MXPA01005657A - Fatty acyl-coa:fatty alcohol o-acyltransferases - Google Patents

Abstract

By this invention, a partially purified fatty acyl-CoA:fatty alcohol acyltransferase (wax synthase) is provided, wherein said protein is active in the formation of a wax ester from fatty alcohol and fatty acyl substrates. Of special interest is a jojoba embryo wax synthase having an apparent molecular mass of approximately 57kD. Also considered are amino acid and nucleic acid sequences obtainable from wax synthase proteins and the use of such sequences to provide transgenic host cells capable of producing wax esters. By this invention, a partially purified fatty acyl-CoA:fatty alcohol acyltransferase (wax synthase) is provided, wherein said protein is active in the formation of a wax ester from fatty alcohol and fatty acyl substrates. Of special interest is a jojoba embryo wax synthase having an apparent molecular mass of approximately 57kD. Also considered are amino acid and nucleic acid sequences obtainable from wax synthase proteins and the use of such sequences to provide transgenic host cells capable of producing wax esters.

Description

ACILO-GRASO COENZIMA A: FATTY ALCOHOL ACILTRANSFERASAS This application is a continuation in part of the patent application of E.U.A. No. 09 / 205,8 5, filed on December 4, 1998.

TECHNICAL FIELD The present invention is directed to enzymes, methods for purifying, and obtaining said enzymes, amino acid sequences and nucleic acids related thereto, and methods of use for said compositions in genetic engineering applications.

INTRODUCTION BACKGROUND OF THE INVENTION Through the development of plant genetic engineering techniques, it is possible to transform and regenerate a variety of plant species to provide plants that have novel and desired characteristics. One area of interest for such plant genetic engineering techniques is the production of valuable products in plant tissues. Such applications require the use of various DNA constructs and nucleic acid sequences for use in transformation events to generate plants that produce the desired product. For example, functional promoters in plants are required for the proper expression of gene sequences, said expression being either in the whole plant or in selected plant tissues. In addition, selective marker sequences are frequently used to identify the transformed plant material. Said plant promoters and selection markers provide valuable tools that are useful for obtaining novel plants. A desirable goal involving such genetic engineering techniques is the ability to provide plant crops that have a convenient source of wax esters. Wax esters are required in a variety of industrial applications, including pharmaceuticals, cosmetics, detergents, plastics, and lubricants. Such products, especially long-chain wax esters, have previously been available from whale sperm, an endangered species, or more recently, from the desert shrub, jojoba. None of these sources provides a convenient wax esters supplement. Thus, in order to obtain an adequate source for these products, it is desirable to transform plant crops, which are easily manipulated in terms of growth, and product extraction.

In order to obtain said transformed plants, in any case, the genes responsible for the biosynthesis of the desired wax ester products must first be obtained. The production of wax ester results from the action of at least two enzymatic activities, fatty acyl reductase and fatty acyl acyltransferase: fatty alcohol, or wax synthase. In addition, a β-ketoacyl-coenzyme A synthase may also be involved in the biosynthesis of wax by providing very long chain fatty acid-CoA acyl substrates for the reductase and for the enzymatic reaction of the wax synthase. Preliminary studies with these enzymes and extensive analyzes and purification of fatty acyl reductase indicate that these proteins are associated with membranes, although the enzyme responsible for the fatty acyl: fatty alcohol ligation reaction in the wax biosynthesis is not has characterized. Thus, further studies and finally, the purification of this enzyme are needed so that the gene sequence encoding the enzymatic activity can be obtained. It is desirable, therefore, to develop a purification protocol in which the wax protein synthase can be obtained and the amino acid sequence determined and / or antibodies specific for wax synthase are obtained. In this way, the selection of a library, and the polymerase chain reaction (PCR) or immunological techniques can be used to identify clones that express a wax synthase protein. The clones thus obtained can be analyzed so as to identify the nucleic acid sequences corresponding to the activity of the wax synthase. The nucleic acid sequences of the wax synthases can be used in conjunction with the fatty acyl reductase proteins, either native to the transgenic host cell or supplemented by recombination techniques, for the production of the wax ethers in the host cells.

BRIEF DESCRIPTION OF THE INVENTION For this invention, the nucleic acid sequences encoding the fatty acyl-CoA protein: fatty alcohol O-acyltransferase are provided. (fatty alcohol acyltransferase E.C.2.3.1.75), wherein said protein is active in the formation of wax esters from fatty alcohol and fatty acyl substrates. This fatty acyl-CoA: fatty alcohol O acyltransferase is referred to hereafter as "wax synthase". The wax synthase in this invention can be activated by a variety of fatty acyl and fatty alcohol substrates, including acyl-CoA and acyl-ACP. The length of the carbon chain of these substrates may vary, although a given wax synthase may show preference for acyl and alcohol substrates having a specific chain length or which may be active with acyl and alcohol substrates having a wide range. with respect to the length of the carbon chain. The wax synthase is preferably obtained from plant sources.

Preferably, the wax synthase of this invention has activity toward at least those acyl and alcohol substrates having a chain length of 8 to 30 carbons, more preferably 8 to 28 carbons. In addition, having obtained the wax synthase protein of this invention, additional manipulations are currently possible as described in the additional details below. These manipulations can lead to the production or discovery of other related wax synthases. Thus, the present invention is directed to fatty acyl-CoA: fatty alcohol O-acyltransferase (also referred to herein, as wax synthase) and in particular to the wax synthase polynucleotides. The polynucleotides of the present invention include those derived from plant sources. One aspect of the present invention relates to oligonucleotides that include partial or complete sequences encoding wax synthase. One aspect of the present invention is also to provide recombinant DNA constructs that can be used for the transcription or transcription and translation (expression) of wax synthase. In particular, constructs that are capable of transcription or transcription and translation in host cells are provided. Particularly preferred constructs are those capable of carrying out transcription or transcription and translation in plant cells.

In another aspect of the present invention, methods are provided for the production of wax synthase in a host cell or progeny thereof. In particular, the host cells are transformed or transfected with a DNA construct that can be used for the transcription or transcription and translation of wax synthase. The recombinant cells containing wax synthase are also part of the present invention. In a further aspect the present invention relates to methods for producing a wax ester in a host cell or progeny thereof. In particular, the host cells are transformed or transfected with a DNA construct that can be used for transcription or transcription and translation of the wax synthase in a host cell having fatty alcohol and fatty acid substrates. The wax ester thus produced is used in a variety of applications including pharmaceuticals, cosmetics, detergents, plastics, food applications and lubricants. In particular, wax esters can be used in food applications as a low calorie fat. In addition, the wax esters can be used as sources for the production of fatty alcohol and fatty acyl products. The wax esters can be subjected to hydrolysis conditions to produce fatty alcohols and fatty acyl products for use in a variety of applications, including, detergents, lubricants, corrosion inhibitors, plasticizers, cosmetics, emulsifiers, and for use in pharmaceutical compositions.

Even in a further aspect of the present invention methods for using the polynucleotide and polypeptide sequences of the present invention to alter the fatty content of a host cell are provided. In particular, the methods involve the growth of a host cell having a recombinant nucleic acid construct comprising a promoter and a nucleic acid sequence encoding an active acyltransferase in the formation of the wax ester. Such methods can be used in the production of host cells with modified oil / protein ratios. Modified plants, seeds and oils obtained by the expression or deletion of wax synthase proteins are also considered part of the invention BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 a calculation of the contribution of wax synthase to the production of very long chain fatty acids (VLFA). Figure 2 results of the wax synthase activity assay using various alcohol substrates and 1 μg of 16: 0-CoA substrate. Figure 3 results of the wax synthase activity assay using various alcohol substrates and 10 μg of 16: 0-CoA substrate. Figure 4 results of the wax synthase activity assay using various alcohol substrates and 1 μg of 24: 0-CoA substrate.

Figure 5 results of the wax synthase activity assay using various alcohol substrates and 10 μg of 24: 0-CoA substrate.

DETAILED DESCRIPTION OF THE INVENTION In accordance with the present invention, nucleic acid sequences encoding amino acids, such as a protein, polypeptide or peptide fragment, are provided, which are active to catalyze the esterification of the fatty alcohol by a fatty acyl group to produce an ester of wax. These proteins are known as fatty acyl-CoA: fatty alcohol acyltransferases (E.C.2.3.1.75). The acyl-CoA: alcohol acyltransferase of this invention is also referred to hereafter as "wax synthase". Although typically referred to as acyl-CoA: alcohol acyltransferase, the wax synthases of this invention can demonstrate activity towards a variety of acyl substrates, including fatty acyl-CoA and fatty acyl-ACP molecules. In addition, both the acyl and the alcohol substrates acting on the wax synthase may have varying carbon chain lengths and saturation degrees, although the wax synthase may demonstrate preferential activity towards certain molecules. Many different organisms produce wax ethers from alcohol and acyl substrates and are desirable sources for a wax synthase protein of this invention. For example, plants that produce epidermal wax, or cuticular wax (Kolattukudy (1980) in The Biochemistry of Plants (Stumpf, PL and Conn, EE, eds.) Vol.4, p.571-645), and the desert shrub , jojoba (Ohlrogge et al. (Lipids (1978) 13: 203-210), as well as Murraya koenigii (Kartha, (1969) Chemistry and Industry 4: 1342-1343 and Kartha, et al. (1972) Chemistry and Industry 891 -892), produce a storage seed wax Wax synthesis has also been observed in several species of bacteria, such as Acinetobacter (Fixter et al (1986) J. Gen Microbiol. 132: 3147-3157 and Micrococcus ( Lloyd (1987) Microbes 52: 29-37), and by the unicellular organism, Euglena (Khan and Kolattukudy (1975) Arch. Biochem. Biophys. 170: 400-408) .In addition, the production of wax and the synthase activity of Waxes have been reported in microsomal preparations from bovine meibomian glands (Kolattukudy et al (1986) J. Lipid Res. 27: 404-411), bird uropigial glands, and various insects. marine organisms and organisms. Consequently, many different wax ethers having various properties can be produced by the wax synthase of this invention, and the activity of the enzyme and type of ether produced may depend on the substrate available or the substrate specificity of the particular wax synthase. of interest. To obtain a safe source of the wax protein synthase for use in esterification reactionsIt is desirable to isolate nucleic acid sequences associated with wax synthase so that these sequences can be cloned into host cells for the production of the wax synthase enzyme. For example, one can clone nucleic acid sequence encoding a wax protein synthase within expression vectors in E. coli cells to provide an easy source of the wax protein synthase. The wax protein synthase thus produced can also be used to generate antibodies against wax synthase proteins for use and identification and purification of related wax synthase proteins from various sources, especially from plants. In addition, the additional study of wax protein synthase can lead to specific site mutagenesis reactions to further characterize and improve its catalytic properties or alter its specificity to the fatty alcohol or fatty acyl substrate. A wax synthase with altered substrate specificity may have application in conjunction with other FAS enzymes. Prior to the present invention, the nucleic acid and amino acid sequences of the wax synthase proteins were not known. Thus, in order to obtain nucleic acid sequences associated with wax synthase, it is first necessary to purify the protein from an available source and to determine at least the partial amino acid sequence so that the appropriate probes useful for the preparation can be prepared. Isolation of the nucleic acid sequence of the wax synthase. The desert shrub, Simmondsia chinensis (jojoba) was identified as a source of a candidate wax protein synthase. Initial studies reveal that jojoba wax synthase is an integral membrane protein and hydrophobic in nature. In general, membrane-associated proteins are difficult to purify since they tend to lose enzymatic activity when they are solubilized, that is, they are separated from the environment of the membrane in which they normally function. Techniques that have been used to solubilize integral membrane proteins include the addition of detergents or organic solvents for a preparation of a suitable membrane fraction. Additional techniques for conventional purification, such as precipitation, ion exchange, gel filtration and affinity chromatography, can be used, assuming that the desired protein still retains the functional activity that can be measured using a specific enzymatic assay. Typically, as a first step toward obtaining a solubilized membrane protein, a microsomal membrane preparation comprising wax synthase activity is desired. Standard microsomal membrane preparations utilize differential centrifugation of a cell-free homogenate (CFH) to produce a membrane fraction that is free of whole cells, nuclei and soluble proteins. (See, for example Mooré et al. (1987) Biological Membranes: A Practical Approach, pp. 37-72, eds Finalay and Evans.) With oilseeds, the initial centrifugation steps typically yield a concentrate, supernatant and a Floating fat pad, and then the microsomal membranes can be recovered by additional centrifugation of the supernatant. A protocol is described in USPN 5,403,918, where a jojoba membrane fraction was obtained with good recovery of the enzymatic activity associated with fatty acyl reductase, another enzyme involved in the formation of wax ethers in jojoba. The method also provides membrane fractions that have wax synthase activity and are described in detail in the examples below. In addition, microsomal membrane preparations from jojoba are also described in Lassner et al. (previously mentioned). Other methods known to those skilled in the art can also be used to obtain similar membrane preparations. further, the test methods for wax synthase activity in said preparations are described in Example 1. A critical step for further enzymatic characterization and purification is to obtain solubilized wax protein synthase that is separated from the native membrane environment of bilayer. lipid, but which retains substantial amounts of measurable wax synthase enzymatic activity. Removal of integral membrane proteins from the lipid bilayer is typically achieved using amphiphilic detergents in aqueous solutions, although in a few cases organic solvents have also been used. Many different detergents and membrane protein solubilization methods are known to those skilled in the art, and are reviewed by Neugebauer (Methods Enzymol. (1990) 182: 239-253) and Hjelmiland (Methods Enzymol. (1990) 182: 253- 264). Frequently, it is found that the detergents that are used to solubilize membrane proteins inhibit the enzymatic activity of a desired protein. Several detergents were tested for the solubilization of jojoba wax synthase, including CHAPS (3- [3-colamidopropyl) -dimethyl-ammonium] -1-propanesulfonate), which was demonstrated in USPN 5,403,918 which is useful in the purification of reductase of fatty acyl from jojoba. It was found that all inhibited the enzymatic activity of wax synthase. Although strong inhibition by CHAPS at concentrations higher than CMC was observed, it was found that the addition of phospholipids, such as L-phosphatidylcholine, and adjustment of the CHAPS concentration from 1.0% to 0.2%, ie, below CMC, results in the reconstitution of a portion of the wax synthase activity. The main requirement for the reconstitution of wax synthase activity is the presence of phospholipids during the removal or dilution of the detergent, so that the wax synthase protein is incorporated into the phospholipid vesicles. This differs from the protocol developed for the reconstitution of jojoba reductase activity, which does not require the addition of phospholipids. Thus, if the phospholipids are present in a wax synthase preparation, such as from a microsomal membrane fraction, activity can be detected simply by removing or diluting the detergent. However, in additionally purified wax synthase preparations, the phospholipids must be added to detect activity. Recovery of optimal activity is obtained when a ratio of CHAPS to PL is 2.8 / 1 (w / w) in the assay. A method for reconstituting and assaying wax synthase activity in solubilized wax synthase preparations is described in Example 1.

Having obtained solubilized wax protein synthase, it can be seen that additional experiments can now be conducted to characterize the enzyme as well as the specific substrate, cofactor requirements and possible agents that inhibit activity. For example, it has been found that the jojoba wax synthase of this invention has a wide range of acyl substrates, including acyl-ACP and acyl-CoA molecules. In addition, the acyl and fatty alcohol substrates can have a wide range of size with respect to the length of the carbon chain. For example, the activity was evaluated using substrates having carbon chain lengths from C12 to C24, and all were found to be used by the enzyme. In addition, the activity was shown with fatty acyl and fatty alcohols having varying degrees of unsaturation. Chromatography techniques can be used to provide enriched preparations of vegetable wax synthase. One such purification step involves chromatography on an immobilized reactive dye matrix, such as the Cibacron blue F3GA (blue A) used in this invention. The activity of jojoba wax synthase binds to the column when loaded in a buffer containing approximately 0.3M NaCl, while the majority of approximately 85% of other proteins pass through or are removed in subsequent washings. As described in USPN 5,403,918, the reductase activity is also bound to the blue A column under said conditions. It is shown here that about 70% of the wax synthase activity loaded on a blue A column can be removed by elution with a 2.0M NaCl wash buffer. The proteins ß-ketoacyl-CoA reductase and synthase (KCS) of jojoba are also present in the blue A eluate. Additional purification of the blue A eluate is obtained by loading the sample onto a crystalline hydroxyapatite (HA) column . Wax synthase activity does not bind to the column and is found in the flow through the column and in the wash. Most reductase and KCS activities bind to the column, as do most of the proteins in the sample. The HA fraction enriched in wax synthase activity can be used for size exclusion chromatography, and using a Superdex 75 size exclusion column, it is estimated that the jojoba wax protein synthase has a molecular weight of 48kD. Using such purification techniques, the jojoba wax protein synthase can be recovered as a substantially purified protein preparation and the amino acid sequence can be obtained. Similarly, due to the hydrophobic nature of the fatty alcohol substrates of the wax synthase enzymes, other wax synthases could also be predicted to be associated with the membranes in their native cells, and thus the purification techniques described herein for the synthase of Jojoba wax, may also be useful for the recovery of purified preparations of other wax synthase proteins. For example, Euglena gracilis produces wax through the enzymatic action of a fatty acyl-CoA reductase and a fatty acyl-CoA alcohol transacylase, or wax synthase. Typically, waxes having carbon chain lengths with a range of 24-32 are detected in this organism. As described above for jojoba, the Euglena wax synthase enzyme can be solubilized using a CHAPS / NaCl solution, and a wax synthase preparation partially purified by ligand-dye, HA and size exclusion chromatography can be obtained. It is known that Acinetobacter species also produce wax ester compositions, although the mechanism is not well defined. As described herein a fatty acyl-CoA alcohol transacylase, or wax synthase activity is detected in Acinetobacter species. The wax synthase activity is solubilized in CHAPS / NaCl, enriched by the chromatography of the blue A column and can be further purified using such techniques as size exclusion chromatography. In order to obtain nucleic acid sequences encoding the wax synthase of the present invention, the band containing the purified protein is cut from an SDS gel for use in amino acid sequencing reactions. The digestion of the gel was used as opposed to more convenient methods, such as transfer of the protein to nitrocellulose or polyvinylidene fluoride (PVDF) membranes due to the fact that the conditions under which the jojoba wax protein synthase could be discovered had not been discovered. be used in blot and join said membranes. A commercial laboratory, W.M. Keck / Yale University, was provided with gel slices containing protein synthase purified jojoba wax for use in determining the amino acid sequences of the jojoba protein by gel digestion and subsequent protein sequencing. The peptide sequences generated in this way can be used in the techniques of gene isolation from PCR and in the selection of cDNA libraries as described in more detail in the following examples. Additional experiments may also be desirable to confirm the identity of the wax synthase, such as the expression of the protein in E. coli. The wax synthase can act on the fatty acyl and fatty alcohol substrates in said cells to produce wax esters which can be detected by various analytical methods. If the host cells do not contain the alcohol substrate of the wax synthase, the activity can be verified by assaying the cell extracts. Alternatively, wax protein synthase can be prepared by in vitro translation using the wax synthase nucleic acid sequences and commercially available translation equipment. The addition of the microsomal membrane preparations to the in vitro translation sample may be necessary to obtain the active wax protein synthase if the membrane insert is critical for the activity. Other tests may include immunological assays, wherein antibodies specific for the candidate protein are prepared and found to inhibit wax synthase activity in protein preparations. Thus, as described in more detail in the examples below, nucleic acid sequences are isolated using amino acid sequences determined by the proteins associated with wax synthase activity, both to confirm the identity of the wax protein synthase and to provide transcription of the sequence and / or expression of the protein in host cells, either prokaryotes or eukaryotes. Since wax synthase is a membrane-bound protein, it may be desirable to express a candidate protein in a plant cell in order to verify activity. Electroporation or bombardment of plant tissue for transient expression may be useful for this purpose. Finally, stable plant expression is desired in a plant that produces substrates recognized by this enzyme. If a white plant for transformation with wax synthase sequences does not naturally contain the fatty alcohol substrates and fatty acyl ester of this enzyme, a plant extract can be prepared and assayed for wax synthase activity by adding wax synthase substrates to the abstract. Constructs and methods for the transformation of host plants with wax synthase sequences are discussed in more detail below. The wax synthase nucleic acids of this invention can be genomic or cDNA and can be isolated from cDNA or genomic libraries or directly from isolated plant DNA. As described in more detail in the examples below, a method is provided for obtaining nucleic acid sequences of jojoba wax synthase by PCR from specific primers described for the jojoba wax synthase peptides.

The wax synthase nucleic acid sequences of this invention include those corresponding to the jojoba wax protein synthase, as well as the sequences that are obtained from the jojoba protein or the nucleic acid sequences. By "corresponding" refers to nucleic acid sequences, either DNA or RNA, including those that code for jojoba wax protein synthase or a portion thereof, regulatory sequences that lie 5 'or 3' of said coding sequences directing transcription or transcription and translation (expression) of wax synthase in jojoba embryos, sequences of introns not present in the cDNA, as well as sequences encoding any leader or signal peptide of a protein synthase precursor of wax that may be required for insertion or retention within the membrane of the endoplasmic reticulum, which may or may not be found in the enzyme mature wax synthase. By "obtainable" sequences from the jojoba sequence or protein, it refers to any nucleic acid sequence associated with a wax synthase protein that can be synthesized from the amino acid sequence of jojoba wax synthase, or alternatively identify themselves in a different organism, and isolate themselves using as probes the nucleic acid sequences of jojoba wax synthase or antibodies prepared against the jojoba wax protein synthase. In this way, it can be seen that the sequences of these other wax synthases can be used similarly to isolate nucleic acid sequences associated with wax synthase proteins from additional sources. Thus, another aspect of the present invention relates to isolated polynucleotides of wax synthase. The polynucleotide sequences of the present invention include isolated polynucleotides encoding polypeptides of the invention having a deduced amino acid sequence selected from the group of sequences set forth in the sequence listing, and other polynucleotide sequences closely related to such sequences, and variants of the same. The invention provides an identical polynucleotide sequence over its entire length to each coding sequence set forth in the sequence listing. The invention also provides the coding sequence for the mature polypeptide or a fragment thereof in a reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, pro- or prepro-protein sequence. . The polynucleotide can also include non-coding sequences, including for example, but not limited to, 5 'and 3' non-coding sequences, such as transcribed, untranslated sequences, termination signals, ribosome binding sites, sequences that stabilize mRNA. , introns, polyadenylation signals, and additional coding sequences that encode additional amino acids. For example, a marker sequence can be included to facilitate purification of the fused polypeptide. The polynucleotides of the present invention also include polynucleotides that comprise a structural gene and the naturally associated sequences that control gene expression. The invention also includes polynucleotides of the formula: X- (R?) N- (R2) - (R3) nY wherein, at the 5 'end, X is hydrogen, and at the 3' end, Y is hydrogen or a metal, Ri and R3 are any nucleic acid residue, n is an integer between 1 and 3000, preferably between 1 and 1000, and R2 is a nucleic acid sequence of the invention, particularly a nucleic acid sequence selected from the group that is describes in the sequence listing, and preferably SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15 and 19. In the formula, R2 is oriented in such a way that its residue at the 5 'end is on the left, joined to Ri, and his residue on the 3 'end is on the right, joined to R3. Any extension of nucleic acid residues denoted by any group R, wherein R is greater than 1, can be either a heteropolymer or a homopolymer, preferably a heteropolymer. The invention also relates to variants of the polynucleotides described herein, which encode variants of the polypeptides of the invention. The variants that are fragments of the polynucleotides of the invention can be used to synthesize full-length polynucleotides of the invention. Preferred embodiments are polynucleotides that encode polypeptide variants in which 5 to 10, 1 to 5, 1 to 3, 2, or 1, or no amino acid residue of a polypeptide sequence of the invention, is substituted, added or deleted , in any combination. Substitutions, additions and deletions that are silent so as not to alter the properties or activities of the polynucleotide or polypeptide are particularly preferred. Preferred embodiments of the invention are at least 50%, 60% >; or 70% identical over their entire length with a polynucleotide encoding a polypeptide of the invention, and polynucleotides that are complementary to said polynucleotides. More preferred are polynucleotides that comprise a region that is at least 80% identical over its entire length with a polynucleotide encoding a polypeptide of the invention, and polynucleotides that are complementary thereto. In this regard, polynucleotides at least 90% identical over their entire length are particularly preferred, with 95% identical being especially preferred. Furthermore, those with at least 97% identity are very preferred and those with 98% and 99% identity are particularly preferred, those with 99% identity being most preferred. Preferred embodiments are polynucleotides that encode polypeptides that retain substantially the same function or biological activity as the mature polypeptides encoded by the polynucleotides described in the sequence listing. In addition, the invention relates to polynucleotides that hybridize with the above-mentioned sequences. In particular, the invention relates to polynucleotides that hybridize under severe conditions with the above-mentioned polynucleotides. As used herein, the terms "severe conditions" and "severe hybridization conditions" mean that hybridization will generally occur if there is at least 95%, and preferably at least 97% identity between the sequences. An example of severe hybridization conditions is incubation overnight at 42 ° C in a solution comprising 50% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6) , 5x Denhardt's solution, 10% dextran sulfate and 20 micrograms / milliliter of fragmented and denatured DNA from salmon sperm, followed by washing the hybridization support in SSC 0.1 x, at approximately 65 ° C. Other hybridization and washing conditions are well known and are exemplified in Sambrook et al., "Molecular Cloning: A Laboratory Manual" Second Edition, Cold Spring Harbor, New York (1989), particularly chapter 11. The invention also provides a polynucleotide consisting essentially of a polynucleotide sequence that can be obtained by selecting an appropriate library containing the complete gene for a polynucleotide sequence described in the sequence listing, under severe hybridization conditions, with a probe having the sequence of said sequence polynucleotide or a fragment thereof; and isolating said polynucleotide sequence. Fragments useful for obtaining said polynucleotide include, for example, probes and primers such as those described herein. As described herein by considering the polynucleotide assays of the invention, for example, the polynucleotides of the invention can be used as a hybridization probe for RNA, cDNA or genomic DNA, to isolate full-length cDNAs or genomic clones encoding a polypeptide, and for isolating clones of cDNA or genomic DNA from other genes having a high sequence similarity to a polynucleotide that is described in the sequence listing. Said probes will generally comprise at least 15 bases. Preferably, said probes will have at least 30 bases and may have at least 50 bases. Particularly preferred probes will have between 30 bases and 50 bases, inclusive. The coding region of each gene comprising or comprised by a polynucleotide sequence described in the sequence listing can be isolated by selection using a DNA sequence provided in the sequence listing to synthesize an oligonucleotide probe. A labeled oligonucleotide having a sequence complementary to that of a gene of the invention is then used to select a library of cDNA, genomic DNA or mRNA, to identify members of the library that hybridize with the probe. For example, synthetic oligonucleotides corresponding to the ETS sequences of the wax synthase can be prepared. Oligonucleotides can be used as primers in polymerase chain reaction (PCR) techniques to obtain 5 'and 3' terminal sequences of the wax synthase genes. Alternatively, when low degeneracy oligonucleotides can be prepared from particular peptides of wax synthase, such probes can be used directly to select libraries for wax synthase gene sequences. In particular, the selection of cDNA libraries in phage vectors is useful for such methods due to the lower levels of background hybridization. Typically, a wax synthase sequence that can be obtained from the use of the nucleic acid probes will show 60-70% sequence identity between the white wax synthase sequence and the coding sequence used as a probe. However, long sequences with a sequence identity as low as 50-60% can also be obtained. The nucleic acid probes can be a long fragment of the nucleic acid sequence, or they can be a shorter oligonucleotide probe. When longer nucleic acid fragments (greater than about 100 bp) are used as probes, one can select with less severity to obtain sequences from the target sample that have 20-50% deviation (ie, 50-80% homology). of sequence) from the sequences used as a probe. The oligonucleotide probes can be considerably shorter than the entire nucleic acid sequence encoding a wax synthase enzyme, but must be at least about 10, preferably at least about 15, and more preferably at least about 20 nucleotides. A greater degree of sequence identity is desired when using shorter regions as opposed to longer regions. Therefore, it may be convenient to identify highly conserved amino acid sequence regions to design oligonucleotide probes to detect and recover other genes related to wax synthase. Generally, shorter probes are particularly useful for polymerase chain reactions (PCR), especially when highly conserved sequences can be identified (see Gould et al., PNAS USA (1989) 86: 1934-1938). Another aspect of the present invention relates to wax synthase polypeptides. Such polypeptides include isolated polypeptides such as those described in the sequence listing, as well as polypeptides and fragments thereof, particularly those polypeptides that exhibit wax synthase activity and also those polypeptides having at least 50%, 60% or 70% polypeptides. % identity, preferably at least 80% identity, more preferably at least 90% identity, and more preferably at least 95% identity with a polypeptide sequence selected from the group of sequences described in the sequence listing, and also includes portions of such polypeptides, wherein said portion of the polypeptide preferably includes at least 30 amino acids, and more preferably includes at least 50 amino acids. "Identity", as is well understood in the art, is a relationship between two or more polypeptide sequences, or two or more polynucleotide sequences, as determined by sequence comparison. In the art, "identity" also means the degree of relationship between the polypeptide or polynucleotide sequences, determined by the coupling between the strands of such sequences. The "identity" can be easily calculated by known methods including, without limitation, those described in "Computational Molecular Biology", by Lesk A.M., ed., Oxford University Press, New York (1988); "Biocomputing: Informatics and Genome Projects" Smith D.W., ed., Academic Press, New York, 1993; "Computer Analysis of Sequence Data" part I, Griffin A.M. and Griffin H.G., eds., Humana Press, New Jersey (1994); "Sequence Analysis in Molecular Biology" von Heinje, G., Academic Press (1987); "Sequence Analysis Primer" Gribskov M. and Devereux J., eds., Stockton Press, New York (1991); and Carillo H. and Lipman D., SIAM J Applied Math, 48: 1073 (1988). The methods to determine the identity are designed to give maximum coupling between the tested sequences. In addition, methods for determining identity are encoded in publicly available programs. Computer programs that can be used to determine the identity between two sequences include, without limitation, GCG (Devereux J. et al., Nucleic Acids Research 12 (1): 387 (1984); series of five BLAST programs, three designed for questions of nucleotide sequences (BLASTN, BLASTX and TBLASTX), and two designed for questions of protein sequences (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology, 12: 76-80 (1994); Birren et al., Genome Analysis , 1: 543-559 (1997).) The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul S. et al., NCBI NLM NIH, Bethesda, Maryland 20894, Altschul et al., J. Mol. Biol. 215: 403-410 (1990).) The well-known Smith Waterman algorithm can also be used to determine identity.

The parameters for polypeptide sequence comparison typically include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970). Comparison matrix: BLOSSUM62 by Hentikoff and Hentikoff, Proc. Nati Acad. Sci. USA 89: 10915-10919 (1992). Space Penalty: 12. Space length penalty: 4. A program that can be used with these parameters is publicly available as the "gap" program of Genetics Computter Group, Madison Wisconsin. The parameters above along with absence of penalty for final space are the default parameters for peptide comparisons. The parameters for polynucleotide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970). Comparison matrix: couplings = +10; decoupling = 0. Space penalty: 50. Space length penalty: 3. A program that can be used with these parameters is publicly available as the "clear" program from Genetics Computter Group, Madison Wisconsin. The parameters above are the default parameters for nucleic acid comparisons. The invention also includes polypeptides of the formula: X- (R?) N- (R2) - (R3) nY wherein, at the amino terminus, X is hydrogen, and at the carboxyl terminus, Y is hydrogen or a metal, Ri and R3 are any amino acid residue, n is an integer between 1 and 1000, and R2 is an amino acid sequence of the invention, particularly an amino acid sequence selected from the group described in the sequence listing, and preferably SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 and 16. In the formula, R2 is oriented in such a way that its amino terminal residue is on the left, joined to Ri, and its terminal carboxyl residue is in the right, joined to R3. Any extension of amino acid residues denoted by any group R, wherein R is greater than 1, can be a heteropolymer or a homopolymer, preferably a heteropolymer. The polypeptides of the present invention include isolated polypeptides encoded by a polynucleotide comprising a sequence selected from the group sequences contained in the sequence listing described herein. The polypeptides of the present invention can be a mature protein or can be part of a fusion protein. Fragments and variants of the polypeptides are also considered as part of the invention. A fragment is a variant polypeptide having an amino acid sequence that is completely the same as a part, but not all, of the amino acid sequence of the polypeptides previously described. The fragments may be "alone" or comprised within a larger polypeptide of which the fragment forms a part or a region, most preferably as a single continuous region. Preferred fragments are biologically active fragments which are those fragments that mediate the activities of the polypeptides of the invention, including those with similar activity or improved activity or with reduced activity. Also included are fragments that are antigenic or immunogenic in an animal, particularly in a human. Variants of the polypeptides also include polypeptides that vary from the sequences described in the sequence listing by conservative amino acid substitutions, substitution of one residue by another with similar characteristics. In general, said substitutions are between Ala, Val, Leu e lie; between Ser and Thr; between Asp and Glu; between Asn and Gln; between Lys and Arg; or between Phe and Tyr. Particularly preferred are variants in which 5 to 10; 1 to 5; 1 to 3; or an amino acid (s) are substituted, deleted or added, in any combination. Variants that are fragments of the polypeptides of the invention can be used to produce the corresponding full length polypeptide by peptide synthesis. Thus, these variants can be used as intermediates in the production of the full-length polypeptides of the invention. The polynucleotides and polypeptides of the invention can be used, for example, in the transformation of host cells, such as plant host cells, as further described herein. The invention also provides polynucleotides that encode a polypeptide that is a mature protein plus additional amino- or carboxyl-terminal amino acids, or amino acids within the mature polypeptide (eg, when the mature form of the protein has more than one polypeptide chain). Such sequences may, for example, have a function in the processing of a protein from a precursor to a mature form, allow the transport of the protein, shorten or lengthen the half-life of the protein, or facilitate the manipulation of the protein in trials or production. It is contemplated that cellular enzymes may be used to remove any additional amino acid from the mature protein. A precursor protein, having the mature form of the polypeptide fused to one or more prosequences, may be an inactive form of the polypeptide. Inactive precursors are usually activated when the prosequences are removed. Some or all of the prosequences can be removed before activation. Such precursor proteins are generally referred to as proproteins. For immunological screening, antibodies to the jojoba wax synthase can be prepared by injecting rabbits or mice with the purified protein. Methods for preparing antibodies are well known to those skilled in the art, and companies that specialize in the production of antibodies are also available. Antibodies can be produced either monoclonal or polyclonal, although typically polyclonal antibodies are more useful for gene isolation. To select the desired plant species, Western analysis is conducted to determine that a related protein is present in a crude extract of said desired plant species, which cross-react with the jojoba wax synthase antibodies. This is achieved by immobilizing the proteins of the plant extract to a membrane, usually nitrocellulose, followed by electrophoresis, and incubation with the antibody. Many different systems are available for detection of the antibody / protein complex on nitrocellulose filters, including radiolabelled antibody and second antibody / enzyme conjugated systems. Some of the available systems have been described by Oberfelder (Focus (1989) BRL / Life Technologies, Inc. 77: 1-5). If the initial experiments fail to detect a related protein, other detection systems and blocking agents can be used. When cross-reactivity is observed, the genes encoding related proteins can be isolated by selection of expression libraries that represent the desired plant species. Expression libraries can be constructed in a variety of commercially available vectors, including lambda gt11, as described in Maniatis, et al. (previously mentioned). Clones identified as described above using DNA for hybridization or immunological screening techniques are purified and the DNA is isolated and analyzed using known techniques. In this way, it is verified that the clones encode a related wax synthase protein. Other wax synthases can be obtained through the use of "new" wax synthases in the same way as jojoba wax synthase was used. Alternatively, databases containing amino acid and nucleic acid sequences from various organisms with the sequences of the present invention can be investigated to identify similar sequences. Surprisingly, using the jojoba wax protein synthase sequence to search a database containing Arabidopsis DNA sequences, a sequence of approximately 12 kb was identified that contains at least seven repeated regions of a reading frame with high similarity to the jojoba sequence. The deduced amino acid sequences demonstrate a high level of homology with the amino acid sequence of jojoba wax synthase. For example, comparisons between the amino acid sequence of jojoba wax synthase and the sequences obtained from the Arabidopsis homologs reveal a range of identity between amino acids of about 36% to about 44%. Thus, as shown here, a homologous similarity (identity + similarity) of at least 52% is shown in the protein sequence comparisons between the jojoba and Arabidopsis sequences. It will be recognized by one skilled in the art that the wax synthase nucleic acid sequences of this invention can be modified using standard site-specific mutation techniques or PCR, or modification of the sequence can be achieved to produce a synthetic nucleic acid sequence. These modified sequences are also considered wax synthase nucleic acid sequences of this invention. For example, the mobile positions in the codons can be changed so that the nucleic acid sequence encodes the same amino acid sequence, or alternatively, the codons can be altered so as to result in substitution of conservative amino acids. In each case, the peptide or protein maintains the desired enzymatic activity and is therefore considered part of the present invention. A nucleic acid sequence of a wax synthase enzyme of this invention can be a DNA or RNA sequence, derived from genomic DNA, cDNA, mRNA, or can be synthesized in whole or in parts. Gene sequences can be cloned, for example, by isolating the genomic DNA from an appropriate source, and amplifying and cloning the sequence of interest using a polymerase chain reaction (PCR). Alternatively, gene sequences can be synthesized, either completely or in part, especially where it is desirable to provide plants with the preferred sequences. Thus, all or a portion of the desired structural gene (that portion of the gene encoding the wax protein synthase) can be synthesized using preferred codons by a selected host. The preferred codons of the host can be determined, for example, from the codons most frequently used in the proteins expressed in the desired host species. The nucleic acid sequences associated with wax synthase proteins will find many uses. For example, recombinant constructs can be prepared which can be used as probes or will provide for the expression of wax protein synthase in host cells. Depending on the intended use, the constructs may contain the sequence encoding the complete wax synthase, or a portion thereof. For example, the critical regions of the wax synthase, such as the active site, can be identified. Thus, additional constructions containing only a portion of the wax synthase sequence encoding the amino acids necessary for a desired wax synthase activity can be prepared. Systems useful for the expression of the wax synthase sequence of this invention include prokaryotic cells, such as E. coli, yeast cells, and plant cells, both vascular and non-vascular plant cells being these desired hosts. In this manner, the wax slntase protein can be produced to allow additional studies, such as site-specific mutagenesis of coding sequences to analyze the effects of specific mutations on the reactive properties of wax protein synthase. The DNA sequence encoding the wax synthase of this invention can be combined with external DNA sequences in a variety of ways. By "external" DNA sequences it refers to any DNA sequence that is not naturally attached to the wax synthase sequence, including DNA sequences from the same organism that are not naturally bound to the wax synthase sequence. Both sense and antisense constructs using sequences encoding wax synthase are considered, wherein the sense sequence can be used for the expression of the wax synthase in a host cell, and the antisense sequences can be used to decrease the endogenous levels of the protein synthase of homologous wax naturally produced by a white organism. In addition, the wax synthase gene sequence of this invention can be employed in an external host in conjunction with all or part of the sequences that are normally associated with wax synthase, such as regulatory sequences or membrane directed sequences. In its component parts, a DNA sequence encoding wax synthase is combined in a recombinant construct having, in the direction of transcription 5 'to 3', a transcription initiation control region capable of promoting transcription and translation into a host cell, the nucleic acid sequence encoding wax synthase and a transcription termination region. Depending on the host, the regulatory regions will vary, and may include regions of viral, plasmid or chromosome genes, or the like. For expression in prokaryotic or eukaryotic organisms, particularly unicellular hosts, a wide variety of constitutive or regulatory promoters may be employed. Expression in a microorganism can provide an easy source of plant enzyme. Among the regions of initiation of transcription that have been described are the regions of bacterial and yeast hosts, such as E. coii, B. subtilis, Saccharomyces cerevisiae, including genes such as beta-galactosidase, T7 polyme-asa, tryptophan E and similar. For the most part, the recombinant constructs will involve functional regulatory regions in plants which are provided for the expression of the ceasease wax gene to produce functional wax protein synthase. The open reading frame, which encodes the vegetable wax synthase or a functional fragment thereof, will be linked at its 5 'end to a regulatory region of the start of transcription such as the wild-type sequence that is naturally found at the end of the transcript. 5 'end in the structural gene of era synthase. Numerous promoter regions of the genes of native plants are available which provide a wide variety of constitutive or regulatory expression of the structural gene sequences. In addition to the sequences from the genes of the native plants, other sequences can be provided for the expression of constitutive genes in plants, such as the regulatory regions associated with Agrobacterium genes, including the regions associated with the nopaiinsynthase genes, (Nos. ), manopinsintasa (Mas), or octopinsintasa (Oes). Regions that control the expression of viral genes, such as regions 355 and 19S of cauliflower mosaic virus (CaMV), are also useful. The term "constitutive" as used herein does not necessarily indicate that a gene is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types, although some variations in abundance are frequently detected. Other transcription initiation regions are provided which are preferably useful for transcription in certain tissues or under certain growth conditions, such as those of napin, seed or leaf ACP, the small subunit of RUBISCO, and the like. In embodiments where expression of the wax protein synthase in a plant host is desired, the use of all or part of the complete plant wax synthase gene may be desired, ie the 5 'non-coding region (promoter) may be used together with the regions of the structural gene sequence and the 3 'non-coding region. If a different promoter is desired, such as a native promoter of the host plant of interest or a modified promoter, i.e., having transcription initiation regions derived from a gene source and translation initiation regions derived from a different gene source or improved promoters, such as the 25S CaMV double promoters, the sequences can be joined using standard techniques. Additionally, the 5 'untranslated regions from highly expressed plant genes can be used to provide increased expression of the wax synthase proteins described herein. The DNA constructs that are provided for the expression of wax synthase in plants can be employed with a wide variety of plant life, particularly plants that produce the fatty acyl-CoA substrates of the wax synthase enzyme, such as Brassica. Other plants of interest produce desirable acyl fatty substrates, such as long or medium chain fatty acyl molecules, and include but are not limited to rapeseed (Cañóla varieties), sunflower, safflower, cotton, Cuphea, soybean, peanut, palms of coconut and oil, and corn. Of particular interest is the use of such constructions in high erric acid rapeseed (HEAR) varieties for the production of long-chain liquid waxes. Additional uses contemplated for HEAR plants include the production of varieties that contain substantially increased levels of erusic acid as a result of providing an additional "deposit" of erusic acid wax, which is normally stored in the TAG seeds. Also for the fatty alcohol substrate of the wax synthase enzyme, other than jojoba, other vegetable seeds are known which produce large amounts of fatty alcohols, although small amounts of this substrate may be available for the wax synthase enzyme. Therefore, in conjunction with the wax synthase constructs of this invention, it is desirable to provide the white host cell with the ability to produce fatty alcohols from the fatty acyl molecules present in the host cells. For example, a fatty acid acyl reductase and methods for providing the expression of the reductase enzymes in plant cells are described in USPN 5,370,996. The nucleic acid sequence and translated amino acid sequence of jojoba reductase is provided in Figure 1 of that patent. Thus, by providing both wax synthase and reductase proteins to host plant cells, wax esters can be produced from fatty alcohol and fatty acyl substrates. In addition, expression of ß-ketoacyl-CoA synthase in conjunction with the expression of wax synthase and reductase proteins is considered in the present invention. In this way, the production of long-chain fatty acid substrates for these enzymes in the white plant species can be increased. In addition to the jojoba reductase, the reductase enzymes of other organisms may be useful in conjunction with the wax synthase of this invention. Other potential sources of reductase enzymes include Euglena, Acinetobacter, Micrococus, certain insects and marine organisms, and specialized mammals or tissues of birds known to contain wax esters, such as meibomian bovine glands or bird uropigial glands. Other potential sources of reductase proteins can be identified by their ability to produce fatty alcohols or, if wax synthase is present, wax esters.

The wax synthase and reductase sequences may be provided during the same transformation event, or alternatively, in two different transgenic plant lines, one having the construction of the wax synthase and the other having the reductase construction which it can be produced by transformation with the various constructions. These plant lines can be crossed using known plant cross-linking techniques to provide plants containing wax synthase and reductase for the production of wax ester products. In addition, other nucleic acid sequences encoding enzymes involved in the formation of very long chain fatty acids can also be used in the DNA constructs of the present invention for the production of wax esters in a host plant. Said nucleic acid sequences are known in the art and are described in the patent of E.U.A. No. 5,679,881. For example, as described in the examples below, the wax synthase of the present invention is used in plant expression constructs in conjunction with nucleic acid sequences encoding for fatty acid elongase (described in USPN 5,679,881, ia whole of which is incorporated herein by reference) and an acyl-CoA reductase (described in USPN 5,403,918, the entirety of which is incorporated herein by reference). Said plant expression constructions are provided for the production of wax esters in transgenic Arabidopsis thaliana plants.

For the applications that lead to the production of wax esters, the 5 'non-coding regions obtained from the genes regulated during the maturation of the seed are desired, especially those expressed preferentially in vegetable embryonic tissue, such as the regions derived from ACP, oleosin (Lee and Huang (1991) Plant Physiol. 96 / 1395-1397) and the regulatory regions of napin. The regions of initiation of transcription that are provided for preferential expression in seed tissues, ie, which are not detected in other plant parts, are considered desirable for the production of wax esters in order to minimize any effect of alteration or that is adverse to gene production in other plant parts. In addition, the seeds of these plants can be harvested and the lipid reserves of these seeds can be harvested to provide an easy source of wax esters. Thus, a novel seed product can be produced in plants with oily seeds which, in the absence of transformation with the wax synthase constructs as described herein, are not known to produce wax esters as a component of the lipid reserves of their seeds. Said "seed specific promoters" can be obtained and used in accordance with the teachings of USPN 5,420,034 and USPN 5,430,194. In addition, where the plant genes, such as jojoba reductase and wax synthase, are expressed, it may be desirable to use the complete plant gene, including the 5 'and 3' regulatory regions and any intron that is present in the coding sequence. , for the expression of jojoba genes in transformed plant species, such as Arabidopsis or Brassica. The regulatory regions of transcription termination can also be provided in recombinant constructs of this invention. The transcription termination regions may be provided by the DNA sequence encoding the plant wax synthase or a convenient transcription termination region derived from a different gene source, especially the transcription termination region which is naturally associates with the region of the beginning of transcription. The term region of the transcript will contain at least about 0.5 kb, preferably about 1-3 kb, of a 3 'sequence of the structural gene from which the termination region is derived. When the expression of wax synthase, as well as other genes involved in wax synthesis, is targeted in other plant tissues, additional promoters can be used in the construction of the present invention. For example, where preferential expression of genes in pollen is desired, the promoter regions may be employed, for example, RopIAt (Li, et al., 81998) Plant Phyiol. 118-407-417) and others described by Hamilton, et al. (1998) Plant Mol Biol. 38 (4) 663-669. Where preferential expression in the epidermis is desired, promoter regions such as Ntltpl may be employed (Canevascini, et al (1996) Plant Phyiol, 112: 513-524).

The additional plant gene regions can be used to optimize the expression of the wax synthase and reductase genes in plant tissues. For example, the 5 'untranslated regions of highly expressed genes, such as that of the small subunit (SSU) of RuBP-carboxylase, inserted 5' of the DNA coding sequence can provide improved translation efficiency. Portions of the region encoding the SSU leader protein (such as that encoding the first 6 amino acids) can also be used in such constructs. In addition, for applications where targeting to plant organelles plastids is desired, the sequences encoding the transit peptide of SSU or other core proteins encoded by the chloroplast can be used in conjunction with the wax synthase and reductase sequences. Depending on the method of introduction of the DNA expression construct into the host cell, other DNA sequences may be required. Importantly, this invention is applicable to similar dicotyledonous and monocotyledonous species and will be readily applicable to novel and / or improved techniques for transformation and regeneration. To develop the recombinant construct, the various components of the construct or fragments thereof will normally be inserted into a convenient cloning vector that is capable of replication in a host bacterium, e.g., E. coli. Numerous vectors exist that have been described in the literature. After each cloning, the plasmid can be isolated and subjected to further manipulation, such as restriction, insertion of new fragments, ligation, deletion, insertion, resection, etc., so as to carry the components of the desired sequence. Once the construction has been completed, it can then be transferred to an appropriate vector for further manipulation according to the manner of transformation of the host cell. Normally, within the construction of DNA will be included a structural gene that has the regulatory region necessary for expression in a host and will provide the selection of the transforming cells. The gene can provide resistance to a cytotoxic agent, for example antibiotic, heavy metal, toxin, etc., providing complementation of prototrophy to an auxotrophic host, viral immunity or the like. Similarly, genes encoding enzymes that provide for the production of a compound identifiable by its color change, such as GUS, or luminescence, such as luciferase, are useful. Depending on the number of different host species the expression construction or components thereof will be introduced, one or more markers may be used, where different selection conditions are used for different hosts. In addition to the sequences that are provided for the transcription of the wax synthase sequences, the DNA constructs of this invention are also provided for the expression of an additional gene or genes, whose protein product can act in conjunction with the wax synthase. to produce a valuable final product. For example, as discussed above, DNA constructs that provide for the expression of wax synthase and fatty acyl reductase are considered in this invention so that wax esters can be produced in the transformed cells. The constructs can also provide for the expression of a third gene encoding, for example β-ketoacyl-CoA synthase (KCS). In addition, the production of different wax esters having varying lengths of carbon chain and varying degrees of saturation is desired and can be provided by transforming host plants having fatty alcohol or fatty acyl substrates with varying chain lengths. Said plants can be provided, for example, by methods described in the international patent application published under PCT number WO 91/1642, which describes various thioesterase genes and methods for using said genes to produce fatty acyl substrates having varying chain lengths in transformed plant hosts. In addition, to optimize the production of wax esters in the oily seeds of host plants, one may wish to decrease the production of triacylglycerols that are normally produced in the seeds of said plants. One method to achieve this is to make an antisense of a critical gene in this process, but not necessary for the production of wax esters. Said white gene includes the acyltransferase of diacylglycerol, and other enzymes that catalyze the synthesis of triacylglycerol. Additionally, it may be desirable to provide plants with oily seeds with enzymes that can be used to degrade wax esters as a source of nutrients, such as can be isolated from jojoba or various other wax producing organisms. In this way, the maximum production of wax esters in the seeds of plant hosts can be achieved. In addition, by modifying wax synthesis systems within plants that do not normally produce wax, it may be possible to increase the production of novel fatty acids. For example, there may be intrinsic limitations in the triacylglycerides of oily seeds and in the synthesis of phospholipids which prefer specific fatty acids for a given position in the glycerol backbone. Therefore, plants modified to produce an "exotic" fatty acid can be limited in the amount of production of that fatty acid due to the limitations of positions in the glycerol backbone, thus, by introducing a wax synthesis system within a plant, it may be possible to increase the amount of an "exotic" fatty acid produced to provide an alternative fatty acid source. In addition, it is possible to increase the amount of an "exotic" fatty acid using a wax synthesis system derived from a source that stimulates the wax esters which are composed of said fatty acids. For example, by using a wax synthase from Euglena, it is possible to increase the amount of C12 fatty acids. In addition, the introduction of a wax synthesis system into oil producing plants can allow a further increase in the amount of oil produced as a component of the host cells. To express a wax synthesis system in an oil-producing plant tissue, such as in an oilseed, it is possible to further increase the amount of oil produced in said fabric, by using the native oil production, such as through the synthesis of diacylglycerol, and the synthesis of wax introduced. The wax esters produced in the methods described herein can be harvested using techniques for extraction of wax from jojoba or by various production methods used to obtain oily products from various crops with oily seeds. The waxes thus obtained will find application in many industries, including pharmaceuticals, cosmetics, detergents, plastics, food applications and lubricants. The applications will vary depending on the chain length and the degree of saturation of the wax ester components. For example, long chain waxes having a double bond in each of the carbon chains are liquid at room temperature, while waxes having saturated carbon chain components can be solid at room temperature, especially if the Saturated carbon chains are longer than carbon chains. The wax esters thus produced can be used as a source to obtain fatty alcohols for use in a variety of applications. Methods for the production of fatty alcohols from wax esters are known in the art, and are described for example by Duncan, et al. (1974) J. Am. Oil Chem. Soc. 51 (12): 534-536. Fatty alcohols find their use in a variety of applications known to those skilled in the art, and include but are not limited to detergents, lubricants, corrosion inhibitors, plasticizers, cosmetics, emulsifiers, and for use in pharmaceutical compositions. The fatty alcohols produced can be saturated and unsaturated, and preferably include short-chain fatty alcohols, medium-chain fatty alcohols and long-chain fatty alcohols, medium and short chain fatty alcohols are more preferred, more especially preferred are fatty alcohols long chain In addition, the production of transgenic plants that produce wax esters in the epidermal cell layers provides improved tolerance to environmental stress, such as drought tolerance, as well as pathogens and insect tolerance. Such papers for epicuticular waxes are known in the art, and are reviewed, for example Post-Beittenmiller (1996) Annu. Rev. Plant Physiol. Plant Mol. Biol. 47: 405-430 and Jeffree (1968) Insects and the Plant Surface (Southwood and Juniper, eds) 23-64 (Edward Arnold). The method for transformation is not critical to the present invention; Currently several plant transformation methods are available. As new methods are available to transform crops, they can be applied directly here. For example, many plant species naturally susceptible to infection by Agrobacterium can be successfully transformed via tripartite or binary vector methods of transformation mediated by Agrobacterium. Other sequences useful for providing the transfer of nucleic acid sequences to host plant cells can be derived from plant pathogenic viruses or plant transposon elements. In addition, the techniques of microinjection, bombardment of DNA particles, electroporation have been developed that allow the transformation of several monocotyledonous and dicotyledonous plant species. The invention now generally described will be more readily understood with reference to the following examples, which are included for purposes of illustration only and are not intended to limit the invention unless it is established.

EXAMPLES EXAMPLE 1 Wax Synthase Assays Methods for the assay of wax synthase activity in preparations of microsomal membranes or in solubilized protein preparations are described.

A. Radiolabelled Material The substrate that was generally used in the wax synthase assays was [1-14C] palmitoyl-CoA, which was obtained from Amersham (Arlington Heights, IL). Other long chain substrates were synthesized in order to carry out chain length specification studies. The long chain fatty acids [1-14 C] (specific activity 51-56 Ci / moi), ie 11-cis-eicosenoic acid, 13-cis-docosenoic acid and 15-cis-tetracosenoic acid were prepared by the reaction of [14 C] potassium cyanide with the corresponding alcohol mesylate, followed by the basic hydrolysis of alcohol nitrile to the free fatty acid. The free fatty acids were converted to their methyl esters with ether diazomethane, and purified for preparative thin layer chromatography on silver nitrate (TLC). The methyl ethers of the fatty acids were hydrolyzed back to free fatty acids. The radiochemical purity was evaluated by 3 TLC methods: normal TLC in silica phase, TLC in silver nitrate, and C18 reverse phase TLC. The radiochemical purity as measured by these methods was 93-98%. The long chain [1-14C] aciI-CoA are prepared from the corresponding free fatty acids [1-14C] by the method of Young and Lynen (J. Bio, Chem. (1969) 244: 377), with the specific activity of 10Ci / mol. [1-14C] hexadecanal is prepared by the oxidation of [1-14C] hexadecan-1-ol dichromate, in accordance with the microscale modification of the Pletcher and Tate method (Tet Lett. (1978) 1601-1602) . The product is purified by preparative TLC on silica, and stored as a solution in hexane at -70 ° C until use.

B. Assay for wax synthase activity in a microsomal membrane preparation Wax synthase activity in a microsomal membrane preparation is measured by incubation of 40 μM [1-14C] acyl-CoA (usually palmitoyl-CoA, sp. act 5.1-5.6 mCi / mmol) and 200 mM oleyl alcohol with the sample that will be evaluated in a total volume of 0.25 ml. The incubation mixture also contains either 25 mM HEPES (4- [2-hydroxyethyl] -1-p-piperazineethane-sulfonic acid), pH 7.5, and the 20% w / v glycerol buffer, 1 mM DTT, 0.5 NaCl M or 25 mM Tricine-NaOH, pH 7.8, as the buffering agent with NaCI 0.28M, 10% glycerol and 2mM β-mercaptoethanol. Initial studies were carried out with the first buffer system, when the pH was chosen to accommodate the preference of the acyl-CoA reductase enzyme. The membrane preparations were subsequently changed to the second buffer system to accommodate the optimum pH higher for the wax synthase. A mixture of the substrate is prepared in a glass vial, with an oleyl alcohol being added immediately after use, and added to the samples. The incubation is carried out at 30 ° C for more than one hour. The test is completed by placing the test tube on ice and immediately adding 0.25 ml of isopropanol: acetic acid (4: 1 w / v). Unlabeled wax esters (0.1 mg) and oleyl alcohol (0.1 mg) are added as vehicles. Lipids [14C] are extracted by the lower scale protocol of Hara and Radin (Anal. Biochem. (1978) 90: 420). Two ml of hexane / isopropanol (3: 2 w / v) are added to the finished tests. The sample is mixed, 1 ml of aqueous sodium sulfate solution (6.6% w / v) is added, and the sample is mixed again.

C. Assay for solubilized wax synthase activity Solubilized wax synthase was assayed using a sample of more than 50 μl in a 250 μl assay containing 1-14C-16: 0 CoA 40 μM (5 Ci / mol) , 18: 1 -OH 200 μM, soy phospholipid 0.07% (Sigma, P-3644), CHAPS 0.2%, NaCl 280 mM, Tricine-NaOH 25 mM, pH 7.8, ß-ME 2mM and glycerol 5.6%. The phospholipid (50 mg / ml in CHAPS 0.5%) was added directly to the sample, which is 1% CHAPS, then diluted in a mixture containing the components of the remaining test. Reconstitution of activity is assumed based on the incorporation of wax synthase into the phospholipid vesicles. The wax synthase is sensitive and requires the amount of phospholipid (PL) and detergent (CHAPS) to balance to 2.8 / 1 (CHAPS / PL, w / w) in the assay for maximum activity. Assays for the wax synthase activity in the concentrated samples by ultrafiltration require a readjustment in the sample volume tested due to the CHAPS concentrations. Introducing too much CHAPS into the assay results in inhibition of activity. If the samples are concentrated by ultracentrifugation, the optimum volume of the sample to be tested can be restored by carrying out a concentration curve of% CHAPS using a small amount of sample and testing a fixed concentration of phospholipid and sodium chloride. Wax synthase is less sensitive to changes in PC concentration than it is to changes in CHAPS concentration.

D. Assay product analysis To analyze the products from either the microsomal membrane preparation for the wax synthase assay or for the solubilized wax synthase assay, two protocols were developed. A protocol, described below as "extensive testing" is more time consuming, but produces larger quantitative results. The other protocol, described below as "rapid assay" also provides a measure for the wax synthase activity, but is faster, more convenient and less quantitative. 1. Extensive analysis: Following the addition of sodium sulfate and the sample mixture, the upper organic phase is removed and the lower aqueous phase is washed with 4 ml hexane / isopropanol (7: 2 w / w). The organic phases are pooled and evaporated to dry under nitrogen. The lipid residue is resuspended in a small volume of hexane, and an aliquot is assayed for radioactivity by liquid scintillation counter. The remnant of the sample can be used for TLC analysis of the labeled classes and therefore gives a measure of the total wax production.

For the analysis of the lipid class the sample is applied to a TLC plate on silica, and the plate is developed in hexane / diethyl ether / acetic acid (80: 20: 1 or 70: 30: 2 w / w / p). The distribution of radioactivity between the lipid classes, long wax esters, free fatty acids, fatty alcohols and polar liquid at the origin, was measured using a radioanalytical imaging system AMBIS (AMBIS Systems Inc., San Diego, CA). If necessary, the individual lipid classes were recovered from the TLC plate for further analysis. Reverse phase systems were also used for this analysis using C18 plates that were developed in methanol. 2. Rapid analysis: Following the addition of sodium sulfate and the sample mixture, a known percentage of the organic phase was removed and counted via a liquid scintillation counter. This calculation is used to estimate the total count in the organic phase. Another portion of the organic phase was removed, dried under nitrogen, redissolved in hexane and applied to TLC plants and developed and evaluated as described for detailed tests. In this way, the percentage of total count that was incorporated into the wax was determined.

EXAMPLE 2 Additional study to characterize wax synthase activity A. Seed development and wax synthase activity profiles Embryonic development was plotted for two summers over five plants in Davis, CA. Weights of dry and fresh embryos were found to increase at a barely stable rate from day 80 to around day 130. Lipid extractions revealed that when the fresh embryo weight reaches around 300 mg (around day) 80), the ratio of lipid weights to dry weight reaches the maximum level of 50%. The synthase activity was measured in the developing embryos as described in example 1B. Since it was determined that the covers of the jojoba seed are the source of inhibitory factors, the seed coatings were removed before freezing the embryos in liquid nitrogen for storage at -70 ° C. Development profiles for wax synthase activities were measured either in cell-free homogenates or in a membrane fraction, indicating a large induction in activity with peaks approximately 110-115 days after anthesis. Then embryos for enzymatic studies were harvested between about 90 to 110 days post-synthesis, a period when the wax synthesis activity is high, the lipid deposition has not reached its maximum levels, and the seed coat is easily removed. . The maximum rate of increase in wax synthase activity is observed between days 80 and 90 post-synthesis. The embryos for the construction of the cDNA library were harvested between about 80 to 90 days post-synthesis when presumably the synthesis rate of the wax protein synthase could be maximal. Correspondingly, the level of mRNA coding for wax synthase could be presumed to be maximum at this stage.

B. Preparation of the microsomal membrane Jojoba embryos were harvested approximately 90-110 days after flowering, as estimated when measuring the water content of the embryos (45-70%). The outer covers and covers of seeds and cotyledons were rapidly frozen in liquid nitrogen and stored at -70 ° C for future use. For the initial protein preparation, the frozen embryos were pulverized by grinding them in a steel mortar at liquid nitrogen temperature. In a typical experiment, 70 g of the embryos were processed. The powder is added, at a ratio of 280 ml of solution per 70 g of embryos, to the following solution with high salt content: 3M NaCl, 0.3 M sucrose, 100 mM HEPES, 2 mM DTT, and protease inhibitors, EDTA 1 mM, leupeptin 0.7 mg / ml, pepstatin 0.5 mg / ml and PMSF 17 mg / ml. A cell-free homogenate (CFH) is formed by dispersing the sprayed embryo in the buffer with a tissue homogenizer (Kinematica, Switzerland, model PT10 / 35) for approximately 30 seconds and then filtered through three layers of Miracloth (CalBioChem , LaJolla, CA). The filtrate is centrifuged at 100,000 x g for one hour. The resulting sample consists of a concentrate, supernatant and a floating fat pad. The fat pad is removed and the supernatant fraction collected and dialyzed overnight (with three changes of buffer solution) against a solution containing 1 M NaCl, 100 mM HEPES, 2 mM DTT and 0.5 M EDTA. centrifuge at 200,000 xg for 1 1/2 hours to produce a concentrate, DP2. The concentrate is suspended in 25 mM HEPES and 10% glycerol, at 1/20 of original CFH volume, to yield the microsomal membrane preparation. The activity is assayed as described in example 1. The recovery of wax synthase activity is estimated at 34% of the original activity in the cell-free homogenate. The wax synthase activity in this preparation is stable when stored at -70 ° C.

C. Substrate Specificity Acyl-CoA and alcohol substrates having varying carbon chain lengths and degrees of unsaturation were added to the microsomal membrane fractions prepared as described above to determine the range of substrates recognized by the wax synthase of jojoba The acyl-CoA and alcohol substrates having varying carbon chain lengths and degrees of unsaturation were added to the microsomal membrane fractions prepared as described in Example 3A to determine the range of substrates recognized by jojoba wax synthase. The tests were carried out as described in example 1B using the tricine buffer system with the following change, both the acyl-CoA and alcohol concentrations were 40 μM instead of the 200 μM alcohol concentrations normally used. . Acyl-CoA were prepared as storage solutions at 2.5 mM (in buffer of 1.25 mM Na acetate pH 4.8 and CHAPS 1.5%) and 4 μl of these storage solutions were used in a 250 μL assay to make the final concentration of CHAPS 0.024% o. Without the addition of detergent, the long saturated chains of acyl-CoA could not dissolve in the buffer. The alcohols were prepared as storage solutions in 25 mM 2-methoxyethanol and 0.4 μl of the storage solution was used in the 250 μl assay. To evaluate the specificity acyl-CoA, 1-14C-hexadecanol (10.3 mCi / mmoles, Sigma 31, 326-2) was used as a substrate. The hexadecanol 1-14C- which was obtained was only 62% pure and had to be further purified by thin layer chromatography before use. The product was placed on a TLC plate of glass silica gel and migrated in hexane: diethyl ether: acetic acid (70: 30: 2). The unlabeled alcohol was placed online and was used to identify the migration levels of the radio-labeled products. The TLC plate was briefly exposed to iodide vapors to identify the location of the alcohol. The 1-14-C-hexadecanoI site was scraped from the TLC plate and transferred to a new vial. The product was eluted from the silica with hexane / isopropanol and the organic extract was filtered to remove the silica. The filtered solvent was transferred to a new vial where the solvent was evaporated to dry. The final product was recovered in 2-methoxyethanol at a concentration of 0.15 μCi / μl. The final product appears to be 100% pure by TLC in the previous solvent system. 1-14C-16: 0-CoA was as described in Example 1. The results of these experiments are presented in Table 1 below.

TABLE 1 Structure Acyl group Alcohol group pmol / min / mg 8: 0 147.5 2656.3 10: 0 197.8 2396.8 12: 0 345.5 5663.4 14: 0 1584.6 4919.1 16: 0 1533.8 5250.6 18: 0 1693.8 2557.9 20: 0 1373.2 1666.4 22: 0 1196.6 1555.9 24: 0 1308.3 2582.0 18: 1 9- c 821.9 12623.8 18: 1 9-t nd 12600.2 18: 1 11-c nd 12147.6 18: 1 11-t nd 13739.4 18: 2 9-c, 12-c 198.8 11344.2 18: 2 9-2, 12-c, 15-c 516.1 nd 20: 1 11-c 3880.1 6172.4 22: 1 13-c 916.8 2783.0 22: 1 13-t nd 1862.0 24: 1 15-c 1794.0 1576.3 For comparison purposes it is desirable to evaluate acyl-CoA and alcohol at equivalent concentrations, however, in practice there is an endogenous grouping of the alcohol present in the microsomal jojoba fractions of unknown concentration. This pool dilutes the labeled hexadecanol 14C used to evaluate the acyl-CoA product of some of the waxes formed in a non-detectable manner. The result is an underestimation of the specific activity for all acyl-CoA relative to the specific activities of the alcohols. The above results demonstrate that jojoba wax synthase uses a wide range of fatty acyl-CoA and fatty alcohol as substrates. 2 In addition, the activity of wax synthase towards various acyl thioester substrates was similarly tested using palmitoyl-CoA, palmitoyl-ACP and N-acetyl-S-palmitoylcysteamine as acyl substrates. The highest activity was observed with the acyl-CoA substrate. Significant activity (~ 10% of that with acyl-CoA) was observed with acyl-ACP, but no activity was detected with the substrate N-acetyl-S-palmitoylcysteamine.

D. Effectors of activity Various sulfhydryl agents were selected for their effects on wax synthase activity. It was shown that organomercury compounds strongly inhibit activity, lodoacetamide and N-ethylmaleimide were much less effective. The inhibition by para-hydroxymercuribenzoate was observed, but this inhibition could be reversed by the subsequent addition of DTT. These results demonstrate that inhibition by para-hydroxymercuribenzoate involves the blocking of an essential sulfhydryl group.

EXAMPLE 3 Purification of jojoba wax synthase Methods that can be used for isolation of the jojoba membrane preparation having wax synthase activity, solubilization of wax synthase activity, and further purification of wax protein synthase are described.

A. Preparation of the microsomal membrane The following modification of the method described in Example 2 is employed and an improved membrane fraction useful for the purification of wax synthase from solubilized membranes is provided. Typically, 100 g of jojoba embryos are added to 400 ml of extraction buffer (40 mM tricine-NaOH, pH 7.8, 200 mM KCl, 10 mM EDTA, 5 mM β-mercaptoethanol), mixed in a mixer, and homogenize with a Polytron tissue disruptor. All subsequent steps are carried out at 4 ° C. The mixed material is filtered through Miracloth (CalBioChem). The centrifugation (20,000 x g, 20 min) of the filtrate produces a layer of floating wax, a cloudy supernatant fraction and a dark green concentrate. The supernatant fraction is collected and centrifuged (100,000 xg, 2 h) to obtain membrane concentrations that are resuspended in 40 ml of buffer A (25 mM tricine-NaOH, pH 7.8, 200 mM KCl, 5 mM EDTA, β-mercaptoethanol 5 mM) containing 50% (w / w) of sucrose. This homogenate is distributed in four SW 28 centrifuge tubes (Beckman) and each is overlaid with 10 ml of buffer A containing 20% sucrose and then with 13 ml of buffer A. After centrifugation (28,000 rpm, 2 h) , a membrane fraction is collected from the 20% / 50% sucrose interface, diluted with four volumes of buffer A and collected by centrifugation (200,000 xg, 1 h). The membranes are then homogenized in 10 ml of storage buffer [25 mM tricine-NaOH, pH 7.8, 1 M NaCl, 10% glycerol (w / w), 5 mM β-mercaptoethanol)]. The concentration of the protein of the membranes prepared via this protocol is typically between 7 and 9 mg / ml. Protein concentrations are estimated as described (Bradford, 1976) using BSA as the standard protein.

B. Solubilization of Wax Protein Synthase The membrane suspension is adjusted to approximately 0.83 mg of protein per ml of dilution with storage buffer (25 mM tricine-NaOH, pH 7.8, 1 M NaCl, 10% glycerol, 5 mM β-mercaptoethanol. ). The solid 3 - ([3-colamidopropyl] dimethyl-ammonium) -1 propanesulfate (CHAPS) is added to achieve a final concentration of 2% w / w and a detergent for a protein ratio of 24: 1. After incubation on ice for 1 hour, the sample is centrifuged (200,000g for 1 hour), and the supernatant fraction is collected.

C. Purification of wax synthase activity The 200,000g supernatant fraction is diluted (with CHAPS 0. 57% o, 25 mM tricine-NaOH, pH 7.8, 20% glycerol) to produce a final concentration of NaCl and CHAPS of 0.3 M and 1%, respectively. The sample is loaded onto a blue A agarose column (Amicon, Inc., Beverly, MA) that has been equilibrated with buffer B (25 mM tricine-NaOH, pH 7.8, 1% CHAPS, 20% glycerol), containing NaCl 0.3 M. After the washings with equilibrium buffer, the wax synthase activity was eluted with buffer B containing 2M NaCl. The active fractions diluted from the blue A column were pooled (blue group) and used for additional chromatography. Two purification protocols were used for band identification and for further purification of the wax protein synthase. In protocol 1, the blue group was concentrated 5.4 times by ultrafiltration in a pressure cell filled with YM30 membrane (Amicon, Inc. Beverly, MA). One half of the concentrate was applied to a column of ceramic hydroxyapatite (Bio-Scale CHT-2; Bio-Rad, Hercules, CA) equilibrated in buffer B containing 2M NaCl. The column was washed with six volumes of equilibration buffer and the bound proteins were eluted with buffer B containing 0.1 M dipotassium phosphate and 2M NaCl. After re-equilibration of the CHT column, the second half of the blue group concentrate was chromatographed in the same manner. In order to detect activity, the wax synthase was tested according to the protocol of the concentrated samples by ultrafiltration. The wax synthase activity, measured on CHT run 1, was found in the flow through the column and in the wash. The protein profiles of the two CHT runs were identical so that CHT run 2 was not tested. The active fractions from the two CHT runs were grouped and concentrated 10 times and applied on a Sephacryl S100HR (2.5x90 cm) column equilibrated in buffer B with 1.0 M NaCl. Protein and activity determinations and fractions were made active were selected by the retained portion of the run with maximum agility and minimal protein. The S100 groupings (fractions 64-70) were applied to a column of crystalline hydroxylapatite (HA) (blo-Gel HT, bio-Rad, Hercules, CA, 1x19.3 cm) equilibrated in buffer B with NaCl 1 M. Again , most of the wax synthase activity was presented in the flow through the column and in the wash. The bound proteins were eluted in buffer B with 0.1 M dipotassium phosphate, and 1M NaCl. The fractions were examined from the final run of HA by SDS-PAGE. A single protein migrated to 33 kD on SDS-PAGE and correlated with the presence of wax synthase activity. In a second preparation (protocol 2) the blue group was applied directly to a crystal column of HA (1x11.7 cm), equilibrated in buffer B with 1 M NaCl, without concentration. The two fractions were selected for further purification by size exclusion chromatography on a Superdex 75 HR 10/30 column (Bio-Rad, Hercules, CA, size range: 500-75,000 daltons) equilibrated with 25 mM tricine-NaOH, pH 7.8, CHAPS 1%, glycerol 20%, NaCl 1 M. The wax synthase activity was measured according to the protocol described for the solubilization of the samples in example 1C. One fraction eluted initially in the flow through the HA column (fraction 31) and the other eluted in the wash (fraction 67). The protein profiles of the two fractions were different based on the SDS-PAGE analysis. Both Superdex 75 runs were examined by SDS-PAGE gradient and a protein of approximately 33 kD was identified with activity in the chromatography. A calibration curve was generated using standard molecular mass chromatography under the same buffer and column conditions. Elution volume comparisons of the peak of the wax synthase activity to this standard curve gave a value of 48 kDa for the molecular mass of the solubilized enzyme. A scheme representing the purification of wax synthase from protocol 1 (Table 2) shows a 150-fold purification of the enzyme from the solubilized protein fraction.

TABLE 2 Purification of jojoba wax synthase Step of Activity Performance Protein Activity Purification enzymatic purification (mg) specific (times) (nmol / min)% (nmol / min / mg) Fraction 274.4 solubilized 100 415 0.7 1 Agarose 214.7 78.2 15 14.3 22 blue A Hidroxiapati 176.6 64.3 6.4 27.6 42 ta ceramic Sephacril S-100 (from 41.3 15.1 1.2 33.1 50 size) Hidroxiapati ta 18.8 6.9 0.2 99.2 150 (crystalline) D. Analysis of SDS PAGE The samples of the fractions of column were diluted in SDS PAGE sample buffer (buffer 1x = SDS 2%, β-mercaptoethanol 250mM, bromophenol blue 0.0025%) and analyzed by electrophoresis. Electrophoresis of the polyacrylamide gradient gel (10-13% >) was carried out according to the method of Laemmli (Nature (1970) 227: 680-685) with some modifications of Delepelaire (Proc. Nat. Acad. Sci (1979) 76: 11-115). Sodium dodecylsulfate was used for the buffer vessel greater than 0.1% but omitted in the lower buffer vessel, to concentrate and resolve the gels. The concentrator gel contained 5% of a storage solution of 30% acrylamide (acrylamide 29.2%, N, N'-bis-methylene acrylamide 0.8%>, w / v), ammonium persulfate 0.06% (w / v) and TEMED 0.1%) (v / v). The spacer gel contained 10-13% of a linear gradient of acrylamide solution stabilized by 0-10% of a linear sucrose gradient. Electrophoresis was carried out at room temperature at 150 V, at constant voltage for 9-10 hours. The proteins were visualized when staining them with silver according to the method of Blum et al. (Electrophoresis (1987) 8: 93-99 or with Coomassie blue (Coomassie blue R-250 0.1%, 50% methanol, 10% acetic acid) The 33 kDa protein identified as wax synthase does not seem a major component of the active fraction up to the purification through the hydroxyapatite column Following the purification of protocol 1 (example 3C) the only protein that correlates with the activity in the final column is one in 33 kDa.

EXAMPLE 4 Preparation of the protein for gel digestion A. Preparation of the samples for SDS-PAGE by concentration An odd number of fractions were grouped from the flow through the column and from the final wash of the HA column (protocol 1) and concentrated three times by ultrafiltration in a cell. of pressure packed with membrane YM 30 (Amicon, Inc., Beverly, MA). The sample was further concentrated using two Centricon-30 units (Amicon, Inc., Beverly, MA) at volumes of approximately 50 μl. Each sample was treated with 6 μl SDS in mixture (4 μl SDS 20%, 1 μl ß-mercaptoethanol 14.3 M, and 1 μl blue bromophenol 0.1%). After standing at room temperature for 105 minutes, the samples were applied to a gradient gel of 10-13% acrylamide or (3D example) (16 x 16 cm x 1 mm thick) and the proteins were resolved by electrophoresis at 150 V at constant voltage, for 9.5 hours. The gel was stained with Coomassie blue 0.1% or in 50% methanol, 10% acetic acid > for 15 minutes then they were destained in 50% methanol, 10% acetic acid for 2 x 20 minutes. The 33 kD wax synthase band was cut from the gel and destained in 50% ethanol for 3 x 20 minutes. One line contained a protein band and was not used in the final digestion.

B. Preparation of samples for SDS-PAGE by precipitation Aliquots (0.8 ml) of an even number of fractions from the final HA column (protocol 1) were grouped in groups of 3 on the column profile. The groups were divided equally into three, 1.5 ml per vial. The proteins were precipitated by the addition of 0.2 ml TCA 40%. After 30 minutes on ice the samples were centrifuged (12,000 x g, 15 minutes at 4 ° C) to concentrate the precipitated protein. The supernatants were removed and the concentrates were washed twice with 0.6 ml acetone cooled on ice. The final concentrations of each set of groups of the samples were resuspended with the same 50 μl of SDS sample buffer when transferring the buffer from one vial to the next. The empty vials, which had been resuspended, were washed with 10 μl of the sample buffer for a total resuspension volume of 60 μl for each pooled sample. Samples were applied to a minigel of 12% acrylamide or Tris / Glycine (Novex, San Diego, CA, 1.5 mm x 10 well) and the proteins were resolved by electrophoresis at 150 V, at constant voltage, for 20 minutes beyond the elution of the dye from the foot of the gel. The gel was stained with Coomassie blue and destained using Gel-clear (Novex, San Diego, CA). The wax synthase was obtained from three non-equivalent lines on the gel that represent the peaks of the fractions obtained by the column. The gel slices were placed in 1.5 ml vials and destained with 1 ml of 50% methanol, 10% acetic acid for 2 hours. The destination solution was removed and the gel slices were frozen in liquid nitrogen and placed on dry ice, overnight, for gel digestion in W.M. Keck Foundation Biotechnology Resources Laboratory at Yale University. A slice of gel from the concentrated sample by ultrafiltration and from the three gel slices from the concentrated samples by precipitation were pooled in a tryptic gel digestion.

EXAMPLE 5 Determination of the amino acid sequence Protein sequencing was carried out in W.M. Keck Foundation Biotechnology Resource Laboratory, Yale University. The procedures include the amino acid analysis of a portion (10-15%) of the gel slice for quantification and amino acid composition, digestion of the protein with one of the proteolytic enzymes (trypsin or lysilendopeptidase), and fractionation of the products by HPLC in reverse phase. The absorbance peaks are selected from the HPLC run and subjected to laser absorption mass spectrometry to determine the presence, amount and mass of the peptide before sequencing the protein. The longest peptide is selected for microsequence. The amino acid sequences of the jojoba wax synthase peptides obtained by trypsin digestion are presented in Table 3 below using the one letter code.

TABLE 3 Amino Acid Sequence of Tryptic Peptides of Jojoba Wax Synthase WSpep29 FVPAVAPHGGALR (SEQ ID NO: 20) WSpep33 TIDEYPVMFNYTQK (SEQ ID NO: 21) EXAMPLE 6 Purification of additional wax synthases and reductases A. Adaptation of the jojoba wax synthase solubilization and purification methods to obtain partially purified preparations of wax synthase from other organisms that are described.

Acinetobacter Cells of Acinetobacter calcoaceticus strain BD413 (ATCC # 33305) are grown on ECLB (Luria broth for E. coli) collected during the logarithmic phase of growth and washed in a buffer containing either HEPES-NaOH, pH 7.5, or Tricine-NaOH pH 7.8 in 0.1 M NaCl. , 1mM DTT and protease inhibitors. The washed cells are resuspended in fresh buffer and broken by passing them through a French pressure cell (two steps at -16,000 p.s.i.). The cells that did not break are removed by centrifugation at 5000 x g 10 minutes, and the membranes are collected by centrifugation at 100,000 x g for one hour. The membrane concentration is homogenized in storage buffer (25 mM HEPES-NaOH, pH 7.5, or 25 mM Tricine-NaOH, pH 7.8 in 10% glycerol (w / v), 100 mM NaCl). Wax synthase activity is detected in these membranes using assay conditions described for the jojoba enzyme in Example 1B, using as substrates [1-14C] palmitoyl-CoA and alcohol 18: 1. The wax synthase activity was solubilized by incubating the membrane with CHAPS 2% > in the presence of NaCl 0.5M, with a detergent to protein ratio of 5: 1. The solubilization of the activity was demonstrated by the detection of the enzymatic activity of the wax synthase in the supernatant fraction after centrifugation at 200,000g for one hour and from the size exclusion chromatography (ie the activity eluting from the column in the fractions retained as in symmetrical peaks). The activity of the solubilized enzyme was detected by simple dilution of the CHAPS concentration to -0.3% (ie below its CMC). The incorporation of the enzyme into phospholipid vesicles is not required to detect the solubilized activity. For purification, the solubilized Acinetobacter wax synthase activity was subjected to chromatography procedures similar to those described for jojoba wax synthase. In one protocol, the preparation of the soluble protein is loaded onto a blue A agarose column under low salt conditions (100 mM NaCl in a column containing 0.75% CHAPS buffer, 10% glycerol, 25 mM HEPES- NaOH, pH 7.5) and eluted from the column using 1.0 M NaCl in column buffer. Mean size chromatography on Superóse 12 (Pharmacia; Piscataway, NJ) mean is used to obtain an estimate of the size of the native enzyme. Comparison of molecular mass standards used in chromatography under identical conditions produces an apparent molecular mass of -40 kDa for solubilized wax synthase. In another protocol, the solubilized protein was loaded on a blue A column equilibrated with 25 mM Tricine-NaOH, pH 7.8, 1% CHAPS, 20% glycerol containing 0.1 M NaCl and eluted in the same buffer containing 1.0 M NaCl. The eluate is then loaded onto a hydroxyapatite column equilibrated with a column buffer containing 1.0 M NaCl and unlike the jojoba wax synthase, the activity of the Acinetobacter wax synthase is bound to the column and eluted in a gradient of 1-100 mM potassium phosphate. When examined by SDS-PAGE, several protein candidates can be correlated with wax synthase activity.

Euglena Euglena gracilis, strain Z (ATCC No. 12716) grows heterotrophically in the dark (Tani et al (1987) Agrie, Biol. Chem. 51: 225-230) at ~ 26 ° C with moderate agitation. The cells are collected and washed in buffer containing 25 mM Bis-Tris-Propane, pH 7.0, 0.25 M NaCl and 1 mM EDTA. The washed cells are resuspended in fresh buffer and are broken by passing them through a French pressure cell (two steps to -p.s.i.). The unbroken cells, the cell remnant and the nuclei are removed by centrifugation at 20,000 xg for 20 minutes, and the microsomal membranes are collected by centrifugation at 200,000xG for one hour. The membrane concentration is homogenized in storage buffer (25 mM Bis-Tris-Propane, pH 7.0, 0.25 M NaCl, 10% glycerol (w / v) and 1 mM EDTA). Wax synthase activity was detected in these membranes using assay conditions as described for the jojoba enzyme. The radiolabeled substrate is the same as in the jojoba example (ie [1-14C] palmitoyl-CoA), although, 16: 0 was used instead of 18: 1 as the acceptor alcohol, and Bis-Tris buffer was used -Propane at pH 7.0. The Euglena wax synthase activity is solubilized by incubation of the membranes with 2% CHAPS in the presence of 0.5M NaCl. The solubilization of the protein is demonstrated by the detection of the enzymatic activity in the supernatant fraction after centrifugation at 200,000 x g for 1 hour. The activity of the solubilized enzyme is detected by dilution of the CHAPS concentration to -0.3% (ie below its CMC). It is not necessary to incorporate the enzyme into the phospholipid vesicle as was the case for solubilized jojoba wax synthase. For partial purification, the solubilized Euglena wax synthase activity was subjected to chromatographic separation on blue agarose medium A. The column is equilibrated with 0.1 M NaCI in a column buffer containing; 25mM Bis-Tris-Propane, pH 7.0, 20% glycerol (w / v), 0.75% CHAPS and 1mM EDTA. The sample containing the solubilized wax synthase activity is diluted to 0.1 M NaCl and loaded onto a 1 x 7 cm column (5.5 ml bed volume). The column is washed with equilibrium buffer and subjected to a linear gradient of NaCl (0.1 M NaCl to 1.0 M) in column buffer. The wax synthase activity elutes as wide peaks in the last half of the salt gradient. SDS-PAGE analyzes of the column fractions reveal that the complexity of the polypeptide of the activity eluted from the column is greatly reduced in relation to the charged material. A polypeptide with an apparent molecular mass of -41 kD was observed to run together with the wax synthase activity in the column fractions. Additional purification techniques, such as those described for jojoba and Acinetobacter are conducted to verify the association of wax synthase activity with the -41 kD peptide. For further analysis of the wax synthase activity in Euglena, size exclusion chromatography was conducted as follows. A microsomal membrane preparation was obtained from the Euglena cells grown in heterotrophic liquid medium (Tani et al., Previously mentioned) in the dark. The wax synthase activity was solubilized by treating the membranes with CHAPS 2% > (w / v) and 500mM NaCl in a buffer solution (Bis-Tris 25mM, pH 7.0, 1mM EDTA and 10% glycerol (w / v)) for one hour on ice. After dilution of CHAPS at 0.75% and NaCl at 200mM by the addition of a dilution buffer, the sample was centrifuged at -200,000 x g for 1.5 hours. The supernatant fraction was loaded onto a column of blue dye A pre-equilibrated with column buffer (25 mM Bis-Tris pH 7.0, 1 mM EDTA, 10% glycerol, 0.75% CHAPS) which also contains 200 mM NaCl. The column was washed with the column buffer containing 200 mM NaCl until the eluent returned to the preload value to A280. The wax synthase activity that bound to the column was released by increasing the NaCl concentrations in the column buffer to 1.5M. The fractions from the blue column A containing wax synthase activity were released by 1.5 M NaCI (-20 ml combined volume) which were pooled and concentrated approximately 30 times via ultrafiltration (Amicon pressure cell filled with a YN 30 membrane). ). The material concentrated from the blue column A was used as the sample for separation via size exclusion chromatography on Superase 12 medium (Pharmacia). Approximately 200μi of the sample was loaded onto a Superóse 12 column (HR 10/30), pre-balanced with column cushion containing NaCl 0.5M, and developed at a flow rate of 0.1m / l / min. The wax synthase activity eluted from the column as a soft peak. Comparison of the elution volume of the wax synthase activity with the elution profile of the standard molecular mass proteins gave an estimate of 166kD of the apparent molecular mass of the enzyme. At 7 Fractions containing the wax synthase activity were analyzed with polyacrylamide-SDS gel electrophoresis followed by silver staining. A preliminary analysis of the polypeptide profiles of the various fractions did not reveal any protein with a molecular mass of 100 kD or greater than those that were strongly stained appearing coupled to the activity profile. The wax synthase polypeptide may be presented as a minor component in the sample mixture that is not readily detectable on silver-stained gels. Alternatively, the enzyme may be composed of subunits that dissociate during SPS-PAGE.

EXAMPLE 7 Isolation of Wax Synthase Nucleic Acid Sequences The DNA sequences encoding the peptides for wax synthase are obtained from jojoba using synthetic oligonucleotides designed from the peptide sequences of the wax synthase. The nucleic acid sequences of the wax synthase can be obtained to amplify DNA by polymerase chain reaction (PCR) using oligonucleotides as primers, or alternatively, by selecting a cDNA or genomic DNA library by radiolabeling the oligonucleotides or sequences previously isolated for use as probes.

A. Construction of jojoba cDNA libraries RNA can be isolated using the methods described by Cathala, et al. (1983) DNA, 3: 329-335. RNA is isolated from the jojoba embryos collected at 80-90 days post-synthesis using a poly-ribosome isolation method, initially described by Jackson and Larkins (Plant Physiol. (1976) -57: 5-10), and modified by Goldberg et al. (Developmental Biol. (1981) 83: 201-217). In this procedure all steps, unless specifically determined, are carried out at 4 ° C. 10 gm of tissue are placed in liquid nitrogen in a Waring blender until the tissue becomes a fine powder. After which the liquid nitrogen has evaporated, 170 ml of extraction buffer (200mM Tris pH 9.0, 160mM KCl, 25mM EGTA, 70mM MgCl 2, 1% Triton X-100, 05% sodium deoxycholate or 1mM spermidine are added. 10 mM β-mercaptoethanol, and 50 mM sucrose) and the tissue is homogenized for about 2 minutes. The homogenate is filtered through sterile miracloth and centrifuged at 12,000 x g for 20 minutes. The supernatant is decanted into a sterile 500 ml bottle, and 1/19 volume of 20% detergent solution is added (Brij 35 20%), 20% Tween 40 or, Noidet p-40 20% op / v ) at room temperature. The solution is stirred at 4 ° C for 30 minutes at moderate speed and the supernatant is centrifuged at 12,000 x g for 30 minutes. About 30ml of supernatant is aliquoted into sterile Ti 60 centrifuge tubes and placed with 7ml of a solution containing 40mM Tris pH 9.0, 5mM EGTA, 200mM KCl, 30mM MgCl 2, 1.8M sucrose, 5mM β-mercaptoethanol. The tubes are filled to the top with extraction cushion, and centrifuged at 60,000 rpm for 4 hours at 4 ° C in a Ti60 rotor. Following centrifugation, the supernatant is aspirated and 0.5 ml of resuspension buffer (Tris 40mM pH 9.0, 5mM EGTA, 200mM KCl, 30mM MgCl 2, 5mM β-mercaptoethanol) is added to each tube. The tubes are placed on ice for 10 minutes, after which the concentrates are vigorously resuspended and grouped. The supernatant is centrifuged at 120 x g for 10 minutes to remove insoluble material. A volume of self-digested 1 mg / ml K proteinase, 20 mM Tris pH 7.6, 200 mM EDTA, 2% N-lauryl-saccharinate is added and the mixture is incubated at room temperature for 30 minutes. The RNA is precipitated by adding 1/10 volume of sodium acetate and 2 volumes of ethanol. After several hours at -20 ° C the RNA is concentrated by centrifugation at 12,000 x g at 4 ° C for 30 minutes. The concentrate is resuspended in 10ml of TE buffer (10mM Tris, 1mM EDTA) and extracted with an equal volume of saturated phenol in Tris pH 7.5. The phases are separated by centrifuging at 10,000 x g for 20 minutes at 4 ° C. The aqueous phase is removed and the organic phase is re-extracted with a volume of buffer TE. The aqueous phases are pooled and extracted with a volume of chloroform. The phases are separated again by centrifugation and the aqueous phase is precipitated in ethanol as previously described, to produce the poly-ribosomal RNA.

The contaminating polysaccharides in the poly-ribosomal RNA preparation are removed by passing the RNA through a cellulose column (Sigma-celi 50) in a high salt buffer (0.5M NaCl, 20mM Tris pH 7.5, 1mM EDTA, 0.1% SDS or). The contaminant binds to the column and the RNA is collected in the eluate. The eluted fractions are pooled and the RNA is precipitated in ethanol. The precipitated total RNA is resuspended in a small volume and applied to an oligo d (T) cellulose column to isolate the polyadenylated RNA. The polyadenylated RNA is used to construct a cDNA library in the plasmid cloning vector pCGN1703, derived from the commercial cloning vector Bluescribe M13 (Stratagene Cloning Systems, San Diego, CA), and is done as follows. The Bluescribe M13 polyadaptator is altered by digestion with BamHI, SamHI endonuclease treatment of the bean, and blunt end ligation to create a plasmid with deleted SamHI, pCGN1700. PCGN1700 is digested with EcoRI and Sstl (adjacent restriction sites) and coupled with a synthetic adapter that has the restriction sites for Bam \, Psil, Xoal, Apal and Smal, a 5% AATT excess and a TCGA 3 excess. ' Inserting the adapter into pCGN1700 removes the EcoRI site, recreates the Ssfl site (also, sometimes referred to here as "Sacl") found in Bluescribe, and adds new restriction sites contained in the adapter. The resulting plasmid pCGN1702 is digested with Hind \\\ and the blunt ends with Klenow enzyme; in linear DNA it is partially digested with PvuW and ligated with T4 DNA of wax synthase in diluted solution. A transformant having the deleted lac promoter region is selected (pCGN1703) and used in the plasmid cloning vector. Briefly, the cloning method for cDNA synthesis is as follows. The plasmid cloning vector is digested with Sst \ and the homopolymer tails T are generated on the sticky ends 3'- using the terminal deoxynucleotidyltransferase. The plasmid with this added end is separated from the unaddressed plasmid or that was not bound at the terminal end by oligo (dA) cellulose chromatography. The resulting vector serves as an initiator for the synthesis of the first strand of cDNA covalently linked to each end of the vector plasmid. The vector-cDNA-mRNA complexes are treated with terminal transferase in the presence of deoxyguanosine triphosphate, generating G-tails at the ends of the cDNA strands. The extra cDNA-mRNA complex, adjacent to the ßamHI site, is removed by digestion with BamHI leaving a complex cDNA-mRNA vector with a sticky end BamHI at one end and a tail G at the other. This complex is cycled using an adapter for synthetic coupling cycling having a sticky 5'ßamHI end, recognition sequences for the restriction enzymes Noti, EcoRl and Ssfi, and a 3'C end. Following the ligation and repair of the circular complex is the transformation within the E. coli strain DH5a (BRL, Gaithersburg, MD) to generate the cDNA library. The cDNA library of the jojoba embryo contains between approximately 1.5x106 clones with an average cDNA insert size of approximately 500 base pairs.

Additionally, polyadenylated jojoba RNA is also used to construct a cDNA library in the IZAPI l / coRI cloning vector (Stratagene, San Diego, CA). The library is constructed using protocols, strains of bacteria and cDNA as provided by the manufacturer. The clones are packaged using the extracts of the Gigapack Gold package (Stratagene), also in accordance with the recommendations of the manufacturers. The cDNA library constructs in this manner contain approximately 1x106 clones with an average cDNA insert size of approximately 400 base pairs.

B. Synthetic Oligonucleotides In general, for use as PCR primers from reverse transcribed mRNAs of single-stranded DNA templates, oligonucleotides are prepared which contain the sequence in sense orientation corresponding to the wax synthase peptide encoding a sequence . These oligonucleotides are used as primers for the "forward" amplification reaction to produce the sense RNA strand. For the "reverse" reaction for the amplification of the strand of Non-coding DNA, an oligonucleotide that is identical to a portion of an initiator used to prepare the DNA template for PCR can be designed.

Alternatively, oligonucleotides containing sequences complementary to the sequence encoding the wax synthase peptide can be used in combination with a "forward" wax synthase oligonucleotide primer as described above. Where the wax synthase peptide sequence containing amino acids can encode a number of different codons, forward or reverse primers can be "degenerate" oligonucleotides ie they contain a mixture of all or some of the possible sequences they encode for a particular peptide region. In order to reduce the number of different oligonucleotides present in said mixture, it is preferable to select peptide regions having the lowest possible number of coding sequences when preparing the synthetic oligonucleotide for PCR primers. Similarly, when synthetic oligonucleotides are used to direct the selection of a library for the wax synthase sequence, the preferred oligonucleotides are those of minor degeneracy. Below is an example of the WSPEP33 peptide sequence (center line) and the forward (upper line) and reverse (lower line) DNA sequences encoding the WSPEP33 peptide. 5TTY GTN CCN GCN GTN GNC CCN CAY GGN GGN GCN YTN MGN 3 '(SEQ ID NO: 22) F V P A V A P H G G A L R (SEQ ID NO. 20) 3' AAR CAN GGN CGN CAN CGN GGN GTR CCN CCN CGN RAN KCN 5" (SEQ ID NO: 23) Below is an example of the peptide sequence WSPEP329 (center line) and the forward (upper line) and reverse (lower line) DNA sequences encoding the WSPEP29 peptide.

'ACN ATH GAY GAR TAY CCN GTN ATG TTYAAY TAY ACB CAR AAR 3' (SEQ IN NO: 24) T I D E Y P V M F N Y T Q K (SEQ ID NO: 21) 3 'TGN TAD CTR CTY ATR GGN CAN TAC AAR TTR ATR TGN GTYTTY 5' (SEQ ID NO: 25) Below is an example of the WSPEP14 peptide sequence (center line) and the forward (upper line) and reverse (lower line) DNA sequences encoding the WSPEP314 peptide.

'TTY MGN GAY GAY CCN WSB AAY GAY CAY 3' (SEQ ID NO: 27) F R D D P S N D H (SEQ ID NO: 26) 3 'AAR KCN CTR CTR GGN WSN TTR CTR GTR 5' (SEQ ID NO: 28) Next are the sequences of synthetic oligonucleotides that can be used to obtain the wax synthase sequences.

The names of the oligonucleotides reflect the numbers of the particular wax synthase peptide fragments listed in Example 5. The letter "S" in the name of the oligonucleotide designates a forward reaction primer for PCR. The letter "R" designates a reverse reaction initiator for PCR WSPEP29.F1 5TTYGTNCCNGCNGTNGC 3 '(SEQ ID NO: 29) WSPEP29.F2 5'GCNCCNCAYGGNGGNGC 3' (SEQ ID NO: 30) WSPEP29.R1 5'GCNCCNCCRTGNGGNGC 3 '(SEQ ID NO: 31) WSPEP29.R2 5'GCNACNGCNGGNACRAA 3 '(SEQ ID NO: 32) WSPEP29.F1 5'ACNATHGAYGARTAYCCNAGT 3' (SEQ ID NO: 33) WSPEP29.F2 5'CCNGTNATGTTYAAYTAYAC 3 '(SEQ ID NO: 34) WSPEP29.R1 5'TTYTGNGTRTARTTRAACAT (SEQ ID NO: 35) W WSSPPEEPP2299..RR22 5'AACATNACNGGRTAYTCRTC 3 '(SEQ ID NO: 36) WSPEP29.F1 5'GAYGAYCCNWSNAAYGAYCA (SEQ ID NO: 37) WSPEP29.R1 5 'TGRTCRTTNSWNGGRTCRTC (SEQ ID NO: 38) The nucleotide base codes for the above oligonucleotides are as follows: A = adenine T = thymine Y = cytosine or thymine C = cytosine U = uracil R = adenine or guanine G = guanine l = isonine 0 = inosine or cytosine H = adenine, cytosine or thymine N = adenine, cytosine, guanine or thymine W = adenine or thymine S = guanine or cytosine B = guanine, cytosine or thymine K = guanine or thymine M = adenine or cytosine C. PCR Reactions Poly (A) + RNA RNA is isolated from total RNA prepared from jojoba tissue as described above. The cDNA is prepared from poly (A) + RNA or total RNA by reverse transcription using the Marathon cDNA amplification equipment (Clontech Laboratories Inc. according to the manufacturer's instructions). The jojoba cDNA is used in the PCR reactions 1-16 set out below. PCR is carried out in a PCR system Perkin Elmer Cetus GeneAmp PCR machine 9600 using as a template single-stranded cDNA reverse transcribed. The commercially available PCR reaction and the optimization reagents are used in accordance with the manufacturers' specifications. Reactor Initiator forward backward initiator 1 WSPEP14-F1 WSPEP29-R1 2 WSPEP14-F1 WSPEP29-R2 3 WSPEP14-F1 WSPEP33-R1 4 WSPEP14-F1 WSPEP33-R12 5 WSPEP29-F1 WSPEP14-R1 6 WSPEP29-F1 WSPEP33-R1 7 WSPEP29-F1 WSPEP33-R2 8 WSPEP29-F2 WSPEP14-R1 9 WSPEP29-F2 WSPEP33-R1 10 WSPEP29-F2 WSPEP33-R2 11 WSPEP33-F1 WSPEP14-R1 12 WSPEP33-F1 WSPEP29-R1 13 WSPEP33-F1 WSPEP29-R2 14 WSPEP33-F2 WSPEP14-R1 15 WSPEP33 -F2 WSPEP29-R1 16 WSPEP33-F2 WSPEP29-R2 The temperature program used for PCR amplification is as follows: 1 cycle of 95 ° C per minute; 4 cycles of 95 ° C for 30 seconds, 60 ° C for 1 minute, and 72 ° C for 4 minutes: 4 cycles of 95 ° C for 30 seconds, 57 ° C for one minute, and 72 ° C for 4 minutes; 4 cycles of 95 ° C for 30 seconds, 54 ° C for one minute and 72 ° C for 4 minutes; 4 cycles of 95 ° C for 30 seconds, 51 ° C for one minute, and 72 ° C for 4 minutes; and 25 cycles of 95 ° C for 30 seconds, 48 ° C for 1 minute and 72 ° C for 4 minutes. For reactions 3 and 4, a PCR product of approximately 700 nucleotides in length was detected. The PCR product was purified using gel electrophoresis and cloned into pCR2.1 using a Topo TA cloning kit (Invitrogen Corp.). The DNA sequence of the cloned PCR product which was determined was 708 nucleotides in length SEQ ID NO: 17.

The complete cDNA can be amplified using 5 'and 3' RACE (Frohman et al., 1988) using the Marathon cDNA amplification kit (Clontech Laboratories Inc.) in accordance with the manufacturer's instructions. The following primers were synthesized for the sequence of the 708 nucleotides of the derived PCR fragment using the primers WSPEP14-F1 and WSPEP33-R2: WSRACEF1 GATTTGCCTCATTTTGTGATCTCGGTGCT (SEQ ID NO: 39) WSRACER2 GACCTATACCCCAGTTCAACGAGCCATAC (SEQ ID NO.40) WSRACEF3 TTCAACGAGCCATACTTAGCCACCTCGCT (SEQ ID NO: 41) WSRACER1 AACAACCACCCTCCCTCCAGTCACCATCACGAAC (SEQ ID NO: 42) WSRACER2 TTGCCTGAAAACCGCCTTCTTCACCCACCATC (SEQ ID NO: 61) WSRACER3 AAGATGTCTGACACCATGAGGATTCCACCTG (SEQ ID NO: 43) The RACE 3 'reactions were designed using the primers WSFACEF2 and WSRACEF3. The 5 'RACE reactions were designed using the primers WSRACER1, WSRACER2 and WSRACER3. The PCR reactions were carried out in accordance with the manufacturers protocol (Clontech Laboratories Inc.). All 6 PCR reactions gave visible PCR products with a size range of about 700 nucleotides to 1000 nucleotides. The PCR products were purified from the gel and cloned into pCR2.1 in accordance with the manufacturers protocol (Invitrogen Corp.). The DNA sequence of several clones from the 5 'and 3' RACE reactions and the previous PCR products derived from the primers WSPEP14-F1 and WSPEP33-R2 were assembled using Sequencher software (Gene Codes Corp.). The assembled sequence for all PCR products contains the reaction encoding the cDNA sequence. To isolate a gene fragment suitable for cloning the wax synthase gene into expression cassettes for plant lipid modification, the region encoding the gene can be amplified from cDNA using the WAXSYNFOR and WASXYNREV primers. The sequence of WAXSYNFOR is GGATCCGTCGACACAATGGAGGTGGAGAAGGAGCTAAAG (SEQ ID NO: 44), and the sequence of WASXYNREV is GCATGCAGATCTCACCACCCCAACAAACCCATC (SEQ ID NO: 45). The PCR reaction is carried out using Marathon CDNA (Clontech Laboratories Inc.) in accordance with the manufacturer's instructions. The PCR program consists of 30 cycles of 94 degrees C for 15 seconds, 60 degrees C for 1 minute, 72 degrees C for 2 minutes. The PCR products were cloned into pCR2.1 in accordance with the manufacturers protocol (Invitrogen Corp.). The resulting plasmid was designated pCGN8538. The nucleic acid sequence and the amino acid sequence derived from the jojoba wax synthase is determined and is provided in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

EXAMPLE 8 Generation of transgenic plants containing the wax synthase cDNA.

Two vegetal binary vectors were constructed. The plasmid PCGN8559 contains 3 genes needed for wax biosynthesis: the condensing enzyme involved in the elongation of fatty acids for longer chains of 18 carbons (KCS), the acyl-CoA reductase involved in the formation of fatty alcohols, and the wax synthase . A control plasmid, pCGN8557, contains the genes for KCS and acyl-CoA reductase. The Asp718 fragment of pCGN7698, which contains the jojoba acyl-CoA reductase under control of the napin regulatory sequence, was cloned into the Asp718 site of the binary vector pCGN5139 to form pCGN8555. The Notl fragment of pCGN7844, which contains KCS from Lunaria under the control of the napin regulatory sequences, was cloned into the NotI site of pCGN85555 to form pCGN8557. The Sall-BglII fragment from pCGN8538 containing the coding region for the jojoba wax synthase gene was cloned into the napin expression cassette of pCGN7770 digested with the same two restriction endonucleases to form pCGN8553. The Sse8387 fragment from pCGN8553, containing the jojoba wax synthase under control of the napin regulatory sequence, was cloned into the Sse8387 site of pCGN8557 to form pCGN8559. The binary vectors were introduced into Agrobacterium tumefaciens EHA105 via electroporation. The vectors were used to transform Arabidopsis thaliana ecotype No-0 according to the vacuum infiltration protocol of Bent et al. (1994, Science 265: 1856-1860).

EXAMPLE 9 Analysis of the development of Arabidopsis seed The siliques were harvested from seven Arabidopsis plants transformed with pCGN8559 that were in several stages of development. The developing seed was removed from 10 siliques collected from each plant and homogenized in 275 μl of buffer (100 mM HEPES / NaOH pH 7.5, 250 mM NaCl). A portion of the homogenate (200 μl) was centrifuged at 16,000 x g for 20 minutes at 4 ° C. The pellet was resuspended in 200 μl of the same buffer. The homogenate and the two fractions were assayed for wax synthase activity in accordance with the protocol described in Example 1 B. 25 μl was used for assay in a final volume of 250 μl. The assay buffer contained 1-14C16: 0-CoA 40 μM (specific activity 5 μCi (μmol), 18: 1 alcohol 200 μM, 50 mM HEPES / NaOH pH 7.5, 250 mM NaCl and 2 mM β-mercaptoethanol) TLC analysis showed the incorporation of the radiolabel of 1-14C 16: 0-CoA within a band that co-migrated with a wax standard in 5 of the 7 plants analyzed.This activity was detected in the homogenate and tablet fractions but not in the supernatant fraction The wax synthase activity detected in the samples is several orders of magnitude higher than the endogenous wax synthase activity previously found in the Arabidopsis seed.The activity detected in 8612-3 and 8613-2 is indicative of this endogenous activity "background." A positive control for the wax activity was the membrane fraction of jojoba (DP2).

EXAMPLE 10 A. Thin-layer chromatographic analysis Seeds of Arabidopsis plants were homogenized in hexane using a mortar and pestle. The hexane was transferred to a new vial and evaporated under nitrogen gas and the oil was resuspended in hexane at a concentration of 10 mg / ml. 10 μl of oil solution was placed on a TLC gel-G plate and the chromatogram was developed in hexane: diethyl acetic acid acetic acid (80: 20: 1). The lipids were stained with iodide. Elevated levels of wax were observed in the oil extract of plants expressing pCGN8559 which also tested positive for wax synthase activity. Intermediate wax levels were detected in seeds of pCGN8557 containing only reductase / KCS and low wax levels were detected in the Arabidopsis No-O controls.

B. Gas Chromatography Analysis The oil in approximatelyrabidopsis seed was derived to form methyl esters of fatty acids (FAME) and free alcohol. The lipids that are extracted were analyzed for DMARDs and the alcohol content was analyzed by gas chromatography. The internal standard TAG_17_: 0 was placed within the lipid fraction and the derivatization was carried out at 90 ° C in the presence of acid methanol and toluene. The lipid products were extracted by adding hexane and aqueous 1M NaCl. The methyl esters of fatty acids (FAME) and the alcohols were separated on a 0.25 mm x 15 m column Supelcowax-10. The composition percentage of the products was determined by their weight contribution to the sample (Table 3A). A correction factor for the response of the Fíame ionization detector (FID), was determined experimentally to be 1155, was used to adjust the quantification of alcohol peaks relative to the standard methyl ester 17: 0. The weight of the composition was used to determine the percentage of very long chain carbon groups (>; 18C) present (Table 3B).

BA Groups Acyl Fatty Fatty Alcohols VLCFA sample 16: 0 16: 1 18: 0 18: 1 18: 2 18: 3 20: 0 20: 1 20: 2 22: 0 22: 1 22: 2 24: 0 24: 1 OH18: 1 01120: 1 OH122: 1 OH24: 1% weight 8559-3 6.1 0.3 2.3 14.7 21.5 19.3 1.1 12.2 1.0 0.8 9.8 0.1 1.0 3.4 0.1 0.5 3.3 2.4 35.7 8559-4 6.1 0.3 2.8 17.5 25.1 18.9 2.2 22.1 1.9 0.3 2.4 0.1 0.1 0.2 0.0 0.0 0.0 0.0 29.4 8559-5 6.1 0.3 2.8 17.2 25.4 18.9 2.3 22.0 1.9 0.3 2.4 0.1 0.1 0.2 0.0 0.0 0.0 0.0 29.3 8559-6 6.0 0.3 2.7 17.9 25.4 18.9 2.2 21.7 1.9 0.3 2.4 0.1 0.1 0.2 0.0 0, 0 0.0 0.0 28.8 8559-7 6.0 0.3 2.6 17.0 25.2 19.6 2.2 22.1 1.9 0.3 2.4 0.1 0.1 0.2 0.0 0.0 0.0 0.0 29.4 8559-8 5.9 0.3 2.2 14.9 21.4 18.7 1.1 13.5 1.1 0.7 8.7 0.2 0.6 2.0 0.1 1.0 5.3 2.2 36.5 8559- 9 5.9 0.4 2.0 13.3 21.7 14.8 1.2 12.9 1.1 0.7 8.8 0.2 1.7 6.5 0.1 0.4 3.8 4.4 42.0 8559-10 5.7 0.4 1.9 13.5 20.6 19.0 1.0 10.7 0.9 0.8 10.1 0.2 1.3 5.5 0.0 0.5 4.2 3.6 38.9 8559-11 5.5 0.2 1.6 10.9 17.5 17.8 0.7 8.9 0.7 0.9 11.3 0.2 1.3 5.3 0.2 1.1 9.3 6.5 46.5 8559-13 6.1 0.3 2.8 16.8 24.3 1 8.8 2.1 19.4 1.6 0.5 5.3 0.1 0.4 1.3 0.0 0.1 0.1 0.1 31.0 8559-14 5.6 0.3 2.7 18.3 24.4 18.5 2.2 22.5 20. 0.3 2.8 0.1 0.1 0.2 0.0 0.0 0.0 0.0 30.2 8559-15 6.1 0.5 1.8 12.6 20.8 16.4 1.0 11.8 1.0 0.8 9.4 0.2 1.1 4.5 0.2 0.8 6.7 4.3 41.9 8559-16 5.9 0.3 2.8 17.9 24.4 18.5 2.3 22.6 1.9 0.3 2.6 0.1 0.2 0.2 0.0 0.0 0.0 0.0 30.2 8559-17 5.8 0.3 2.5 16.7 23.2 18.9 1.7 17.2 1.4 0.6 7.3 0.1 0.5 2.3 0.0 0.2 0.7 0.5 32.5 8559-18 5.7 0.4 1.7 10.9 18.5 16.4 1.0 12.4 1.0 0.8 8.3 0.2 1.2 4.3 0.0 1.3 9.9 5.9 46.4 8557-1 5.6 0.3 2.4 16.6 22.5 19.6 1.5 15.4 1.3 0.6 8.0 0.2 0.5 2.7 0.0 0.1 1.1 1.5 33.0 8557-3 5.9 0.3 2.6 16.6 22.3 21, 1 2.1 21.4 2.1 0.3 2.8 0.1 0.1 0.2 0.0 1.8 0.2 0.0 31.1 8557-4 6.4 0.4 2.5 14.1 23.0 17.7 1.4 12.8 1.3 0.8 8.8 0.2 0.8 2.5 0.0 0.3 2.9 4.2 35.9 8557-5 5.6 0.2 2.3 13.6 21.9 21.8 1.1 11.3 1.3 0.8 10.9 0.2 0.7 3.2 0.0 0.2 2.1 2.8 34.6 8557-6 5.8 0.4 2.6 14.4 23.1 19.6 1.4 14.3 1.4 0.7 8.8 0.2 0.7 3.1 0.0 0.1 1.3 2.1 34.1 Ul 8557-7 5.5 0.3 2.4 13.7 23.2 21.0 1.6 17.4 1.7 0.6 8.9 0.2 0.5 2.8 0.0 0.0 0.1 0.2 34.0 8557-8 6.0 0.4 2.3 12.6 21.5 20.9 0.9 8.7 1.0 0.9 12.3 0.3 0.9 4.3 0.0 0.2 2.6 4.0 36.2 8557-9 5.6 0.3 2.4 14.4 22.5 21.7 1.2 12.6 1.3 0.7 10.5 0.2 0.6 3.1 0.0 0.1 1.2 1.4 33.1 8557-10 6.0 0.3 2.5 14.3 22.6 21.1 1.2 11.7 1.3 0.8 10.1 0.2 0.7 3.0 0.0 0.2 1.9 2.4 33.3 8557-11 6.0 0.4 2.5 13.2 22.4 19.5 1.2 11.8 1.2 0.8 10.1 0.2 0.9 3.8 0.0 0.2 2.2 3.6 36.0 8557-12 5.7 0.3 2.8 16.3 24.5 19.4 2.1 23.4 2.1 0.3 2.6 0.1 0.1 0.2 0.0 0.0 0.0 0.0 30.9 8557-13 6.1 0.3 2.5 13.3 22.3 21.2 1.1 11.2 1.2 0.8 10.6 0.2 0.7 3.0 0.0 0.2 2.1 3.0 34.2 8557-14 5.9 0.2 2.5 13.4 23.4 19.4 1.1 11.4 1.3 0.8 10.9 0.2 0.7 2.9 0.0 0.2 2.7 3.2 35.5 No-O- 1 6.5 0.4 3.1 15.6 26.3 17.7 2.7 22.1 2.1 0.4 2.6 0.2 0.2 0.2 0.0 0.0 0.0 0.0 30.5 No-O-2 6.4 0.4 3.1 15.6 26.2 17.9 2.7 22.0 2.1 0.4 2.6 0.2 0.2 0.2 0.0 0.0 0.0 0.0 30.4 No-O- 3 6.4 0.4 3.1 15.6 26.3 17.6 2.7 22.1 2.1 0.4 2.6 0.2 0.2 0.2 0.0 0.0 0.0 0.0 30.6 C. 13 C-NMR analysis for the intact seed of Arabidopsis The TLC analysis shows that the plants expressing pCGN8559 do not contain any free alcohol although the type of alcohol present in the transmethylated samples was probably due to the derivatization of the wax present in the oil of seed. Based on this evidence it is estimated that the amount of wax in the plants expressing pCGN8559 is twice the weight of the alcohol detected by gas chromatography (Table 4A). This was not the case for plants expressing pCGN8557 where both alcohol and wax marks were visible by 7TLC after exposure to iodide vapor. In order to find a more direct measure of the amount of wax present, the 3C-NMR spectrum was obtained for the mature intact Arabidopsis seed to determine the molar percentage of wax and TAG. A region of the spectrum between 60-70 ppm was identified as containing a single carbon change for the sn-2 carbon of the glycerol skeleton at 69.5 ppm, representing the molar amount of TAG, and the first carbon on the alcohol side of the spectrum. wax ester bound to 64.2 ppm, represented by the molar amount of wax. The proportions of these two unique carbons were determined. For these reactions, the molar percentage of wax was calculated (Table 4B). The molar percentage data was converted to weight percentage data using the following conversion: (mol% wax * molecular weight of the wax) Weight% = 10 * (mol% wax * PMcera) + [(100 - p? ol% wax) * PM TAG)] the molecular weight of the wax and TAG were assigned as 20: 1-20, 1 wax and 20: 1 TAG. The weight percentage of wax was calculated by the GC method that was in agreement with the percentage of wax weight determined by non-destructive measurements using 13 C-NMR. Using this method, a determination of the molar percentage of wax present in the plants expressing pCGN8557 was obtained. A calculation of the combination of wax synthase for the production of very long fatty acid chains (VLCFA) is shown in Figure 1.

TABLE 4 Sample GC GC RMN Wax Weight% OH Weight% wax Weight wax Mol% wax 8559-3 6.2 12.4 12.8 19.4 8559-4 0.0 0.0 0.0 0.0 8559-5 0.0 0.0 0.0 0.0 8559-6 0.0 0.0 0.0 0.0 8559-7 0.0 0.0 0.0 0.0 8559-8 8.6 17.1 17.2 25.4 8559-9 8.7 17.5 nd nd 8559-10 8.4 16.7 15.5 23.1 8559-11 17.1 34.1 37.2 49.2 8559-13 0.3 0.5 nd nd 8559-14 0.0 0.0 nd nd 8559-15 12.0 24.1 24.4 34.6 8559-16 0.0 0.0 0.0 0.0 8559-17 1.4 2.8 1.9 3.0 8559-18 17.2 34.3 34.9 46.8 8557-1 2.7 - nd nd 8557-3 2.0 - 1.2 2.0 8557-4 7.4 - 9.9 15.3 8557-5 5.1 - 5.8 9.1 8557-6 3.6 - 3.8 6.0 8557-7 0.2 - 0.0 0.0 8557 -8 6.8 - 10.4 16.0 8557-9 2.8 - 2.4 3.8 8557-10 4.4 - 6.3 9.9 8557-11 6.0 - 9.9 15.3 8557-12 0.0 - 0.0 0.0 8557-13 5.4 - 4.4 7.0 8557-14 6.1 - 7.4 11.5 No- O-1 0.0 - No-O-2 0.0 - No-O-3 0.0 - nd EXAMPLE 11 Analysis of transgenic leaves of Arabidopsis The rosette leaves from the plants transformed with the pCGN8593 construct, which express wax synthase under the control of the 35S promoter, were analyzed for wax synthase activity. The leaves are homogenized in 200 μl homogenization buffer (100 mM Tricine / NaOH, pH 7.8, 280 mM NaCl, 10% glycerol, and inhibitors of protease Aprotinin 0.1 uM, Leupeptin 1 μM, and Pefabloc 100 μM) and solids they were concentrated by centrifugation at 16,000 x g for 10 minutes and 4 ° C. He supernatant was removed and the pellet resuspended in 200μl of homogenization buffer This fraction was referred to as the fraction P1. Five control leaves harvested from the No-O cultivar of Arabidopsis were tested as controls. The P1 fractions were tested for wax synthase activity as described in example 1 B. The wax synthase activity in the plants expressing pCGN8593 was compared to the average activity found in the No-O controls. Eleven of the 24 plants analyzed showed activity more than twice the average leaf background found in the No-O controls. One plant showed almost a 10-fold increase in activity.

EXAMPLE 12 Identification of additional wax synthase sequences The protein sequence of jojoba wax synthase (SEQ ID NO: 2) is used for a search of the DNA sequence databases of Arabidopsis (http: // genome-www. stanford.edu/Arabidopsis/). One of the accesses, the clone P1 MTE17 (Genbank access AB015479), contains 7 repeated regions of open reading frame with similarity to the jojoba wax synthase. Open reading frames have been designated ATWS1 through ATWS7 (SEQ ID Nos: 3, 5, 7, 9, 11, 13 and 15, respectively). These are between nucleotides 23670 and 11479 of MTE17 using the Genbank entry numbering system. The inferred sequences of proteins, SEQ ID NO 4, 6, 8, 10, 12, 14, and 16, respectively. The peptide sequences conserved between the amino acid sequences (Table 5). The percentages of identity and similarity are also determined, and they are present in table 6.

TABLE 5 SEQUENCE SEQ ID NO: 1 LXLF (AS) (F / L) XX (G / E) 46 2 PYL (A / S) TSL (Q / H) (D / E) FW (G / S (PJH) RWNL ( M / I) V 47 3 FX (VT) SGXXHEXX (F / Y) FYX (I / T) R 48 4 P (S / T) (W / G) EV (T / A) XFF (V / L) LHG 49 TABLE 6 SEQUENCES PERCENTAGE OF PERCENTAGE OF COMPARED IDENTITY SIMILARITY Jo S vs ATWSI 41% 17% JoWS vs ATWS2 37% 19% JoWS vs ATWS3 42% 15% JoWS vs ATWS4 42% 16% JoWS vs ATWS5 44% 13% JoWS vs ATWS6 41% 17% JoWS vs ATWS7 36 % 16% JoWS vs ATWS6 59% 14% JoWS vs ATWS1 49% 17% JoWS vs ATWS4 71% 10% JoWS vs ATWS7 55% 15% JoWS vs ATWS2 49% 21% JoWS vs ATWS5 64% 14% JoWS vs ATWSI 47% 18% JoWS vs ATWS4 57% 15% JoWS vs ATWS7 51% 17% JoWS vs ATWS2 45% 18% JoWS vs ATWS5 57% 15% JoWS vs ATWS4 52% 17% JoWS vs ATWS7 46% 19% JoWS vs ATWS2 65% 12 % SEQUENCES PERCENTAGE OF PERCENTAGE OF COMPARED IDENTITY SIMILARITY JoWS vs ATWS5 49% 17% JoWS vs ATWS7 58% 13% JoWS vs ATWS2 50% 19% JoWS vs ATWS5 65% 13% JoWS vs ATWS2 45% 18% JoWS vs ATWS5 55% 16% JoWS vs ATWS5 49% 17% Complementary DNA (cDNA) is constructed from Arabidopsis RNA isolated from immature seeds, complete seed structures (vegetative tissue), and inflorescences (flowers and flower stems using the cDNA library construction kit in accordance with The protocol of the manufacturers (Clontech) The SMART cDNA is also constructed from RNA from leaves of Brassica napus, and from immature seeds harvested 15 days after pollination (DAP), 18 DAP, and 30 DAP. it is used for virtual analysis of Northern, in accordance with the protocol of the Clontech SMART cDNA manual, of ATWS cDNA expression of Arabidopsis, ATWS2 is expressed more highly in immature seeds of Arabidopsis and Brassica seeds 30 DAP. it is detected in Brassica leaves or in Arabidopsis floral tissues, this is an expression pattern consistent with what is expected for DAGAT, since triglycerides are mainly formed in the developing seeds of these plants. In addition, the tag expression sequence (EST) is identified from the databases containing nucleic acid and protein sequences obtained from soybean (Glycine max). This sequence is provided in SEQ ID NO: 19.

EXAMPLE 13 Expression of constructions for 13A homologs. Expression in insect cell cultures The constructs are prepared to direct the expression of the homologous sequence of Arabidopsis wax synthase in cultured insect cell. The complete coding region of the wax synthase sequence of ATWS1 (SEQ ID NO: 3) and ATWS2, (SEQ ID NO: 5) and ATWS3 (SEQ ID NO: 7) are amplified in a polymerase chain reaction (PCR) ) and subcloned into pCR2.1 (Invítrogen) to produce pCGN9705 and pCGN9707, respectively. The double-stranded DNA sequence was obtained to verify that no errors were introduced by PCR amplification. The fragment containing the complete coding region of the Arabidopsis ATWS1 and ATWS2 sequences was cloned into the bacoluvirus expression vector pFastBad (Gibco-BRL, Gaithersburg, MD). A bacoluvirus expression construct containing the ATWS1 and ATWS2 sequences is transformed and expressed using the BAC-to-BAC baculovirus expression system (Gibco-BRL, Gaithersburg, MD) according to the manufacturer's instructions, except that the Harvesting of the recombinant viruses was done 5 days post-transfection. The supernatant of the transfection mixture was used to generate a virus storage solution which in turn was used to infect Sf9 cells for use in this assay. The transformed insect cells were tested for wax synthase activity using methods described herein. The insect cell was centrifuged and the resulting concentrated cells were resuspended in medium I (0.25 M sucrose and 1 mM EDTA in 10 mM Tris-Cl, pH 7.4) and homogenized on ice. The homogenate was centrifuged at 105,000 x g for 1 hour at 4 ° C. Total membranes were resuspended in medium I. Wax synthase activity was determined using two different acyl-CoA substrates, 16: 0-CoA, and 24: 1 -CoA, and five different alcohol substrates, 16: OH, 18: 0H, 18: 1 -OH, 20: 1 -OH, 22: 1 -OH, and 24: 1 -OH. The wax synthase activity was tested in 0.25 ml of a reaction mixture containing 50 mM Tricine, pH 7.8, 2 mM β-mercaptoethanol, 250 mM sodium chloride, respective alcohol (40 μM 18: 1-OH) and, μM 1-14C palmitoyl-CoA, or 1-14C nervonoyl-CoA 200 μM. The reactions were run at 25 ° C for 10 minutes. The result of the wax synthase activity assay demonstrates that the protein encoded by the ATWS1 sequence has wax synthase activity for any acyl-CoA and alcohol substrates tested (Figures 2, 3, 4, and 5). Particularly the wax synthase has a higher activity for long chain substrates, particularly C20 and higher substances. 13S. Plant expression To characterize the Arabidopsis sequence that is preferably expressed in the developing seed, the constructs were prepared to direct the expression of the sequence in host plant cells. A plasmid containing the napin cassette derived from pCGN3223 (described in USPN 5,639,790, the entirety of which is incorporated herein by reference) was modified to make it more useful for cloning long fragments of DNA containing multiple restriction sites, and to allow the cloning of multiple napin fusion genes within the plant binary transformation vectors. An adapter comprising an auto-annealing oligonucleotide of the sequence 5'-CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGGCAGGGCGCGC CATTTAAAT (SEQ ID NO: 50) was ligated into the cloning vector pBC SK + (Stratagene) after digestion with the restriction endonuclease BssHIl to construct a vector pCGN7765. The plasmids pCGN3223 and pCGN7765 were digested with Notl and ligated together. The resulting vector, pCGN7770, contains the backbone of pCGN7765 with the seed napin-specific expression cassette from pCGN3223. The cloning cassette, pCGN7787, is essentially the same regulatory element of pCGN7770, with the exception that the napin regulatory region of pCGN7770 has been replaced with the double 35S CAMV promoter and the tml polyadenylation region and the transcription termination region. . A binary vector for plant transformation, pCGN5 39 was constructed from pCGN1558 (McBride and Summerfelt, (1990) Plant Molecular Biology, 14: 269-276). The polylinker of pCGN1558 was replaced as a Hindlll / Asp718 fragment with a polyadapter containing unique sites of restriction endonucleases Ascl, PacI, Xbal, Swal, BamHl and Notl. The restriction endonuclease sites Asp718 and Hindlll are retained in pCGN5139. A series of turbo binary vectors were constructed to allow rapid cloning of DNA sequences within binary vectors containing the transcription initiation regions (promoters) and the transcription termination regions. Plasmid pCGN8618 was constructed by ligating the oligonucleotides '-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3 '(SEQ ID NO: 51) and 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3' (SEQ ID NO: 52) within Sall / Xhol-digested with pCGN7770. A fragment containing the napin promoter, polyadaptator and 3 'napin region was cut from pCGN8618 by digestion with Asp718l; the fragment was blunt-ended by filling in the remaining 5 'ends with the Klenow fragment and then ligating them into pCGN5139 which had been digested with Asp718l and Hindlll and the ends blunted by filling them in 5' with the Klenow fragment. A plasmid containing the insert oriented so that the napin promoter was closest to the Asp718l binding site of pCGN5139 and 3 'napin was closest to the binding site Hindlll was subjected to sequence analysis to confirm both the orientation of the insert and the integrity of cloning unions. The resulting plasmid was designated pCGN8622. Plasmid pCGN8619 was constructed by ligating the oligonucleotides d'-TYCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-S '(SEQ ID NO: 53) and 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' (SEQ ID NO: 54) into pCGN7770 digested with Sall / Xhol. A fragment containing the napin promoter, polyadaptator and 3 'napin region was cut from pCGN8619 by digestion with Asp718l; the fragment was blunt-ended by filling in the remaining 5 'ends with the Klenow fragment and then ligating them into pCGN5139 which had been digested with Asp718l and Hindlll and the ends had become blunt when filled in 5' with the Klenow fragment. A plasmid containing the insert oriented so that the napin promoter was closest to the Asp718l binding site of pCGN5139 and 3 'napin was closest to the binding site Hindlll was subjected to sequence analysis to confirm both the orientation of the insert and the integrity of cloning unions. The resulting plasmid was designated pCGN8623. Plasmid pCGN8620 was constructed by ligating the oligonucleotides '-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGGAGCT-3 '(SEQ ID NO: 55) and 5'-CCTGCAGGAAGCTTGCGGCCGCGGATCC-3' (SEQ ID NO: 56) within pCGN7787 digested with Sall / Xhol. A fragment containing the d35S promoter, polyadaptator and tml 3 'region was removed from pCGN8620 by digestion with Asp718l and partial digestion with Notl. The fragment was blunt-ended by filling the remaining 5 'ends with the Klenow fragment and then ligating them with pCGN5139 which had been digested with Asp718l and Hindlll and the blunt ends were filled at the 5' end with the Klenow fragment. A plasmid containing the insert orientated so that the d35S promoter was closest to the Asp718l binding site of pCGN5139 and the 3 'tml was closest to the HindIII binding site was subjected to sequence analysis to confirm both the orientation of the insert and the integrity of cloning unions. The resulting plasmid was designated pCGN8624. Plasmid pCGN8621 was constructed by ligating the oligonucleotides 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCCAGCT-3 '(SEQ ID NO: 57) and 5'-GGATCCGCGGCCGCAAGCTTCTGCAGG-3' (SEQ ID NO: 58) into pCGN7787 digested with Sall / Xhol. A fragment containing the d35S promoter, polyadaptator and tml 3 'region was removed from pCGN8621 by digestion with Asp718l and partial digestion with Notl. The fragment was blunt-ended by filling the remaining 5 'ends with the Klenow fragment and then ligating them with pCGN5139 which had been digested with Asp718l and Hindlll and the blunt ends were filled at the 5' end with the Klenow fragment. A plasmid containing the insert orientated so that the d35S promoter was closest to the Asp718l binding site of pCGN5139 and the 3 'tml was closest to the HindIII binding site was subjected to sequence analysis to confirm both the orientation of the insert and the integrity of cloning unions. The resulting plasmid was designated pCGN8625. The open reading frame of AT-WS2 was amplified by PCR from Arabidopsis genomic DNA using the primers 5'-GGATCCGCGGCVGCATTATGAAACAGTTAGCAACCAACAGA-3 '(SEQ ID NO: 59) and 5'-GGATCCCCTGCAGGTTACAT TAAAATACAGACAACGTGCC-3' (SEQ ID NO. : 60). The PCR product is cloned into plasmid pCR 2.1 according to the manufacturers protocol (Clontech) to generate the plasmid pCGN9706. To direct the transcription of a sense transcript under the control of the napin expression cassette in the transgenic plants, the plasmid pCGN9712 is constructed by cloning the Notl / Sse8387l fragment of pCGN9706 into the binary vector pCGN8622 digested with NotI / PstI. To direct the transcription of an antisense transcript under the control of the napin expression cassette in the transgenic plants, the plasmid pCGN9713 is constructed by cloning the Notl / Sse8387l fragment of pCGN9706 into the binary vector pCGN8623 digested with NotI / PstI. To direct the transcription of a sense transcript under the control of a 35S double expression cassette in transgenic plants, the plasmid pCGN9714 is constructed by cloning the NotI / Sse8387I fragment of pCGN9706 into the binary vector pCGN8624 digested with NotI / PstI. Plasmids pCGN9712, pCGN9713 and pCGN9714 were introduced into Agrobacterium tumefaciens EHA 105 by electroporation, and the resulting Agrobacterium strains were used to transform Arabidopsis thaliana plants by vacuum infiltration.

The open reading frame of the ATWS1 sequence was amplified using PCR and cloned into pCGN8622, pCGN8623 and pCVGN8624 to create the plant expression constructs pCGN9708, pCGN9709 and pCGN9710, respectively.

EXAMPLE 14 Methods and analysis for plant transformation A variety of methods have been developed to insert DNA sequences of interest into the genome of a host plant to obtain transcription or transcription and translation of the sequence to effect genotypic changes. The varieties of high erucic acid, such as the cultivar Reston, or varieties of the Brassica napus canola type, can be transformed using Agrobacterium-mediated transformation methods as described by Radke et al. (Theor. Appl. Genet. (1988) 75 / 685-694; Plant Cell Reports (19902) 77:; 499-505). Transgenic Arabidopsis thaliana plants can be obtained by transformation mediated by Agrobacterium as described by Valverkens et al., (Proc. Nat .. Acad. Sci. (1988) 85;: 5536-5540), or as described by Bent et al. ((1994), Science 265: 1856-1860), or Bechtold et al. (1993), C.R.Acad. Sci, Life Sciences 316; 1194-1199). Other plant species can similarly be transformed using related techniques.

Alternatively, microprojectile bombardment methods, such as those described by Klein et al. (Bio / (Technology : 286-291) may also be useful for obtaining transformed plants comprising the reductase and wax synthase expression constructs described herein. The oily seeds obtained from the plants Transgenic Arabidopsis expressing ATWS1 (pCGN9708) or ATWS12 (pCGN9712) from the napin promoter are analyzed for the production of triglycerides by thin layer chromatography (TLC) and analysis of the methyl esters of fatty acid (FAME) using the methods described herein. The results of the analyzes show that the lines expressing the ATWS1 sequence have a reduced amount of triglycerides as well as a reduced amount of total fatty acids. Lines 9708-AT001-7 and 9708-AT001-23 contain 27.34% > and 24.85% DMARD per dry weight compared to untransformed Arabidopsis seed, which contains approximately 34% DMARD. In addition, the lines expressing ATWS2 have about 31% FAME (Table I).

TABLE l The above results demonstrate that nucleic acid sequences obtained from partially purified wax synthase proteins are active in the formation of wax esters from fatty alcohol and fatty acyl substrates. The methods for obtaining the wax synthase proteins and the amino acid sequence thereof are provided. Said nucleic acid sequences can be manipulated to provide transcription of the sequences and / or expression of wax protein synthase in host cells, whose proteins can be used for a variety of applications. Such applications include the production of wax ester compounds when the wax synthase is used in host cells having a fatty alcohol substrate source, which substrates may be native to the host cell or supplemented by the use of recombinant constructs encoding a fatty acyl protein reductase which is active in the formation of alcohols from fatty acyl substrates. All publications and patent applications cited in this specification are incorporated herein by reference as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Although the present invention has been described in some detail by way of illustration and examples for purposes of clarity and understanding, it will be readily apparent to those skilled in the art in light of the teachings of this invention that certain changes and modifications can be made without departing of the spirit or scope of the appended claims.

Claims (24)

NOVELTY OF THE INVENTION CLAIMS

1. - An isolated polynucleotide selected from the group consisting of: a) an isolated polynucleotide comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 2; b) an isolated polynucleotide comprising SEQ ID NO: 1; c) an isolated polynucleotide comprising a nucleotide sequence which has at least 70% identity to that of SEQ ID NO: 1 over the total length of SEQ ID NO: 1; d) an isolated polynucleotide comprising a nucleotide sequence which is at least 80% > of identity to that of SEQ ID NO: 1 on the total length of SEQ ID NO: 1; e) an isolated polynucleotide comprising a nucleotide sequence which has at least 90% identity to that of SEQ ID NO: 1 over the total length of SEQ ID NO: 1; f) an isolated polynucleotide comprising a nucleotide sequence which has at least 95% identity to that of SEQ ID NO: 1 over the total length of SEQ ID NO: 1; g) an isolated polynucleotide that hybridizes, under severe conditions, with SEQ ID NO: 1 or with a fragment thereof; and h) an isolated polynucleotide complementary to the polynucleotide sequence of (a), (b), (c), (d), (e), (f), or (g).

2. An isolated polynucleotide selected from the group consisting of: a) an isolated polynucleotide comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 4; b) an isolated polynucleotide comprising SEQ ID NO: 3; c) an isolated polynucleotide comprising a nucleotide sequence which has at least 70% identity to that of SEQ ID NO: 3 over the total length of SEQ ID NO: 3; d) an isolated polynucleotide comprising a nucleotide sequence which has at least 80% identity to that of SEQ ID NO: 3 over the total length of SEQ ID NO: 3; e) an isolated polynucleotide comprising a nucleotide sequence which is at least 90% > of identity to that of SEQ ID NO: 3 on the total length of SEQ ID NO: 3; f) an isolated polynucleotide comprising a nucleotide sequence which has at least 95% identity to that of SEQ ID NO: 3 over the total length of SEQ ID NO: 3; g) an isolated polynucleotide that hybridizes, under severe conditions, with SEQ ID NO: 3 or with a fragment thereof; and h) an isolated polynucleotide complementary to the polynucleotide sequence of (a), (b), (c), (d), (e), (f), or (g).

3. An isolated polynucleotide selected from the group consisting of SEQ ID Nos: 5, 7, 9, 11, 13 and 15.

4. A method for producing wax synthase in a host cell comprising the steps of growing a cell host having a recombinant DNA construct comprising a functional promoter in a host cell, and a nucleic acid sequence encoding an active acyltransferase in the formation of wax ester from fatty alcohol and fatty acyl substrates.

5. The method according to claim 4, further characterized in that said host cell is selected from the group consisting of a bacterial cell, an insect cell, and a plant cell.

6. The method according to claim 4, further characterized in that said nucleic acid sequence is selected from the group consisting of the sequence of claim 1 and the sequence of claim 2.

7. A method for producing ester of wax in a host cell comprising the steps of growing a host cell having a recombinant construct comprising a functional promoter in a host cell, and a nucleic acid sequence encoding at least a portion of an active acyltransferase in the formation of a wax ester, under conditions which will cause the expression of said acyltransferase, wherein said host cell comprises a fatty alcohol substrate of said acyltransferase, wherein the wax ester is produced in a host cell.

8. The method according to claim 7, further characterized in that said wax ester is produced from fatty alcohol and CoA-fatty substrate.

9. The method according to claim 7, further characterized in that said host cell is selected from the group consisting of a bacterial cell, an insect cell, and a plant cell.

10. - The method according to claim 7, further characterized in that said promoter is functional in a plant cell.

11. The method according to claim 10, further characterized in that said promoter is preferably expressed in a specific plant tissue.

12. The method according to claim 10, further characterized in that said promoter is preferably expressed in a plant seed cell.

13. The method according to claim 7, further characterized in that it comprises a second construct comprising a nucleic acid sequence encoding reductase under the regulatory control of the functional promoters in said host cell.

14. A method according to claim 13, further characterized in that it comprises a third construct comprising a sequence coding for β-ketoacyl-CoA synthase under the regulatory control of a functional promoter in said host cell.

15. The method according to claim 7, further characterized in that the wax ester that is produced results in an increase in oil as a component of said host cell.

16. A host cell comprising a wax ester produced in accordance with the method of claim 7. 7

17. - A wax ether obtained from the cell according to claim 16.

18. A low calorie food composition comprising a wax ester according to claim 17.

19. A method for altering the fat content of the host cells comprising, generating a host cell having a recombinant construct comprising a functional promoter in a host cell, and a nucleic acid sequence encoding at least a portion of an active acyltransferase in the formation of wax ester , under conditions that will cause the expression of said acyltransferase.

20. The method according to claim 19, further characterized in that said host cell is selected from the group consisting of a bacterial cell, an insect cell and a plant cell.

21. The method according to claim 19, further characterized in that said triglyceride content is reduced.

22. The method according to claim 19, wherein the oil content is reduced.

23. The method according to claim 22, wherein the protein composition of said cell is increased.

24. A method for producing a fatty alcohol comprising the steps of generating a host cell having a recombinant construct comprising a functional promoter in a host cell, and a nucleic acid sequence encoding an active acyltransferase in the formation of a host. wax ester, under conditions which will cause the expression of said acyltransferase, wherein said host cell comprises a fatty alcohol substrate of said acyltransferase, wherein the wax ester is produced in said host cell, isolating said wax ester from said said host cell, and subjecting said wax ester to conditions in which the fatty alcohols are produced.