier DNA. The media were changed on the cells one hour prior to transfection. The DNA was added to 0.2 M CaCl₂ solution, mixed with HBS, allowed to form DNA/CaP0₄ co-precipitation complexes for 30 minutes at room temperature, and then added to the cells. The cells were incubated overnight with DNA/CaP0₄ complexes at 37°C, 10% C0₂, after which time media were changed. At 48, 72, and 96 hours post-transfection, the media were removed and 100 μl of IX CCLR was added to each well. Luciferase activity in 10 μl lysate was measured as previously described. Captured light units (LU) were multiplied by two to reflect a 2X lysate dilution factor to yield LU/20μl sample volume. Data points represent the mean of n=4.

As is shown in FIG. 10, the method of the invention results in increased expression of a foreign gene when co-transfected with a plasmid expressing an augmentor factor when the augmentor nucleic acid sequence comprises a myoD cDNA which is part of a fusion protein (VP16/MyoD) (FIG 10A) , when the augmentor sequence comprises a myoD coding region and associated 5' and 3' regions (large myoD) present in VP16/MyoD (FIG 10B) , or when the enhancer sequencer comprises a coding region only of myoD cDNA

(small myoD) (FIG 11C) . For all three augmentor sequences, expression of luciferase was both increased and prolonged. Therefore, the method of the invention is not limited to utilization of the sequence encoding MyoD as the augmentor sequence .

Example 12: Effect of an Augmentor Sequence Encoding a MyoD Fragment on Expression of Luciferase

The expression of firefly luciferase in NIH3T3 cells was observed for a luciferase reporter plasmid in combination with an expression vector comprising an augmentor sequence encoding a different sized MyoD fragments . These experiments examined the effect on firefly luciferase expression in NIH3T3 cells of an expression vector comprising an augmentor sequence encoding a MyoD fragment comprising additional deletions, either at the carboxy terminus, at the ammo terminus, or at both. The deletions are referred to by ammo acid position withm murine MyoD, which contains a total of 318 ammo acids.

MyoD C-termmal truncations L122X, L163X, S189X, and P263X were created by utilizing the GeneEditor™ Mutagenesis System (Promega Corp., Q9280) according to manufacturer's instructions. The sense strand oligonucleotides listed below were used to create a stop codon followed by an EcoR V restriction enzyme site (GATATC) immediately downstream of the designated ammo acid in pCISM (i.e. L122X changes the leucine at ammo acid 122 of MyoD to a stop codon) .

L122X 5' CGCGAGCGCCGCCGCTGAGATATCAGCAAAGTGAATGAG 3'

(SEQ ID NO: 7) L163X 5' GAAGGTCTGCAGGCTTGAGATATCCTGCGCGACCAGGAC 3'

(SEQ ID NO: 8) S189X 5 ' CCCCCAGGCCGTGGCTGAGATATCGAGCACTACAGTGGC 3 '

(SEQ ID NO: 9) P263X 5' ATCTCCACAGACAGCTGAGATATCGCTGCGCCTGCGCTGCT 3' (SEQ ID NO: 10)

To safeguard against any possible read-through of the stop codon back into MyoD coding sequence, the mutant plasmids were digested with restriction enzymes EcoR V and Not I (located downstream of the myoD gene and upstream of the polyadenylation signal) to remove the myoD sequence downstream of the inserted stop codon. The Not I end was filled in using T4 DNA polymerase (Promega Corp., M4211) according to manufacturer's instructions, the enzyme was denatured at 75°C for 10 minutes and the plasmids were religated overnight at 14°C and transformed into JM109 cells .

To create N-termmal deletions and additional C- terminal truncations m pCISM, the MutaGene^® Mutagenesis Kit (Bio-Rad, Hercules, CA) was used according to manufacturer's instructions. The anti -sense oligonucleotides listed below were used to yield the deletions listed below (e.g., Δ2-10aa is a deletion from myoD of the sequence encoding ammo acids two through ten, leaving the sequence encoding the next amino acid the same open reading frame as the sequence encoding amino acid two) .

Δ2-10aa 5' GCCTGTCAAGTCTATCATGGCTGGGTCGAC 3' (SEQ ID NO:ll)

Δ2-20aa 5' TGTCTCAAAGGAGCACATGGCTGGGTCGAC 3'

(SEQ ID NO: 12) Δ2-30aa 5' GAAACACGGATCATCCATGGCTGGGTCGAC 3'

(SEQ ID NO: 13) Δ2-48aa 5' CACGTGCACCAGGCGCATGGCTGGGTCGAC 3'

(SEQ ID NO: 14) Δ2-102aa 5' GTTGGTGGTCTTGCGCATGGCTGGGTCGAC 3'

(SEQ ID NO: 15) G280X 5' GGGATGCCCCCTCGATATCTTACGGAGGCGACTCTGG 3' (SEQ ID NO: 16)

T290X 5' CTGGGTTCCCTGTTCGATATCTTAGTCGCTTAGGGATGC 3'

(SEQ ID NO:17) D300X 5' ACACTGAGGGGCGGCGATATCTTAGGGAGACGGGGTCTG 3'

(SEQ ID NO: 18)

pCISM was also mutated to concurrently incorporate both Δ2-20 and G280X mutations to create the mutant named pCISMΔ2-20 , G280X using the previously described primers in one reaction. All mutant plasmids created were purified using QIAfilter Plasmid Maxi Kit (Qiagen, Valencia, CA) and confirmed by dideoxy DNA sequencing. The mutants were then co-transfected into NIH3T3 cells in 24 well plates with pCI-Luc plasmid for time course luciferase expression studies. Three microliters Transfast™ Reagent and 0.5 μg of each plasmid was used for each transfection. The details of the method were as previously described. On various days post- transfection (as indicated m data table below) the cells were lysed m 100 μl CCLR. Control reactions were always set up on the same day as the test reactions. Then 20 μl of the lysate was combined with 100 μl LAR and the light output immediately measured m relative light units (rlu) in quadruplicate (n=4) using a Labsystems luminometer. The resulting mean of the data is listed below.

Plasmid day 3 rlu day 4 rlu day 5 rlu pCI 6,890 1,595 304 pCISM 56,688 163,618 304,830

Δ2-10 54,973 109, 740 158,975

Δ2-20 65,368 139,500 246,363

Δ2-30 50,490 63, 713 78,483

G280X 74, 148 198,975 373,390

T290X 57,513 135,305 279, 140

D300X 74,910 144,893 278, 120

Plasmi .d day 2 rlu day 3 rlu day 4 rlu pCI 40,005 14, 792 4, 021 pCISM 47,290 83, 874 185,864

L122X 25, 959 6,577 1,490

L163X 22,880 5,538 1, 751

P263X 36,677 74,156 130,523 Plasmid day 2 rlu day 4 rlu day 6 rlu day 8 rlu pCI 16,928 8,323 952 132 pCISM 15,159 74,823 292,233 230,188 Δ2-20,G280X 19,677 47,910 142,183 144,610

The half life of luciferase protein in transfected cells is approximately 3 hours m HepG2 cells and about 5-6 hours m HeLa cells (unpublished data, Y. Zhuang, Promega Corp.) . Therefore the rlu measured result from activity of luciferase translated in the transfected cell several hours prior to measurement.

The results show that m the absence of MyoD, luciferase expression levels fall off rapidly after two days post transfection. However, m the presence of MyoD (pCISM) high levels of Luciferase expression still occur up to eight days post-transfection. The expression of a MyoD protein, therefore, augments expression of a foreign gene of interest out to at least eight days post-transfection. Fragments of MyoD were also demonstrated to have augmentor activity. Twenty ammo acids deleted from the amino terminus of MyoD resulted a MyoD fragment capable of augmentor activity at levels minimally below that of the wild-type MyoD. Deletion of 30 ammo acids from the ammo terminus of MyoD resulted m a MyoD fragment exhibiting significantly elevated levels of expression of the foreign gene of interest at five days post-transfection when compared to the absence of any MyoD protein, though the augmented expression was about four- fold less than was observed for the wild-type MyoD protein. When 18, 28, or 38 ammo acids are deleted from the carboxy-terminus of MyoD, the MyoD fragments exhibited levels of augmented expression similar to those of wild type MyoD.

A MyoD fragment with deletions at both the carboxy and ammo terminals also exhibited significant augmentor activity. This MyoD fragment, encoded by pCISMΔ2-20,G280X, contained ammo acids 1 and 21 through 279, and resulted m augmented expression of luciferase to about 63% of the level observed for wild type MyoD at eight days post-transfection. The augmented level of expression for this MyoD fragment was significantly greater than the luciferase activity observed m the absence of MyoD, which has decreased to background levels by eight days post- transfection. These experiments indicate that nucleic acid sequences which code for different MyoD protein fragments may result in differential levels of augmented expression of a foreign gene. The method of the invention contemplates using as an augmentor sequence only those nucleic acid sequences which are effective m augmenting expression of a foreign gene when co-transfected with the foreign gene .

Example 13 : Effect of MyoD Coding Sequence and Protein Product on Foreign Gene Expression

In order to determine wnether augmented expression of a foreign gene of interest as demonstrated m Examples 2-12 resulted from the presence of the MyoD protein or simply from the presence of the polynucleotide sequence encoding MyoD, host cells were transfected with an augmentor sequence that encoded MyoD and with a modified augmentor sequence that encoded MyoD, but that would not express MyoD protein. This was accomplished by partially deleting the myoD ATG start codon m order to prevent MyoD expression from the modified augmentor sequence.

myoD Start Codon Deletion Construction

The myoD ATG start codon in the pCISM MyoD expression vector, described m Example 1, was partially deleted in order to prevent MyoD expression. Mutagenesis was performed based on the dut ung method described by Kunkel, et al . m Proc . Natl . Acad . Sci . USA 82:488-492, 1985. Single-stranded DNA was generated from pCISM as described in the Bio-Rad Muta-Gene^® Phagemid m vi tro

Mutagenesis Kit (Bio-Rad, Hercules, CA) . Mutagenesis was performed according to the above kit manufacturer's instruction using the antisense mutagenic primer 5' GGCGATAGAAGCTCCGGCTGGGTCGACTCT 3' (SEQ ID NO: 20) which deletes the AT nucleotides from the ATG start codon of myoD, but preserves the remainder of the myoD sequence . The DNA of mutagenic clones in JM109 cells was purified using QIAfilter Plasmid Maxi Kit iQiagen, Valencia, CA) and were screened by restriction digest with Neo I and the AT deletion verified to be correct by dideoxy DNA sequence analysis. These mutant plasmids were named pCISM-AT. Three pCISM-AT mutagenic clones were then further screened to confirm the absence of MyoD protein production using the TNT^® T7 Quick Coupled Transcription/Translation System (Promega Corp., L1170) according to the manufacturer's instructions. No MyoD protein was expressed when using the pCISM-AT plasmid m the TNT assay, while the positive control, pCISM, expressed the correct size MyoD as expected.

Analysis of effect on expression of foreign gene

To determine if the presence of the pCISM-AT plasmid was able to increase or prolong expression of a foreign gene of interest, NIH3T3 cells grown in 24 -well tissue culture plates were separately cotransfected with pCI-Luc and pCISM (positive control), pCI-Luc and pCI (negative control), and pCI-Luc and pCISM-AT plasmids (three different clones were used) using TransFast™ Transfection Reagent as described previously using 0.5 μg each plasmid. On each of days two, three, and four, one set of cotransfected cells was lysed with 100 μl IX CCLR (Promega Corp., E1531) . The resulting relative light units (rlu) measured as previously described using a mean of four measurements on each day (n=4), are listed below:

Plasmid day rlu pCISM 2 24,233

3 25, 649

4 55, 025

pCI 2 21, 826

3 4,300

4 1,240

pCISM-AT(l) 2 19,319 3 4, 070 4 3, 167

pCISM-AT(2) 2 10,983 3 4, 070 4 2, 003

pCISM-AT(3) 2 14, 932 3 5, 101 4 2,510

These results indicated that in the absence of expressed MyoD protein, there was no augmentation of expression of the foreign gene of interest. Therefore, it is the presence of the MyoD protein and not simply the myoD gene, exerting an augmentation effect on the cotransfected gene of interest.

Example 14: Cellular Morphology and Localization of MyoD Post-transfection

Both the morphology and the cellular localization of MyoD after co-transfecting host cells with an augmentor sequence encoding MyoD and with a luciferase gene as the foreign gene were observed for up to eight days after transfection. Transfection and Staining

PCISM and several pCISM-AT plasmids which yielded no MyoD protein by in vi tro transcription/translation were transfected separately into NIH3T3 cells along with the pCI-Luc plasmid which would express the foreign gene of interest (1 μg each plasmid DNA per well of a LAB-TEK chamber slide which is a 2 -well tissue culture treated slide (Nunc, Inc., Naperville, IL) using TransFast™ Transfection Reagent (Promega Corp., E2431) . 1 x 10⁵ cells were seeded per well the day before transfection. The day of transfection, 2 μg DNA was combined with 6 μl TransFast™

Reagent in 400 μl DMEM media. The lipid and DNA were allowed to combine in this mixture for 10 minutes at room temperature. The mixture was added to the cells and allowed to incubate for one hour at 37°C. After this time, the cells were overlaid with 2 ml of complete medium. The transfected NIH3T3 cells were assayed for MyoD production 6 days post transfection by in si tu labeling of MyoD. The transfected cells were fixed and labeled 2,

4, 6, and 8 days post-transfection using the monoclonal antibody MyoDl Ab-2 (200 μg/ml, NeoMarker, Inc., Fremont, CA) . The cells were washed with cold IX PBS, fixed with 4% paraformaldehyde for 30 minutes at room temperture, permeabilized for 10 minutes at room temperature with 0.1% Triton-X 100, blocked with 10% horse serum (HyClone, Logan, UT) for one hour at room temperature, and labeled with 1:100 dilution of mAb MyoDl in IX PBS overnight at 4°C. The following day, the cells were rinsed with IX PBS and counter-stained with donkey anti -mouse Cy3 secondary antibody (750 μg/ml, Jackson Immunoresearch Laboratories, Inc., West Grove, PA) at 1:250 dilution for 60 minutes at room temperature. The labeled slides were mounted in Vectashield^® mounting medium with DAPI (Vector

Laboratories, Inc., Burlingame, CA) and viewed under a Zeiss Axioplan 2 fluorescent microscope (Carl Zeiss, Jena GmbH) with a rhodamine (Cy-3) and DAPI filter. Digital imaging was performed using the Spot II Version 2.1.2 software (Diagnostics Instruments, Inc., Sterling Heights, MI) . These results are described below.

Apoptosis TUNEL assay followed by in si tu MyoD labeling ΝIH3T3 cells grown in 2 -well slides were cotransfected with pCI-Luc and pCISM using TransFast™ Transfection Reagent as previously described. As a negative control, NIH3T3 cells grown in a 2 -well slide were transfected with pCI-Luc only. A well of cells to be used for a positive control for apoptosis was also seeded, however these cells were not transfected. The cells were fixed and labeled for apoptosis 2, 4, 6, and 8 days post- transfection using the Apoptosis Detection System, Fluorescein (Promega Corp., G3250), also known as the TUNEL assay. This was followed by MyoD labeling as described above. Essentially, the cells were washed with cold IX

PBS, fixed with 4% paraformaldehyde for 30 minutes at room temperature, and permeabilized for 10 minutes at room temperature with 0.1% Triton-X ICO. The positive apoptosis control cells were treated with 70 units DNase I in water at room temperature for 10 minutes. The TUNEL assay labeling for apoptosis was performed accordmg to manufacturer's instructions on all cells for two hours at 37°C following the manufacturer's protocol. Then, all cells were blocked with 10% horse serum for 30 minutes at room temperature and MyoD labeled with CY-3 secondary antibody followed by DAPI nuclear staining and mounting as described above .

Staining Results The three fluorescent colors used for labeling the cells were distinguishable from one another such that no misinterpretation of the data due to fluorescent emission overlap is suspected; the colors were: MyoD-pink; DAPI-blue; and FITC-green. All ceils were viewed using the Zeiss Acioplan 2 Fluorescent microscope and different filter sets; Cy-3 for MyoD, DAPI for genomic DNA and FITC for apoptosis. Images were captured using the SPOT II Image Analysis software.

Upon viewing of the day two post-transfection MyoD labeled cells, it was noticed that MyoD was abundantly present in both the nucleus and the cytoplasm. Cell morphology of NIH3T3 cells was characteristic at day 2. Upon examination of day 6 post-transfection cells, the morphology of many cells had changed, yielding multinucleate, elongated banded cells, characteristic of muscle cells. This change m morphology was directly correlated to the expression of MyoD protein in those cells. Cells transfected with pCISM-AT did not express MyoD nor exhibit this morphological change. At this time point there was no nuclear localization of MyoD detected. All MyoD detected were present m the cytoplasm. Several cells also appeared to exhibit blebbmg suggesting apoptosis, but they were apoptosis negative. At day 8 post-transfection, MyoD was localized exclusively to the cytoplasm and the multinucleate, elongated, banded morphology that was associated with MyoD expression is present and more pronounced.

Based on the appearance of possible apoptosis events occuring, cells were co-labeled for fragmented nuclear DNA, a marker for apoptosis, via the TUNEL assay where FITC is used to label the fragmented DΝA. When all time points were examined, 2, 6, and 8 days post- transfection, there was no incidence of apoptosis which could be correlated with expression of MyoD. The apoptosis positive control cells tested positive for FITC labeling, therefore it was concluded that if apoptosis was occuring in response to MyoD overexpression in these cells, it would have been detected.

In summary, the pattern of MyoD expression correlates with the morphological changes of the ΝIH3T3 cells to muscle cells, but does not correlate with the occurrence of apoptosis. Also, the majority of MyoD is localized to the cytoplasm greater than two days post transfection.

Example 15: Mutations in Basic Segment of bHLH Protein

The murine myoD gene encodes a bHLH protein containing a basic region which functions in binding to DNA. In this example, the basic region of the murine myoD gene was modified such that the expressed MyoD protein would not bind to DNA, and the effect of the modified protein on augmentation of expression of a co-transfected foreign gene determined. The basic region of the murine myoD gene in the pCISM plasmid was mutagenized using the Bio-Rad MutaGene^® Kit as previously described. The eight mutagenic primers used are listed below and named in the following manner: D109E indicates that the D (Asp) amino acid present at residue 109 of the MyoD protein is mutagenized to an E (Glu) .

D109E 5' GGCGGCCTTGCGGCGCTCAGCGTTGGTGGTC 3' (SEQ ID NO: 19)

A114N 5 ' GCGCTCGCGCATGGTGTTGGCCTTGCGGCATC 3 '

(SEQ ID NO: 20) T115N 5' GCGCTCGCGCATGTTGGCGGCCTTGCG 3' (SEQ ID NO:21) R117L 5' CGGCGGCGCTCCAGCATGGTGGCGGC 3' (SEQ ID NO:22) R120L 5' CACTTTGCTCAGGCGCAGGCGCTCGCGCATGG 3' (SEQ ID NO:23) A114N, T115N (Mutant called AT)

5 ' GCGCTCGCGATGTTGTTGGCCTT-CGGCG 3 ' (SEQ ID NO: 24) D109E, A114N, T115N (Mutant called DAT, SEQ ID NO:25)

5 ' GCGCTCGCGCATGTTGTTGGCCTTGCGGCGCTCAGCGTTGGTGGTC A114N, T115N, R120L (Mutant called ATR, SEQ ID NO:26)

5 ' CTTTGCTCAGGCGCAGGCGCTCGCGCATGTTGTTGGCCTTGCGGCG

These plasmids were then each cotransfected with pCI-Luc into NIH3T3 cells as previously described. A set of co-transfections was harvested at various days post- transfection by lysing the cells in 100 μl CCLR. Then 20 μl each lysate was added to 100 μl LAR and the resulting light output measured in a LabSystem Luminoskan luminometer. The average relative light value (rlu) generated from four separate measurements is listed below.

For each separate experiment negative control (pCI) and positive control (pCISM) values are also listed. Results

The results are expressed as the average relative light unit values. pCI pCISM R117L

Day 2 28,453 25,388 41,815 Day 3 16,471 64,519 33,616 Day 4 3, 062 164,877 10,378

pCI pCISM A114N T115 Day 2 33, 286 31,841 16,718 16,378

Day 4 2,206 343,142 10,126 28,971

Day 6 1,847 318,830 12,968 27,474

Day 8 275 470,417 19,418 52,488

pCI pCISM D109E R120L AT DAT ATR

Day 2 16,106 25,604 36,673 31,623 23,257 14,012 22,570 Day 4 2,083 86,064 123,613 132,758 5,249 1,663 2,791 Day 6 199 199,830 200,525 273,815 507 499 508 Day 8 104 192,472 222,052 255,492 183 859 674

Individual amino acids were changed in the basic domain (aal02-121) of MyoD. Wild-type activity was maintained with changes in amino acids 109 (not previously reported to affect MyoD activity) as well as residue 120. Changing this Arg maintained DNA binding and transcriptional activity as reported by van Antwerp et al . Proc . Natl . Acad. Sci . 89:9012, 1992. In this publication, it was also reported that alteration of Arg 177 to Leu eliminated DNA binding and decreased transcriptional activity. This corresponding mutant resulted in attenuation of the wild type MyoD effect post-transfection in the present experiment. Ala 114 and Thr 115 are key residues that contact the DNA and are also implicated in transcriptional activation (Ma et al . Cell 77:451, 1994). Changing either of these residues resulted in prolonged expression post- tranfection, but an attenuation of the increased expression levels of a co-transfected reporter gene. Changing both of these residues resulted in loss of MyoD augmentor activity. The relative activity of MyoD as an augmentor element can be correlated with its ability to bind DNA, perhaps at the chromosomal level m the responder cell lines.

Example 16: Mutations in RSV Promoter E-box The basic region of a bHLH transcription factor binds to E-box DNA sequence often located withm a promoter region. The E-box sequence m a promoter of a foreign gene was modified to determine whether DNA binding by an augmentor sequence protein product is necessary for augmented expression of the co-transfected foreign gene. The polynucleotide consensus E-box site is CANNTG, where N can be any nucleotide. The RSV promoter has two E-box consensus sites; one is CACTTG, and the other is CATTTG. Mutagenesis of the RSV promoter E-box consensus sites was undertaken such that the MyoD, or other bHLH proteins, would no longer bind to the E-box, and the modified promoter/foreign gene construct co-transfected with an augmentor sequence encoding a MyoD protein to determine the effect of the modified E-box on the expression of the foreign gene.

The RSV promoter was excised from 5 μg of pRcRSV vector (Invitrogen, Carlsbad, CA) using Nru I and Hind III restriction enzymes, yielding a fragment 406 base pairs m length. The 406 base pair fragment was isolated from a 1% low melting agarose gel and the DNA was purified using AgarACE™ Enzyme (M1741, Promega Corp.) according to manufacturer's instructions and reconstituted in sterile water. The fragment was ligated overnight into the pGL3 Basic vector (E1751, Promega Corp.) that had been digested with Sma I and Hind III restriction enzymes, gel purified as described above, and reconstituted in sterile water. The ligation mixture was transformed into JM109 cells and colonies screened by restriction digest for incorporation of the RSV promoter into the pGL3Basιc vector yielding the pGL3RSV vector. Digestion of pGL3RSV with EcoR I restriction enzyme results in a linear vector, digestion of pGL3RSV with Mlu I restriction enzyme results in 33 base pair and 5158 base pair fragments. The DNA from several positive clones was purified and separately transfected into NIH3T3 cells for verification that the RSV promoter was functional and resulted in luciferase expression. The resulting data are listed below.

The pGL3RSV vector was then used as a template for mutating the RSV promoter E-box sequences. The CACTTG E-box was altered to CCCTTG and the CATTTG E-box was altered to CCTTTG. The altered sites no longer have the CANNTG consensus site required for binding by a bHLH protein and would, therefore, not be expected to be able to bind a bHLH containing protein such as MyoD. Mutagenesis was performed using the BioRad Muta-Gene^® Phagemid in vi tro Mutagenesis Kit (BioRad, Hercules, CA) according to manufacturer's instructions. The following antisense primers were used separately to knock out the CANNTG consensus E-box sites in the RSV promoter, i.e. one of the two E-box sites were removed in each mutant :

CACTTG to CCCTTG

5' CATGTTGCAAGACTACAAGGGTATTGCATAAGACTAC 3' (SEQ ID NO: 27)

CATTTG TO CCTTTG

5' CAATGTGGTGAATGGTCAAAGGGCGTTTATTGTATCG 3' (SEQ ID NO: 28)

The mutagenized DNA templates were transformed separately into JM109 cells and DNA from several colonies was purified and verified for incorporation of the correct mutation by dideoxy DNA sequencing. The clones were co- transfected with the wild type myoD sequence (pCISM) into NIH3T3 cells using TransFast™ Transfection Reagent as previously described. On days 2, 3, and 4 post transfection a set of transfections (i.e. pGL3RSV (wild type), pGL3RSV5 ' (CCCTTG), and pGL3RSV3 ' (CCTTTG) was lysed in IX CCLR buffer and 20 μl of the lysate was added to 100 μl LAR and the resulting light output measured in a LabSystems luminometer. The average relative light units (rlu) from four measurements is listed below.

Average Relative Light Units

PGL3RSV pGL3RSV5 ' pGL3RSV wild type CCCTTG CCTTTG

Day 2 47,478 36,327 25, 972

Day 3 141, 193 128,465 100,261

Day 4 231, 077 225,443 198, 143

The results demonstrated that the absense of one or the other consensus E-box sites in the promoter directing expression the foreign gene of interest did not prevent the bHLH-containing protein, in this case MyoD, from augmenting expression of the foreign gene of interest. This suggests that the bHLH protein is not acting via binding the E-box in the promoter initiating expression of the foreign gene of interest .

Example 17: Cloning of Murine myogenin , myf-5 , and myf- 6 Genes

Several additional genes from the murine myogenic family of bHLH transcription factors were cloned for use in determining whether other myogenic bHLH transcription factors also exhibited augmented expression of a co- transfected foreign gene. Cloning of Murine myogenin Gene

The murine myogenin gene was cloned from murine Neuro2A cells (CCL-131, ATCC, Bethesda, MD) . Total RNA was isolated from Neuro2A cells using the SV Total RNA Isolation System (Promega Corp., Z3100) . This RNA was then used m an RT-PCR amplification using Promega ' s RT-PCR System (A1250) according to manufacturer's instructions with the following two primers designed according to the published murine myogenin gene (Genbank, X15784) :

5 ' CCGACCTGATGGAGCTGTATG 3 ' myogenin forward primer (SEQ ID NO : 31)

5' GACAGACAATGTGAGTTGGGC 3' myogenin reverse primer (SEQ ID NO: 32) The RT-PCR reaction yielded an amplicon of expected size, 735 bp . The amplification product was then ligated into the pTarget vector (Promega Corp., A1410) according to manufacturer's instructions and transformed into JM109 cells. Positive clones were identified by restriction analysis with Pst I enzyme which resulted in fragments of 3652, 1750, and 962 base pairs detected by 1.0% agarose gel electrophoresis . The clone was demonstrated to express a protein of the expected size, about 25 kDa, upon in vi tro transcription/translation system analysis as described above In addition the nucleotide sequence of the cloned fragment was sequenced by dideoxy sequencing. When compared to the published murine myogenin gene (Genbank, X15784) the clone was shown to contain a silent mutation at nucleotide 210 that replaced a T base for the expected C base. However, this change did not result in an ammo acid change m the expressed protein. The cloned myogenin fragment was then subcloned from the pTargeT vector into the pCI mammalian expression vector with unique Xho I and Not I restriction sites present in both vectors .

Cloning of Murine myf-5 Gene

To clone the murine myf-5 gene, C2C12 cells (CRL- 1772, ATCC, Bethesda, MD) were first transfected with a plasmid capable of expressing murine Myogenm. A standard Transfast™ transfection reaction .as used as previously described. Then, total RNA was isolated from the transfected C2C12 cells (CRL-1772, ATCC, Bethesda, MD) 48 hours post transfection using the SV Total RΝA Isolation System (Promega Corp., Z3100) according to manufacturer's instructions. The RΝA was used m an RT-PCR reaction as described above, using the following myf - 5 specific primers :

5' ATGGACATGACGGACGGCTGCC 3' myf-5 forward primer (SEQ ID NO: 31) 5' CCTAGCAGGAGTGATCATCGGG 3' myf -5 reverse primer (SEQ ID NO: 32)

A myf-5 amplicon of the expected size, 797 bp, was produced by the RT-PCR reaction and verified in an agarose gel . It is notable that when a similar series of reactions was performed with C2C12 cells transfected with a plasmid capable of expressing murine MyoD, no myf-5 amplicon was produced.

The myf-5 amplicon was ligated into the pTarget™ vector and transformed into JM109 cells as described above. Potential clones were screened by restriction digest using Pst I restriction enzyme resulting m fragments of 3652, 1781, 586, and 448 base pairs. The clones were also screened with the m vi tro transcription/translation system as described above to confirm expression of the Myf5 protein, about 28 kDa size. Lastly, clones were determined to have the correct nucleotide sequence by dideoxy DNA sequencing and comparing to the published murine myf-5 sequence (Genbank, X56812) . Cloning of Murine myf- 6 Gene The myf-6 gene is composed of three exons and two mtrons, resulting m a total size of 1392 base pairs. In order to clone the gene, total genomic DNA was first isolated from Neuro2A cells using the Promega Wizard^® Genomic DNA Purification Kit (A1120) . The region of the genomic DNA containing the myf- 6 gene was PCR amplified with myf- 6 specific primers:

5' GGAGGAGAACATGATGATGG 3' myf - 6 forward primer (SEQ ID NO: 33) 5' GGCTGAGTTACTTCTCCACC 3' myf - 6 reverse primer (SEQ ID NO: 34)

The resulting 1392 base pair amplicon was ligated overnight into the pTargeT vector and transformed into JM109 cells. Several clones positive for the murine myf-6 gene were identified by restriction enzyme analysis. A positive clone was then transfected into NIH3T3 cells using TransFast™ Transfection Reagent as previously described. The total RNA was isolated from the transfected cells, 24 hours post transfection using SV Total RNA Isolation System (Promega Corp., Z3100) . The RNA was then used in an RT-PCR reaction with the same myf- 6 specific primers used in the preceding PCR reaction.

A 746 base pair amplicon was produced as expected, and confirmed by agarose gel electrophoresis . The murine myf- 6 cDNA amplicon was then ligated into the pTargeT vector and transformed into JM109 cells. Positive clones were identified by restriction enzyme digest with Kpn I restriction enzyme yielding fragment of 5783 and 635 base pairs and four of the clones were further confirmed by dideoxy DNA sequencing.

All four of the murine myf- 6 cDNA clones contained at least one mutation. The mutations were located in different regions of the cDNA. One of the clones was chosen for further study and the mutation present in that clone was at nucleotide 20. The mutation was corrected by PCR amplification of 1 ng of the clone using a newly designed forward primer,

5' GAACATGATGATGGACCTTTTTGAAACTGG 3' (SEQ ID NO : 35) and the original myf-6 reverse primer. The resulting myf-6 amplicon was gel purified from an agarose gel and ligated into the pCI mammalian expression vector that was digested at the Sma I restriction enzyme site and dephosphorylated with CIP enzyme (Promega Corp., M1821) .

The sequence was confirmed by dideoxy DNA sequencing, compared to the published murine myf- 6 gene (Genbank, X59060) and found to be identical. An in vi tro transcription/translation analysis was used to determine if the pCI -myf-6 clones were able to express a protein of the expected size. The pCI -myf-6^' clones expressed a protein very close to the predicted size of 27 kDa.

Example 18: Cloning of Murine neuroD and neurogenin Genes

Genes from the murine neurogenic family of bHLH transcription factors were cloned to use in determining whether other non-myogenic bHLH transcription factors exhibited augmented expression of a co-transfected foreign gene.

The cloning of murine DNA encoding NeuroD and murine DNA encoding Neurogenin was performed by PCR amplification of murine Neuro2A genomic DNA. The genomic DNA was isolated from murine Neuro2A cells (ATCC CCL-131) using the Wizard^® Genomic DNA Purification Kit (Promega Corp., A1120) according to manufacturer's instructions. The neuroD and neurogenin genes are both composed of two exons, the first of which is untranslated. Therefore, the neuroD and neurogenin genes were cloned by PCR amplification using Pfu DNA polymerase with primers designed specifically for exon 2. PCR primers used for the murine neuroD amplification were the neuroD forward primer 5 ' GTGGAAACATGACCAAATC 3' (SEQ ID NO: 36) and the neuroD reverse primer 5' CTGACGTGCCTCTAATCGTG 3' (SEQ ID NO: 37). The PCR primers for the amplification of the murine neurogenin gene were the neurogenin forward primer 5 ' CTAGTGGTATGGGATGAAACAGGG 3' (SEQ ID NO: 38) and the neurogenin reverse primer 5 ' CTAGTGGTATGGGATGAAACAGGG 3 • (SEQ ID NO:39). The PCR conditions for the amplification of these genes was 95°C/l minute, 60°C/l minutes and 72°C/1 minute for 35 cycles.

The neuroD and neurogenin amplicons were then purified from an agarose gel and ligated overnight into the mammalian cell expression vector pCI (Promega Corp., E1731) that had been previously digested with the restriction enzyme Sma I and dephosphorylated with Calf Intestine

Alkaline Phosphatase (CIAP, Promega Corp., M1821) according to manufacturer's instructions. The ligation was then transformed into JM109 cells. Two colonies of each clone were screened with restriction enzymes and shown to generate the expected fragments. The clones were further demonstrated to express the expected size protein of about 40 kDa for NeuroD and about 26 kDa for Neurogenin by in vi tro transcription and translation in the presence of radiolabeled methionine (TNT, Promega Corp., L4610) . The nucleotide sequence of the clones were confirmed by dideoxy sequencing and found to agree with published sequences for murine neuroD (Genbank, U28888) and murine neurogenin (Genbank, U67776) .

Example 19: Cloning of Human Myogenic and Neurogenic

Genes

Genes from the human myogenic and neurogenic families of bHLH transcription factors were cloned to use in determining whether other non-murine bHLH transcription factors exhibited augmented expression of a co-transfected foreign gene. Cloning of Human myoD Gene

Genomic DNA from human IMR32 cells (CCL-127, ATCC, Bethesda, MD) was isolated using the Wizard^® Genomic DNA Purification Kit (Promega Corp., A1120). The following human myoD specific PCR primers were designed: 5 ' GATATGGAGCTACTGTCGCC 3 ' human myoD forward (SEQ ID NO:40) 5 ' CCCTCAGAGCACCTGGTATATCG 3 ' human myoD reverse (SEQ ID NO: 41)

The IMR32 genomic DNA was used for PCR amplification using the human myoD specific PCR primers and standard PCR conditions described heremabove. A PCR amplicon of 1.7 kilobases, as expected, was produced as verified by agarose gel electrophoresis . The myoD amplified fragment was then ligated into the pTargeT™ vector and transformed into JM109 cells. Positive clones containing the human myoD gene were identified by restriction analysis with the restriction enzyme Pst I generated the expected DNA fragments of 3652, 2778 and 940 base pairs. These clones were separately transfected into NIH3T3 cells using Transfast™ Transfection Reagent according to standard conditions previously described. Then, 24 hours post-transfection, total RNA was isolated from the cells and a RT-PCR reaction was performed with the total RNA and the human myoD forward and reverse primers used m the original PCR reaction.

An amplicon corresponding to the expected size of the human myoD cDNA was isolated and then ligated into the pTargeT™ vector and transformed into JM109 cells. Positive clones were screened with a restriction enzyme and then further confirmed to be correct by dideoxy DNA sequencing and comparing the sequence obtained to the published sequence (Genbank, X56677) . A protein of the expected size, about 34.5 kDa, was generated by these clones by in vi tro transcription and translation analysis. The human myoD coding sequence was subsequently subcloned from the pTargeT vector into the pCI mammalian expression vector using unique Xho I and Not I restriction enzyme sites present m both vectors. Cloning of Human neuro D Gene

Genomic DΝA was harvested from IMR-32 tissue culture cells, a human neuroblastoma cell line (ATCC #127- CCL) , using the Wizard^® Genomic DΝA Purification kit (Promega Corp, A1120) according to manufacturer's instructions. PCR amplification was performed to obtain the human neuroD (hΝD) gene (Genbank #D82347) from IMR-32 (#CCL-127, ATCC, Bethesda, MD) genomic DΝA using the PCR primers: forward primer 5 ' CCATGACCAAATCGTACAGCGAG 3' (SEQ ID NO: 41) , and reverse primer 5 ' CTAATCATGAAATATGGCATTG 3' (SEQ ID NO: 42) . PCR reaction components included 40 ng of IMR-32 genomic DNA, 0.2 ug of each primer, 0.2 mM each dNTP, 0.5 units Taq polymerase (Boehrmger Mannheim, Indianapolis, IN), IX Taq reaction buffer, in a total volume of 50 ul and the following program was used for amplification; denature at 94°C/20 sec, anneal at 55°C/20 sec, extend at 74°C/20 sec (30 cycles) , extend at 74°C/4 mm (1 cycle), reaction stored at 4°C.

The 1071 bp PCR amplification product of hND (about 39 kD protein) was purified and ligated into the pTargetT Mammalian Expression TA vector (Promega Corp., A1410) by established protocols yielding pThND plasmid. The correct incorporation and orientation of the hND gene was verified by: restriction digest, n vi tro protein expression using the T7 TNT^® Coupled Reticulocyte Lysate System (Promega Corp., L4610) , and dideoxy DNA sequencing. The hND gene was subsequently cloned from the pThND into the pCI mammalian expression vector (Promega Corp., E1731) using the EcoR I restriction enzyme sites flanking the hND gene in the pThND plasmid and the .EcoR I site found in the multiple cloning site of the pCI vector by established cloning methodologies, yielding pCIhND plasmid. Correct orientation and incorporation of the hND gene was performed as for the pThND plasmid vector.

Example 20: Efficacy of Augmentor Sequences Encoding Proteins Derived from Different bHLH

Proteins

Transfection assays were designed and implemented in order to determine the effect of the expression of various cloned myogenic and neurogenic factors obtained from different sources on expression of a co-transfected foreign gene, luciferase.

The nucleic acids expressing various myogenic factors were separately co-transfected with a nucleic acid expressing luciferase into NIH3T3 cells. The nucleic acids expressing various neurogenic factors were separately co- transfected with a nucleic acid expressing luciferase into PC12 and Neuro2A cells.

Twenty four hours prior to transfection, 5 x 10⁴ cells were seeded per well of a 24 -well tissue culture plate and incubated overnight at 37°C in 10% C0₂. After the 24 hour incubation, the cells were co-transfected with both a plasmid expressing a foreign gene of interest and a plasmid expressing a bHLH protein using TransFast™ Transfection Reagent following the manufacturer's protocol for each of the cell lines. The cell lines tested were all from ATCC and were grown as suggested by ATCC.

Briefly, 0.5 μg of pCI-luc and 0.5 ug of a second plasmid containing an augmentor sequence comprising a cloned myogenic or neurogenic factor were mixed with 3 μl of TransFast™ Reagent and incubated at room temperature for 15 minutes. A 200 μl aliquot of the DNA/TransFast™ Reagent mixture was then added to a well of a 24 -well plate in replicate wells. The cells were incubated for one hour at 37°C in 10% C0₂. After the one hour incubation, one ml of serum-containing media were added per well and the incubation was continued until the desired assay time point. Positive and negative controls were used in each of the transfection experiments. The positive control was cells transfected with both 0.5 μg pCI-luc and 0.5 μg of pCISM. The negative control was the transfection of cells with both 0.5 μg of pCI-luc and 0.5 μg of pCI .

Transfected cells were harvested on days two, four, six, eight, and ten days post-transfection. Cell lysates were harvested by removing the media, adding 100 μl of IX CCLR, swirling to mix the lysmg reagent and the transfected cells, and subsequent storage of the plates at -80°C. Once all time points were collected, the amount of luciferase protein present was determined by combining 20 μl of the lysate with 100 μl LAR and measuring the light output on a LabSystem Lummoskan luminometer.

The resulting levels of luciferase expression in the presence of an augmentor sequence encoding a particular bHLH protein when compared to luciferase expression levels in the presence of an augmentor sequence encoding a murine MyoD protein are listed m the tables below.

The resulting luciferase relative light unit values from cells transfected with nucleic acid expressing the various myogenic factors have been normalized to luciferase relative light unit values from cells transfected with nucleic acid expressing murine myoD and luciferase. The 8 day post-transfection time point represents the highest level of luciferase expression and the data are listed below: Clone NIH3T3 cells

Murine myoD cDNA (pCISM) 100% Human myoD-genomic 80.6% Human myoD cDNA 84.3

Murine myf-5 58 Murine myf - 6 0 . 7

The resulting luciferase relative light unit values from cells transfected with nucleic acid expression the various neurogenic factors have been normalized to luciferase relative light unit values from cells transfected with nucleic acid expressing luciferase and pCI . The 2 day post-transfection time point and 4 day post-transfection time points were selected for PC12 and Neuro2A respectively, as they represent the highest level of luciferase expression and the data are listed below:

Clone PC12 Neuro2A pCI 100% 100%

Murine neuroD 147.8 211.1 Murine neurogenin 177.2 135.5

Murine myoD 59 52.7

These results demonstrated that an augmentor sequence encoding human MyoD, murine Myf-5 and murine Myogenin resulted m augmented expression of a co- transfected foreign gene when expressed in NIH3T3 cells, although to varying levels. In addition, murine Myogenin has augmentor activity in Neuro2A cells. The results also show that an augmentor sequence encoding the neurotropic bHLH proteins, murine NeuroD and murine Neurogenin, augmented expression of a foreign gene when expressed in neuro cell lines PC-12 and Neuro2A, but did not augment expression of reporter genes in NIH3T3 cells.

These results and those from similar experiments, in which various cell lines were co-transfected with pCISM and pCI-Luc plasmids according to standard conditions previously detailed, demonstrate that the following augmentor sequences are known to achieve augmented expression of transiently co-transfected foreign genes the indicated cell lines:

Example 21: Construction of Multi-Expression Vectors

A bicistronic vector (pCIneo/IRES/Luc) was constructed that would support the expression of both an augmentor sequence encoding MyoD and luciferase (Luc) as a co-transfected foreign gene; in this case, luciferase was the reporter molecule. The vector also contained a neo gene which, when expressed in the eukaryotic cells, can serve as a selectable marker for cells which had incorporated the plasmid into their genome. The muiti -expression vector was designed to contain a CMV promoter initiating MyoD expression and an SV40 promoter initiating neo and luc expression. A similar control vector lacking the myoD gene was also constructed.

Three micrograms of vectors pCIneo (Promega Corp., E1841) and pCIneoSM, previously described in Example 1, were separately digested with restriction enzyme Csp45 I . This enzyme cuts at a unique restriction site located just upstream of the neo polyadenylation signal. The restriction ends generated were then filled in with T4 DNA polymerase (Promega Corp., M4211) according to manufacturer's instructions, resulting in a blunt-ended, linear DNA fragment. These DNA fragments were subsequently dephosphorylated using calf intestinal alkaline phosphatase (Promega Corp., M1821) according to manufacturer's instructions. The linearized, dephosphorylated DNA fragments were then purified using AgarACE^® enzyme (Promega Corp., M1741) according to manufacturer's instructions and resuspended m sterile water for subsequent overnight ligation and transformation into JM109 cells. The encephalomyocarditis virus (EMCV) internal πbosome entry site (IRES) sequence and associated firefly luciferase gene were excised from the vector pCIneoGFP/lRES/Luc with restriction enzymes EcoR I ( 5 ' end of the IRES sequence) and Xba I (3' of luc gene) . The construction of the pCIneoGFP/lRES/Luc vector is described herein below. The resulting EcoR I and Xba I restricted ends were filled m with T4 DNA polymerase and dNTPs as described above to generate a blunt -ended IRES/Luc fragment. The IRES/Luc blunt-ended fragment was then purified using AgarACE^® enzyme as described above and resuspended in sterile water. The blunt-ended IRES/Luc fragment was ligated overnight at 14°C into the blunt -ended dephosphorylated pCIneo and pCIneoSM vectors and subsequently transformed into JM109 bacterial cells. Clones of both pCIneo/IRES/Luc and pCIneoSM/lRES/Luc were screened via restriction digest for incorporation and correct orientation of the IRES/Luc insert, with potentially useful clones being sequenced at the junction of the 5' luciferase gene and the IRES and the junction of the IRES and the 3 ' end of the neomycin gene with GLprimer2 (Promega Corp., E1661) for verification. The pCIneo/IRES/Luc plasmid when digested with Neo I generates five fragments of 4372, 1497, 754, 719, and 296 base pairs; when digested with Hind III it generates three fragments of 4962, 1659, and 1017 base pairs. The pCIneoSM/IRES/Luc plasmid when digested with Neo I generates six fragments of 72, 1841, 754, 719, 617, and 296 base pairs; when digested with Hind III it generates three fragments of 4962, 2620 and 1017 base pairs. The pCIneoGFP/lRES/Luc plasmid was constructed using the plasmid pCITE 4a(+) (Clontech Laboratories, Palo Alto, Cal . ) as the source for the EMCV IRES. PCR primers were designed for amplification of the EMCV IRES sequence from pCITE 4a(+) . The forward IRES primer has the sequence 5' GCTAGCGAATTCGTTATTTTCCACCATATTGC 3' (SEQ ID NO: 44). The underlined sequence denotes the restriction enzyme sequences for Nhe I and EcoRI . The reverse IRES primer has the sequence 5' CCATGGTATCATCGTGTTTTTCAAAGG 3' (SEQ ID NO:45). The underlined sequence denotes the restriction enzyme sequence for Neo I .

PCR reaction components included 40 ng of pCITE

4 (+) plasmid vector, 0.2 μg of each primer, 0.2 mM each dNTP, 0.5 units Taq polymerase (Boehringer Mannheim, Indianapolis, IN), IX Taq reaction buffer, and nanopure water to a final total volume of 50 μl . The following program was used for amplification: 94°C/3 min (94°C/20 sec, 62°C/20 sec, 72°C/20 sec) x 30 cycles, 72°C/3 min, stored at 4°C. The synthesis of one band of the expected size was confirmed by running a fraction of the reaction on a 1% agarose gel, staining with ethidium bromide and visualizing under a UV light. The 497 bp IRES amplification product was cloned into the plasmid pTARGET (Promega Corp. A1410) according to manufacturer's instructions creating pTARGET/IRES vector. The IRES sequence was then restricted out of pTARGET/IRES using Nhe I and Neo I restriction enzymes and ligated overnight into the pSPLuc-t- plasmid (Promega Corp., E1781) at the same sites yielding pSPLuc+/lRES plasmid and subsequently transformed into JM109 cells. The IRES/Luc sequences were then restricted out of pSPLuc/IRES and ligated overnight into the pCIneoGFP plasmid described in Example 1 using the restriction enzymes EcoR I (5' end of the IRES) and Xba I (3' of the luc gene) yielding the final plasmid vector pCIneoGFP/IRES/Luc. This final vector was used above in the construction of the bicistronic vectors as the source for the EMCV IRES and luciferase gene.

Example 21: Generation of Stable Cell Lines

Cell lines that stably expressed an augmentor protein and a foreign gene were generated by transfecting cells with the bicistronic vectors described in Example 20. Cell lines NIH3T3, C2C12, BHK-21, C3H10T1/2 (all available from ATCC, Bethesda, MD) were transfected separately with pCIneo/IRES/Luc or with pCIneoSM/IRES/Luc plasmids to generate stably-transfected cell lines. These cell lines would constitutively express luciferase if generated with pCIneo/IRES/Luc plasmid or luciferase and MyoD if generated with the pCIneoSM/IRES/Luc plasmid.

The procedure was carried out similarly for each cell line. The day prior to transfection, the cells were seeded at 2.5 x 10⁴ - 5 x 10⁵ cells/well in a 6-well tissue culture dish. The day of transfection, 5 μg plasmid DNA in water, previously prepared with a QIAfilter Plasmid Maxi Kit (Qiagen, Valencia, CA) , was added to a tube containing lml of serum free media. Fifteen microliters TransFast™ Transfection Reagent (Promega Corp., E2431) was added to the DNA solution, vortexed briefly, and then the DNA and lipid allowed to complex by incubation for 10-15 minutes at room temperature. Immediately prior to transfection, the media were aspirated from the wells. One milliliter of the DNA/lipid complex was then added to each well and allowed to incubate at 37°C/10% C0₂ for one hour. These reactions were performed in duplicate. Then 5 ml of complete medium (DMEM + 10% calf serum for NIH3T3 cells, DMEM + 10% fetal calf serum for C2C12 cells, all medium from Life Technologies, Gaithersburg, MD) was added to each well and the cells were returned to the incubator for an additional 48 hours.

Two days post-transfection, the cells in each well were separately trypsinized (Life Technologies, Gaithersburg, MD) , cells from two wells were pooled and counted with a hemacytometer using standard methods and then normalized before seeding new 6-well plates at 1:200, 1:400, and 1:800 cell dilution (n=2), so that the same number of cells were plated for each cell line. A 1:200 dilution contains 5000 cells, a 1:400 dilution contains 2500 cells, and a 1:800 dilution contains 1250 cells. These plates are subsequently referred to as the dilution plates. At the time of seeding, G418 (Life Technologies, Gaithersburg, MD) was added to each cell culture media at 500 μg/ml working concentration for stable cell selection. At the same time, a 100mm tissue culture dish was seeded separately with each cell line for future subcloning. These plates are subsequently referred to as the subcloning plates. Complete media used were as listed above. The stably-transfected cell cultures were incubated for an additional 14 days, with media changes every third day. The same type of media containing G418 was used for all media changes .

After 14 days, the dilution plates were stained for colony counting. Methylene blue, a 2% solution in 60% methanol, was prepared. Media were aspirated from the 6- well plates, 2% methylene blue was added (n=2 for each cell line) so that the solution covered the bottom of each well, and the plates were then incubated for 5 minutes at room temperature. After incubation, the wells were rinsed with IX PBS (Sigma, St. Louis, MO) allowed to air dry, and stable colonies were counted for each cell line. The colony numbers (average of three measurements plus or minus the standard deviation) obtained are listed below:

Colony Numbers pCIneo/IRES/Luc pCIneoSM/IRES/Luc

Cell Line 1:400 1:800 1:400 1:800 dilution

BHK-21 14±2 10±6 16±4 5±1

NIH3T3 7±1 2±2 21±3 10±4

C2C12 5±1 2±1 14±2 11±2

C3H10T1/2 l±l l±l 4±1 4±3

These results indicate clearly that the presence of MyoD protein resulted in up to a three- fold increase in the number of stably transfected colonies generated which stably express both MyoD and a foreign gene of interest, which in this case was luciferase. This effect was also demonstrated in multiple types of eukaryotic cells.

At the same time, the cells in the subcloning plates were trypsinized and the cells seeded in a 96-well tissue culture treated plate at about 1 cell/well in complete media. After the cells reached 90% confluency, 24 of the wells were separately trypsinized and the cells from one well of a 96-well plate transferred to one well of a 24-well tissue culture plate. This second generation of cells was grown in complete media. Once these subcloned cells were 90% confluent (3 to 7 days) , they were trypsinized and counted as described above. They were then pelleted and 1 x 10⁶ cells of each clone were lysed by addition of 100 μl of IX Cell Culture Lysis Reagent (Promega Corp., E1531) . Twenty microliters of the lysate was then added to 100 μl LAR and the resulting light output immediately measured on a Labsystems Luminoskan luminometer. Multiple clones of each type of cell line were tested and the average relative light units (rlu) of four measurements for each clone is listed below:

Cell type Plasmid average rlu

NIH3T3 pCIneo/IRES/Luc 3.5 pCIneo/IRES/Luc 11.4 pCIneoSM/IRES/Luc 109.4 pCIneoSM/IRES/Luc 124.4 pCIneoSM/IRES/Luc 46.5 pCIneoSM/IRES/Luc 27.9 pCIneoSM/IRES/Luc 42.8 pCIneoSM/IRES/Luc 45.7

The cells were divided three to four times prior to assay for luciferase activity.

The results demonstrate that the transfection of NIH3T3 cells with the clone expressing MyoD protein provides cells stably expressing luciferase, and MyoD augmented the expression of the luciferase protein. The variation in the average rlu values generated by the cell clones reflects expression variability between different clones and may also result from integration of the genes into different regions of the cellular genome. Co- transfection with a plasmid expressing MyoD provided overall higher levels of luciferase expression in expanded cell clones.

Example 22 Transient Expression of an Augmentor Factor in a Cell Stably-Expressing a Foreign Gene of Interest A population of NIH3T3 cells stably expresses firefly luciferase. The cells are created using methods previously described herein for generation of stable cell lines. The expressing cells are created using a mammalian expression plasmid containing the gene to be expressed downstream of a promoter that functions in eukaryotic cells. The plasmid also contains a neo gene capable of being expressed for use as a selectable marker.

The cell population is then transfected using standard methods with a plasmid containing a nucleic acid capable of expressing an augmentor factor or with a control plasmid not containing the sequence encoding the augmentor factor. For the population of cells stably expressing luciferase, an augmentor sequence encodes murine MyoD.

At 24, 48, and 96 hours after transfection, a cell lysate is prepared and luciferase activity is measured. The luciferase activity 96 hours after transfection is about the same or higher than the luciferase activity 48 hour after transfection and at all time points higher than the luciferase activity measured in the lysate prepared from the tranfection with the control plasmid at that time point.

The present invention has, of necessity, been discussed herein by reference to certain specific methods and materials. The enumeration of these methods and materials was merely illustrative, and in no way constitutes any limitation on the scope of the present invention. It is to be expected that those skilled in the art may discern and practice variations of, or alternatives to, the specific teaching provided herein without departing from the scope of the present invention. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention

Claims

What is claimed is:

1. A method of improving transient expression of an extrachromosomal foreign gene, comprising

co-transfecting a eukaryotic host cell with a first nucleic acid capable of transiently expressing a foreign gene and with a second nucleic acid capable of expressing an augmentor factor,

wherein transient expression of the foreign is augmented.

2. A method according to claim 1, wherein the first

nucleic acid and the second nucleic acid are present in separate vectors .

3. A method according to claim 1, wherein the first nucleic acid and the second nucleic acid are present in a single vector

4. A method of improving expression of a foreign gene stably incorporated into a eukaryotic host cell genome, comprising

co-transfecting a host cell with a first nucleic acid capable of stably expressing a foreign gene when incorporated into the host cell genome and with a second nucleic acid capable of stably expressing an augmentor factor when incorporated into the host cell genome ,

whereby the first nucleic acid and the second nucleic acid are stably incorporated into the host cell genome, and whereby stable expression of the foreign gene is augmented.

5. A method according to claim 4, wherein the first nucleic acid and the second nucleic acid are present in a single vector.

6. A method according to claim 5, wherein the vector further comprises a nucleic acid capable of expressing a eukaryotic selectable marker.

7. A method according to claim 4, wherein the first nucleic acid and the second nucleic acid are present in separate vectors .

8. A method according to claim 7, wherein each separate vector further comprises a nucleic acid capable of expressing a eukaryotic selectable marker.

9. A method of increasing a frequency of generating eukaryotic host cells stably expressing a foreign gene, comprising

cotransfecting a population of host cells with a first nucleic acid capable of stably expressing a foreign gene when incorporated into the host cell genome and with a second nucleic acid capable of expressing an augmentor factor.

10. A method according to claim 9, wherein the second nucleic acid is capable of stably expressing an augmentor sequence when incorporated into the host cell genome, and further wherein the first nucleic acid and the second nucleic acid are present in a single vector.

11. A method according to claim 9, wherein the vector further comprises a nucleic acid capable of expressing a eukaryotic selectable marker.

12. A method of improving expression of a foreign gene stably incorporated into a eukaryotic host cell genome, comprising

transfecting a host cell that is stably expressing a foreign gene with a nucleic acid capable of expressing an augmentor factor,

wherein stable expression of the foreign gene is augmented .

13. A vector comprising a nucleic acid encoding an augmentor factor, wherein the augmentor factor is selected from the group consisting of an active fragment or a homologue or active fragment of a homologue of a bHLH transcription factor protein.

14. A vector according to claim 13, where the bHLH transcription factor protein is selected from the group consisting of MyoD, Myf-5, myogenin, NeuroD and neurogenin.

15. A vector according to claim 13, wherein the vector further comprises a regulatory sequence which directs expression of the augmentor factor.

16. A vector according to claim 15, wherein the regulatory sequence comprises a promoter selected from the group consisting of an RSV promoter, a CMV immediate-early promoter, and an SV40 promoter.

17. A vector according to claim 13, wherein the vector further comprises a cloning site.

18. A vector comprising a nucleic acid encoding an augmentor factor, wherein the augmentor factor is a fusion protein of two protein components, wherein a first component is a bHLH transcription factor protein or an active fragment or a homologue or active fragment of a homologue of a bHLH transcription factor protein and a second component is a second protein.

19. A vector according to claim 18, wherein the augmentor factor fusion protein is VP16/MyoD.

20. A vector comprising

a first nucleic acid comprising a nucleic acid sequence encoding a foreign gene and at least one regulatory sequence required for expressing the foreign gene, and

a second nucleic acid comprising an augmentor sequence and at least one regulatory sequence required for expression of the augmentor sequence.

21. A vector according to claim 20, wherein the vector further comprises a third nucleic acid encoding a eukaryotic selectable marker and at least one regulatory sequence required for expression of the eukaryotic selectable marker.

22. A vector according to claim 20, wherein the vector further comprises a cloning site.

23. A vector according to claim 20, wherein the vector further comprises an internal ribosome entry site (IRES) upstream of the first nucleic acid sequence encoding the foreign gene of interest .

24. A vector according to claim 20, wherein the vector further comprises an internal ribosome entry site (IRES) upstream of the second nucleic acid sequence encoding the augmentor sequence .

25. A vector according to claim 21, wherein the selectable marker is the neomycin phosphotransferase gene.

26. A vector comprising

a first nucleic acid comprising at least one regulatory sequence that directs gene expression in eukaryotic cells,

a second nucleic acid comprising at least one cloning site located downstream of the regulatory sequence into which a foreign gene can be inserted,

a third nucleic acid comprising an augmentor sequence, and

a fourth nucleic acid sequence comprising at least one regulatory sequence required for expression of the augmentor sequence .

27. A vector according to claim 26, wherein a regulatory sequence of the first nucleic acid is an IRES sequence .

28. A vector according to claim 26, wherein a regulatory sequence of the fourth nucleic acid is an IRES sequence .

29. A vector according to claim 26, wherein a regulatory sequence of the first nucleic acid is a promoter sequence .

30. A vector according to claim 26, wherein a regulatory sequence of the fourth nucleic acid is a promoter sequence .

18

31. A vector according to claim 26, wherein the vector further comprises a fifth nucleic acid comprising a sequence encoding a eukaryotic selectable marker and a sequence comprising at least one regulatory sequence required for expression of the eukaryotic selectable marker .

32. A vector according to claim 31, wherein the selectable marker is the neomycin phosphotransferase gene.

33. A eukaryotic host cell stably expressing a foreign gene and transiently expressing a nucleic acid comprising an augmentor sequence, wherein the augmentor sequence encodes an active fragment or a homologue or active fragment of a homologue of a bHLH transcription factor protein.