WO2000036095A2 - FATTY ACYL-CoA: FATTY ALCOHOL ACYLTRANSFERASES - Google Patents
FATTY ACYL-CoA: FATTY ALCOHOL ACYLTRANSFERASES Download PDFInfo
- Publication number
- WO2000036095A2 WO2000036095A2 PCT/US1999/028678 US9928678W WO0036095A2 WO 2000036095 A2 WO2000036095 A2 WO 2000036095A2 US 9928678 W US9928678 W US 9928678W WO 0036095 A2 WO0036095 A2 WO 0036095A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- wax
- seq
- wax synthase
- host cell
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6436—Fatty acid esters
- C12P7/6445—Glycerides
- C12P7/6463—Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
Definitions
- FATTY ACYL-CoA FATTY ALCOHOLACYLTRANSFERASES
- the present invention is directed to enzymes, methods to purify, and obtain such enzymes, amino acid and nucleic acid sequences related thereto, and methods of use for such compositions in genetic engineering applications.
- plant genetic engineering techniques it is possible to transform and regenerate a variety of plant species to provide plants which have novel and desirable characteristics.
- One area of interest for such plant genetic engineering techniques is the production of valuable products in plant tissues.
- Such applications require the use of various DNA constructs and nucleic acid sequences for use in transformation events to generate plants which produce the desired product.
- plant functional promoters are required for appropriate expression of gene sequences, such expression being either in the whole plant or in selected plant tissues.
- selective marker sequences are often used to identify the transformed plant material. Such plant promoters and selectable markers provide valuable tools which are useful in obtaining the novel plants.
- Wax esters are required in a variety of industrial applications, including pharmaceuticals, cosmetics, detergents, plastics, and lubricants. Such products, especially long chain wax esters have previously been available from the sperm whale, an endangered species, or more recently, from the desert shrub, jojoba. Neither of these sources provides a convenient supply of wax esters. Thus, in order to obtain a reliable source of such compounds, transformation of crop plants, which are easily manipulated in terms of growth, harvest and extraction of products, is desirable.
- Wax ester production results from the action of at least two enzymatic activities, fatty acyl reductase and fatty acy fatty alcohol acyltransferase, or wax synthase.
- a ⁇ -ketoacyl-Coenzyme A synthase may also be involved in wax biosynthesis by providing very long chain fatty acyl- CoA substrates for the reductase and wax synthase enzymatic reaction.
- Clones obtained in this manner can be analyzed so that the nucleic acid sequences corresponding to wax synthase activity are identified.
- the wax synthase nucleic acid sequences may then be utilized in conjunction with fatty acylreductase proteins, either native to the transgenic host cells or supplied by recombinant techniques, for production of wax esters in host cells.
- nucleic acid sequences encoding fatty acyl-CoA fatty alcohol O- acyltransferase protein (fatty alcohol acyltransferase, E.C.2.3.1.75), are provided, wherein said protein is active in the formation of wax esters from fatty alcohol and fatty acyl substrates.
- This fatty acyl-CoA: fatty alcohol O-acyltransferase is also referred to herein as "wax synthase”.
- the wax synthase of this invention may be active with a variety of fatty acyl and fatty alcohol substrates, including acyl-CoAs and acyl-ACPs.
- the carbon chain length of these substrates may vary, although a given wax synthase may show preference for acyl and alcohol substrates having a specific chain length or may be active with acyl and alcohol substrates having a wide range with respect to carbon chain length.
- the wax synthases are preferably obtained from plant sources.
- the wax synthase of this invention has activity towards at least those acyl and alcohol substrates having a chain length of from 8 to 30 carbons, more preferably from 8 to 28 carbons.
- the wax synthase protein of this invention further manipulations are now possible as described in further detail below. These manipulations may lead to production or discovery of other related wax synthases.
- the present invention is directed to fatty acyl-CoA: fatty alcohol O- acyltransferase (also referred to herein as wax synthase), and in particular to wax synthase polynucleotides.
- the polynucleotides of the present invention include those derived from plant sources.
- One aspect of the present invention relates to oligonucleotides which include partial or complete wax synthase encoding sequences. It is also an aspect of the present invention to provide recombinant DNA constructs which can be used for transcription or transcription and translation (expression) of wax synthase.
- constructs are provided which are capable of transcription or transcription and translation in host cells. Particularly preferred constructs are those capable of transcription or transcription and translation in plant cells.
- methods are provided for production of wax synthase in a host cell or progeny thereof.
- host cells are transformed or transfected with a DNA construct which can be used for transcription or transcription and translation of wax synthase.
- the recombinant cells which contain wax synthase are also part of the present invention.
- the present invention relates to methods of producing a wax ester in a host cell or progeny thereof.
- host cells are transformed or transfected with a DNA construct which can be used for transcription or transcription and translation of wax synthase in a host cell having fatty alcohol and fatty acid substrates.
- the wax ester so produced find use in a variety of applications including pharmaceuticals, cosmetics, detergents, plastics, food applications and lubricants.
- the wax esters can be used in food applications as a low calorie fat.
- the wax esters can be used as sources for the production of fatty alcohols and fatty acyl products.
- the wax esters can be subjected to hydrolysis conditions to produce fatty alcohols and fatty acyl products for use in a variety of applications, including, detergents, lubricants, corrosion inhibition, plasticiers, cosmetics, emulsifiers, and for use in pharmaceutical compositions.
- methods of using polynucleotide and polypeptide sequences of the present invention to alter the oil content of a host cell involve growing a host cell having a recombinant nucleic acid construct comprising a promoter and a nucleic acid sequence which encodes an acyltransferase active in the formation of a wax ester.
- Such methods can be used in the production of host cells with modified oil/protein ratios.
- the modified plants, seeds and oils obtained by the expression or suppression of the wax synthase proteins are also considered part of the invention.
- Figure 2 Results of wax synthase activity assay using various alcohol substrates and 1 ug 16:0-CoA substrate.
- Figure 4 Results of wax synthase activity assay using various alcohol substrates and 1 ug 24: l-CoA substrate.
- Figure 5 Results of wax synthase activity assay using various alcohol substrates and 10 ug 24: l-CoA substrate.
- Figure 6 provides the results of fatty acid methyl ester (FAME) analysis for oils obtained from Arabidopsis plants transformed with ATWS 1 (lines 9708) and ATWS2 (lines 9712).
- FAME fatty acid methyl ester
- nucleic acid sequences which encode for amino acids, such as a protein, polypeptide or peptide fragment, which are active in catalyzing the esterification of a fatty alcohol by a fatty acyl group to produce a wax ester.
- amino acids such as a protein, polypeptide or peptide fragment
- Such proteins are known as fatty acyl-CoA: fatty alcohol acyltransferase (E.C.2.3.1.75).
- the acyl-CoA alcohol acyltransferase of this invention is also referred to hereafter as "wax synthase”.
- the wax synthases of this invention may demonstrate activity towards a variety of acyl substrates, including fatty acyl-CoA and fatty acyl-ACP molecules.
- both the acyl and alcohol substrates acted upon by the wax synthase may have varying carbon chain lengths and degrees of saturation, although the wax synthase may demonstrate preferential activity towards certain molecules.
- wax esters from alcohol and acyl substrates and are desirable sources of a wax synthase protein of this invention.
- plants produce epidermal, or cuticular wax (Kolattukudy (1980) in The Biochemistry of Plants (Stumpf, P.K. and Conn, E.E., eds.) Vol.4, p. 571-645), and the desert shrub, jojoba (Ohlrogge et al. (Lipids (1978) 3: 203 -210), as well as Murraya koenigii (Kartha, (1969) Chemistry and Industry 4:1342-1343 and Kartha, et al. (1972) Chemistry and Industry 891-892), produce a seed storage wax.
- Wax synthesis has also been observed in various species of bacteria, such as Acinetobacter (Fixter et al. (1986) J. Gen. Microbiol. 752:3147-3157) and Micrococcus (Lloyd (19S7) Microbios 52:29-37), and by the unicellular orgnanism, Euglena (Khan and Kolattukudy (1975) Arch. Biochem. Biophys. 770:400-408).
- wax production and wax synthase activity have been reported in microsomal preparations from bovine meibomian glands (Kolattukudy et al (1986) J. Lipid Res.
- wax esters which will have various properties may be produced by the wax synthases of this invention, and the activity of the enzyme and type of wax ester produced may depend upon the available substrate or the substrate specificity of the particular wax synthase of interest.
- nucleic acid sequences associated with the wax synthase such that these sequences may be cloned into host cells for the production of the wax synthase enzyme.
- one may clone nucleic acid sequences encoding a wax synthase protein into vectors for expression in E. coli cells to provide a ready source of the wax synthase protein.
- the wax synthase protein so produced may also be used to raise antibodies against wax synthase proteins for use in identification and purification of related wax synthase proteins from various sources, especially from plants.
- wax synthase protein may lead to site-specific mutagenesis reactions to further characterize and improve its catalytic properties or to alter its fatty alcohol or fatty acyl substrate specificity.
- a wax synthase with altered substrate specificity may find application in conjunction with other FAS enzymes.
- nucleic acid and amino acid sequences of wax synthase proteins were not known. Thus, in order to obtain the nucleic acid sequences associated with wax synthase, it was necessary to first purify the protein from an available source and determine at least partial amino acid sequence so that appropriate probes useful for isolation of wax synthase nucleic acid sequences could be prepared.
- jojoba The desert shrub, Simmondsia chinensis (jojoba) was identified as a source of a candidate wax synthase protein.
- membrane associated proteins are difficult to purify as they tend to lose enzymatic activity when they are solubilized, i.e. separated from the membrane environment in which they normally function.
- Techniques that have been used to solubilize integral membrane proteins include addition of detergents or organic solvents to a preparation of a suitable membrane fraction.
- microsomal membrane preparation which comprises wax synthase activity is desired.
- Standard microsomal membrane preparations utilize differential centrifugation of a cell- free homogenate (CFH) to yield a membrane fraction which is free of whole cells, nuclei and soluble protein.
- CSH cell- free homogenate
- initial centrifugation steps typically yield a pellet, supernatant and a floating fat pad, and microsomal membranes may then be recovered by further centrifugation of the supernatant.
- a protocol is described in USPN 5,403,918, whereby a jojoba membrane fraction was obtained with good recovery of enzyme activity associated with fatty acylreductase, another enzyme involved in the formation of wax esters in jojoba.
- the method also provides membrane fractions having wax synthase activity as described in detail in the examples which follow.
- microsomal membrane preparations from jojoba are also described in Lassner et al (supra). Other procedures are known to those in the art and may be utilized to obtain similar membrane preparations.
- methods to assay for wax synthase activity in such preparations are described in Example 1.
- a critical stage for further enzyme characterization and purification is that of obtaining solubilized wax synthase protein that is separated from its native lipid bilayer membrane environment, but retains substantial amounts of measurable wax synthase enzymatic activity.
- the removal of integral membrane proteins from the lipid bilayer is typically accomplished using amphiphilic detergents in aqueous solution, although organic solvents have also been used in a few cases.
- amphiphilic detergents in aqueous solution, although organic solvents have also been used in a few cases.
- Many different detergents and methods of solubilization of membrane proteins are known to those skilled in the art, and are also reviewed by Neugebauer (Methods Enzymol. (1990) 782:239-253) and Hjelmiland (Methods Enzymol. (1990) 782:253-264).
- detergents which are used to solubilize membrane proteins are found to inhibit the enzymatic activity of a desired protein.
- Several detergents were tested for solubilization of jojoba wax synthase, including CHAPS (3-[(3-cholamidopropyl)- dimethyl-ammonio]-l-propanesulfonate), which was demonstrated in USPN 5,403,918 to be useful in purification of a fatty acyl reductase from jojoba. All were found to inhibit wax synthase enzymatic activity.
- the jojoba wax synthase of this invention has a broad range of acyl substrates, including acyl-ACP and acyl-CoA molecules.
- the acyl and fatty alcohol substrates may have a broad size range with respect to carbon chain length.
- activity was tested using substrates having carbon chain lengths of from C12 to C24, and all were shown to be utilized by the enzyme.
- activity was shown with fatty acyl and fatty alcohols having varying degrees of unsaturation. Chromatography techniques may be utilized to provide enriched preparations of plant wax synthase.
- One such purification step involves chromatography over an immobilized reactive dye matrix, such as the Cibacron Blue F3GA (Blue A) used in this invention.
- the jojoba wax synthase activity binds to such a column when loaded in a buffer containing approximately 0.3M NaCl, while greater than approximately 85% of other protein passes through or is removed in subsequent washes.
- reductase activity is also bound to the Blue A column under such conditions. It is demonstrated herein that approximately 70% of the wax synthase activity loaded to a Blue A column can be recovered by elution with a 2.0M NaCl buffer wash.
- the jojoba reductase and ⁇ -ketoacyl-CoA synthase (KCS) proteins are also present in this Blue A eluate.
- a cyrstalline hydroxyapatite (HA) column Further purification of the Blue A eluate is obtained by loading the sample onto a cyrstalline hydroxyapatite (HA) column. Wax synthase activity does not bind to the column and is found in the flow through and wash. The majority of the reductase and KCS activities bind to the column, as does the majority of the protein in the sample.
- the HA fraction enriched in wax synthase activity can be used for size exclusion chromatography, and using a Superdex 75 size exclusion column, the jojoba wax synthase protein is estimated to have a molecular weight of 48kD.
- the jojoba wax synthase protein can be recovered as a substantially purified protein preparation and the amino acid sequence can be obtained.
- other wax synthases would also be predicted to be associated with membranes in their native cells, and thus purification techniques described herein for jojoba wax synthase, may also be useful in recovery of purified preparation of other wax synthase proteins.
- Euglena gracilis produces waxes through the enzymatic actions of a fatty acyl-CoA reductase and a fatty acyl-CoA alcohol transacylase, or wax synthase.
- waxes having carbon chain lengths ranging from 24-32 are detected in this organism.
- the Euglena wax synthase enzyme may be solubilized using a CHAPS/NaCl solution, and a partially purified wax synthase preparation is obtained by dye-ligand, HA and size exclusion chromatography.
- Acinetobacter species are also known to produce wax ester compositions, although the mechanism is not well defined.
- a fatty acyl-CoA alcohol transacylase, or wax synthase activity is detected in Acinetobacter species.
- the wax synthase activity is solubilized in CHAPS/NaCl, enriched by Blue A column chromatography and may be further purified using such techniques as size exclusion chromatography.
- the band containing the purified protein is cut out of an SDS gel to use in amino acid sequencing reactions.
- wax synthase may also be desirable, such as expression of the protein in E. coli.
- the wax synthase may then act on fatty acyl and fatty alcohol substrates in such cells to produce wax esters which may be detected by various analytical methods. If the host cells do not contain the alcohol substrate of the wax synthase, activity may be verified by assaying cell extracts.
- wax synthase protein may be prepared by in vitro translation using wax synthase nucleic acid sequences and commercially available translation kits. Addition of microsomal membrane preparations to the in vitro translation sample may be necessary to obtain active wax synthase protein if membrane insertion is critical to activity. Other testing may include immunological assays, whereby antibodies specific for the candidate protein are prepared and found to inhibit wax synthase activity in protein preparations.
- nucleic acid sequences are isolated using amino acid sequences determined for the proteins associated with wax synthase activity, both to confirm the identity of a wax synthase protein and to provide for transcription of the sequences and/or expression of the protein in host cells, either prokaryotic or eukaryotic.
- wax synthase is a membrane bound protein
- the wax synthase nucleic acids of this invention may be genomic or cDNA and may be isolated from cDNA or genomic libraries or directly from isolated plant DNA. As described in more detail in the examples below, a method for obtaining nucleic acid sequence for the jojoba wax synthase by PCR from primers specific for the disclosed jojoba wax synthase peptides is provided herein.
- Wax synthase nucleic acid sequences of this invention include those corresponding to the jojoba wax synthase protein, as well as sequences obtainable from the jojoba protein or nucleic acid sequences.
- corresponding is meant nucleic acid sequences, either DNA or RNA, including those which encode jojoba wax synthase protein or a portion thereof, regulatory sequences found 5' or 3' to said encoding sequences which direct the transcription or transcription and translation (expression) of the wax synthase in jojoba embryos, intron sequences not present in the cDNA, as well as sequences encoding any leader or signal peptide of a precursor wax synthase protein that may be required for insertion or retention into the endoplasmic reticulum membrane, which may or may not be found in the mature wax synthase enzyme.
- sequences "obtainable” from the jojoba sequence or protein is intended any nucleic acid sequences associated with a desired wax synthase protein that may be synthesized from the jojoba wax synthase amino acid sequence, or alternatively identified in a different organism, and isolated using as probes jojoba wax synthase nucleic acid sequences or antibodies prepared against the jojoba wax synthase protein. In this manner, it can be seen that sequences of these other wax synthases may similarly be used to isolate nucleic acid sequences associated with wax synthase proteins from additional sources.
- polynucleotide sequences of the present invention include isolated polynucleotides that encode the polypeptides of the invention having a deduced amino acid sequence selected from the group of sequences set forth in the Sequence Listing and to other polynucleotide sequences closely related to such sequences and variants thereof.
- the invention provides a polynucleotide sequence identical over its entire length to each coding sequence as set forth in the Sequence Listing.
- the invention also provides the coding sequence for the mature polypeptide or a fragment thereof, as well as the coding sequence for the mature polypeptide or a fragment thereof in a reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, pro-, or prepro- protein sequence.
- the polynucleotide can also include non-coding sequences, including for example, but not limited to, non-coding 5' and 3' sequences, such as the transcribed, untranslated sequences, termination signals, ribosome binding sites, sequences that stabilize mRNA, introns, polyadenylation signals, and additional coding sequence that encodes additional amino acids.
- non-coding sequences including for example, but not limited to, non-coding 5' and 3' sequences, such as the transcribed, untranslated sequences, termination signals, ribosome binding sites, sequences that stabilize mRNA, introns, polyadenylation signals, and additional coding sequence that encodes additional amino acids.
- a marker sequence can be included to facilitate the purification of the fused polypeptide.
- Polynucleotides of the present invention also include polynucleotides comprising a structural gene and the naturally associated sequences that control gene expression.
- the invention also includes polynucleotides of the formula: wherein, at the 5' end, X is hydrogen, and at the 3' end, Y is hydrogen or a metal, Rj and R 3 are any nucleic acid residue, n is an integer between 1 and 3000, preferably between 1 and 1000 and R 2 is a nucleic acid sequence of the invention, particularly a nucleic acid sequence selected from the group set forth in the Sequence Listing and preferably SEQ ID NOs: 1,3,5,7,9,11,13,15, and 19
- R 2 is oriented so that its 5' end residue is at the left, bound to Ri, and its 3' end residue is at the right, bound to R 3 . Any stretch of nucleic acid residues denoted by either R group, where R is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer.
- the invention also relates to variants of the polynucleotides described herein that encode for variants of the polypeptides of the invention.
- Variants that are fragments of the polynucleotides of the invention can be used to synthesize full-length polynucleotides of the invention.
- Preferred embodiments are polynucleotides encoding polypeptide variants wherein 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues of a polypeptide sequence of the invention are substituted, added or deleted, in any combination. Particularly preferred are substitutions, additions, and deletions that are silent such that they do not alter the properties or activities of the polynucleotide or polypeptide.
- polynucleotide encoding a polypeptide of the invention and polynucleotides that are complementary to such polynucleotides. More preferable are polynucleotides that comprise a region that is at least 80% identical over its entire length to a polynucleotide encoding a polypeptide of the invention and polynucleotides that are complementary thereto.
- polynucleotides at least 90% identical over their entire length are particularly preferred, those at least 95% identical are especially preferred.
- those with at least 97% identity are highly preferred and those with at least 98% and 99% identity are particularly highly preferred, with those at least 99% being the most highly preferred.
- Preferred embodiments are polynucleotides that encode polypeptides that retain substantially the same biological function or activity as the mature polypeptides encoded by the polynucleotides set forth in the Sequence Listing.
- the invention further relates to polynucleotides that hybridize to the above- described sequences.
- the invention relates to polynucleotides that hybridize under stringent conditions to the above-described polynucleotides.
- stringent conditions and “stringent hybridization conditions” mean that hybridization will generally occur if there is at least 95% and preferably at least 97% identity between the sequences.
- An example of stringent hybridization conditions is overnight incubation at 42°C in a solution comprising 50% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 micrograms/milliliter denatured, sheared salmon sperm DNA, followed by washing the hybridization support in 0.1 x SSC at approximately 65 °C.
- Other hybridization and wash conditions are well known and are exemplified in Sambrook, et al, Molecular Cloning: A Laboratory Manual, Second Edition, cold Spring Harbor, NY (1989), particularly Chapter 11.
- the invention also provides a polynucleotide consisting essentially of a polynucleotide sequence obtainable by screening an appropriate library containing the complete gene for a polynucleotide sequence set for in the Sequence Listing under stringent hybridization conditions with a probe having the sequence of said polynucleotide sequence or a fragment thereof; and isolating said polynucleotide sequence. Fragments useful for obtaining such a polynucleotide include, for example, probes and primers as described herein.
- polynucleotides of the invention can be used as a hybridization probe for RNA, cDNA, or genomic DNA to isolate full length cDNAs or genomic clones encoding a polypeptide and to isolate cDNA or genomic clones of other genes that have a high sequence similarity to a polynucleotide set forth in the Sequence Listing.
- Such probes will generally comprise at least 15 bases.
- Preferably such probes will have at least 30 bases and can have at least 50 bases.
- Particularly preferred probes will have between 30 bases and 50 bases, inclusive.
- each gene that comprises or is comprised by a polynucleotide sequence set forth in the Sequence Listing may be isolated by screening using a DNA sequence provided in the Sequence Listing to synthesize an oligonucleotide probe.
- a labeled oligonucleotide having a sequence complementary to that of a gene of the invention is then used to screen a library of cDNA, genomic DNA or mRNA to identify members of the library which hybridize to the probe.
- synthetic oligonucleotides can be prepared which correspond to the wax synthase EST sequences.
- the oligonucleotides can be used as primers in polymerase chain reaction (PCR) techniques to obtain 5' and 3' terminal sequence of wax synthase genes.
- oligonucleotides of low degeneracy can be prepared from particular wax synthase peptides
- probes may be used directly to screen gene libraries for wax synthase gene sequences.
- screening of cDNA libraries in phage vectors is useful in such methods due to lower levels of background hybridization.
- a wax synthase sequence obtainable from the use of nucleic acid probes will show 60-70% sequence identity between the target wax synthase sequence and the encoding sequence used as a probe.
- lengthy sequences with as little as 50-60% sequence identity can also be obtained.
- the nucleic acid probes may be a lengthy fragment of the nucleic acid sequence, or may also be a shorter, oligonucleotide probe.
- longer nucleic acid fragments are employed as probes (greater than about 100 bp)
- one may screen at lower stringencies in order to obtain sequences from the target sample which have 20-50% deviation (i.e., 50-80% sequence homology) from the sequences used as probe.
- Oligonucleotide probes can be considerably shorter than the entire nucleic acid sequence encoding a wax synthas enzyme, but should be at least about 10, preferably at least about 15, and more preferably at least about 20 nucleotides. A higher degree of sequence identity is desired when shorter regions are used as opposed to longer regions. It may thus be desirable to identify regions of highly conserved amino acid sequence to design oligonucleotide probes for detecting and recovering other related wax synthase genes. Shorter probes are often particularly useful for polymerase chain reactions (PCR), especially when highly conserved sequences can be identified. (See, Gould, et al., PNAS USA (1989) 86:1934-1938.).
- PCR polymerase chain reactions
- polypeptides include isolated polypeptides set forth in the Sequence Listing, as well as polypeptides and fragments thereof, particularly those polypeptides which exhibit wax synthase activity and also those polypeptides which have at least 50%, 60% or 70% identity, preferably at least 80% identity, more preferably at least 90% identity, and most preferably at least 95% identity to a polypeptide sequence selected from the group of sequences set forth in the Sequence Listing, and also include portions of such polypeptides, wherein such portion of the polypeptide preferably includes at least 30 amino acids and more preferably includes at least 50 amino acids.
- Identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences.
- identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as determined by the match between strings of such sequences.
- Identity can be readily calculated by known methods including, but not limited to, those described in Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York (1988); Biocomputing: Informatics and
- Computer programs which can be used to determine identity between two sequences include, but are not limited to, GCG (Devereux, J., et al., Nucleic Acids Research 12(1):387 (1984); suite of five BLAST programs, three designed for nucleotide sequences queries (BLASTN, BLASTX, and TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology, 12: 76- 80 (1994); Birren, et al, Genome Analysis, 1: 543-559 (1997)).
- BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al, NCBI NLM NIH, Bethesda, MD 20894; Altschul, S., et al, J. Mol. BioL, 215:403-410 (1990)).
- the well known Smith Waterman algorithm can also be used to determine identity. Parameters for polypeptide sequence comparison typically include the following:
- Gap Penalty 12 Gap Length Penalty: 4
- Gap Length Penalty 3 A program which can be used with these parameters is publicly available as the
- the invention also includes polypeptides of the formula: wherein, at the amino terminus, X is hydrogen, and at the carboxyl terminus, Y is hydrogen or a metal, Ri and R 3 are any amino acid residue, n is an integer between 1 and 1000, and R is an amino acid sequence of the invention, particularly an amino acid sequence selected from the group set forth in the Sequence Listing and preferably SEQ ID NOs: 2,4, 6, 8, 10, 12, 14, and 16.
- R 2 is oriented so that its amino terminal residue is at the left, bound to R ⁇ , and its carboxy terminal residue is at the right, bound to R 3 . Any stretch of amino acid residues denoted by either R group, where R is greater than 1, may be either a heteropolymer or a homopolymer, preferably a heteropolymer.
- Polypeptides of the present invention include isolated polypeptides encoded by a polynucleotide comprising a sequence selected from the group of a sequence contained in the Sequence Listing set forth herein .
- polypeptides of the present invention can be mature protein or can be part of a fusion protein.
- a fragment is a variant polypeptide which has an amino acid sequence that is entirely the same as part but not all of the amino acid sequence of the previously described polypeptides.
- the fragments can be "free-standing" or comprised within a larger polypeptide of which the fragment forms a part or a region, most preferably as a single continuous region.
- Preferred fragments are biologically active fragments which are those fragments that mediate activities of the polypeptides of the invention, including those with similar activity or improved activity or with a decreased activity. Also included are those fragments that antigenic or immunogenic in an animal, particularly a human.
- Variants of the polypeptide also include polypeptides that vary from the sequences set forth in the Sequence Listing by conservative amino acid substitutions, substitution of a residue by another with like characteristics. In general, such substitutions are among Ala, Val, Leu and He; between Ser and Thr; between Asp and Glu; between Asn and Gin; between Lys and Arg; or between Phe and Tyr. Particularly preferred are variants in which 5 to 10; 1 to 5; 1 to 3 or one amino acid(s) are substituted, deleted, or added, in any combination.
- Variants that are fragments of the polypeptides of the invention can be used to produce the corresponding full length polypeptide by peptide synthesis. Therefore, these variants can be used as intermediates for producing the full-length polypeptides of the invention.
- polypeptides and polypeptides of the invention can be used, for example, in the transformation of host cells, such as plant host cells, as further discussed herein.
- the invention also provides polynucleotides that encode a polypeptide that is a mature protein plus additional amino or carboxyl-terminal amino acids, or amino acids within the mature polypeptide (for example, when the mature form of the protein has more than one polypeptide chain).
- Such sequences can, for example, play a role in the processing of a protein from a precursor to a mature form, allow protein transport, shorten or lengthen protein half-life, or facilitate manipulation of the protein in assays or production. It is contemplated that cellular enzymes can be used to remove any additional amino acids from the mature protein.
- a precursor protein, having the mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide.
- the inactive precursors generally are activated when the prosequences are removed. Some or all of the prosequences may be removed prior to activation.
- Such precursor protein are generally called proproteins.
- antibodies to the jojoba wax synthase can be prepared by injecting rabbits or mice with the purified protein. Methods of preparing antibodies are well known to those in the art, and companies which specialize in antibody production are also available. Either monoclonal or polyclonal antibodies can be produced, although typically polyclonal antibodies are more useful for gene isolation.
- genes encoding the related proteins can be isolated by screening expression libraries representing the desired plant species.
- Expression libraries can be constructed in a variety of commercially available vectors, including lambda gtl 1, as described in Maniatis, et al. (supra).
- the clones identified as described above using DNA hybridization or immunological screening techniques are then purified and the DNA isolated and analyzed using known techniques. In this manner, it is verified that the clones encode a related wax synthase protein.
- Other wax synthases may be obtained through the use of the "new" wax synthase in the same manner as the jojoba wax synthase was used.
- databases containing nucleic acid and amino acid sequences from various organisms may be searched with the sequences of the present invention to identify similar sequences.
- an approximately 12 Kb sequence containing at least seven repeats of an open reading frame with high similarity to the jojoba sequence are identified.
- the deduced amino acid sequences demonstrate a high level of homology to the jojoba wax synthase amino acid sequence.
- amino acid sequence comparisons between jojoba wax synthase and the sequences obtained from the Arabidopsis homologues reveals an identity ranging from about 36% to about 44% between the amino acids.
- wax synthase nucleic acid sequences of this invention may be modified using standard techniques of site specific mutation or PCR, or modification of the sequence may be accomplished in producing a synthetic nucleic acid sequence. These modified sequences are also considered wax synthase nucleic acid sequence of this invention. For example, wobble positions in codons may be changed such that the nucleic acid sequence encodes the same amino acid sequence, or alternatively, codons can be altered such that conservative amino acid substitutions result. In either case, the peptide or protein maintains the desired enzymatic activity and is thus considered part of the instant invention.
- a nucleic acid sequence of a wax synthase enzyme of this invention may be a DNA or RNA sequence, derived from genomic DNA, cDNA, mRNA, or may be synthesized in whole or in part.
- the gene sequences may be cloned, for example, by isolating genomic DNA from an appropriate source, and amplifying and cloning the sequence of interest using a polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the gene sequences may be synthesized, either completely or in part, especially where it is desirable to provide plant- preferred sequences.
- all or a portion of the desired structural gene may be synthesized using codons preferred by a selected host. Host-preferred codons may be determined, for example, from the codons used most frequently in the proteins expressed in a desired host species.
- the nucleic acid sequences associated with wax synthase proteins will find many uses. For example, recombinant constructs can be prepared which can be used as probes or will provide for expression of the wax synthase protein in host cells. Depending upon the intended use, the constructs may contain the sequence which encodes the entire wax synthase, or a portion thereof. For example, critical regions of the wax synthase, such as an active site may be identified. Further constructs containing only a portion of the wax synthase sequence which encodes the amino acids necessary for a desired wax synthase activity may thus be prepared.
- Useful systems for expression of the wax synthase sequences of this invention include prokaryotic cells, such as E. coli, yeast cells, and plant cells, both vascular and nonvascular plant cells being desired hosts.
- the wax synthase protein may be produced to allow further studies, such as site-specific mutagenesis of encoding sequences to analyze the effects of specific mutations on reactive properties of the wax synthase protein.
- the DNA sequence encoding a wax synthase of this invention may be combined with foreign DNA sequences in a variety of ways.
- “foreign" DNA sequences is meant any DNA sequence which is not naturally found joined to the wax synthase sequence, including DNA sequences from the same organism which are not naturally found joined to wax synthase sequences.
- sense and antisense constructs utilizing wax synthase encoding sequences are considered, wherein sense sequence may be used for expression of wax synthase in a host cell, and antisense sequences may be used to decrease the endogenous levels of a homologous wax synthase protein naturally produced by a target organism.
- the wax synthase gene sequences of this invention may be employed in a foreign host in conjunction with all or part of the sequences normally associated with the wax synthase, such as regulatory or membrane targeting sequences.
- a DNA sequence encoding wax synthase is combined in a recombinant construct having, in the 5' to 3' direction of transcription, a transcription initiation control region capable of promoting transcription and translation in a host cell, the nucleic acid sequence encoding wax synthase and a transcription termination region.
- the regulatory regions will vary, and may include regions from viral, plasmid or chromosomal genes, or the like.
- a wide variety of constitutive or regulatable promoters may be employed. Expression in a microorganism can provide a ready source of the plant enzyme.
- transcriptional initiation regions which have been described are regions from bacterial and yeast hosts, such as E. coli, B. subtilis, Sacchromyces cerevisiae, including genes such as beta-galactosidase, T7 polymerase, tryptophan E and the like.
- the recombinant constructs will involve regulatory regions functional in plants which provide for expression of the wax synthase gene to produce functional wax synthase protein.
- the open reading frame, coding for the plant wax synthase or a functional fragment thereof will be joined at its 5' end to a transcription initiation regulatory region such as the wild-type sequence naturally found 5' upstream to the wax synthase structural gene.
- Numerous other promoter regions from native plant genes are available which provide for a wide variety of constitutive or regulatable expression of structural gene sequences.
- sequences from native plant genes can provide for constitutive gene expression in plants, such as regulatory regions associated with Agrobacterium genes, including regions associated with nopaline synthase (Nos), mannopine synthase (Mas), or octopine synthase (Ocs) genes. Also useful are regions which control expression of viral genes, such as the 35S and 19S regions of cauliflower mosaic virus (CaMV).
- constitutive as used herein does not necessarily indicate that a gene is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types, although some variation in abundance is often detectable.
- Other useful transcriptional initiation regions preferentially provide for transcription in certain tissues or under certain growth conditions, such as those from napin, seed or leaf ACP, the small subunit of RUBISCO, and the like.
- the use of all or part of the complete plant wax synthase gene may be desired, namely the 5' upstream non-coding regions (promoter) together with the structural gene sequence and 3' downstream non-coding regions may be employed.
- a different promoter such as a promoter native to the plant host of interest or a modified promoter, i.e., having transcription initiation regions derived from one gene source and translation initiation regions derived from a different gene source or enhanced promoters, such as double 35S CaMV promoters, the sequences may be joined together using standard techniques.
- 5' untranslated regions from highly expressed plant genes may be useful to provide for increased expression of the wax synthase proteins described herein.
- the DNA constructs which provide for wax synthase expression in plants may be employed with a wide variety of plant life, particularly, plants which produce the fatty acyl-CoA substrates of the wax synthase enzyme, such as Brassica.
- plants which produce the fatty acyl-CoA substrates of the wax synthase enzyme such as Brassica.
- Other plants of interest produce desirable fatty acyl substrates, such as medium or long chain fatty acyl molecules, and include but are not limited to rapeseed (Canola varieties), sunflower, safflower, cotton, Cuphea, soybean, peanut, coconut and oil palms, and corn.
- rapeseed Canola varieties
- sunflower safflower
- cotton Cuphea
- soybean peanut, coconut and oil palms
- HEAR high erucic acid varieties of rapeseed Brassica
- HEAR plants includes the production of varieties containing substantially increased levels of erucic acid as the result of providing an additional wax "sink" for the erucic acid
- fatty alcohol substrate of the wax synthase enzyme other than jojoba
- seed plants are not known to produce large quantities of fatty alcohols, although small amounts of this substrate may be available to the wax synthase enzyme. Therefore, in conjunction with the wax synthase constructs of this invention, it is desirable to provide the target host cell with the capability to produce fatty alcohols from the fatty acyl molecules present in the host cells.
- a plant fatty acyl reductase and methods to provide for expression of the reductase enzymes in plant cells are described in USPN 5,370,996.
- the nucleic acid sequence and translated amino acid sequence of the jojoba reductase is provided in Figure 1 of that patent.
- wax esters may be produced from the fatty alcohol and fatty acyl substrates.
- expression of ⁇ -ketoacyl-CoA synthase in conjunction with expression of wax synthase and reductase proteins is considered in the present invention. In this manner, the production of very long chain fatty acid substrates of these enzymes may be increased in the target plant species.
- reductase enzymes from other organisms may be useful in conjunction with the wax synthases of this invention.
- Other potential sources of reductase enzymes include Euglena, Acinetobacter, Micrococus, certain insects and marine organisms, and specialized mammalian or avian tissues which are known to contain wax esters, such as bovine meibomian glands or ovian uropygial glands.
- Other potential sources of reductase proteins may be identified by their ability to produce fatty alcohols or, if wax synthase is also present, wax esters.
- the wax synthase and reductase sequences may be provided during the same transformation event, or alternatively, two different transgenic plant lines, one having wax synthase constructs and the other having reductase constructs may be produced by transformation with the various constructs. These plant lines may then be crossed using known plant breeding techniques to provide wax synthase and reductase containing plants for production of wax ester products.
- nucleic acid sequences encoding for enzymes involved in the formation of very long chain fatty acids may also find use in the DNA constructs of the present invention for the production of wax esters in a plant host.
- Such nucleic acid sequences are known in the art and are as described in U.S. Patent Number 5,679,881.
- the wax synthase of the present invention is used in plant expression constructs in conjunction with nucleic acid sequences encoding for a fatty acid elongase (described in USPN 5,679,881, the entirety of which is incorporated herein by reference) and an acyl-CoA reductase (described in USPN 5,403,918, the entirety of which is incorporated herein by reference).
- Such plant expression constructs provide for the production of wax esters in transgenic Arabidopsis thaliana plants.
- 5' upstream non-coding regions obtained from genes regulated during seed maturation are desired, especially those preferentially expressed in plant embryo tissue, such as regions derived from ACP, oleosin (Lee and Huang (1991) Plant Physiol 96: 1395-1397) and napin regulatory regions.
- Transcription initiation regions which provide for preferential expression in seed tissue, i.e., which are undetectable in other plant parts, are considered desirable for wax ester production in order to minimize any disruptive or adverse effects of the gene product in other plant parts.
- the seeds of such plants may be harvested and the lipid reserves of these seeds recovered to provide a ready source of wax esters.
- a novel seed product may be produced in oilseed plants which, absent transformation with wax synthase constructs as described herein, are not known to produce wax esters as a component of their seed lipid reserves.
- seed-specific promoters may be obtained and used in accordance with the teachings of USPN 5,420,034, and USPN 5,430,194.
- plant genes such as the jojoba reductase and wax synthases are expressed
- Transcription termination regions may be provided by the DNA sequence encoding the plant wax synthase or a convenient transcription termination region derived from a different gene source, especially the transcription termination region which is naturally associated with the transcription initiation region.
- the transcript termination region will contain at least about 0.5kb, preferably about l-3kb of sequence 3' to the structural gene from which the termination region is derived.
- promoter regions for example, RoplAt (Li, et al. (1998) Plant Phyiol. 118:407-417) and others described by Hamilton, et al. (1998) Plant Mol BioL 38(4)663-669 may be employed.
- promoter regions such as Ntltpl (Canevascini, et al. (1996) Plant Physiol. 112:513-524) may be employed.
- Additional plant gene regions may be used to optimize expression of wax synthase and reductase genes in plant tissues.
- 5 'untranslated regions of highly expressed genes such as that of the small subunit (SSU) of RuBP-carboxylase, inserted 5' to DNA encoding sequences may provide for enhanced translation efficiency.
- Portions of the SSU leader protein encoding region (such as that encoding the first 6 amino acids) may also be used in such constructs.
- transit peptide encoding sequences from SSU or other nuclear-encoded chloroplast proteins may be used in conjunction with wax synthase and reductase sequences.
- DNA expression constructs may be required.
- this invention is applicable to dicotyledons and monocotyledons species alike and will be readily applicable to new and/or improved transformation and regeneration techniques.
- the various components of the construct or fragments thereof will normally be inserted into a convenient cloning vector which is capable of replication in a bacterial host, e.g., E. coli. Numerous vectors exist that have been described in the literature.
- the plasmid may be isolated and subjected to further manipulation, such as restriction, insertion of new fragments, ligation, deletion, insertion, resection, etc., so as to tailor the components of the desired sequence.
- further manipulation such as restriction, insertion of new fragments, ligation, deletion, insertion, resection, etc., so as to tailor the components of the desired sequence.
- included with the recombinant construct will be a structural gene having the necessary regulatory regions for expression in a host and providing for selection of transformant cells.
- the gene may provide for resistance to a cytotoxic agent, e.g. antibiotic, heavy metal, toxin, etc., complementation providing prototrophy to an auxotrophic host, viral immunity or the like.
- genes encoding enzymes providing for production of a compound identifiable by color change, such as GUS, or luminescence, such as luciferase are useful.
- one or more markers may be employed, where different conditions for selection are used for the different hosts.
- the DNA constructs of this invention may also provide for expression of an additional gene or genes, whose protein product may act in conjunction with the wax synthase to produce a valuable end product.
- DNA constructs which provide for expression of wax synthase and a fatty acyl reductase so that wax esters may produced in transformed hosts are considered in this invention.
- the constructs may also provide for the expression of a third gene encoding, for example ⁇ -ketoacyl-CoA synthase (KCS).
- KCS ⁇ -ketoacyl-CoA synthase
- wax esters having varying carbon chain lengths and degrees of saturation is desired and may be provided by transforming host plants having fatty alcohol or fatty acyl substrates of varying chain lengths.
- Such plants may be provided, for example, by methods described in the published international patent application number PCT WO 91/16421, which describes various thioesterase genes and methods of using such genes to produce fatty acyl substrates having varying chain lengths in transformed plant hosts.
- wax esters in oilseed plant hosts may wish to decrease the production of the triacylglyceride oils that are normally produced in the seeds of such plants.
- One method to accomplish this is to antisense a gene critical to this process, but not necessary for the production of wax esters.
- gene targets include diacylglycerol acyltransferase, and other enzymes whichcatalyse the synthesis of triacylglycerol.
- an "exotic" fatty acid using a wax synthesis system derived from a source which accumulates wax esters which are composed of such fatty acids.
- a wax synthesis system derived from a source which accumulates wax esters which are composed of such fatty acids.
- the introduction of a wax synthesis system into oil producing plants may allow for a further increase in the amount of oil produced as a component of the host cell.
- a wax synthesis system in an oil producing plant tissue such as an oil seed
- it is possible to further increase the amount of oil produced in such a tissue by utilizing the native oil production, such as through triacylglycerol synthesis, and the introduced wax synthesis.
- the wax esters produced in the methods described herein may be harvested using techniques for wax extraction from jojoba or by various production methods used to obtain oil products from various oilseed crops.
- the waxes thus obtained will find application in many industries, including pharmaceuticals, cosmetics, detergents, plastics, food applications and lubricants. Applications will vary depending on the chain length and degree of saturation of the wax ester components. For example, long chain waxes having a double bond in each of the carbon chains are liquid at room temperature, whereas waxes having saturated carbon chain components, may be solid at room temperature, especially if the saturated carbon chains are longer carbon chains.
- the wax esters so produced can be used as a source for obtaining fatty alcohols for use in a variety of applications.
- Methods for the production of fatty alcohols from wax esters are known in the art, and are described for example by Duncan, et al (1974) J. Am. Oil Chem. Soc. 51(12):534-536.
- Fatty alcohols find use in a variety of applications known to the skilled artisan, and include but are not limited to detergents, lubricants, corrosion inhibition, plasticiers, cosmetics, emulsifiers, and for use in pharmaceutical compositions.
- the fatty alcohols produced can be saturated or unsaturated, and preferably include short chain fatty alcohols, medium chain fatty alcohols and long chain fatty alcohols, most preferred are medium and long chain fatty alcohols, most especially preferred are long chain fatty alcohols.
- transgenic plants which produce wax esters in the epidermal cell layer provides for enhanced tolerance to various environmental stresses, such as drought tolerance, as well as pathogen and insect tolerances.
- drought tolerance as well as pathogen and insect tolerances.
- pathogen and insect tolerances Such roles for epicuticular waxes are known in the art, and are reviewed, for example, by Post-
- the method of transformation is not critical to the instant invention; various methods of plant transformation are currently available. As newer methods are available to transform crops, they may be directly applied hereunder. For example, many plant species naturally susceptible to Agrobacterium infection may be successfully transformed via tripartite or binary vector methods of Agrobacterium mediated transformation. Other sequences useful in providing for transfer of nucleic acid sequences to host plant cells may be derived from plant pathogenic viruses or plant transposable elements. In addition, techniques of microinjection, DNA particle bombardment, electroporation have been developed which allow for the transformation of various monocot and dicot plant species.
- the substrate generally used in the wax synthase assays [l- 14 C]palmitoyl-CoA, is purchased from Amersham (Arlington Heights, IL). Other chain length substrates were synthesized in order to perform chain length specification studies.
- Long chain [1- 1 C] fatty acids (specific activity 51-56 Ci/mole), namely 11-cis-eicosenoic acid, 13-cis- docosenoic acid and 15-cis-tetracosenoic acid are prepared by the reaction of potassium [ 14 C]cyanide with the corresponding alcohol mesylate, followed by the base hydrolysis of the alcohol nitrile to the free fatty acid.
- the free fatty acids are converted to their methyl esters with ethereal diazomethane, and purified by preparative silver nitrate thin layer chromatography (TLC).
- TLC thin layer chromatography
- the fatty acid methyl esters are hydrolyzed back to the free fatty acids.
- Radiochemical purity is assessed by three TLC methods: normal phase silica TLC, silver nitrate TLC, and C18 reversed phase TLC. Radiochemical purity as measured by these methods was 92-98%.
- Long chain [1- 1 C] acyl-CoAs are prepared from the corresponding [1- 14 C] free fatty acids by the method of Young andLynen (J. Bio. Chem. (1969) 244:377), to a specific activity of lOCi/mole.
- [l- 14 C]hexadecanal is prepared by the dichromate oxidation of [l- 14 C]hexadecan-l-ol, according to a micro-scale modification of the method of Pletcher and Tate (Jet. Lett. (1978) 1601-1602). The product is purified by preparative silica TLC, and stored as a hexane solution at -70°C until use.
- B. Assay for Wax synthase Activity in a Microsomal Membrane Preparation Wax synthase activity in a microsomal membrane preparation is measured by incubation of 40 ⁇ M [l- 14 C]acyl-CoA (usually palmitoyl-CoA, sp. act.
- the incubation mixture also contains either 25 mM HEPES (4-[2-hydroxyethyl]-l- piperazineethane-sulfonic acid), pH 7.5, as the buffering agent with 20% w/v glycerol, lmM DTT, 0.5M NaCl or 25 mM Tricine-NaOH, pH 7.8, as the buffering agent with 0.28M NaCl, 10% glycerol, and 2mM ⁇ -mercaptoethanol.
- a substrate mixture is prepared in a glass vial, with oleyl alcohol being added immediately before use, and is added to samples. Incubation is carried out at 30°C for up to one hour.
- the assay is terminated by placing the assay tube on ice and immediately adding 0.25ml isopropanol: acetic acid (4: 1 v/v). Unlabeled wax esters (O.lmg) and oleyl alcohol (O.lmg) are added as carriers.
- the [ 14 C] lipids are extracted by the scaled-down protocol of Hara and Radin (Anal. Biochem. (1978) 90:420). Two ml of hexane/isopropanol (3:2, v/v) is added to the terminated assay.
- the sample is vortexed, lml of aqueous sodium sulphate solution (6.6% w/v) is added, and the sample is again vortexed.
- Solubilized wax synthase is assayed using up to 50 ⁇ l sample in a 250 ⁇ l assay that contains 40 ⁇ M 1- 14 C-16:0 CoA (5 Ci/mol), 200 ⁇ M 18: l-OH, 0.07% soybean phospholipid (Sigma, P-3644), 0.2 %CHAPS, 280 mM NaCl, 25 mM Tricine-NaOH, pH 7.8, 2mM ⁇ -ME and 5.6% glycerol.
- Phospholipid 50mg/ml in 0.5% CHAPS is added directly to the sample, which is in 1% CHAPS, then diluted by a cocktail containing the remaining assay components.
- Wax synthase is sensitive to detergent and requires the amount of phospholipid (PL) and detergent (CHAPS) to be balanced at 2.8/1 (CHAPS/PL, w/w) in the assay for maximal activity.
- Assays for wax synthase activity in samples concentrated by ultra- filtration require a readjustment of the sample volume assayed because of the concentration of CHAPS. Introducing too much CHAPS into the assay results in inhibition of activity.
- the optimum volume of sample to be assayed may be reestablished by performing a concentration curve of %CHAPS in the assay using a small amount of sample and assaying at a fixed concentration of phospholipid and sodium chloride. Wax synthase is less sensitive to changes in PL concentration than it is to changes in CHAPS concentration.
- the sample is applied to a silica TLC plate, and the plate is developed in hexane/diethyl ether/acetic acid (80:20: 1 or 70:30:2 v/v/v).
- the distribution of radioactivity between the lipid classes is measured using an AMBIS radioanalytic imaging system (AMBIS Systems Inc., San Diego, CA). If necessary the individual lipid classes can be recovered from the TLC plate for further analysis. Reversed-phase TLC systems using C18 plates developed in methanol have also been used for the analysis.
- Embryo development was tracked over two summers on five plants in Davis, CA. Embryo fresh and dry weights were found to increase at a fairly steady rate from about day 80 to about day 130. Lipid extractions reveal that when the embryo fresh weight reaches about 300mg (about day 80), the ratio of lipid weight to dry weight reaches the maximum level of 50%.
- Wax synthase activity was measured in developing embryos as described in Example IB. As the jojoba seed coats were determined to be the source of an inhibiting factor(s), the seed coats were removed prior to freezing the embryos in liquid nitrogen for storage at -70°C.
- Jojoba embryos are harvested at approximately 90-110 days after flowering, as estimated by measuring water content of the embryos (45-70%). The outer shells and seed coats are removed and the cotyledons quickly frozen in liquid nitrogen and stored at -70°C for future use. For initial protein preparation, frozen embryos are powdered by pounding in a steel mortar and pestle at liquid nitrogen temperature. In a typical experiment, 70g of embryos are processed.
- the powder is added, at a ratio of 280ml of solution per 70g of embryos, to the following high salt solution: 3M NaCl, 0.3M sucrose, lOOmM HEPES, 2mM DTT, and the protease inhibitors, lmM EDTA, 0.7mg/ml leupeptin, 0.5mg/ml pepstatin and 17mg/ml PMSF.
- a cell free homogenate (CFH) is formed by dispersing the powdered embryos in the buffer with a tissue homogenizer (Kinematica, Switzerland; model
- the resulting sample consists of a pellet, supernatant and a floating fat pad.
- the fat pad is removed and the supernatant fraction is collected and dialyzed overnight (with three changes of the buffering solution) versus a solution containing IM NaCl, lOOmM
- HEPES HEPES, 2mM DTT and 0.5M EDTA.
- the dialyzate is centrifuged at 200,000 x g for 1 1/2 hour to yield a pellet, DP2.
- the pellet is suspended in 25mM HEPES and 10% glycerol, at 1/20 of the original CFH volume, to yield the microsomal membrane preparation.
- acyl-CoA's would not dissolve in the buffer.
- Alcohols were prepared as 25 mM stocks in 2-methoxyethanol and 0.4 ⁇ l of the stock was used in a 250 ⁇ l assay.
- l- 14 C-hexadecanol (10.3 mCi/mmol, Sigma 31,326-2) was used as substrate.
- the purchased 1- 14 C- hexadecanol was only 62% pure and had to be further purified by thin layer chromatography prior to use.
- the product was spotted onto a glass silica gel TLC plate and migrated in hexane:diethyl ethe ⁇ acetic acid (70:30:2).
- Unlabeled alcohol was spotted in outside lanes and used to identify the migration level of the radiolabeled product.
- the TLC plate was briefly exposed to iodine vapors to identify the location of the alcohol.
- the l- 14 C-hexadecanol spot was scraped from the TLC plate and transferred to a new vial.
- the product was eluted from the silica with hexane/isopropanol and the organic extract was filtered to remove silica.
- the filtered solvent was transferred to a new vial where the solvent was evaporated to dryness.
- the final product was resuspended in 2- methoxyethanol at a concentration of 0.15 ⁇ Ci/ ⁇ l.
- the final product appeared to be 100% pure by TLC in the solvent system above.
- the l- 14 C-16:0-CoA was as described in Example 1. Results of these experiments are presented in Table 1 below.
- Example 3 Purification of Jojoba Wax Synthase Methods are described which may be used for isolation of a jojoba membrane preparation having wax synthase activity, solubilization of wax synthase activity, and further purification of the wax synthase protein.
- Example 2 The following modification of the method described in Example 2 is employed and provides an improved membrane fraction useful for purification of wax synthase from solubilized membranes.
- jojoba embryos are added to 400 ml of extraction buffer (40 mM Tricine-NaOH, pH 7.8, 200 mM KC1, 10 mM EDTA, 5 mM ⁇ -mercaptoethanol), ground in a blender, and homogenized with a Polytron tissue disrupter. All subsequent steps are performed at 4°C. The blended material is filtered through Miracloth
- This homogenate is distributed into four SW28 centrifuge tubes (Beckman) and each is overlaid with 10 ml Buffer A containing 20% sucrose and then with 13 ml Buffer A. After centrifugation (28,000 rpm; 2 h), a membrane fraction is collected from the 20%/50% sucrose interface, diluted with four volumes Buffer A and collected by centrifugation (200,000 x g; 1 h). The membranes are then homogenized in 10 ml storage buffer [25 mM Tricine-NaOH, pH 7.8, 1 M NaCl, 10% (w/v) glycerol, 5 mM ⁇ -mercaptoethanol)]. The protein concentration of membranes prepared via this protocol is typically between 7 and 9 mg/ml. Protein concentrations are estimated as described (Bradford, 1976) using BSA as the protein standard.
- Protocol l Two purification protocols were used for band identification and further purification of the wax synthase protein.
- Protocol l the Blue Pool was concentrated 5.4 fold by ultrafiltration in a pressure cell fitted with a YM 30 membrane (Amicon, Inc., Beverly, MA).
- One-half of the concentrate was applied to a Ceramic Hydroxyapatite (CHT) column (Bio-Scale CHT-2; Bio-Rad, Hercules, CA) equilibrated in buffer B containing 2M NaCl.
- CHT Ceramic Hydroxyapatite
- the column was washed with 6 column volumes of equilibration buffer and bound proteins were eluted with buffer B containing 0.1M dipotassium phosphate and 2M NaCl.
- the SI 00 pool (fractions 64-70) was applied to a crystalline hydroxylapatite (HA) column (Bio-Gel HT; Bio-Rad, Hercules, CA, 1 x 19.3cm) equilibrated in buffer B with 1 M NaCl. Again, the majority of the wax synthase activity was present in the flow through and wash. Bound proteins were eluted in buffer B with 0.1M dipotassium phosphate, and IM NaCl. Fractions from the final HA run were examined by SDS-PAGE. A single protein migrating at 33 kD on SDS-PAGE was correlated with the presence of wax synthase activity.
- HA crystalline hydroxylapatite
- a chart representing the purification of wax synthase from Protocol 1 shows a 150 fold purification of the enzyme from the solubilized protein fraction.
- Table 2 Purification of Jojoba Wax Synthase
- Step Activity % (mg) Activity (fold) (nmol/min) (nmol/min/mg)
- the stacking gel contained 5% of a 30% acrylamide stock (29.2% acrylamide, 0.8% N,N'-bis-methyleneacrylamide, w/v), 0.06% ammonium persulfate (w/v) and 0.1% TEMED (v/v).
- the resolving gel contained a 10- 13% linear gradient of acrylamide stock stabilized by a 0-10% linear gradient of sucrose. Electrophoresis was carried out at room temperature at 150V, constant voltage, for 9-10 hours. Proteins were visualized by staining with silver according to the method of Blum et al.
- Odd numbered fractions from the flow through/wash of the final HA column were pooled and concentrated three fold by ultrafiltration in a pressure cell fitted with a YM 30 membrane (Amicon, Inc., Beverly, MA). The sample was further concentrated using two Centricon-30 units (Amicon, Inc., Beverly, MA) to volumes of approximately 50 ⁇ l. Each sample was treated with 6 ⁇ l SDS Cocktail (4 ⁇ l 20%SDS, l ⁇ l 14.3M ⁇ -metcaptoethanol, and l ⁇ l 0.1% Bromophenol Blue).
- the destain solution was removed and the gel slices were frozen in liquid nitrogen and sent on dry ice, overnight, to the W M Keck Foundation Biotechnology Resource Laboratory at Yale University for in-gel-digestion.
- One gel slice from the sample concentrated by ultrafiltration and three gel slices from the samples concentrated by precipitation were pooled for in-gel tryptic digestion.
- Protein sequencing was performed at the W.M. Keck Foundation Biotechnology Resource Laboratory, Yale University. Procedures include amino acid analysis of a portion (10-15%) of the gel slice for quantitation and amino acid composition, digestion of the protein with one of the proteolytic enzymes (trypsin or lysyl endopeptidase), and fractionation of the products by reverse phase HPLC. Absorbance peaks are selected from the HPLC run and subjected to laser desorption mass spectrometry to determine the presence, amount, and mass of the peptide prior to protein sequencing. The longest peptides are selected for microsequencing.
- proteolytic enzymes trypsin or lysyl endopeptidase
- Example 6 Purification of Additional Wax Synthases and Reductases
- Acinetobacter Cells of Acinetobacter calcoaceticus strain BD413 (ATCC #33305) are grown on ECLB (E. coli luria broth), collected during the logarithmic growth phase and washed in a buffer containing either HEPES-NaOH, pH 7.5, or Tricine-NaOH pH 7.8, in 0.1M NaCl, ImM DTT and protease inhibitors. Washed cells were resuspended in fresh buffer and ruptured by passage through a French pressure cell (two passes at ⁇ 16,000p.s.i.).
- Unbroken cells are removed by centrifugation at 5000 x g for 10 minutes, and membranes are collected by centrifugation at 100,000 x g for 1 hour.
- the membrane pellet is homogenized in storage buffer (25mM HEPES-NaOH, pH 7.5, or 25mM Tricine-NaOH, pH 7.8, in 10% (w/v) glycerol, lOOmM NaCl). Wax synthase activity is detected in these membranes using assay conditions described for the jojoba enzyme in Example IB, using [1- 14 C] palmitoyl-CoA and 18: 1 alcohol as the substrates.
- Wax synthase activity is solubilized by incubation of the membranes with 2% CHAPS in the presence of 0.5M NaCl, at a detergent to protein ratio of 5: 1. Solubilization of the activity is demonstrated by the detection of wax synthase enzyme activity in the supernatant fraction after centrifugation at 200,000g for 1 hour and by size exclusion chromatography (i.e. the activity elutes from the column in the retained fractions as a symmetrical peak). The activity of the solubilized enzyme is detected by simple dilution of the CHAPS concentration to -0.3% (i.e. to below its CMC). Incorporation of the enzyme into phospholipid vesicles is not required to detect solubilized activity.
- the solubilized Acinetobacter wax synthase activity is subjected to chromatographic procedures similar to those described for the jojoba wax synthase.
- the soluble protein preparation is loaded to a Blue A agarose column under low salt conditions (100 mM NaCl in a column buffer containing 0.75% % CHAPS, 10% glycerol, 25 mM HEPES-NaOH, pH 7.5) and eluted from the column using 1.0M NaCl in the column buffer.
- Size exclusion chromatography on Superose 12 (Pharmacia; Piscataway, NJ) medium is used to obtain an estimate of the size of the native enzyme. Comparison to molecular mass standards chromatographed under identical conditions yields an apparent mass of -40 kDa for the solubilized wax synthase.
- solubilized protein is loaded onto a Blue A column equilibrated with 25 mM Tricine-NaOH, pH 7.8, 1% CHAPS, 20% glycerol containing 0.1M NaCl and eluted in the same buffer containing 1.0M NaCl.
- the eluted material is then loaded onto a hydroxyapatite column equilibrated with column buffer containing 1.0 M NaCl and unlike the jojoba wax synthase, the acinetobacter wax synthase activity binds the column and is eluted in a gradient of 1-100 mM dipotassium phosphate.
- SDS-PAGE SDS-PAGE
- several protein candidates can be correlated with wax synthase activity.
- Euglena gracilis, strain Z (ATCC No. 12716) is grown heterotrophically in the dark (Tani et al. (1987) Agric. BioL Chem. 57:225-230) at ⁇ 26°C with moderate shaking. Cells are collected and washed in buffer containing 25mM Bis-Tris-Propane, pH 7.0, 0.25M NaCl and ImM EDTA. Washed cells are resuspended in fresh buffer and ruptured by passage through a French pressure cell (two passes at ⁇ 16,000 p.s.i.).
- Unbroken cells, cell debris and nuclei are removed by centrifugation at 20,000 x g for 20 minutes, and microsomal membranes are collected by centrifugation at 200,000 x g for 1 hour.
- the membrane pellet is homogenized in storage buffer (25mM Bis-Tris-Propane, pH 7.0, 0.25M NaCl, 10% (w/v) glycerol and ImM EDTA ). Wax synthase activity is detected in these membranes using assay conditions as described for the jojoba enzyme.
- the radiolabelled substrate is the same as for the jojoba example (i.e.
- the Euglena wax synthase activity is solubilized by incubation of the membranes with 2% CHAPS in the presence of 0.5M NaCl. Solubilization of the protein is demonstrated by the detection of enzyme activity in the supernatant fraction after centrifugation at 200,000 x g for 1 hour. The activity of the solubilized enzyme is detected by dilution of the CHAPS concentration to -0.3% (i.e. to below its CMC). It is not necessary to incorporate the enzyme into phospholipid vesicles as was the case for the solubilized jojoba wax synthase.
- the solubilized Euglena wax synthase activity is subjected to chromatographic separation on Blue A agarose medium.
- the column is equilibrated with 0.1M NaCl in a column buffer containing; 25mM Bis-Tris-Propane, pH 7.0, 20% (w/v) glycerol, 0.75% CHAPS and ImM EDTA.
- the sample containing solubilized wax synthase activity is diluted to O.lM NaCl and loaded onto a 1 x 7cm column (5.5ml bed volume).
- the column is washed with equilibration buffer and subjected to a linear NaCl gradient (O.IM to 1.0M NaCl) in column buffer.
- Wax synthase activity is eluted as a broad peak in the last half of the salt gradient.
- wax synthase activity in Euglena size exclusion chromatography was conducted as follows.
- a microsomal membrane preparation was obtained from Euglena cells grown on liquid, heterotrophic, medium (Tani et al, supra) in the dark.
- Wax synthase activity was solubilized by treating the membranes with 2% (w/v) CHAPS and 500mM NaCl in a buffered solution (25mM Bis-Tris, pH 7.0, ImM EDTA and 10% (w/v) glycerol) for 1 hour on ice.
- a buffered solution 25mM Bis-Tris, pH 7.0, ImM EDTA and 10% (w/v) glycerol
- the fractions from the Blue A column containing wax synthase activity released by the 1.5MNaCl were pooled and concentrated approximately 30-fold via ultrafiltration (Amicon pressure cell fitted with a YM 30 membrane).
- the concentrated material from the Blue A column was used as the sample for a separation via size exclusion chromatography on Superose 12 medium (Pharmacia).
- the wax synthase polypeptide may be present as a minor component in the sample mixture that is not readily detectable on the silver-stained gel.
- the enzyme may be composed of subunits which are dissociated during SDS-PAGE.
- DNA sequences encoding wax synthase peptides are obtained from jojoba using synthetic oligonucleotides designed from wax synthase peptide sequences.
- the wax synthase nucleic acid sequences may be obtained by amplification of DNA by polymerase chain reaction (PCR) using oligonucleotides as primers, or alternatively, by screening a cDNA or genomic DNA library by radiolabeling the oligonucleotides or previously isolated sequences for use as probes.
- PCR polymerase chain reaction
- RNA may be isolated using the methods described by Cathala, et al. (1983) EWA, 3:329-335. RNA is isolated from jojoba embryos collected at 80-90 days post-anthesis using a polyribosome isolation method, initially described by Jackson and Larkins (Plant Physiol. (1976) 57:5-10), as modified by Goldberg et al. (Developmental BioL (1981) 53:201-217). In this procedure all steps, unless specifically stated, are carried out at 4°C. lOgm of tissue are ground in liquid nitrogen in a Waring blender until the tissue becomes a fine powder.
- extraction buffer 200mM Tris pH 9.0, 160mM KCl, 25mM ⁇ GTA, 70mM MgC12, 1% Triton X-100, 05% sodium deoxycholate, ImM spermidine, lOmM ⁇ -mercaptoethanol, and 500mM sucrose
- extraction buffer 200mM Tris pH 9.0, 160mM KCl, 25mM ⁇ GTA, 70mM MgC12, 1% Triton X-100, 05% sodium deoxycholate, ImM spermidine, lOmM ⁇ -mercaptoethanol, and 500mM sucrose
- the supernatant is decanted into a 500ml sterile flask, and 1/19 volume of a 20% detergent solution (20% Brij 35, 20% Tween 40, 20% Noidet p-40 w/v) is added at room temperature. The solution is stirred at 4°C for 30 minutes at a moderate speed and the supernatant is then centrifuged at 12,000 x g for 30 minutes.
- a 20% detergent solution (20% Brij 35, 20% Tween 40, 20% Noidet p-40 w/v
- resuspension buffer 40mM Tris pH 9.0, 5mM ⁇ GTA, 200mM KCl, 30mM MgCl 2 , 5mM ⁇ -mercaptoethanol
- the tubes are placed on ice for 10 minutes, after which the pellets are thoroughly resuspended and pooled. The supernatant is then centrifuged at 120 x g for 10 minutes to remove insoluble material.
- RNA is precipitated by adding 1/10 volume of sodium acetate and 2 volumes of ethanol. After several hours at -20°C RNA is pelleted by centrifugation at 12,000 x g at 4°C for 30 minutes. The pellet is resuspended in 10ml of T ⁇ buffer (lOmM Tris, ImM ⁇ DTA) and extracted with an equal volume of Tris pH 7.5 saturated phenol. The phases are separated by centrifuging at 10,000 x g for 20 minutes at 4°C. The aqueous phase is removed and the organic phase is re-extracted with one volume of TE buffer. The aqueous phases are then pooled and extracted with one volume of chloroform.
- T ⁇ buffer laOmM Tris, ImM ⁇ DTA
- the phases are again separated by centrifugation and the aqueous phase ethanol precipitated as previously described, to yield the polyribosomal RNA.
- Polysaccharide contaminants in the polyribosomal RNA preparation are removed by running the RNA over a cellulose column (Sigma-cell 50) in high salt buffer (0.5M NaCl, 20mM Tris pH 7.5, ImM EDTA, 0.1% SDS). The contaminant binds to the column and the RNA is collected in the eluant. The eluant fractions are pooled and the RNA is ethanol precipitated. The precipitated total RNA is then resuspended in a smaller volume and applied to an oligo d(T) cellulose column to isolate the polyadenylated RNA.
- Polyadenylated RNA is used to construct a cDNA library in the plasmid cloning vector pCGN1703, derived from the commercial cloning vector Bluescribe Ml 3- (Stratagene Cloning Systems; San Diego, CA), and made as follows.
- the polylinker of Bluescribe Ml 3- is altered by digestion withTf ⁇ mHI, treatment with mung bean endonuc lease, and blunt-end ligation to create a ZJ ⁇ raHI-deleted plasmid, pCGN1700.
- pCGN1700 is digested with EcoRI and Sstl (adjacent restriction sites) and annealed with a synthetic linker having restriction sites for BamRI, Pstl, Xbal, Apal and Smal, a 5' overhang of AATT, and a 3' overhang of TCGA.
- the insertion of the linker into pCGN1700 eliminates the EcoRI site, recreates the Sstl (also, sometimes referred to as "Sad” herein) site found in Bluescribe, and adds the new restriction sites contained on the linker.
- the resulting plasmid pCGN1702 is digested with H dffl and blunt-ended with Klenow enzyme; the linear DNA is partially digested withPvwII and ligated with T4 DNA wax synthase in dilute solution.
- a transformant having the lac promoter region deleted is selected (pCGN1703) and is used as the plasmid cloning vector.
- the cloning method for cDNA synthesis is as follows.
- the plasmid cloning vector is digested with Sstl and homopolymer T-tails are generated on the resulting 3'- overhang stick-ends using terminal deoxynucleotidyl transferase.
- the tailed plasmid is separated from undigested or un-tailed plasmid by oligo(dA)-cellulose chromatography.
- the resultant vector serves as the primer for synthesis of cDNA first strands covalently attached to either end of the vector plasmid.
- the cDNA-mRNA- vector complexes are treated with terminal transferase in the presence of deoxyguanosine triphosphate, generating G-tails at the ends of the cDNA strands.
- the extra cDNA-mRNA complex, adjacent to the BamR ⁇ site, is removed by BamTTl digestion, leaving a cDNA-mRNA- vector complex with a BamUI stick-end at one end and a G-tail at the other.
- This complex is cyclized using an annealed synthetic cyclizing linker which has a 5' JS ⁇ mHI sticky-end, recognition sequences for restriction enzymes Notl, EcoRI and Sstl, and a 3' C-tail end.
- the circular complexes are transformed into E. coli strain DH5a (BRL, Gaithersburg, MD) to generate the cD ⁇ A library.
- the jojoba embryo cD ⁇ A bank contains between approximately 1.5xl0 6 clones with an average cD ⁇ A insert size of approximately 500 base pairs.
- jojoba polyadenylated R ⁇ A is also used to construct a cD ⁇ A library in the cloning vector lZAPII/EcoRI (Stratagene, San Diego, CA).
- the library is constructed using protocols, D ⁇ A and bacterial strains as supplied by the manufacturer. Clones are packaged using Gigapack Gold packaging extracts (Stratagene), also according to manufacturer's recommendations.
- the cD ⁇ A library constructed in this manner contains approximately 1 x 10 6 clones with an average cD ⁇ A insert size of approximately 400 base pairs.
- oligonucleotides containing the sense orientation sequence corresponding to wax synthase peptide encoding sequences are prepared. These oligonucleotides are used as primers for the "forward" amplification reaction to produce sense strand D ⁇ A.
- an oligonucleotide may be designed to be identical to a portion of a primer used to prepare D ⁇ A template for PCR.
- oligonucleotides which contain sequence complementary to wax synthase peptide encoding sequences may be used in combination with a "forward" wax synthase oligonucleotide primer as described above.
- the forward or reverse primers may be "degenerate" oligonucleotides, i.e. containing a mixture of all or some of the possible encoding sequences for a particular peptide region. To reduce the number of different oligonucleotides present in such a mixture, it is preferable to select peptide regions which have the least number of possible encoding sequences when preparing the synthetic oligonucleotide for PCR primers. Similarly, where the synthetic oligonucleotide is to be used to directly screen a library for wax synthase sequences, lower degeneracy oligonucleotides are preferred.
- oligonucleotide names reflect the particular wax synthase peptide fragment numbers as listed in Example 5.
- the letter “F” in the oligonucleotide name designates a PCR forward reaction primer.
- the letter “R” designates a PCR reverse reaction primer.
- nucleotide base codes for the above oligonucleotides are as follows:
- Y cytosine or thymine
- H adenine, cytosine or thymine
- N adenine, cytosine, guanine or thymine
- W adenine or thymine
- K guanine or thymine
- M adenine or cytosine
- RNA is isolated from total RNA prepared from jojoba tissue as described above.
- cDNA is prepared from poly(A)+ or total RNA by reverse transcription using the Marathon cDNA Amplification Kit (Clontech Laboraties Inc according to the manufacturer's directions.
- the jojoba cDNA is used in PCR reactions 1-16 set forth below. PCR is conducted in a Perkin Elmer Cetus GeneAmp PCR System 9600 PCR machine using reverse transcribed single-stranded cDNA as template. Commercially available PCR reaction and optimization reagents are used according to manufacturer's specifications
- the temperature program used for PCR amplification is as follows: 1 cycle of 95 degrees C for 2 minutes; 4 cycles of 95 degrees C for 30 seconds, 60 degrees C for 1 minute, and 72 degrees C for 4 minutes; 4 cycles of 95 degrees C for 30 seconds, 57 degrees C for 1 minute, and 72 degrees C for 4 minutes; 4 cycles of 95 degrees C for 30 seconds, 54 degrees C for 1 minute, and 72 degrees C for 4 minutes; 4 cycles of 95 degrees C for 30 seconds, 51 degrees C for 1 minute, and 72 degrees C for 4 minutes; and 25 cycles of 95 degrees C for 30 seconds, 48 degrees C for 1 minute, and 72 degrees C for 4 minutes.
- PCR product approximately 700 nucleotides in length was detected.
- the PCR product was purified using gel electrophoresis and cloned into pCR2.1 using a Topo TA cloning kit (Invitrogen Corp.). The DNA sequence of the cloned PCR product was determined and was 708 nucleotides long SEQ ID NO: 17.
- the entire cDNA can be amplified using 5' and 3' RACE (Frohman et al., 1988) using the Marathon cDNA Amplification Kit (Clontech Laboraties Inc.) according to the manufacturers instructions. From the sequence of the 708 nucleotide PCR fragment derived using primers WSPEP14-F1 and WSPEP33-R2 the following primers were synthesized:
- 3'RACE reactions were set up using parimers WSRACEF l,WSRACEF2,and WSRACEF3.
- 5'RACE reactions were set up using parimers WSRACERl,WSRACER2,and WSRACER3.
- PCR reactions were performed according to the manufacturer's protocol (Clontech Laboraties Inc.). All 6 PCR reactions gave visible PCR products ranging in size from approximately 700 nucleotides to 1000 nucleotides. The PCR products were gel purified and cloned into pCR2.1 according to the manufacturer's protocol (Invitrogen Corp.).
- the DNA sequence of several clones from both the 5' and 3' RACE reactions and the previous PCR product derived from primers WSPEP14-F1 and WSPEP33-R2 were assembled using Sequencher software (Gene Codes Corp.).
- the assembled sequence of all the PCR products contains the coding region of the cDNA sequence.
- the coding region of the gene can be amplified from cDNA using the primers WAXSYNFOR and WASXYNREV.
- the sequence of WAXSYNFOR is GGATCCGTCGACACAATGGAGGTGGAGAAGGAGCTAAAG (SEQ ID NO:44), and the sequence of WASXYNREV is
- GCATGCAGATCTCACCACCCCAACAAACCCATC (SEQ ID NO:45).
- the PCR reaction is performed using the Marathon CDNA (Clontech Laboraties Inc.) according to the manufacturer's instructions.
- the PCR program consists of 30 cycles of 94 degrees C for 15 seconds, 60 degrees Cfor 1 minute, 72 degrees C for 2 minutes.
- the PCR products were cloned into pCR2.1 according to the manufacturers protocol (Invitrogen Corp.).
- the resulting plasmid was designated pCGN8538.
- the nucleic acid sequence and the derived amino acid sequence of the jojoba wax synthase is determine and provided in SEQ ID NO: l and SEQ ID NO:2, respectively.
- Plasmid pCGN8559 contains 3 genes necessary for wax biosynthesis: the condensing enzyme involved in fatty acid elongation to chain lengths greater than 18 carbons (KCS), the acyl-CoA reductase involved in formation of fatty alcohols, and the wax synthase.
- a control plasmid, pCGN8557, contains the KCS and acyl-CoA reductase genes.
- the Asp718 fragment of pCGN7698 which contains the jojoba acyl-CoA reductase under control of napin regulatory sequences, was cloned into the Asp718 site of binary vector pCGN5139 to form pCGN8555.
- the Notl fragment of pCGN7844 which contains the Lunaria KCS under control of napin regulatory sequences, was cloned into the Notl site of pCGN8555 to form pCGN 8557.
- the binary vectors were introduced into Agrobacterium tumefaciens EHA105 via electroporation. The vectors were used to transform Arabidopsis thaliana ecotype No-O according to the vacuum infiltration protocol of Bent et al. (1994, Science 265: 1856- 1860).
- Example 9 Analysis of Developing Arabidopsis Seed Siliques were harvested from seven Arabidopsis plants transformed with pCGN8559 which were in various stages of development. Developing seed was removed from ten siliques collected from each plant and homogenized in 275 ⁇ l of buffer (100 mM HEPES/NaOH pH 7.5, 250 mM NaCl). A portion of the homogenate (200 ⁇ l) was centrifuged at 16000 x g for 20 minutes at 4°C resulting in a supernatant and pellet. The pellet was resuspended in 200 ⁇ l of the same buffer. The homogenate and the two fractions were assayed for wax synthase activity according to the protocol detailed in Example IB.
- buffer 100 mM HEPES/NaOH pH 7.5, 250 mM NaCl
- the assay buffer contained 40 ⁇ M 1- I4 C 16:0-CoA (specific activity 5 ⁇ Ci/ ⁇ mol), 200 ⁇ M 18: 1 alcohol, 50 mM HEPES/NaOH pH 7.5, 250 mM NaCl and 2 mM ⁇ - mercaptoethanol.
- TLC analysis showed the incorporation of radiolabel from 1- 14 C 16:0-CoA into a band which comigrated with a wax standard in 5 of the 7 plants analyzed. This activity was detected in the homogenate and pellet fractions but not in the supernatant fraction.
- the wax synthase activity detected in these samples is several orders of magnitude greater than an endogenous wax synthase activity previously shown to be present in developing Arabidopsis seed.
- the activity detected in 8612-3 and 8613-2 is indicative of this endogenous "background” activity.
- a positive control for wax activity was the jojoba (DP2) membrane fraction.
- the oil in about lOmg of Arabidopsis seed was derivatized to form fatty acid methyl esters (FAME) and free alcohol.
- the extractable lipid was analyzed for FAME and alcohol content by gas chromatography. Internal standard 17:0 TAG was spiked into the lipid fraction and derivatization was carried out at 90° C in the presence of acidic methanol and toluene. Lipid products were extracted by adding hexane and IM aqueous NaCl. The fatty acid methyl esters (FAME) and alcohols were separated on a 0.25mm x 15m Supelcowax-10 column. Percent composition of the products was determined by their weight contribution to the sample (Table 3A).
- a correction factor for the Flame Ionization Detector (FID) response determined experimentally to be 1.155, was used to adjust the quantitation of the alcohol peak relative to the 17:0 methyl ester standard.
- the weight composition was used to determine the percentage of very long chain carbon groups ( >18C) present (Table 3B).
- Example 11 Analysis of Transgenic Arabidopsis Leaves Rosette leaves from plants transformed with construct pCGN 8593, expressing wax synthase under the control of the 35S promoter, were analyzed for wax synthase activity. Leaves were homogenized in 200 ⁇ l homogenization buffer (100 mM Tricine/NaOH, pH 7.8, 280 mM NaCl, 10 % glycerol, and protease inhibitors 0.1 uM Aprotinin, 1 ⁇ M Leupeptin, and 100 ⁇ M Pefabloc) and the solids were pelleted by centrifugation at 16,000 x g for 10 min and 4° C.
- homogenization buffer 100 mM Tricine/NaOH, pH 7.8, 280 mM NaCl, 10 % glycerol, and protease inhibitors 0.1 uM Aprotinin, 1 ⁇ M Leupeptin, and 100 ⁇ M Pefabloc
- the supernatant was removed and the pellet resuspended in 200 ⁇ l homogenization buffer. This fraction was referred to as the PI fraction.
- Five control leaves harvested from Arabidopsis cultivar No-O were assayed as controls.
- the PI fractions were assayed for wax synthase activity as described in Example IB. Wax synthase activity in the plants expressing pCGN8593 was compared with the average activity found in the No-O controls. Eleven of the 24 plants analyzed demonstrated activity more than twice the average background level found in No-O. One plant demonstrated nearly a 10-fold increase in activity.
- Example 12 Identification of Additional Wax Synthase Sequences
- the protein sequence of the jojoba wax synthase (SEQ ID NO:2) is used to query the Arabidopsis DNA sequence database (http://genome-www.stanford.edu/Arabidopsis/).
- One of the accessions PI clone MTE17(Genbank accession AB015479) contains 7 repeats of open reading frames with similarity to the jojoba wax synthase.
- the open reading frames have been designated ATWS1 to ATWS7 (SEQ ID NOs: 3, 5, 7, 9, 11, 13, and 15, respectively). They are found between nucleotides 23670 and 11479 of MTE17 using the numbering system of the Genbank entry.
- the inferred protein sequences SEQ ID NOs: 4, 6, 8, 10,12, 14, and 16, respectively.
- the conserved peptide sequences between the amino acid sequences (Table 5). The percent identities and similarities are also determined, and are presented in table 6.
- JoWS vs ATWSl 41% 17% JoWS vs ATWS2 37% 19% JoWS vs ATWS3 42% 15% JoWS vs ATWS4 42% 16% JoWS vs ATWS5 44% 13% JoWS vs ATWS6 41% 17% JoWS vs ATWS7 36% 16%
- cDNA Complementary DNA
- cDNA is constructed from Arabidopsis RNA isolated from immature seeds, whole seedlings (vegetative tissue), and inflorescences (flowers and flower stalks) using the SMART PCR cDNA Library construction kit according to the manufacturer's protocol (Clontech).
- SMART cDNA is also constructed from RNA from Brassica napus leaves, and immature seeds harvested at 15 days after pollination (DAP), 18 DAP, and 30 DAP.
- DAP 15 days after pollination
- the SMART cDNAs are used for virtual Northern analysis, according to the protocol in the SMART cDNA manual from Clontech, of expression of the Arabidopsis ATWS cDNAs.
- ATWS2 is most highly expressed in Arabidopsis immature seeds and Brassica 30 DAP seeds. Expression is not detected in Brassica leaves or Arabidopsis seedlings. This is an expression pattern consistent with that expected for DAGAT, since triglycerides are primarily formed in developing seeds of these plants.
- an expressed sequence tag (EST) sequence is identified from databases containing protein and nucleic acid sequences obtained from soybean (Glycine max). This sequence is provided in SEQ ID NO: 19.
- Constructs are prepared to direct the expression of the Arabidopsis wax synthase homologous sequence in cultured insect cells.
- the entire coding region of the Arabidopsis wax synthase sequences, ATWS1 (SEQ ID NO:3) and ATWS2, (SEQ ID NO:5) and ATWS3 (SEQ ID NO:7) are amplified in a polymerase chain reaction (PCR) and subcloned into pCR2.1 (Invitrogen) to produce pCGN9705, pCGN9706 and pCGN9707, repsectively. Double stranded DNA sequence was obtained to verify that no errors were introduced by PCR amplification.
- the fragment containing the entire coding region of the Arabidopsis ATWS1 and ATWS2 sequences were subcloned into baculovirus expression vector pFastBacl (Gibco- BRL, Gaithersburg, MD).
- a baculovirus expression construct containing the ATWS 1 and ATWS2 sequences are transformed and expressed using the BAC-to-BAC Baculovirus Expression System (Gibco-BRL, Gaithersburg, MD) according to the maufacturers directions, except harvesting of recombinant viruses was done 5 days post-transfection. The supernatant from the transfection mixture is used for generating virus stock which in turn is used for infecting Sf9 cells for use in the assay. The transformed insect cells are assayed for wax synthase activity using methods described herein.
- Insect cells are centrifuged and the resulting pelletted cells were resuspended in Medium I (0.25 M sucrose and 1 mM EDTA in 10 mM Tris-Cl, pH 7.4) and homogenized on ice. The homogenate is centrifuged at 105,000 x g for 1 at 4° C. Total membranes are resuspended in Medium I. Wax synthase activity is determined using two different acyl-CoA substrates, 16:0-
- CoA, and 24:l-CoA and five different alcohol substrates, 16:0-OH, 18:0-OH, 18:l-OH, 20: 1-OH, 22: 1-OH, and 24: 1-OH.
- Wax synthase activity is assayed in a 0.25 ml reaction mixture containing 50 mM Tricine, pH 7.8, 2 mM ⁇ -mercaptoethanol, 250 mM sodium chloride, 200 ⁇ M respective alcohol (40 ⁇ M 18: l-OH) and, 20 ⁇ M 1- 14 C palmitoyl-CoA, or 1- I4 C nervonoyl-CoA. The reactions were run at 25°C for 10 minutes.
- the results of the wax synthase activity assay demonstrates that the protein encoded by the ATWS 1 sequence has wax synthase activity for all acyl-CoA and alcohol substrates tested ( Figures 2, 3, 4, and 5).
- the wax synthase particularly has greater activity for longer chain substrates, particularly C20 and greater substrates.
- constructs are prepared to direct the expression of the sequence in host plant cells.
- a plasmid containing the napin cassette derived from pCGN3223 (described in USPN 5,639,790, the entirety of which is incorporated herein by reference) was modified to make it more useful for cloning large DNA fragments containing multiple restriction sites, and to allow the cloning of multiple napin fusion genes into plant binary transformation vectors.
- An adapter comprised of the self annealed oligonucleotide of sequence 5 ' -CGCG ATTT AAATGGCGCGCCCTGC AGGCGGCCGCCTGC AGGG CGCGCCATTTAAAT (SEQ ID NO:50) was ligated into the cloning vector pBC SK+ (Stratagene) after digestion with the restriction endonuclease BssHII to construct vector pCGN7765. Plasmids pCGN3223 and pCGN7765 were digested with Notl and ligated together. The resultant vector, pCGN7770, contains the pCGN7765 backbone with the napin seed specific expression cassette from pCGN3223.
- the cloning cassette, pCGN7787 essentially the same regulatory elements as pCGN7770, with the exception of the napin regulatory regions of pCGN7770 have been replaced with the double CAMV 35S promoter and the tml polyadenylation and transcriptional termination region.
- a binary vector for plant transformation was constructed from pCGN1558 (McBride and Summerfelt, (1990) Plant Molecular Biology, 14:269-276).
- the polylinker of pCGN1558 was replaced as a HindIII/Asp718 fragment with apolylinker containing unique restriction endonuclease sites, Ascl, Pad, Xbal, Swal, BamHI,and Notl.
- the Asp718 and Hindlll restriction endonuclease sites are retained in pCGN5139.
- a series of turbo binary vectors are constructed to allow for the rapid cloning of DNA sequences into binary vectors containing transcriptional initiation regions (promoters) and transcriptional termination regions.
- the plasmid pCGN8618 was constructed by ligating oligonucleotides 5'- TCGAGGATCCGCGGCCGC AAGCTTCCTGC AGG-3 ' (SEQ ID NO: 51 ) and 5 ' - TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3' (SEQ ID NO: 52) into Sall/XhoI-digested pCGN7770.
- a fragment containing the napin promoter, polylinker and napin 3' region was excised from pCGN8618 by digestion with Asp718I; the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and Hindlll and blunt-ended by filling in the 5' overhangs with Klenow fragment.
- a plasmid containing the insert oriented so that the napin promoter was closest to the blunted Asp718I site of pCGN5139 and the napin 3' was closest to the blunted Hindlll site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions. The resulting plasmid was designated pCGN8622.
- the plasmid pCGN8619 was constructed by ligating oligonucleotides 5'- TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC -3' (SEQ ID NO:53) and 5'- TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' (SEQ ID NO: 54) into Sall/XhoI-digested pCGN7770.
- a fragment containing the napin promoter, polylinker and napin 3' region was removed from pCGN8619 by digestion with Asp718I; the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and Hindlll and blunt-ended by filling in the 5' overhangs with Klenow fragment.
- a plasmid containing the insert oriented so that the napin promoter was closest to the blunted Asp718I site of pCGN5139 and the napin 3' was closest to the blunted Hindlll site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions. The resulting plasmid was designated pCGN8623.
- the plasmid pCGN8620 was constructed by ligating oligonucleotides 5'- TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGGAGCT -3' (SEQ ID NO:55) and 5'- CCTGCAGGAAGCTTGCGGCCGCGGATCC-3' (SEQ ID NO: 56) into Sall/Sad- digested pCGN7787.
- a fragment containing the d35S promoter, polylinker and tml 3' region was removed from pCGN8620 by complete digestion with Asp718I and partial digestion with Notl.
- the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and Hindlll and blunt-ended by filling in the 5' overhangs with Klenow fragment.
- a plasmid containing the insert oriented so that the d35S promoter was closest to the blunted Asp718I site of pCGN5139 and the tml 3' was closest to the blunted Hindlll site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions.
- the resulting plasmid was designated pCGN8624.
- the plasmid pCGN8621 was constructed by ligating oligonucleotides 5'- TCGACCTGCAGGAAGCTTGCGGCCGCGGATCCAGCT -3'(SEQ ID NO:57) and 5'- GGATCCGCGGCCGCAAGCTTCCTGCAGG-3' (SEQ ID NO:58) into Sall/Sacl- digested pCGN7787.
- a fragment containing the d35S promoter, polylinker and tml 3' region was removed from pCGN8621 by complete digestion with Asp718I and partial digestion with Notl.
- the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and Hindlll and blunt-ended by filling in the 5' overhangs with Klenow fragment.
- a plasmid containing the insert oriented so that the d35S promoter was closest to the blunted Asp718I site of pCGN5139 and the tml 3' was closest to the blunted Hindlll site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions.
- the resulting plasmid was designated pCGN8625.
- AT-WS2 The open reading frame of AT-WS2 was PCR amplified from Arabidopsis genomic DNA using the primers 5 ' -GGATCCGCGGCC
- plasmid pCGN9712 is constructed by cloning the NotI/Sse8387I fragment from pCGN9706 into Notl/Pstl digested binary vector pCGN8622.
- plasmid pCGN9713 was constructed by cloning the NotI/Sse8387I fragment from pCGN9706 into Notl/Pstl digested binary vector pCGN8623.
- plasmid pCGN9714 was constructed by cloning the NotI Sse8387I fragment from pCGN9706 into Notl/Pstl digested binary vector pCGN8624.
- Plasmids pCGN9712, pCGN9713, and pCGN9714 were introduced into Agrobacterium tumefaciens EHA105 by electroporation, and the resultant Agrabacterium strains were used to transform Arabidopsis thaliana plants by vacuum infiltration.
- the open reading frame of the ATWS 1 sequence was amplified using PCR and cloned into pCGN8622, pCGN8623, and pCGN8624 to create the plant expression constructs pCGN9708, pCGN9709, and pCGN9710, respectively.
- a variety of methods have been developed to insert a DNA sequence of interest into the genome of a plant host to obtain the transcription or transcription and translation of the sequence to effect phenotypic changes.
- High erucic acid varieties such as cultivar Reston, or Canola-type varieties of
- Brassica napus may be transformed using Agrobacterium mediated transformation methods as described by Radke et al. (Theor. Appl. Genet. (1988) 75:685-694; Plant Cell Reports (1992) 77:499-505).
- Transgenic Arabidopsis thaliana plants may be obtained by
- Lines 9708-AT001-7 and 9708-AT001-23 contained 27.34% and 24.85% FAME by dry weight compared to non-transformed Arabidopsis seed, which contain approximately 34%
- Such applications include the production of wax ester compounds when the wax synthase is used in host cells having a source of fatty alcohol substrates, which substrates may be native to the host cells or supplied by use of recombinant constructs encoding a fatty acylreductase protein which is active in the formation of alcohols from fatty acyl substrates.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Cell Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Coloring Foods And Improving Nutritive Qualities (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2000588344A JP2002532089A (ja) | 1998-12-04 | 1999-12-03 | 脂肪アシル−CoA:脂肪アルコールアシルトランスフェラーゼ |
| EP99967187A EP1135474A2 (en) | 1998-12-04 | 1999-12-03 | FATTY ACYL-CoA: FATTY ALCOHOL ACYLTRANSFERASES |
| CA002352473A CA2352473A1 (en) | 1998-12-04 | 1999-12-03 | Fatty acyl-coa: fatty alcohol acyltransferases |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US09/205,815 | 1998-12-04 | ||
| US09/205,815 US6492509B1 (en) | 1994-06-23 | 1998-12-04 | Fatty acyl-CoA: fatty alcohol acyltransferases |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2000036095A2 true WO2000036095A2 (en) | 2000-06-22 |
| WO2000036095A3 WO2000036095A3 (en) | 2000-08-03 |
Family
ID=22763751
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/028678 Ceased WO2000036095A2 (en) | 1998-12-04 | 1999-12-03 | FATTY ACYL-CoA: FATTY ALCOHOL ACYLTRANSFERASES |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US6492509B1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP1135474A2 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2002532089A (cg-RX-API-DMAC7.html) |
| CA (1) | CA2352473A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2000036095A2 (cg-RX-API-DMAC7.html) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7118896B2 (en) * | 2002-03-01 | 2006-10-10 | Monsanto Technology, L.L.C. | Methods and compositions for modification of lipid biosynthesis |
| MX2008010989A (es) | 2006-03-01 | 2009-01-26 | Pionner Hi Bred International | Composiciones relacionadas con el locus 6 de rasgo cuantitativo (qtl6) en maiz y metodos de uso. |
| BR112014007115A2 (pt) | 2011-09-27 | 2017-04-25 | Exxonmobil Res & Eng Co | éster sintases de cera acil-acp |
| US8962299B2 (en) | 2012-02-29 | 2015-02-24 | Exxonmobil Research And Engineering Company | Four-gene pathway for wax ester synthesis |
| EP2820029A4 (en) * | 2012-02-29 | 2015-12-23 | Exxonmobil Res & Eng Co | FOUR GENE SIGNAL PATH FOR WAXESES SYNTHESIS |
| CN104711238B (zh) * | 2015-03-30 | 2018-10-23 | 中国科学院华南植物园 | 一种水稻抗旱蛋白OsWS1及其编码基因和用途 |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5420034A (en) | 1986-07-31 | 1995-05-30 | Calgene, Inc. | Seed-specific transcriptional regulation |
| US5344771A (en) | 1990-04-26 | 1994-09-06 | Calgene, Inc. | Plant thiosterases |
| EP0529048A4 (en) | 1991-02-22 | 1994-08-17 | Calgene Inc | Seed plant fatty acyl reductase proteins and genes |
| US5723747A (en) | 1991-02-22 | 1998-03-03 | Calgene, Inc. | Wax esters in transformed plants |
| US5411879A (en) | 1991-02-22 | 1995-05-02 | Calgene Inc. | Fatty acyl reductases |
| US5403918A (en) | 1991-02-22 | 1995-04-04 | Calgene, Inc. | Fatty acyl reductase |
| WO1993010241A1 (en) | 1991-11-20 | 1993-05-27 | Calgene, Inc. | FATTY ACYL-CoA: FATTY ALCOHOL O-ACYLTRANSFERASES |
| US5679881A (en) | 1991-11-20 | 1997-10-21 | Calgene, Inc. | Nucleic acid sequences encoding a plant cytoplasmic protein involved in fatty acyl-CoA metabolism |
| JP3363197B2 (ja) | 1992-06-18 | 2003-01-08 | 麒麟麦酒株式会社 | アルコールアセチルトランスフェラーゼ遺伝子およびその利用 |
| WO1998055632A1 (en) | 1997-06-05 | 1998-12-10 | Calgene Llc | FATTY ACYL-CoA: FATTY ALCOHOL ACYLTRANSFERASES |
-
1998
- 1998-12-04 US US09/205,815 patent/US6492509B1/en not_active Expired - Lifetime
-
1999
- 1999-12-03 CA CA002352473A patent/CA2352473A1/en not_active Abandoned
- 1999-12-03 EP EP99967187A patent/EP1135474A2/en not_active Withdrawn
- 1999-12-03 WO PCT/US1999/028678 patent/WO2000036095A2/en not_active Ceased
- 1999-12-03 JP JP2000588344A patent/JP2002532089A/ja active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| JP2002532089A (ja) | 2002-10-02 |
| US6492509B1 (en) | 2002-12-10 |
| WO2000036095A3 (en) | 2000-08-03 |
| CA2352473A1 (en) | 2000-06-22 |
| EP1135474A2 (en) | 2001-09-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2292768C (en) | Fatty acyl-coa: fatty alcohol acyltransferases | |
| CA2331329C (en) | Diacylglycerol acyl transferase proteins | |
| US6828475B1 (en) | Nucleic acid sequences encoding a plant cytoplasmic protein involved in fatty acyl-CoA metabolism | |
| US7741532B2 (en) | Diacylglycerol acyl transferase proteins | |
| US5679881A (en) | Nucleic acid sequences encoding a plant cytoplasmic protein involved in fatty acyl-CoA metabolism | |
| WO1998055631A1 (en) | Diacylglycerol acyl transferase proteins | |
| US5445947A (en) | Jojoba wax biosynthesis gene | |
| CA2375540A1 (en) | Nucleic acid sequences encoding proteins involved in fatty acid beta-oxidation and methods of use | |
| EP0529048A1 (en) | Seed plant fatty acyl reductase proteins and genes | |
| EP0711351B1 (en) | Wax esters in transformed plants | |
| WO2000032793A2 (en) | Plant cell derived diacylglycerol acyltransferases | |
| US7332311B2 (en) | Fatty acyl-CoA: fatty alcohol acyltransferases | |
| US6492509B1 (en) | Fatty acyl-CoA: fatty alcohol acyltransferases | |
| EP1114163A2 (en) | Engineering beta-ketoacyl acp synthase for novel substrate specificity | |
| MXPA01005657A (en) | Fatty acyl-coa:fatty alcohol o-acyltransferases | |
| MXPA99011202A (es) | Aciltransferasas acilo-coa graso:alcohol graso | |
| MXPA99011201A (en) | Diacylglycerol acyl transferase proteins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): CA CN JP KR MX |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): CA CN JP KR MX |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2352473 Country of ref document: CA Ref country code: CA Ref document number: 2352473 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 588344 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2001/005657 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999967187 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999967187 Country of ref document: EP |