WO2000032793A2 - Diacylglycerol acyle transferases - Google Patents
Diacylglycerol acyle transferases Download PDFInfo
- Publication number
- WO2000032793A2 WO2000032793A2 PCT/US1999/028825 US9928825W WO0032793A2 WO 2000032793 A2 WO2000032793 A2 WO 2000032793A2 US 9928825 W US9928825 W US 9928825W WO 0032793 A2 WO0032793 A2 WO 0032793A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dagat
- plant
- construct
- cell
- acyltransferase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11B—PRODUCING, e.g. BY PRESSING RAW MATERIALS OR BY EXTRACTION FROM WASTE MATERIALS, REFINING OR PRESERVING FATS, FATTY SUBSTANCES, e.g. LANOLIN, FATTY OILS OR WAXES; ESSENTIAL OILS; PERFUMES
- C11B11/00—Recovery or refining of other fatty substances, e.g. lanolin or waxes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6436—Fatty acid esters
- C12P7/6445—Glycerides
- C12P7/6463—Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
Definitions
- the present invention is directed to enzymes, methods to purify, and obtain such enzymes, amino acid and nucleic acid sequences related thereto, and methods of use for such compositions in genetic engineering applications.
- Plant oils are used in a variety of industrial and edible uses. Novel vegetable oils compositions and/or improved means to obtain oils compositions, from biosynthetic or natural plant sources, are needed. Depending upon the intended oil use, various different fatty acid compositions are desired.
- oilseed with a higher ratio of oil to seed meal would be useful to obtain a desired oil at lower cost. This would be typical of a high value oil product. Or such an oilseed might constitute a superior feed for animals . In some instances having an oilseed with a lower ratio of oil to seed meal would be useful to lower caloric content.
- edible plant oils with a higher percentage of unsaturated fatty acids are desired for cardiovascular health reasons .
- temperate substitutes for high saturate tropical oils such as palm, coconut, or cocoa would also find uses in a variety of industrial and food applications.
- One means postulated to obtain such oils and/or modified fatty acid compositions is through the genetic engineering of plants.
- Fatty acids are made in plastids from acetyl-CoA through a series of reactions catalyzed by enzymes known collectively as Fatty Acid Synthetase (FAS) .
- FAS Fatty Acid Synthetase
- the fatty acids produced in plastids are exported to the cytosolic compartment of the cell, and are esterified to coenzyme A.
- acyl-CoAs are the substrates for glycerolipid synthesis in the endoplasmic reticulum (ER) .
- Glycerolipid synthesis itself is a series of reactions leading first to phosphatidic acid (PA) and diacylglycerol (DAG) .
- PA phosphatidic acid
- DAG diacylglycerol
- Either of these metabolic intermediates may be directed to membrane phospholipids such as phosphatidylglycerol (PG) , phosphatidylethanolamine (PE) or phosphatidylcholine (PC) , or they may be directed on to form neutral triacylglycerol (TAG) the primary component of vegetable oil used by the seed as a stored form of energy to be used during seed germination.
- PG phosphatidylglycerol
- PE phosphatidylethanolamine
- PC phosphatidylcholine
- TAG neutral triacylglycerol
- Diacylglycerol is synthesized from glycerol-3- phosphate and fatty acyl-CoAs in three steps catalyzed sequentially by glycerol-3 -phosphate acyltransferase (G3PAT) , lysophosphatidic acid acyltransferase ( PAAT) to make PA, and a further hydrolytic step catalyzed by phosphatidic acid phosphatase (PAP) to make DAG.
- G3PAT glycerol-3 -phosphate acyltransferase
- PAAT lysophosphatidic acid acyltransferase
- PAP phosphatidic acid phosphatase
- DAG is used to make membrane phospholipids, the first step being the synthesis of PC catalyzed by CTP-phosphocholine cytidylyltransferase .
- DAG is acylated with a third fatty acid in a reaction catalyzed by diacylglycerol acyltransferase (DAGAT) .
- DAG diacylglycerol acyltransferase
- acyltransferases from many temperate zone species of seeds to allow either a saturated or an unsaturated fatty acid at the sn-1 or the sn-3 position, but only an unsaturated fatty acid at the sn-2.
- the absolute specificity for an unsaturated fatty acid at sn-2 is determined by the substrate preference of LPAAT enzyme.
- TAG compositions suggest that this tendency is carried further in that there is an apparent preference for acylation of the sn-3 position with a saturated fatty acid, if the sn-1 position is esterified to a saturated fatty acid.
- the reaction catalyzed by DAGAT is at a critical branchpoint in glycerolipid biosynthesis . Enzymes at such branchpoints are considered prime candidates for sites of metabolic regulation. Up through the synthesis of diacylglycerol, TAG and membrane lipid synthesis share in common G3PAT, LPAAT, and PAP. Since all cells have membranes, they must have these enzymes. What makes oil synthesis unique is the DAGAT reaction. The presence of DAGAT activity provides an alternative fate for DAG than going into membranes.
- nucleic acid sequences capable of producing a phenotypic result in the incorporation of fatty acids into a glycerol backbone to produce an oil is subject to various obstacles including but not limited to the identification of metabolic factors of interest, choice and characterization of a protein source with useful kinetic properties, purification of the protein of interest to a level which will allow for its amino acid sequencing, utilizing amino acid sequence data to obtain a nucleic acid sequence capable of use as a probe to retrieve the desired DNA sequence, and the preparation of constructs, transformation and analysis of the resulting plants .
- the identification of enzyme targets and useful tissue sources for nucleic acid sequences of such enzyme targets capable of modifying oil structure and quantity are needed.
- an enzyme target will be amenable to one or more applications alone or in combination with other nucleic acid sequences relating to increased/decreased oil production, TAG structure, the ratio of saturated to unsaturated fatty acids in the fatty acid pool, and/or to other novel oils compositions as a result of the modifications to the fatty acid pool.
- enzyme targets (s) are identified and qualified, quantities of protein and purification protocols are needed for sequencing.
- useful nucleic acid constructs having the necessary elements to provide a phenotypic modification and plants containing such constructs are needed.
- Several putative isolation procedures have been published for DAGAT. Polokoff and Bell (1980) reported solubilization and partial purification of DAGAT from rat liver microsomes .
- Solubilization of a multienzyme complex from Euglena gracilis having fatty acyl-SCoA transacylase activity is reported by Wildner and Hallick (Abstract from The Southwest
- WO 93/10241 is directed to plant fatty acyl-CoA: fatty alcohol 0-acyltransferases .
- a jojoba 57kD protein is identified as the jojoba fatty acyl-CoA: fatty alcohol 0- acyltransferase (wax synthase) .
- the present inventors later reported that the 57kD protein from jojoba is a ⁇ -ketoacyl-CoA synthase involved in the biosynthesis of very long chain fatty acids (Lassner et al . ( The Plant Cell (1996) 5:281-292).
- compositions and methods of use related to diacylglycerol acyltransferase hereinafter also referred to as DAGAT.
- DAGAT protein preparations which have relatively high specific activity are of interest for use in a variety of applications, in vitro and in vivo.
- protein preparations having DAGAT activities are contemplated hereunder .
- DAGATs obtainable from Mortierella ramanniana and Arabidopsis .
- the jojoba wax synthase of the present invention also demonstrates diacylglycerol (DAGAT) activity.
- DAG diacylglycerol
- TAG is not naturally produced in jojoba and thus the activity of the wax synthase enzyme with DAG substrates suggests that the wax synthase is related to DAGAT, an enzyme responsible for production of TAG in most plant species, particularly in oilseed crop plants whose seeds contain high levels of storage TAG.
- DAGAT diacylglycerol
- the exemplified ojoba DAGAT is purified away from the membrane (i.e. solubilized) , and the solubilized DAGAT preparation is subjected to various chromatographic analyses to identify a protein associated with the DAGAT activity. In this manner a protein having a molecular weight of approximately 33 kDA based on SDS-PAGE_analysis is identified as associated with DAGAT activity. Further purification methods, such as column chromatography and polyacrylamide gel electrophoresis are utilized to obtain the DAGAT protein in sufficient purity for amino acid sequence analysis .
- Peptide fragments from the DAGAT proteins are used as a template in designing various synthetic oligonucleotides which are used to obtain nucleic acid sequences encoding all or a portion of the DAGAT protein. Using the DAGAT encoding sequences so obtained, it is also possible to isolate other DAGAT genes which encode DAGAT proteins. As demonstrated herein, nucleic acid sequences coding for DAGAT are obtained from Arabidopsis .
- this invention encompasses DAGAT peptides and the corresponding amino acid sequences of those peptides. Such sequences find particular use in the preparation of oligonucleotides containing DAGAT encoding sequences for analysis and recovery of DAGAT gene sequences.
- the DAGAT encoding sequence may encode a complete or partial sequence depending upon the intended use. All or a portion of the genomic sequence, or cDNA sequence, is intended.
- constructs which provide for transcription or transcription and translation (expression) of the DAGAT sequences.
- constructs which are capable of transcription or transcription and translation in plant host cells are preferred.
- Such constructs may contain a variety of regulatory regions including transcriptional initiation regions obtained from genes preferentially expressed in plant seed tissue.
- this invention relates to a method for producing a DAGAT in a host cell or progeny thereof via the expression of a construct in the cell.
- Cells containing a DAGAT as a result of the production of the DAGAT encoding sequence are also contemplated herein.
- this invention relates to methods of using DNA sequences encoding DAGAT for the modification of the ratio of oil (TAG) to other constituents as well as the composition and structure of the triglyceride molecules, especially in the seed oil of plant oilseed crops. Plant cells having such a modified triglyceride are also contemplated herein.
- modified plants, seeds and oils obtained by expression of the plant DAGAT proteins of this invention are also considered in this invention.
- Figure 1 presents results of analysis of jojoba wax synthase activity in column fractions from a first wax synthase purification protocol.
- Figure 1A provides results of Blue A agarose chromatography.
- Figure IB provides results of ceramic hydroxyapatite chromatography.
- Figure 1C provides results of sephracryl S-100 size exclusion chromatography.
- Figure ID provides results of hydroxyapatite chromatography.
- Figure 2 presents results of analysis of jojoba wax synthase activity in column fractions from a second wax synthase purification protocol.
- Figure 2A provides results of Blue A agarose chromatography.
- Figure 2B provides results of hydroxyapatite chromatography.
- Figure 2C provides results of Superdex 75 size exclusion chromatography.
- Figure 3 presents results of jojoba wax synthase and DAGAT activity in fractions from a purified wax synthase preparation according to the wax synthase purification represented in
- Figure 4 presents results of analysis of DAGAT activity in column fractions from a Mortierella ramanniana DAGAT purification protocol utilizing Yellow 86-Agarose chromatography .
- Figure 5A presents results of further chromatography of Mortierella ramanniana DAGAT activity in column fractions from Heparin-Sepharose CL-6B chromatography of pooled DAGAT- containing fractions from Yellow 86-Agarose chromatography.
- Figure 5B provides results of SDS-PAGE analysis of the peak fractions .
- Figure 6A presents results of further chromatography of Mortierella ramanniana DAGAT on Yellow 86-Agarose using gradient elution.
- the sample applied was pooled fractions from the late-eluting DAGAT peak from Heparin-Sepharose CL-6B.
- Figure 6B presents the SDS-PAGE analysis of the peak fractions.
- Figure 7 presents results of analysis of DAGAT activity in column fractions from a second Mortierella ramanniana DAGAT purification protocol utilizing Yellow 86-Agarose chromatography .
- Figure 8A presents results of analysis of Mortierella ramanniana DAGAT activity in column fractions from Hydroxylapatite chromatography of DAGAT fractions pooled from a Yellow 86-Agarose column.
- Figure 8B provides results of SDS- PAGE analysis of the peak fractions.
- Figure 9 presents results of analysis of DAGAT activity in column fractions from a Mortierella ramanniana DAGAT purification protocol.
- Figure 9A provides results of tandem Yellow 8 ⁇ -Agarose/Hydr ⁇ xylapatite chromatography.
- Figure 9B provides results of SDS-PAGE analysis of the peak fractions from the tandem chromotography .
- Figure 10 provides the nucleic acid sequence for jojoba wax synthase.
- Figure 11 provides the amino acid sequence derived from the nucleic acid sequence of jojoba wax synthase.
- Figure 12 provides the nucleic acid sequence of AT_WS1.
- Figure 13 provides the nucleic acid sequence of AT_WS2.
- Figure 14 provides the nucleic acid sequence of AT_WS3.
- Figure 15 provides the nucleic acid sequence of AT_WS4.
- Figure 16 provides the nucleic acid sequence of AT_WS5.
- Figure 17 provides the nucleic acid sequence of AT_WS6.
- Figure 18 provides the nucleic acid sequence of AT_WS7.
- Figure 19 provides an alignment between the amino acid sequences of the jojoba wax synthase, and Arabidopsis AT-WS1, AT_WS2, AT_WS3, AT_WS4 , AT_WS5 , AT_WS6, and AT_WS7.
- Figure 20 provides a dendogram of the relationships between the amino acid sequences compared in Figure 20.
- Figure 21 provides the results of DAGAT assays on leaves of Arabidopsis plants expressing the coding sequence of ATWS1 (PCGN9710) and ATWS2 (pCGN9714) .
- a diacylglycerol acyltransferase (referred to herein as DAGAT) of this invention includes nucleic acid sequences coding sequences of amino acids, such as a protein, polypeptide or peptide, obtainable from a cell source, which demonstrates the ability to catalyze the production of triacylglycerol from 1, 2 -diacylglycerol and an acyl-CoA substrate under enzyme reactive conditions.
- enzyme reactive conditions is meant that any necessary conditions are available in an environment (i.e., such factors as temperature, pH, lack of inhibiting substances) which will permit the enzyme to function.
- solubilization refers to extraction of the DAGAT enzyme from the membranes in such a way that it then behaves in a manner typical of enzymes that are not membrane-associated. Because the membrane effectively links the DAGAT protein to other proteins which are also present therein, solubilization is an essential requirement for identification and to purification of the DAGAT protein as described in the following examples. In testing for solubilization of DAGAT activity, three different indications of solubilization, as described in more detail in the following examples, are considered.
- DAGAT activity is not sedimented by very high-speed centrifugation .
- DAGAT activity migrates on a size-exclusion chromatography column as though it had a native molecular weight typical of enzymes which are not membrane-associated .
- Proteins present in the DAGAT preparation are at least partially separable from each other by column chromatography.
- the first criterion of failure to sediment at very high g forces could be misleading if the density of the solution used for solubilization is similar to that of the unsolubilized membranes so that they sediment only very slowly.
- the second criterion in which solubilized activity migrates more slowly through a size-exclusion column than the original membranes, may be compromised if the membranes themselves bind weakly to the column after exposure to detergent so that their migration through it is slowed.
- the third criterion, in which the solubilized proteins are chromatographically resolvable, is the least likely to be compromised by artifacts or unforeseen situations.
- membranes could be partially dissociated by the solubilization procedure such that various aggregates of proteins are released. Such aggregates might then be resolved from each other chromatographically.
- satisfaction of all three criteria is necessary to assure that DAGAT solubilization is achieved.
- the jojoba DAGAT of this invention has a broad range of acyl substrates, including acyl-ACP and acyl-CoA molecules.
- the acyl and fatty alcohol substrates may have a broad size range with respect to carbon chain length. For example, activity was tested using substrates having carbon chain lengths of from C8 to C24, and all were shown to be utilized by the enzyme. In addition, activity was shown with fatty acyl and fatty alcohols having varying degrees of unsaturation.
- the purified jojoba wax synthase is also shown herein to have activity with diacylglycerol (DAG) and fatty acyl-CoA substrates to produce triacylglycerol (TAG) , even though TAG have not been reported to exist in jojoba plant tissues.
- the wax synthase has at least two acyltransferase activities, one in which the acceptor substrate for the acyl-CoA molecule is an alcohol (fatty alcohol acyltransferase) and another in which the acceptor subsrate is a diacylglycerol (DAG acyltransferase, or DAGAT) .
- DAGAT diacylglycerol
- the presence of the DAGAT activity of the wax synthase enzyme suggests that wax synthase protein is closely related to DAGAT proteins in other plant species.
- Solubilization of Jojoba and Mortierella ramanniana DAGATs are described in the following examples. Solubilization of DAGAT is confirmed by demonstration of each of the above criteria of solubilization. Solubilized preparations of Mortierella ramanniana DAGAT are utilized in a variety of chromatographic experiments for identification and partial purification of the DAGAT protein. In this manner, a protein having a molecular weight of approximately 33 kDa is identified as associated with DAGAT activity. As described in more detail in the following examples, the 33 kDa protein is partially purified by chromatography on Yellow 86-Agarose and hydroxyapatite columns .
- the protein is then obtained in substantially purified form by gel electrophoresis and, if desired, by blotting of the partially purified DAGAT protein to polyvinylidine difluoride (PVDF) or nitrocellulose membranes.
- PVDF polyvinylidine difluoride
- the 33 kDA protein is recovered by cutting out that portion of the gel or membrane containing the identified band.
- the purified protein is then digested with various enzymes to generate peptides for use in determination of amino acid sequence.
- the tryptic peptide of the 33 kDa protein described herein represents a portion of a Mortierella ramanniana DAGAT.
- Other Mortierella ramanniana DAGAT peptides may be similarly obtained and the amino acid sequences determined.
- amino acid sequences from DAGAT peptides to obtain nucleic acid sequences which encode DAGAT is described herein.
- synthetic oligonucleotides are prepared which correspond to the DAGAT peptide sequences .
- the oligonucleotides are used as primers in polymerase chain reaction (PCR) techniques to obtain partial DNA sequence of DAGAT genes .
- the partial sequences so obtained are then used as probes to obtain DAGAT clones from a gene library prepared from Mortierella ramanniana tissue.
- PCR polymerase chain reaction
- probes may be used directly to screen gene libraries for DAGAT gene sequences.
- screening of cDNA libraries in phage vectors is useful in such methods due to lower levels of background hybridization .
- a nucleic acid sequence of a DAGAT of this invention may be a DNA or RNA sequence, derived from genomic DNA, cDNA, mRNA, or may be synthesized in whole or in part.
- the gene sequences may be cloned, for example, by isolating genomic DNA from an appropriate source, and amplifying and cloning the sequence of interest using a polymerase chain reaction (PCR) .
- PCR polymerase chain reaction
- the gene sequences may be synthesized, either completely or in part, especially where it is desirable to provide plant-preferred sequences.
- all or a portion of the desired structural gene may be synthesized using codons preferred by a selected host. Host-preferred codons may be determined, for example, from the codons used most frequently in the proteins expressed in a desired host species.
- nucleic acid probes DNA and RNA
- DNA and RNA DNA and RNA
- homologous sequences are found when there is an identity of sequence, which may be determined upon comparison of sequence information, nucleic acid or amino acid, or through hybridization reactions between a known DAGAT and a candidate source.
- Conservative changes such as Glu/Asp, Val/Ile, Ser/Thr, Arg/Lys and Gln/Asn may also be considered in determining sequence homology.
- Amino acid sequences are considered homologous by as little as 25% sequence identity between the two complete mature proteins. (See generally, Doolittle, R.F., OF URFS and ORFS (University Science Books, CA, 1986.)
- DAGATs may be obtained from the specific exemplified Mortierella ramanniana protein preparations and sequences provided herein.
- DAGATs including modified amino acid sequences and starting materials for synthetic-protein modeling from the exemplified DAGATs and from DAGATs which are obtained through the use of such exemplified sequences.
- Modified amino acid sequences include sequences which have been mutated, truncated, increased and the like, whether such sequences were partially or wholly synthesized. Sequences which are actually purified from plant preparations or are identical or encode identical proteins thereto, regardless of the method used to obtain the protein or sequence, are equally considered naturally derived.
- a DAGAT sequence obtainable from the use of nucleic acid probes will show 60-70% sequence identity between the target DAGAT sequence and the encoding sequence used as a probe.
- lengthy sequences with as little as 50-60% sequence identity may also be obtained.
- the nucleic acid probes may be a lengthy fragment of the nucleic acid sequence, or may also be a shorter, oligonucleotide probe.
- longer nucleic acid fragments are employed as probes (greater than about 100 bp) , one may screen at lower stringencies in order to obtain sequences from the target sample which have 20-50% deviation (i.e., 50-80% sequence homology) from the sequences used as probe.
- Oligonucleotide probes can be considerably shorter than the entire nucleic acid sequence encoding an DAGAT enzyme, but should be at least about 10, preferably at least about 15, and more preferably at least about 20 nucleotides. A higher degree of sequence identity is desired when shorter regions are used as opposed to longer regions . It may thus be desirable to identify regions of highly conserved amino acid sequence to design oligonucleotide probes for detecting and recovering other related DAGAT genes . Shorter probes are often particularly useful for polymerase chain reactions (PCR) , especially when highly conserved sequences can be identified. ⁇ See, Gould, et al . , PNAS USA (1989) Sf5:1934-1938) .
- PCR polymerase chain reactions
- databases containing nucleic acid and amino acid sequences from various organisms may be searched with the sequences of the present invention to identify similar sequences. For example, using the jojoba DAGAT protein sequence to search a database containing DNA sequences from Arabidopsis, an approximately 12 Kb sequence containing at least seven repeats of an open reading frame with high similarity to the jojoba sequence are identified. In addition, one of the sequences is identified to be expressed preferentially in immature seeds of Arabidopsis and in 30 day post anthesis seeds of Brassica . The deduced amino acid sequences demonstrate a high level of homology to the jojoba wax synthase amino acid sequence.
- homologous similarity refers to the amount of identity plus the amount of similarity between a set of sequences.
- genes for other related acyltransferase proteins may also be obtained using sequence information from the DAGAT and related nucleic acid sequences.
- other acyltransferase enzymes are involved in plant lipid biosynthesis, including plastidial DAGAT, mitochondrial DAGAT, lysophosphosphatidylcholine acyltransferase (LPCAT) , lysophosphosphatidylserine acyltransferase (LPSAT) , lysophosphosphatidylethanolamine acyltransferase (LPEAT) , and lysophosphosphatidylinositol acyltransferase (LPIAT) .
- acyltransferases including fatty acyl-CoA: fatty alcohol 0-acyltransferase (wax synthase) from jojoba may be related to diacylglycerol acylransferases .
- DAGAT and wax synthase are members of a homologous family of proteins is supported by information obtained through the purification of DAGAT from a species of oleaginous fungus, Mortierella ramanniana (see Examples) .
- the fungal DAGAT activity is membrane bound, and may be solubilized only through the use of detergents.
- solubilization it is necessary following solubilization to include a phospholipid (e.g., phosphatidic acid) in the assay mixture in order to restore enzyme activity of the fungal DAGAT.
- a phospholipid e.g., phosphatidic acid
- DAGAT behaves very similar to jojoba wax synthase during the purification chromatography. Specifically, both enzyme species flow through a hydroxylapatite column with only a slight retardation, whereas most other protein species in the membrane preparations are bound to the column matrix (see
- the sequence is labeled to allow detection, typically using radioactivity, although other methods are available.
- the labeled probe is added to a hybridization solution, and incubated with filters containing the desired nucleic acids, such as Northern or Southern blots, or the filters containing cDNA or genomic clones to be screened.
- Hybridization and washing conditions may be varied to optimize the hybridization of the probe to the sequences of interest. Lower temperatures and higher salt concentrations allow for hybridization of more distantly related sequences (low stringency) . If background hybridization is a problem under low stringency conditions, the temperature can be raised either in the hybridization or washing steps and/or salt content lowered to improve detection of the specific hybridizing sequence.
- Hybridization and washing temperatures can be adjusted based on the estimated melting temperature of the probe as discussed in Beltz, et al . (Methods in Enzymology (1983) 100:266-285) .
- a useful probe and appropriate hybridization and washing conditions having been identified as described above, cDNA or genomic libraries are screened using the labeled sequences and optimized conditions.
- antibodies to the DAGAT protein can be prepared by injecting rabbits or mice with the purified protein, such methods of preparing antibodies being well known to those in the art. Either monoclonal or polyclonal antibodies can be produced, although typically polyclonal antibodies are more useful for gene isolation.
- Western analysis may be conducted to determine that a related protein is present in a crude extract of the desired plant n species, as determined by cross-reaction with the antibodies to the coconut DAGAT. When cross-reactivity is observed, genes encoding the related proteins are isolated by screening expression libraries representing the desired plant species. Expression libraries can be constructed in a variety of commercially available vectors, including lambda gtll, as described in Maniatis, et al .
- oils from several tropical plants including cocoa, illipe, sal, shea, and Garcinia species such as kokum have been shown to accumulate high amounts of TAG in this form.
- Plants having significant medium-chain fatty acids in their seed oils are preferred candidates to obtain plant DAGATs capable of incorporating medium-chain fatty acids into the sn-3 position of TAG.
- Several species in the genus Cuphea accumulate triglycerides containing medium-chain fatty acids in their seeds, e.g., procumbens , lutea, hookeriana, hyssopi folia, wrightii and inflata .
- Another natural plant source of medium-chain fatty acids are seeds of the Lauraceae family.
- DAGATs from plant species which incorporate unusual long-chain fatty acids in the storage TAG.
- nasturtium and meadowfoam contain 22:1 acyl groups in the seed TAG.
- plant DAGATs from a variety of sources can be used to investigate TAG biosynthesis events of plant lipid biosynthesis in a wide variety of in vivo applications. Because all plants appear to synthesize lipids via a common metabolic pathway, the study and/or application of one plant DAGAT to a heterologous plant host may be readily achieved in a variety of species. In other applications, a plant DAGAT can be used outside the native plant source of the DAGAT to enhance the production and/or modify the composition of the TAG produced or synthesized in vi tro .
- nucleic acid sequences associated with plant DAGAT proteins will find many uses. For example, recombinant constructs can be prepared which can be used as probes, or which will provide for expression of the DAGAT protein in host cells to produce a ready source of the enzyme and/or to modify the composition of triglycerides found therein. Other useful applications may be found when the host cell is a plant host cell, either in vi tro or in vivo . For example, by increasing the amount of a respective medium-chain preferring DAGAT available to the plant TAG biosynthesis pathway, an increased percentage of medium-chain fatty acids may be obtained in the TAG.
- DAGAT DAGAT endogenously expressed in a plant cell by anti-sense technology.
- DAGAT decreased expression of a native Brassica long-chain preferring DAGAT may be desired.
- Decreased endogenous DAGAT would allow for more opportunity for the seeds engineered with wax synthase to synthase long-chain liquid waxes.
- decreased endogenous DAGAT could be used to decrease synthesis of TAG so that additional carbon would be available for other seed constituents or products, including but not limited to protein and starch.
- the constructs may contain the sequence which encodes the entire DAGAT protein, or a portion thereof.
- the entire DAGAT sequence is not required.
- DAGAT constructs are intended for use as probes, it may be advantageous to prepare constructs containing only a particular portion of an DAGAT encoding sequence, for example a sequence which is discovered to encode a highly conserved DAGAT region.
- nucleic acid sequence encoding a plant DAGAT of this invention may include genomic, cDNA or mRNA sequence.
- encoding is meant that the sequence corresponds to a particular amino acid sequence either in a sense or anti-sense orientation.
- extrachromosomal is meant that the sequence is outside of the plant genome of which it is naturally associated.
- recombinant is meant that the sequence contains a genetically engineered modification through manipulation via mutagenesis, restriction enzymes, and the like.
- a cDNA sequence may or may not contain pre-processing sequences, such as transit peptide sequences or targeting sequences to facilitate delivery of the DAGAT protein to a given organelle or membrane location.
- pre-processing sequences such as transit peptide sequences or targeting sequences to facilitate delivery of the DAGAT protein to a given organelle or membrane location.
- the use of any such precursor DAGAT DNA sequences is preferred for uses in plant cell expression.
- a genomic DAGAT sequence may contain the transcription and translation initiation regions, introns , and/or transcript termination regions of the plant DAGAT, which sequences may be used in a variety of DNA constructs, with or without the DAGAT structural gene.
- nucleic acid sequences corresponding to the plant DAGAT of this invention may also provide signal sequences useful to direct protein delivery into a particular organelle or membrane location, 5' upstream non-coding regulatory regions (promoters) having useful tissue and timing profiles, 3' downstream non-coding
- the desired plant DAGAT nucleic acid sequence may be manipulated in a variety of ways. Where the sequence involves non-coding flanking regions, the flanking regions may be subjected to resection, mutagenesis, etc. Thus, transitions, transversions , deletions, and insertions may be performed on the naturally occurring sequence. In addition, all or part of the sequence may be synthesized.
- one or more codons may be modified to provide for a modified amino acid sequence, or one or more codon mutations may be introduced to provide for a convenient restriction site or other purpose involved with construction or expression.
- the structural gene may be further modified by employing synthetic adapters, linkers to introduce one or more convenient restriction sites, or the like.
- nucleic acid or amino acid sequences encoding a plant DAGAT of this invention may be combined with other non-native, or “heterologous” , sequences in a variety of ways.
- heterologous sequences is meant any sequence which is not naturally found joined to the plant DAGAT, including, for example, combinations of nucleic acid sequences from the same plant which are not naturally found joined together.
- the DNA sequence encoding a plant DAGAT of this invention may be employed in conjunction with all or part of the gene sequences normally associated with the DAGAT.
- a DNA sequence encoding DAGAT is combined in a DNA construct having, in the 5' to 3 ' direction of transcription, a transcription initiation control region capable of promoting transcription and translation in a host cell, the DNA sequence encoding plant DAGAT and a transcription and translation termination region.
- Potential host cells include both prokaryotic and eukaryotic cells .
- a host cell may be unicellular or found in a multicellular differentiated or undifferentiated organism depending upon the intended use. Cells of this invention may
- 2.1 be distinguished by having a plant DAGAT foreign to the wild- type cell present therein, for example, by having a recombinant nucleic acid construct encoding a plant DAGAT therein.
- the regulatory regions will vary, including regions from viral, plasmid or chromosomal genes, or the like.
- a wide variety of constitutive or regulatable promoters may be employed. Expression in a microorganism can provide a ready source of the plant enzyme.
- transcriptional initiation regions which have been described are regions from bacterial and yeast hosts, such as E. coli , B . subtilis , Sacchromyces cerevisiae, including genes such as beta-galactosidase, T7 polymerase, tryptophan E and the like.
- the constructs will involve regulatory regions functional in plants which provide for modified production of plant DAGAT, and possibly, modification of the fatty acid composition.
- the open reading frame, coding for the plant DAGAT or functional fragment thereof will be joined at its 5' end to a transcription initiation regulatory region.
- the use of all or part of the complete plant DAGAT gene is desired; namely all or part of the 5' upstream non-coding regions (promoter) together with the structural gene sequence and 3 ' downstream non-coding regions may be employed.
- a different promoter such as a promoter native to the plant host of interest or a modified promoter, i.e., having transcription initiation regions derived from one gene source and translation initiation regions derived from a different gene source
- numerous transcription initiation regions are available which provide for a wide variety of constitutive or regulatable, e.g., inducible, transcription of the structural gene functions.
- the transcription/translation initiation regions corresponding to such structural genes are found immediately 5' upstream to the respective start codons.
- transcriptional initiation regions used for plants are such regions associated with the T-DNA structural genes such as for nopaline and mannopine synthases, the 19S and 35S promoters from CaMV, and the 5' upstream regions from other plant genes such as napin, ACP, SSU, PG, zein, phaseolin E, and the like.
- Enhanced promoters, such as double 35S, are also available for expression of DAGAT sequences.
- 5' upstream non-coding regions are obtained from other genes regulated during seed maturation, those preferentially expressed in plant embryo tissue, such as ACP and napin-derived transcription initiation control regions, are desired.
- seed-specific promoters may be obtained and used in accordance with the teachings of U.S.
- promoter regions for example, RoplAt (Li, et al . (1998) Plant Phyiol . 118:407-417) and others described by Hamilton, et al . (1998) Plant Mol Biol . 38(4)663-669 may be employed.
- promoter regions such as Ntltpl (Canevascini , et al . (1996) Plant Physiol . 112:513-524) may be employed.
- Transcript termination regions may be provided in DNA constructs of this invention as well.
- Transcript termination regions may be provided by the DNA sequence encoding the plant DAGAT or a convenient transcription termination region derived from a different gene source, for example, the transcript termination region which is naturally
- transcript termination region is from a different gene source, it will contain at least about 0.5 kb, preferably about 1-3 kb of sequence 3 ' to the structural gene from which the termination region is derived.
- Plant expression or transcription constructs having a plant DAGAT as the DNA sequence of interest for increased or decreased expression thereof may be employed with a wide variety of plant life, particularly, plant life involved in the production of vegetable oils for edible and industrial uses. Most especially preferred are temperate oilseed crops. Plants of interest include, but are not limited to, rapeseed (Canola and High Erucic Acid varieties), sunflower, safflower, cotton, soybean, peanut, coconut and oil palms, and corn. Depending on the method for introducing the recombinant constructs into the host cell, other DNA sequences may be required. Importantly, this invention is applicable to dicotyledyons and monocotyledons species alike and will be readily applicable to new and/or improved transformation and regulation techniques.
- DAGAT proteins of this invention include their use in preparation of structured plant lipids which contain TAG molecules having desirable fatty acyl groups incorporated into particular positions on the TAG molecules.
- the method of transformation in obtaining such transgenic plants is not critical to the instant invention, and various methods of plant transformation are currently available. Furthermore, as newer methods become available to transform crops, they may also be directly applied hereunder . For example, many plant species naturally susceptible to Agrobacterium infection may be successfully transformed via tripartite or binary vector methods of Agrobacterium mediated transformation. In many instances, it will be desirable to have the construct bordered on one or both sides by T-DNA, particularly having the left and right borders, more particularly the right border. This is particularly useful when the construct uses A . tumefaciens or A . rhizogenes as a mode for transformation, although the T-DNA borders may find use with other modes of transformation.
- DNA constructs Normally, included with the DNA construct will be a structural gene having the necessary regulatory regions for expression in a host and providing for selection of transformant cells.
- the gene may provide for resistance to a cytotoxic agent, e.g. antibiotic, heavy metal, toxin, etc., complementation providing prototrophy to an auxotrophic host, viral immunity or the like.
- cytotoxic agent e.g. antibiotic, heavy metal, toxin, etc.
- one or more markers may be employed, where different conditions for selection are used for the different hosts.
- a vector may be used which may be introduced into the Agrobacterium host for homologous recombination with T-DNA or the Ti- or Ri-plasmid present in the Agrobacterium host.
- the Ti- or Ri-plasmid containing the T-DNA for recombination may be armed (capable of causing gall formation) or disarmed (incapable of causing gall formation), the latter being permissible, so long as the vir genes are present in the transformed Agrobacterium host.
- the armed plasmid can give a mixture of normal plant cells and gall.
- the expression or transcription construct bordered by the T-DNA border region (s) will be inserted into a broad host range vector capable of replication in E. coli and Agrobacterium, there being broad host range vectors described in the literature. Commonly used is pRK2 or derivatives thereof. See, for example, Ditta, et al . , ( Proc . Na t . Acad. Sci . , U. S. A . (1980) 77:7347-7351) and EPA 0 120 515, which are incorporated herein by reference.
- a vector containing separate replication sequences one of which stabilizes the vector in E. coli , and the other in Agrobacterium .
- McBride and Summerfelt Plant Mol . Biol . (1990) 14:269-276
- the pRiHRI Jaanin, et al . , Mol . Gen . Genet . (1985) 201:370-374
- origin of replication is utilized and provides for added stability of the plant expression vectors in host Agrobacterium cells.
- Included with the expression construct and the T-DNA will be one or more markers, which allow for selection of transformed Agrobacterium and transformed plant cells.
- markers have been developed for use with plant cells, such as resistance to chloramphenicol , kanamycin, the aminoglycoside G418, hygromycin, or the like.
- the particular marker employed is not essential to this invention, one or another marker being preferred depending on the particular host and the manner of construction.
- explants may be combined and incubated with the transformed Agrobacterium for sufficient time for transformation, the bacteria killed, and the plant cells cultured in an appropriate selective medium. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be grown to seed and the seed used to establish repetitive generations and for isolation of vegetable oils .
- the invention now being generally described, it will be more readily understood by reference to the following examples which are included for purposes of illustration only and are not intended to limit the present invention. 4 Examples Example 1 - Wax synthase Assays
- the substrate generally used in the wax synthase assays [1- 14 C] palmitoyl-CoA, is purchased from Amersham (Arlington Heights, IL) .
- Other chain length substrates were synthesized in order to perform chain length specification studies.
- Long chain [1- 1 C] fatty acids (specific activity 51-56 Ci/mole) , namely 11-cis-eicosenoic acid, 13-cis-docosenoic acid and 15- cis-tetracosenoic acid are prepared by the reaction of potassium [ 1 C] cyanide with the corresponding alcohol mesylate, followed by the base hydrolysis of the alcohol nitrile to the free fatty acid.
- the free fatty acids are converted to their methyl esters with ethereal diazomethane, and purified by preparative silver nitrate thin layer chromatography (TLC) .
- TLC thin layer chromatography
- the fatty acid methyl esters are hydrolyzed back to the free fatty acids.
- Radiochemical purity is assessed by three TLC methods: normal phase silica TLC, silver nitrate TLC, and C18 reversed phase TLC. Radiochemical purity as measured by these methods was 92-98%.
- Long chain [1- 1 C] acyl-CoAs are prepared from the corresponding [1- 1 C] free fatty acids by the method of Young and Lynen (J " . Bio . Chem . (1969) 244:377), to a specific activity of lOCi/mole.
- [1- 14 C] hexadecanal is prepared by the dichromate oxidation of [1- 1 C] hexadecan-1-ol, according to a micro-scale modification of the method of Pletcher and Tate (Tet. Lett. (1978) 1601-1602) .
- the product is purified by preparative silica TLC, and stored as a hexane solution at -70°C until use.
- Wax synthase activity in a microsomal membrane preparation is measured by incubation of 40 ⁇ M [1- 14 C] acyl-CoA
- the incubation mixture also contains either 25 mM HEPES (4- [2-hydroxyethyl] -1-piperazineethane-sulfonic acid), pH 7.5, as the buffering agent with 20% w/v glycerol, ImM DTT, 0.5M NaCI or 25 mM Tricine-NaOH, pH 7.8 , as the buffering agent with 0.28M NaCI, 10% glycerol, and 2mM ⁇ - mercaptoethanol .
- Initial studies were performed with the first buffer system, when the pH was chosen to accomodate the preference of the acyl-CoA reductase enzyme. Membrane preparations were later changed to the second buffer system to accomodate the higher pH optimum of wax synthase.
- a substrate mixture is prepared in a glass vial, with oleyl alcohol being added immediately before use, and is added to samples. Incubation is carried out at 30°C for up to one hour. The assay is terminated by placing the assay tube on ice and immediately adding 0.25ml isopropanol : acetic acid (4:1 v/v) . Unlabeled wax esters (O.lmg) and oleyl alcohol (O.lmg) are added as carriers. The [ 1 C] lipids are extracted by the scaled-down protocol of Hara and Radin (Anal. Biochem . (1978) 90:420).
- Solubilized wax synthase is assayed using up to 50 ⁇ l sample in a 250 ⁇ l assay that contains 40 ⁇ M 1- 14 C-16:0 CoA (5 Ci/mol), 200 ⁇ M 18:l-OH, 0.07% soybean phospholipid (Sigma, P- 3644), 0.2 %CHAPS, 280 mM NaCI, 25 mM Tricine-NaOH, pH 7.8, 2mM ⁇ -ME and 5.6% glycerol.
- Phospholipid 50mg/ml in 0.5% CHAPS is added directly to the sample, which is in 1% CHAPS, then diluted by a cocktail containing the remaining assay components .
- Wax synthase is sensitive to detergent and requires the amount of phospholipid (PL) and detergent (CHAPS) to be balanced at 2.8/1 (CHAPS/PL, w/w) in the assay for maximal activity.
- Assays for wax synthase activity in samples concentrated by ultra-filtration require a readjustment of the
- the sample is applied to a silica TLC plate, and the plate is developed in hexane/diethyl ether/acetic acid (80:20:1 or 70:30:2 v/v/v) .
- the distribution of radioactivity between the lipid classes is measured using an AMBIS radioanalytic imaging system (AMBIS Systems Inc., San Diego, CA) . If necessary the individual lipid classes can be recovered from the TLC plate for further analysis . Reversed- phase TLC systems using C18 plates developed in methanol have also been used for the analysis.
- Embryo development was tracked over two summers on five plants in Davis, CA. Embryo fresh and dry weights were found to increase at a fairly steady rate from about day 80 to about day 130. Lipid extractions reveal that when the embryo fresh weight reaches about 300mg (about day 80), the ratio of lipid weight to dry weight reaches the maximum level of 50%.
- Wax synthase activity was measured in developing embryos as described in Example IB. As the jojoba seed coats were determined to be the source of an inhibiting factor (s), the seed coats were removed prior to freezing the embryos in liquid nitrogen for storage at -70°C.
- s inhibiting factor
- Microsomal Membrane Preparation Jojoba embryos are harvested at approximately 90-110 days after flowering, as estimated by measuring water content of the embryos (45-70%) . The outer shells and seed coats are removed and the cotyledons quickly frozen in liquid nitrogen and stored at -70°C for future use. For initial protein preparation, frozen embryos are powdered by pounding in a steel mortar and pestle at liquid nitrogen temperature. In a typical experiment, 70g of embryos are processed.
- the powder is added, at a ratio of 280ml of solution per 70g of embryos, to the following high salt solution: 3M NaCI, 0.3M sucrose, lOOmM HEPES, 2mM DTT, and the protease inhibitors, ImM EDTA, 0.7mg/ml leupeptin, 0.5mg/ml pepstatin and 17mg/ml PMSF .
- a cell free homogenate (CFH) is formed by dispersing the powdered embryos in the buffer with a tissue homogenizer (Kinematica, Switzerland; model PT10/35) for approximately 30 sec. and then filtering through three layers of Miracloth (CalBioChem, LaJolla, CA) . The filtrate is centrifuged at 100,000 x g for one hour.
- the resulting sample consists of a pellet, supernatant and a floating fat pad.
- the fat pad is removed and the supernatant fraction is collected and dialyzed overnight (with three changes of the buffering solution) versus a solution containing IM NaCI, lOOmM HEPES, 2mM DTT and 0.5M EDTA.
- the dialyzate is centrifuged at 200,000 x g for 1 1/2 hour to yield a pellet, DP2.
- the pellet is suspended in 25mM HEPES and 10% glycerol, at 1/20 of the original CFH volume, to yield the microsomal membrane preparation.
- acyl-CoA's would not dissolve in the buffer.
- Alcohols were prepared as 25 mM stocks in 2- methoxyethanol and 0.4 ⁇ l of the stock was used in a 250 ⁇ l assay.
- l- 14 C-hexadecanol (10.3 mCi/mmol, Sigma 31,326-2) was used as substrate.
- the purchased l- 14 C-hexadecanol was only 62% pure and had to be further purified by thin layer chromatography prior to use. The product was spotted onto a glass silica gel TLC plate and migrated in hexane : diethyl ether:acetic acid (70:30:2).
- Unlabeled alcohol was spotted in outside lanes and used to identify the migration level of the radiolabeled product.
- the TLC plate was briefly exposed to iodine vapors to identify the location of the alcohol.
- the l- 14 C-hexadecanol spot was scraped from the TLC plate and transferred to a new vial.
- the product was eluted from the silica with hexane/isopropanol and the organic extract was filtered to remove silica.
- the filtered solvent was transferred to a new vial where the solvent was evaporated to dryness .
- the final product was resuspended in 2-methoxyethanol at a concentration of 0.15 ⁇ Ci/ ⁇ l.
- the final product appeared to be 100% pure by TLC in the solvent system above.
- the 1- 14 C-16 : 0-CoA was as described in Example 1. Results of these experiments are presented in Table 1 below.
- Example 3 Purification of Jojoba Wax Synthase Methods are described which may be used for isolation of a jojoba membrane preparation having wax synthase activity, solubilization of wax synthase activity, and further purification of the wax synthase protein.
- A. Microsomal Membrane Preparation The following modification of the method described in
- Example 2 is employed and provides an improved membrane fraction useful for purification of wax synthase from solubilized membranes.
- jojoba embryos are added to 400 ml of extraction buffer (40 mM Tricine-NaOH, pH 7.8, 200 mM KC1, 10 mM EDTA, 5 mM ⁇ -mercaptoethanol ) , ground in a blender, and homogenized with a Polytron tissue disrupter. All subsequent steps are performed at 4°C.
- the blended material is filtered through Miracloth (CalBioChem) . Centrifugation (20,000 x g; 20 min.) of the filtrate yielded a floating wax layer, a turbid supernatant fraction and a dark green pellet.
- the supernatant fraction is collected and centrifuged (100,000 x g; 2 h) to obtain membrane pellets which are then resuspended in 40 ml of Buffer A (25 mM Tricine-NaOH, pH 7.8, 200 mM KC1, 5 mM EDTA, 5 mM ⁇ -mercaptoethanol ) containing 50% (w/v) sucrose.
- Buffer A 25 mM Tricine-NaOH, pH 7.8, 200 mM KC1, 5 mM EDTA, 5 mM ⁇ -mercaptoethanol
- This homogenate is distributed into four SW28 centrifuge tubes (Beckman) and each is overlaid with 10 ml Buffer A containing 20% sucrose and then with 13 ml Buffer A.
- a membrane fraction is collected from the 20%/50% sucrose interface, diluted with four volumes Buffer A and collected by centrifugation (200,000 x g; 1 h) .
- the membranes are then homogenized in 10 ml storage buffer [25 mM Tricine-NaOH, pH 7.8 , 1 M NaCI, 10% (w/v) glycerol, 5 mM ⁇ -mercaptoethanol)] .
- the protein concentration of membranes prepared via this protocol is typically between 7 and 9 mg/ml . Protein concentrations are estimated as described (Bradford, 1976) using BSA as the protein standard.
- the membrane suspension is adjusted to approximately 0.83mg of protein per ml by dilution with storage buffer (25mM Tricine-NaOH, pH 7.8 , IM NaCI, 10% glycerol, 5 mM ⁇ - mercaptoethanol) .
- Solid 3- ( [3-cholamidopropyl] dimethyl- ammonio) -1-propanesulfate (CHAPS) is added to achieve a final concentration of 2% (w/v) and a detergent to protein ratio of 24:1.
- the sample is centrifuged (200,000g for 1 hr) , and the supernatant fraction collected.
- the 200,000g supernatant fraction is diluted (with 0.57% CHAPS, 25 mM Tricine-NaOH, pH 7.8, 20% glycerol) to yield final concentrations of NaCI and CHAPS of 0.3M and 1%, respectively.
- the sample is loaded onto a Blue A-agarose
- CHT Hydroxyapatite
- Protein profiles of the two CHT runs were identical so the CHT-run 2 was not assayed. Active fractions from the two CHT runs were pooled and concentrated 10 fold and applied to a Sephacryl SlOO HR column (2.5 x 90cm) equilibrated in buffer B with 1.0 M NaCI. Protein and activity determinations were made and active fractions were selected from the retained portion of the run which maximized activity and minimized protein.
- the SlOO pool fractions 64- 70
- a chart representing the purification of wax synthase from Protocol 1 shows a 150 fold purification of the enzyme from the solubilized protein fraction.
- the stacking gel contained 5% of a 30% acrylamide stock (29.2% acrylamide, 0.8% N, N 1 -bis-methyleneacrylamide, w/v), 0.06% ammonium persulfate (w/v) and 0.1% TEMED (v/v).
- the resolving gel contained a 10-13% linear gradient of acrylamide stock stabilized by a 0-10% linear gradient of sucrose. Electrophoresis was carried out at room temperature at 150V, constant voltage, for 9-10 hours. Proteins were visualized by staining with silver according to the method of Blum et al .
- Protocol 1 (Example 3C) the only protein that correlates with activity on the final column is one at 33 kDa.
- Odd numbered fractions from the flow through/wash of the final HA column were pooled and concentrated three fold by ultrafiltration in a pressure cell fitted with a YM 30 membrane (Amicon, Inc., Beverly, MA). The sample was further concentrated using two Centricon-30 units (Amicon, Inc., Beverly, MA) to volumes of approximately 50 ⁇ l. Each sample was treated with 6 ⁇ l SDS Cocktail (4 ⁇ l 20%SDS, l ⁇ l
- the samples were applied to a 12% acrylamide Tris/Glycine mini-gel (Novex, San Diego, CA, 1.5mm x 10 well) and proteins were resolved by electrophoresis at 150 V, constant voltage, for 20 minutes beyond the elution of dye from the foot of the gel.
- Wax Synthase was excised from three non-equivalent lanes on the gel representing the peak and tailing fractions from the column.
- the gel slices were placed in 1.5 ml vials and destained with 1 ml of 50% methanol, 10% acetic acid for 2 hours.
- the destain solution was removed and the gel slices were frozen in liquid nitrogen and sent on dry ice, overnight, to the W M Keck Foundation Biotechnology Resource Laboratory
- DNA sequences encoding wax synthase peptides are obtained from jojoba using synthetic oligonucleotides designed from wax synthase peptide sequences.
- the wax synthase nucleic acid sequences may be obtained by amplification of DNA by polymerase chain reaction (PCR) using oligonucleotides as primers, or alternatively, by screening a cDNA or genomic DNA library by radiolabeling the oligonucleotides or previously isolated sequences for use as probes.
- PCR polymerase chain reaction
- RNA is isolated from jojoba embryos collected at 80-90 days post-anthesis using a polyribosome isolation method, initially described by Jackson and Larkins ( Plant Physiol . (1976) 57:5-10), as modified by Goldberg et al . ( Developmental Biol . (1981) 83:201-217) . In this procedure all steps, unless specifically stated, are carried out at 4°C. lOgm of tissue are ground in liquid nitrogen in a Waring blender until the tissue becomes a fine powder. After the liquid nitrogen has evaporated, 170ml of extraction buffer (200mM Tris pH 9.0,
- 160mM KC1, 25mM EGTA, 70mM MgC12 , 1% Triton X-100, 05% sodium deoxycholate, ImM spermidine, lOmM ⁇ -mercaptoethanol, and 500mM sucrose) is added and the tissue is homogenized for about 2 minutes.
- the homogenate is filtered through sterile miracloth and centrifuged at 12,000 x g for 20 minutes.
- the supernatant is decanted into a 500ml sterile flask, and 1/19 volume of a 20% detergent solution (20% Brij 35, 20% Tween 40, 20% Noidet p-40 w/v) is added at room temperature.
- the solution is stirred at 4°C for 30 minutes at a moderate speed and the supernatant is then centrifuged at 12,000 x g for 30 minutes .
- the tubes are filled to the top with extraction buffer, and spun at 60,000 rpm for 4 hours at 4°C in a Ti60 rotor. Following centrifugation, the supernatant is aspirated off and 0.5ml of resuspension buffer (40mM Tris pH 9.0, 5mM EGTA, 200mM KC1, 3 OmM MgCl 2 , 5mM ⁇ - mercaptoethanol) is added to each tube.
- resuspension buffer 40mM Tris pH 9.0, 5mM EGTA, 200mM KC1, 3 OmM MgCl 2 , 5mM ⁇ - mercaptoethanol
- the pellet is resuspended in 10ml of TE buffer (lOmM Tris, ImM EDTA) and extracted with an equal volume of Tris pH 7.5 saturated phenol.
- TE buffer lOmM Tris, ImM EDTA
- the phases are separated by centrifuging at 10,000 x g for 20 minutes at 4°C.
- the aqueous phase is removed and the organic phase is re- extracted with one volume of TE buffer.
- the aqueous phases are then pooled and extracted with one volume of chloroform.
- the phases are again separated by centrifugation and the aqueous phase ethanol precipitated as previously described, to yield the polyribosomal RNA.
- Polysaccharide contaminants in the polyribosomal RNA preparation are removed by running the RNA over a cellulose column (Sigma-cell 50) in high salt buffer ( 0.5M NaCI, 20mM Tris pH 7.5, ImM EDTA, 0.1% SDS) .
- the contaminant binds to the column and the RNA is collected in the eluant .
- the eluant fractions are pooled and the RNA is ethanol precipitated.
- the precipitated total RNA is then resuspended in a smaller volume and applied to an oligo d(T) cellulose column to isolate the polyadenylated RNA.
- Polyadenylated RNA is used to construct a cDNA library in the plasmid cloning vector pCGNl703, derived from the 2. commercial cloning vector Bluescribe M13- (Stratagene Cloning Systems; San Diego, CA) , and made as follows.
- the polylinker of Bluescribe M13- is altered by digestion with BamHI, treatment with mung bean endonuclease, and blunt-end ligation to create a BamHI-deleted plasmid, pCGNl700.
- pCGN1700 is digested with BcoRI and Sstl (adjacent restriction sites) and annealed with a synthetic linker having restriction sites for BamHI, Pstl, Xbal , Apal and Smal , a 5' overhang of AATT, and a 3' overhang of TCGA.
- the insertion of the linker into pCGNl700 eliminates the EcoRI site, recreates the Sstl (also, sometimes referred to as "Sad” herein) site found in Bluescribe, and adds the new restriction sites contained on the linker.
- the resulting plasmid pCGN1702 is digested with HirzdIII and blunt-ended with Klenow enzyme; the linear DNA is partially digested with Pvull and ligated with T4 DNA wax synthase in dilute solution.
- a transformant having the lac promoter region deleted is selected (pCGNl703) and is used as the plasmid cloning vector.
- the cloning method for cDNA synthesis is as follows.
- the plasmid cloning vector is digested with Sstl and homopolymer T-tails are generated on the resulting 3 ' -overhang stick-ends using terminal deoxynucleotidyl transferase.
- the tailed plasmid is separated from undigested or un-tailed plasmid by oligo (dA) -cellulose chromatography.
- the resultant vector serves as the primer for synthesis of cDNA first strands covalently attached to either end of the vector plasmid.
- the cDNA-mRNA-vector complexes are treated with terminal transferase in the presence of deoxyguanosine triphosphate, generating G-tails at the ends of the cDNA strands.
- the extra cDNA-mRNA complex, adjacent to the BamHI site, is removed by BamHI digestion, leaving a cDNA-mRNA- vector complex with a BamHI stick-end at one end and a G-tail at the other.
- This complex is cyclized using an annealed synthetic cyclizing linker which has a 5' BamHI sticky-end, recognition sequences for restriction enzymes Notl , EcoRI and Sstl, and a 3' C-tail end.
- E. coli strain DH5a (BRL, Gaithersburg, MD) to generate the cDNA library.
- the 3 jojoba embryo cDNA bank contains between approximately 1.5xl0 6 clones with an average cDNA insert size of approximately 500 base pairs .
- jojoba polyadenylated RNA is also used to construct a cDNA library in the cloning vector lZAPII/BcoRI
- oligonucleotides containing the sense orientation sequence corresponding to wax synthase peptide encoding sequences are prepared. These oligonucleotides are used as primers for the "forward" amplification reaction to produce sense strand DNA.
- an oligonucleotide may be designed to be identical to a portion of a primer used to prepare DNA template for PCR.
- oligonucleotides which contain sequence complementary to wax synthase peptide encoding sequences may be used in combination with a "forward" wax synthase oligonucleotide primer as described above.
- the forward or reverse primers may be "degenerate" oligonucleotides, i.e. containing a mixture of all or some of the possible encoding sequences for a particular peptide region. To reduce the number of different oligonucleotides present in such a mixture, it is preferable to select peptide regions which have the least number of possible encoding sequences when preparing the synthetic oligonucleotide for PCR primers. Similarly, where the synthetic oligonucleotide is to
- M be used to directly screen a library for wax synthase sequences, lower degeneracy oligonucleotides are preferred.
- oligonucleotide names reflect the particular wax synthase peptide fragment numbers as listed in Example 5.
- the letter “F” in the oligonucleotide name designates a PCR forward reaction primer.
- the letter “R” designates a PCR reverse reaction primer.
- WSPEP29-R1 5' GCNCCNCCRTGNGGNGC 3'
- WSPEP29 -R2 5 GCNACNGCNGGNACRAA 3 '
- nucleotide base codes for the above oligonucleotides are as follows:
- Y cytosine or thymine
- N adenine, cytosine, guanine or thymine
- W adenine or thymine
- M adenine or cytosine
- Poly (A) + RNA is isolated from total RNA prepared from jojoba tissue as described above.
- cDNA is prepared from poly (A) + or total RNA by reverse transcription using the Marathon cDNA Amplification Kit (Clontech Laboraties Inc according to the manufacturer's directions. The jojoba cDNA is used in PCR reactions 1-16 set forth below.
- PCR is conducted in a Perkin Elmer Cetus GeneAmp PCR System 9600 PCR machine using reverse transcribed single- stranded cDNA as template.
- Commercially available PCR reaction and optimization reagents are used according to manufacturer's specifications Reaction Forward Primer Reverse Primer
- the temperature program used for PCR amplification is as follows: 1 cycle of 95 degrees C for 2 minutes; 4 cycles of 95 degrees C for 30 seconds, 60 degrees C for 1 minute, and 72 degrees C for 4 minutes; 4 cycles of 95 degrees C for 30 seconds, 57 degrees C for 1 minute, and 72 degrees C for 4 minutes; 4 cycles of 95 degrees C for 30 seconds, 54 degrees C for 1 minute, and 72 degrees C for 4 minutes; 4 cycles of 95 degrees C for 30 seconds, 51 degrees C for 1 minute, and 72 degrees C for 4 minutes; and 25 cycles of 95 degrees C for 30 seconds, 48 degrees C for 1 minute, and 72 degrees C for 4 minutes.
- PCR product approximately 700 nucleotides in length was detected.
- the PCR product was purified using gel electrophoresis and cloned into pCR2.1 using a Topo TA cloning kit (Invitrogen Corp.) .
- the DNA sequence of the cloned PCR product was determined and was 70! nucleotides long ( Figure 3) .
- the entire cDNA can be amplified using 5' and 3' RACE (Frohman et al . , 1988) using the Marathon cDNA Amplification Kit (Clontech Laboraties Inc.) according to the manufacturers instructions. From the sequence of the 708 nucleotide PCR fragment derived using primers WSPEP14-F1 and WSPEP33-R2 the following primers were synthesized:
- WSRACEF1 GATTTGCCTCATTTTGTGATCTCGGTGCT WSRACEF2 GACCTATACCCCCAGTTCAACGAGCCATAC WSRACEF3 TTCAACGAGCCATACTTAGCCACCTCGCTG WSRACER1 AACAACCACCCTCCAGTCACCATCACGAAC
- the assembled sequence of all the PCR products contains the coding region of the cDNA sequence.
- the coding region of the gene can be amplified from cDNA using the primers WAXSYNFOR and WASXYNREV.
- the sequence of WAXSYNFOR is
- the PCR program consists of 30 cycles of 94 degrees C for 15 seconds, 60 degrees C for 1 minute, 72 degrees C for 2 minutes.
- the PCR products were cloned into pCR2.1 according to the manufacturers protocol (Invitrogen Corp.).
- the resulting plasmid was designated pCGN8538.
- the nucleic acid sequence and the derived amino acid sequence of the jojoba wax synthase is determine and shown in Figures 10 and 11.
- Constructs are prepared to express the jojoba wax synthase sequence in plant cells. Constructs for the expression of the wax synthase sequence alone are prepared to confirm wax synthase as well as DAGAT enzyme activities for the sequence. In addition, constructs employing the jojoba wax synthase sequence with sequences for reductase, as well as reductase and an elongase are also prepared.
- the primers GGATCCGTCGACACAATGGAGGTGGAGAAGGAGCTAAAG and GCATGCAGATCTCACCACCCCAACAAACCCATC are used to PCR amplify the wax synthase open reading from and introduce BamHI and Sail restriction sites at the 5' end of the gene and Sphl and Bglll site at the 3' end of the gene.
- PCR amplification was carried out using the Marathon cDNA previously described and 30 cycles of PCR amplification using the cycle profile: 15 seconds at 94 degrees C, 30 seconds at 60 degrees C, and 1 minute at 72 degrees C.
- PCR product was cloned into plasmid pCR2.1 to yield pCGN8538 and the sequence was determined to ensure that no errors were introduced during the PCR reaction.
- the insert from pCGN8538 was cloned as a Sall-Bglll fragment into the napin cassette of pCGN7770 to form pCGN8553.
- Plasmid pCGN 8557 was constructed by cloning the napin/jojoba reductase gene fusion from pCGN7698 (USPN 5,445,947) and the napin/lunaria KCS (described in European Patent Application Publication 0731840) from pCGN7844 into the Asp718 and Notl sites of binary vector pCGN5139PASS .
- Plasmid pCGN8559 was constructed by cloning the napin/wax synthase gene fusion from plasmid pCGN8553 into the Sse8387I site of plasmid pCGN8557.
- the Sall-Bglll fragment from pCGN8538 was cloned into the Sail and BamHi sites of the double 35S (D35S) expression cassette vector pCGN7787 (described below) to yield pCGN8591.
- the D35S/wax synthase gene fusion was cloned into the Notl site of pCGN5139 (described below) to yield pCGN8593.
- the binary vectors pCGN8557, pCGN8559, and pCGN8593 are introduced into Agrobacterium tumefaciens EHA105 via electroporation. Arabidopsis plants are transformed by vacuum infiltration. Brassica plants are transformed with pCGN8557 and pCGN8559 as previously described.
- Wax synthase and reductase gene sequences may be inserted into such cassettes to provide expression constructs for plant transformation methods.
- a construct for expression of reductase in plant cells using 5' and 3' regulatory regions from a napin gene is described in USPN 5,445,947.
- Binary vector constructs are transformed into Agrobacterium cells, such as of strain EHA101 (Hood et al . , J. Bacteriol (1986) 158:1291-1301), by the method of Holsters et al . (Mol . Gen . Genet . (1978) 163 : 181-187 ) and used in plant transformation methods as described below.
- DAGAT activity is assayed with 3.67 ⁇ M 1- 14 C-18 : 1-Coenzyme A (53.5-54.5 Ci/mole, New England Nuclear, Boston, MA) and 1.5 mM 1,2-18:1 diacylglycerol (DAG) (Sigma D-0138, prepared as a 150 mM stock in 2-methoxyethanol) in a buffer containing 10 mM potassium phosphate (pH 7.0), 100-150 mM KC1, and 0.1 % TX-100 (w/v) in a total volume of 100 ⁇ l as similarly described by Kamisaka et al .
- the assay is performed as described for non-solubilized samples with the following changes: the amount of 1,2-18:1 DAG is reduced to 0.5 mM, the amount of Triton X-100 is increased to 0.2%, and the KCl concentration is maintained between 100-125 mM. It is also necessary to include L- ⁇ - phosphatidic acid (Sigma P-9511, prepared as a 50 mM stock in 1% Triton X-100 (w/v) ) to recover activity following solubilization with detergent as described by Kamisaka et al . (1996, 1997), with slight modification of the protocol.
- L- ⁇ - phosphatidic acid Sigma P-9511, prepared as a 50 mM stock in 1% Triton X-100 (w/v)
- assays After assays are stopped, they can be stored at 4 °C for processing at a later date or immediately processed by addition of 0.1 ml 1 M NaHC0 3 followed by 1 ml of heptane containing 15 nmoles/ml triolein as a carrier for extraction.
- the contents are vortexed and, after separation of aqueous and organic phases, the upper organic phase is removed to a new glass vial and washed with 1 ml IM NaCI. Forty percent of the final organic phase is removed for liquid scintillation counting and the remaining organic phase is transferred to a clean vial and evaporated to dryness under nitrogen gas.
- the residue is resuspended in 45 ⁇ l hexane and spotted onto a silica gel-G, glass, thin-layer chromatography (TLC) plate with a preadsorbent loading zone (Analtech #31011, Newark, Delaware) .
- TLC thin-layer chromatography
- the TLC plate is developed in hexane: diethyl ether .-acetic acid (50:50:1, v/v/v) to the top then dried and scanned by a radio-image analyzer (AMBIS 3000, San Diego, CA)
- Example 8 Growth and Harvesting of Mortierella ramanniana cultures .
- Mortierella ramanniana is cultured by inoculating 1 liter of Defined Glucose Media (30 g glucose, 1.5 g (NH 4 ) 2 S0 4 , 3 g K 2 HP0 4 , 0.3 g MgS0 4 »7H20, 0.1 g NaCI, 5g CH 3 C00Na*3H 2 0, 10 mg FeS0 4 «7H 2 0, 1.2 mg CaCl 2 »2H 2 0, 0.2 mg CuS0 4 «5H 2 0, 1.0 mg ZnS0 4 «7H 2 0, 1.0 mg MnCl 2 »4H 2 0, 2 mg thiamine-HCl and 0.02 mg biotin in 1 L of water purified by reverse osmosis (pH 5.7)) with 1.5-3 x 10 6 spores and incubating at 30 °C with shaking at 200 rpm for 9-11 days. Cultures are harvested by filtration through one layer of Miracloth (Calbiochem, La Jolla, CA) . Excess liquid is
- SDS-PAGE Polyacrylamide Gel Electrophoresis
- Polyacrylamide gradient gel electrophoresis (10-13%) is carried out according to the method of Laemmli (1970) with some of the modifications of Delepelaire (1979) .
- Sodium dodecyl sulfate is used in the upper reservoir buffer at 0.1% but is omitted from the lower reservoir buffer, stacking and resolving gels.
- the stacking gel contains 5% of a 30% acrylamide stock (acrylamid:N, N' -Methylenacrylamid, 37.5:1, Bio-Rad, Hercules, CA) , 0.06% ammonium persulfate and 0.1% TEMED (v/v) .
- the resolving gel contains a 10-13% linear gradient of acrylamide stock stabilized by a 0-10% linear gradient of sucrose. Electrophoresis is carried out at room temperature at 150V, constant voltage, for 7-9 hours. Proteins are visualized by staining with silver according to the method of Blum et al . (1987) or with Coomassie Blue (0.1% Coomassie Blue R-250, 50% methanol (v/v), 10% acetic acid (v/v)) .
- wet packed cells typically, 70-75 g of wet packed cells (stored at -70 °C) are used for each lipid body preparation. Just prior to use, cells are thawed on ice and resuspended in 150 ml of Buffer A (10 mM potassium phosphate (pH 7.0), 0.15 M KCl, 0.5 M sucrose, and 1 mM EDTA) .
- Buffer A 10 mM potassium phosphate (pH 7.0), 0.15 M KCl, 0.5 M sucrose, and 1 mM EDTA
- the following protease inhibitors are added to reduce proteolysis: 0.1 ⁇ M Aprotinin, 1 ⁇ M Leupeptin, and 100 ⁇ M Pefabloc (all from Boehringer Mannheim, Germany) .
- Cells are divided into five, 50-ml tubes and lysed with a Polytron Tissue Homogenizer (Kinematic GmbH, Brinkman Insruments, Switzerland) on setting #7 with a 1 cm diameter probe for 7 x 1 min.
- the resulting slurry is transferred to centrifuge tubes (29 x 104 mm) and solid debris made to pellet by spinning at 1500 x g (Beckman Instruments, J2-21, JA-20 rotor, 3500 rpm) for 10 min at 4 °C .
- the supernatant is removed and the pellets washed with another 5 ml of Buffer A. Following centrifugation, the supernatant volumes are combined. This fraction is referred to as the 'SI'.
- the SI is divided into six ultracentrifuge tubes (25 x 89 mm, Beckman Instruments, Fullerton, CA) and each is overlayed with 5 ml of Buffer B (10 mM potassium phosphate pH, 7.0, 0.15 M KCl, 0.3 M sucrose, and 1 mM EDTA ). Samples are centrifuged at 100,000 x g (Beckman Instruments, L8-M, SW-28 rotor, 21000 rpm) at 4 °C for 3 hours. The Lipid Body Fraction (LBF) , floating on top of the overlay, is recovered with a spatula and transferred to a glass homogenizer (Potter-Elvehjem) .
- Buffer B 10 mM potassium phosphate pH, 7.0, 0.15 M KCl, 0.3 M sucrose, and 1 mM EDTA .
- Interface fraction the interface between the 0.3 and 0.5 M sucrose buffers
- Soluble fraction the liquid volume beneath the interface
- the Membrane fraction a tan/brown pellet at the bottom of each tube. All are frozen and stored at -70 °C awaiting solubilization and further purification.
- Samples are centrifuged at 100,000 x g (Beckman Instruments, L8-M, SW-28 rotor, 21000 rpm) at 4 °C for 3 hours.
- the solubilized material referred to as the 'Triton X-100 extract', is recovered by inserting a thin tube through the overlay to within 1 cm of the bottom of each ultracentrifuge tube and removing the lower, 0.5M sucrose, layer with gentle suction while leaving the upper 0.3M sucrose overlay (including a floating fat layer) and the pellet behind.
- the first peak elutes during the gradient, as found by Kamisaka et al . (1997) and a second peak, not found by Kamisaka et al . , elutes at the end of the gradient with much less protein (Figure 5A) .
- a portion (250 ⁇ l) of the two peak fractions from the Heparin column are further purified by size exclusion chromatography on a Superdex-200 column (1 x 30 cm, Bio-Rad, Hercules, CA) at 0.2 ml/min equilibrated with 150 mM KCl in Buffer C.
- the column is equilibrated with 150 mM KCl in a Modified Buffer C in which Triton X-100 is replaced with Triton X-100 R (Calbiochem, La Jolla, CA) .
- the column is calibrated using Bio-Rad Gel Filtration Standards.
- the DAGAT activity from each of the two peaks from Heparin-Sepharose CL-6B elutes at an estimated molecular mass of 99 kDa.
- the second peak from the Heparin column (fractions 36-41) is diluted 1:6.6 with Buffer C to a volume of 46.7 ml.
- the sample is applied to a Yellow 86 Agarose column (1.0 cm x 6.4 cm) equilibrated with 75 mM KCl in Buffer C at 0.5 ml/min.
- bound proteins and all of the DAGAT activity elute in a 40 ml linear gradient of 75-500 mM KCl in Buffer C.
- DAGAT activity elutes as a single peak ( Figure 6A) .
- the protein composition of the fractions containing DAGAT activity from the Heparin and second Yellow 86 columns are analyzed by gradient SDS-PAGE according to the protocol in Example 3. Protein bands are detected by silver-staining. The pattern of bands eluting from these columns is compared, fraction by fraction, to the respective DAGAT activity profile. Many protein candidates are present that correlate with the presence of DAGAT activity. It is our opinion that the purification protocol is insufficient to identify a particular protein candidate associated with DAGAT activity ( Figure 5B, 6B) .
- Example 11 New purification protocol for identifying DAGAT protein candidates purified from Mortierella ramanniana A. Preparation of the Lipid Body Fraction
- the following steps are performed at 4 °C .
- 70-75 g of wet packed cells (stored at -70 °C) are used for each lipid body preparation.
- cells are thawed on ice and resuspended in 150 ml of Buffer A (10 mM potassium phosphate (pH 7.0), 0.15 M KCl, 0.5 M sucrose, 1 mM EDTA) .
- Buffer A 10 mM potassium phosphate (pH 7.0), 0.15 M KCl, 0.5 M sucrose, 1 mM EDTA) .
- the following protease inhibitors are added to reduce proteolysis: 0.1 ⁇ M Aprotinin, 1 ⁇ M Leupeptin, and 100 ⁇ M Pefabloc (all from Boehringer Mannheim, Germany) .
- Samples are lysed with a cell disrupter (Bead-Beater, Biospec Products, Bartlesville, OK) using 0.5 mm glass beads.
- the sample chamber is filled with 180 ml of glass beads.
- Wet- packed cells are thawed on ice and resuspended in 150 ml of Buffer A.
- the cell slurry is poured over the glass beads.
- an additional 40-50 ml of Buffer A are needed to fill the chamber for proper functioning. This volume is used to rinse the remains of the cell slurry from its original container so that it can be combined with the rest of the sample.
- Cells are ground ('Homogenize' setting) for 45-90 seconds depending on the viscosity of the sample.
- the cell slurry containing glass beads is divided into tubes (29 x 104 mm) and centrifuged at 500 x g (Beckman Instruments, GP centrifuge, GH 3.7 Horizontal rotor at 1500 rpm) and 4 °C . The supernatant is removed and the pellets washed with another 5 ml of Buffer A. Following centrifugation the supernatant volumes are combined. This fraction is referred to as the
- the SI is divided into six ultracentrifuge tubes (25 x 89 mm, Beckman Instruments) and each is overlayed with 5 ml of Modified Buffer B (10 mM potassium phosphate pH, 7.0, 0.15 M KCl, and 0.3 M sucrose) .
- EDTA is omitted from Buffer B (see Example 4) since it interferes with hydroxylapatite chromatography. Samples are centrifuged at 100,000 x g
- the Lipid Body Fraction (LBF), floating on top of the overlay, is recovered with a spatula and transferred to a glass homogenizer. Small amounts of LBF remaining in the centrifuge tube are recovered with a pipet by removing 4 ml of the Buffer B overlay and combining it with the LBF in the homogenizer. The final LBF is homogenized in 40 ml of Buffer B. The remaining fractions are collected as follows: Interface fraction (the interface between the 0.3 and 0.5 M sucrose buffers), Soluble fraction (the liquid volume beneath the interface) , and the Membrane fraction (a tan/brown pellet
- a protein determination is made with an aliquot of the Lipid Body Fraction by the method of Bradford (Bio-Rad Reagent, Hercules, CA) using bovine serum albumin as a standard.
- the LBF is thawed on ice, then diluted to a concentration of 1 mg protein/ml and treated with Triton X-100 at a detergent to protein ratio of 15:1 (w/w, equivalent to 1.3% Triton X-100).
- Solid sucrose (Mallinckrodt , Paris, Kentucky) is added to achieve a final concentration of 0.5M.
- the detergent-treated sample is rocked at 4 °C for one hour then divided into six ultracentrifuge tubes (25 x 89 mm,
- Protocol A activity is bound to the first column and after elution, fractions are assayed for activity. The active fractions are then pooled and applied to the second column. We refer to this as a sequential run.
- Protocol B activity is bound to the first column then elutes and flows directly onto the second column without pooling and assaying in between. We refer to this as a tandem run.
- Protocol A the Triton X-100 extract is applied to a Yellow 86-Agarose column (2.5 cm x 6.4 cm) equilibrated with 75 mM KCl in Buffer C (Example 4.C) at 2 ml/min.
- the column is washed with 5 column volumes of equilibration buffer then eluted with 500 mM KCl in Buffer C at 0.5 ml/min ( Figure 7) .
- the two most active fractions (64 and 65), containing 93% of the eluted activity, are pooled and loaded onto a hydroxylapatite column (Bio-Gel HT, Bio-Rad, 1 cm x 25.5 cm) equilibrated with 500 mM KCl in Buffer C at 0.5 ml/min. DAGAT activity flows through the column whereas the majority of the proteins bind the column. The column is washed with 3 volumes of equilibration buffer. Bound proteins are eluted with 100 mM dipotassium phosphate and 500 mM KCl in Buffer C at 0.5 ml/min ( Figure 8A) .
- a portion of the fractions containing the DAGAT activity peak are run on gradient gel SDS-PAGE as described in Example 3.
- the proteins are stained with silver and the pattern of the bands are compared, fraction by fraction, to the activity profile ( Figure 8B) .
- Several DAGAT protein candidates correlate with activity.
- attention is called to bands migrating at positions corresponding to 43 kD, 36.5 kD, 33 kDa, 29 kD, 28 kD and 27 kD. There does not appear to be a candidate protein in the region of 53 kD that correlates with activity.
- Protocol B the Triton X-100 extract is applied to a Yellow 86-Agarose column (1.5 cm x 5.8 cm) equilibrated with 75 mM KCl in Buffer C at 1 ml/min. The column is washed with 5 column volumes of equilibration buffer. Then, the outlet from the Yellow 86-Agarose column is connected to the inlet of a hydroxylapatite column (1.0 cm x 26.2 cm, Bio-Rad, Hercules, CA) equilibrated with 500 mM KCl in Buffer C.
- a hydroxylapatite column 1.0 cm x 26.2 cm, Bio-Rad, Hercules, CA
- DAGAT activity bound to the Yellow 86 column is eluted with 110 ml of Buffer C containing 500 mM KCl and passes directly through the hydroxylapatite column at 0.2 ml/min. Finally, the hydroxylapatite column is disconnected from the Yellow 86- Agarose column and proteins bound to the hydroxylapatite column are eluted with 100 mM dipotassium phosphate and 500 mM KCl in Buffer C. DAGAT activity is found in fractions from the hydroxylapatite column collected during the 110-ml wash with Buffer C containing 500 mM KCl.
- Triton X-100 extract does not bind the Yellow 86-Agarose column and is discarded.
- Buffer C When this eluate is applied to the hydroxylapatite column, DAGAT activity flows through while most of the remaining proteins bind the column and are separated ( Figure 9A) . A portion of the fractions containing the DAGAT activity peak are run on gradient gel SDS-PAGE and are silver-stained.
- the pattern of bands eluting from these columns is compared, fraction by fraction, to the respective DAGAT activity profile. Examination of the stained protein bands indicate a protein at 33 kDa correlates best with DAGAT activity ( Figure 9B) .
- Protein sequencing can be performed using a wide variety of methods known in the art.
- One technique involves digestion of the protein, using enzymes such as trypsin, while still in an SDS-polyacrylamide gel.
- enzymes such as trypsin
- SDS-polyacrylamide gel Several commercial enterprises known in the art have established protocols for obtaining peptides in this manner.
- standard techniques are employed to separate and sequence them.
- In order to gel-purify a protein candidate it is often necessary to concentrate the liquid sample first so that it can be loaded on the gel . Samples containing high amounts of detergent may pose special problems. Depending on the micelle size of the detergent, it may concentrate during ultrafiltration and pose problems during electrophoresis. An alternative method of concentrating the protein sample must then be employed.
- Samples for SDS-PAGE by Concentration Fractions can be concentrated in a pressure cell fitted with a membrane of the appropriate molecular weight retention limit. Alternatively, the sample may be concentrated using filtration by centrifugation in individual units, for example a product such as Centricon-30 (Amicon, Inc., Beverly, MA), to volumes of approximately 50 ⁇ l. Following concentration, samples can be treated with a loading buffer, for example, Laemmli .
- Procedures for in-gel digestion may include amino acid analysis of a portion (10- 15%) of the gel slice for quantitation and amino acid composition, digestion of the protein with one of the proteolytic enzymes (trypsin or lysyl endopeptidase), and fractionation of the products by reverse phase HPLC. Absorbance peaks may be selected from the HPLC run and subjected to laser desorption mass spectrometry to determine the presence, amount, and mass of the peptide prior to protein sequencing. The longest peptides are selected for microsequencing .
- DAGAT peptide encoding sequences are prepared. These oligonucleotides are used as primers for the "forward" amplification reaction to produce sense strand DNA.
- an oligonucleotide may be designed to be identical to a portion of a primer used to prepare DNA template for PCR.
- oligonucleotides which contain sequence complementary to DAGAT peptide encoding sequences may be used in combination with a "forward" DAGAT oligonucleotide primer as described above.
- the forward or reverse primers may be "degenerate" oligonucleotides, i.e. containing a mixture of all or some of the possible encoding sequences for a particular peptide region. To reduce the number of different oligonucleotides present in such a mixture, it is preferable to select peptide regions which have the least number of possible encoding sequences when preparing the synthetic oligonucleotide for PCR primers. Similarly, where the synthetic oligonucleotide is to be used to directly screen a library for DAGAT sequences, lower degeneracy oligonucleotides are preferred.
- DAGAT DNA fragments obtained by PCR are labeled and used as a probe to screen clones from cDNA libraries.
- Complementary DNA and DNA constructioin and library screening techniques are known to those in the art and described, for example in Maniatis et al . (Molecular Cloning: A Laboratory Manual , Second Edi tion (1989) Cold Spring Harbor Laboratory Press) .
- DAGAT nucleic acid sequences are obtained which may be analyzed for nucleic acid sequence and used for expression of DAGAT in various hosts, both procaryotic and eucaryotic.
- Constructs which provide for expression of DAGAT sequences in plant cells may be prepared as follows .
- Expression cassettes which contain 5' and 3' regulatory regions from genes expressed preferentially in seed tissues may be prepared from napin, Bce4 and ACP genes as described, for example in WO 92/03564.
- a napin expression cassette, pCGN1808, which may be used for expression of wax synthase or reductase gene constructs is described in Kridl et al . ( Seed Science Research (1991) 1:209-219).
- An additional napin expression cassette, pCGN3223 contains an ampicillin resistance background, and essentially identical 1.725 napin 5' and 1.265 3' regulatory sequences as found in pCGNl808.
- the regulatory regions are flanked with Hindlll, Notl and Kpnl restriction sites and unique Sail, Bglll, Pstl, and Xhol cloning sites are located between the 5' and 3' noncoding regions.
- a cassette for cloning of sequences for transcriptional regulation under the control of 5' and 3' regions from an oleosin gene may also be used. Sequence of a Brassica napus oleosin gene was reported by Lee and Huang ( Plant Phys . (1991) 96 : 1395-1397 ) . Sequence of an oleosin cassette, pCGN7636, is provided in Figure 4 of USPN 5,445,947.
- the oleosin cassette is flanked by BssHII, Kpnl and Xbal restriction sites, and contains Sail, BamHI and Pstl sites for insertion of wax synthase, reductase, or other DNA sequences of interest between the 5' and 3' oleosin regions.
- DAGAT gene sequences may be inserted into such cassettes to provide expression constructs for plant transformation methods.
- a construct for expression of reductase in plant cells using 5' and 3' regulatory regions from a napin gene is described in USPN 5,445,947.
- Binary vector constructs are transformed into Agrobacterium cells, such as of strain EHA101 (Hood et al . , J " . Bacteriol (1986) 158:1291-1301), by the method of Holsters et al . (Mol . Gen . Genet . (1978) 163 : 181-187 ) and used in plant transformation methods as described below.
- the protein sequence of the jojoba wax synthase (Figure 11) is used to query the Arabidopsis DNA sequence database (http://genome-www.stanford.edu/Arabidopsis/).
- One of the accessions, PI clone MTE17 (Genbank accession AB015479), contains 7 repeats of open reading frames with similarity to M the jojoba wax synthase.
- the open reading frames have been designated ATWSl to ATWS7 ( Figures 12-18, respectively) . They are found between nucleotides 23670 and 11479 of MTE17 using the numbering system of the Genbank entry.
- the inferred protein sequences are aligned with the jojoba wax synthase sequence (Figure 19) and a dendogram (Figure 20) of their relationships is constructed using the Clustal W algorithm of MacVector 6.5 (Oxford Molecular).
- the sequence alignment in Figure 19 shows a series of peptide sequences which are conserved between the amino acid sequences (Table 5) .
- the percent identities and similarities are also determined, and are presented in table 6.
- cDNA Complementary DNA
- cDNA is constructed from Arabidopsis RNA isolated from immature seeds, whole seedlings (vegetative tissue), and inflorescences (flowers and flower stalks) using the SMART PCR cDNA Library construction kit according to the manufacturer's protocol (Clontech).
- SMART cDNA is also constructed from RNA from Brassica napus leaves, and immature seeds harvested at 15 days after pollination (DAP) , 18 DAP, and 30 DAP.
- DAP 15 days after pollination
- the SMART cDNAs are used for virtual Northern analysis, according to the protocol in the SMART cDNA manual from Clontech, of expression of the Arabidopsis ATWS cDNAs .
- ATWSl and ATWS2 Two of the sequences, ATWSl and ATWS2 , are the most highly expressed.
- ATWS2 is most highly expressed in Arabidopsis immature seeds and Brassica 30 DAP seeds. Expression is not detected in Brassica leaves or Arabidopsis seedlings. This is an expression pattern consistent with that expected for DAGAT, since triglycerides are primarily formed in developing seeds of these plants .
- constructs are prepared to direct the expression of the sequence in host plant cells.
- a plasmid containing the napin cassette derived from PCGN3223 (described in USPN 5,639,790, the entirety of which is incorporated herein by reference) was modified to make it more useful for cloning large DNA fragments containing multiple restriction sites, and to allow the cloning of multiple napin fusion genes into plant binary transformation vectors.
- An adapter comprised of the self annealed oligonucleotide of sequence CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGCAGGGCGCGCCATTTAAAT was ligated into the cloning vector pBC SK+ (Stratagene) after digestion with the restriction endonuclease BssHII to construct vector pCGN7765.
- Plamids pCGN3223 and pCGN7765 were digested with Notl and ligated together.
- the resultant vector, pCGN7770 contains the pCGN7765 backbone with the napin seed specific expression cassette from pCGN3223.
- the cloning cassette, pCGN7787 essentially the same regulatory elements as pCGN7770, with the exception of the napin regulatory regions of pCGN7770 have been replaced with the double CAMV 35S promoter and the tml polyadenylation and transcriptional termination region.
- pCGN5139 A binary vector for plant transformation, pCGN5139, was constructed from pCGNl558 (McBride and Summerfelt, (1990) Plant Molecular Biology, 14:269-276).
- the polylmker of pCGN1558 was replaced as a HindIII/Asp718 fragment with a polylinker containing unique restriction endonuclease sites, Ascl, Pad, Xbal, Swal, BamHI, and Notl.
- the Asp718 and Hindlll restriction endonuclease sites are retained in PCGN5139.
- a series of turbo binary vectors are constructed to allow for the rapid cloning of DNA sequences into binary vectors containing transcriptional initiation regions (promoters) and transcriptional termination regions.
- the plasmid pCGN8618 was constructed by ligating oligonucleotides 5 ' -TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3 ' and 5 ' -TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3 ' into Sail/Xhol-digested pCGN7770.
- a fragment containing the napin promoter, polylinker and napin 3' region was excised from pCGN8618 by digestion with Asp718l; the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718l and Hindlll and blunt-ended by filling in the 5' overhangs with Klenow fragment.
- a plasmid containing the insert oriented so that the napin promoter was closest to the blunted Asp718I site of pCGN5139 and the napin 3' was closest to the blunted Hindlll site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions. The resulting plasmid was designated pCGN8622.
- the plasmid pCGN8619 was constructed by ligating oligonucleotides 5'- TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC -3' and 5'- TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3 'into Sall/XhoI-digested pCGN7770.
- a fragment containing the napin promoter, polylinker and napin 3' region was removed from pCGN8619 by digestion with Asp718l; the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and Hindlll and blunt-ended by filling in the 5 ' overhangs with Klenow fragment.
- a plasmid containing the insert oriented so that the napin promoter was closest to the blunted Asp718l site of pCGN5139 and the napin 3' was closest to the blunted Hindlll site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions. The resulting plasmid was designated pCGN8623.
- the plasmid pCGN8620 was constructed by ligating oligonucleotides 5'- TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGGAGCT -3' and 5 ' -CCTGCAGGAAGCTTGCGGCCGCGGATCC-3 ' into Sall/SacI-digested pCGN7787. A fragment containing the d35S promoter, polylinker and tml 3' region was removed from pCGN8620 by complete digestion with Asp718I and partial digestion with Notl.
- the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718I and Hindlll and blunt-ended by filling in the 5' overhangs with Klenow fragment.
- a plasmid containing the insert oriented so that the d35S promoter was closest to the blunted Asp718l site of pCGN5139 and the tml 3' was closest to the blunted Hindlll site was subjected to sequence analysis to confirm both the insert orientation and the integrity of cloning junctions.
- the resulting plasmid was designated pCGN8624.
- the plasmid pCGN8621 was constructed by ligating oligonucleotides 5'- TCGACCTGCAGGAAGCTTGCGGCCGCGGATCCAGCT -3' and 5'-GGATCCGCGGCCGCAAGCTTCCTGCAGG-3 ' into Sall/SacI-digested pCGN7787. A fragment containing the d35S promoter, polylinker and tml 3' region was removed from pCGN8621 by complete digestion with Asp718l and partial digestion with Notl.
- the fragment was blunt-ended by filling in the 5' overhangs with Klenow fragment then ligated into pCGN5139 that had been digested with Asp718l and Hindlll and blunt-ended by filling in the 5' overhangs with Klenow fragment.
- a plasmid containing the insert oriented so that the d35S promoter was closest to the blunted Asp718l site of pCGN5139 and the tml 3' was closest to the blunted Hindlll site was subjected to sequence analysis to confirm both the insert orientation and the
- the resulting plasmid was designated pCGN8625.
- AT-WS2 The open reading frame of AT-WS2 was PCR amplified from Arabidopsis genomic DNA using the primers 5 ' -GGATCCGCGGCC GCATTATGAAACAGTTAGCAACCAACAGA-3 ' and 5 ' -GGATCCCCTGCAGGTTACAT TAAAATACAGACAACGTGCC-3 ' .
- the PCR product is cloned into plasmid pCR 2.1 according to the manufacturer's protocol (Clontech) to generate the plasmid pCGN9706.
- plasmid pCGN9712 is constructed by cloning the NotI/Sse8387l fragment from pCGN9706 into Notl/Pstl digested binary vector pCGN8622.
- plasmid pCGN9713 was constructed by cloning the NotI/Sse8387l fragment from pCGN9706 into Notl/Pstl digested binary vector pCGN8623.
- Plasmids pCGN9712, pCGN9713, and pCGN9714 were introduced into Agrobacterium tumefaciens EHA105 by electroporation, and the resultant Agrabacterium strains were used to transform Arabidopsis thaliana plants by vacuum infiltration.
- the vector pCGN9710 is similar to pCGN9714, only the coding sequence of ATWS2 from pCGN9714 has been replaced with the coding sequence of ATWSl.
- a variety of methods have been developed to insert a DNA sequence of interest into the genome of a plant host to obtain the transcription or transcription and translation of the sequence to effect phenotypic changes .
- High erucic acid varieties such as cultivar Reston, or Canola-type varieties of Brassica napus may be transformed using Agrobacterium mediated transformation methods as described by Radke et al . ( Theor. Appl . Genet . (1988) 75:685- 694; Plant Cell Reports (1992) 11:499-505) .
- Arabidopsis thaliana plants may be obtained by Agrobacterium- mediated transformation as described by Valverkens et al . , ( Proc . Nat . Acad. Sci . (1988) 85:5536-5540), or as described by Bent et al . ((1994), Science 265:1856-1860), or Bechtold et al. ((1993), C . R . Acad. Sci , Life Sciences 316:1194-1199).
- microprojectile bombardment methods such as described by Klein et al . (Bio/Technology 10:286-291) may also be used to obtain transformed plants comprising the reductase and wax synthase expression constructs described herein.
- 100 ⁇ l buffer 100 mM Tricine/NaOH, pH 7.8, 280 mM NaCI, 10 % glycerol, and protease inhibitors 0.1 ⁇ M Aprotinin, 1 ⁇ M Leupeptin,
- DAGAT assays were performed as described in Example 7A with the following modifications. We determined that inclusion of 0.1% Triton X-100 in the assay cocktail was detrimental to DAGAT activity in this tissue therefore it was omitted. Also, since the tissue was isolated in homogenization buffer above, the assay was performed in the same buffer. 25 ⁇ l of sample was assayed in a total volume of 100 ⁇ l containing the following components: 3.67 ⁇ M I 1-14C,-18 : 1-Coenzyme A (53.5-54.5 Ci/mole, New England Nuclear, Boston, MA) lOOmM Tricine/NaOH, pH 7.8, lOOmM NaCI, 1.5mM di-18:l- DAG) .
- DAGAT proteins which are active in the formation of triacylglycerols from fatty acyl and diacylglycerol substrates.
- Methods to obtain the DAGAT proteins and amino acid sequences thereof are provided.
- DAGAT nucleic acid sequences may also be obtained from the amino acid sequences using PCR and library screening methods provided herein. Such nucleic acid sequences may be manipulated to provide for transcription of the sequences and/or expression of DAGAT proteins in host cells, which proteins may be used for a variety of applications. Such applications include the modification of triacylglycerols levels and compositions in host cells.
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU21664/00A AU2166400A (en) | 1998-12-04 | 1999-12-03 | Diacylglycerol acyl transferase proteins |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US20527198A | 1998-12-04 | 1998-12-04 | |
US09/205,271 | 1998-12-04 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2000032793A2 true WO2000032793A2 (fr) | 2000-06-08 |
WO2000032793A3 WO2000032793A3 (fr) | 2000-10-19 |
Family
ID=22761538
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1999/028825 WO2000032793A2 (fr) | 1998-12-04 | 1999-12-03 | Diacylglycerol acyle transferases |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU2166400A (fr) |
WO (1) | WO2000032793A2 (fr) |
Cited By (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000066749A1 (fr) * | 1999-05-04 | 2000-11-09 | Cargill, Incorporated | Acyltransferases de plantes |
EP1543130A2 (fr) * | 2002-07-31 | 2005-06-22 | Monsanto Technology, LLC | Sequences d'acides nucleiques de la diacylglycerol acyltransferase et produits associes |
US6995301B1 (en) | 1999-05-04 | 2006-02-07 | Cargill, Incorporated | Plant acyltransferases |
US7045326B2 (en) | 2001-02-23 | 2006-05-16 | The Regents Of The University Of California | Mono- and diacylglycerol acyltransferases and methods of use thereof |
US7862819B2 (en) | 2001-02-23 | 2011-01-04 | The J. David Gladstone Institutes | Diacylglycerol O-acyltransferase 2α (DGAT2α) |
US8716555B2 (en) | 2008-07-21 | 2014-05-06 | Commonwealth Scientific And Industrial Research Organisation | Cottonseed oil and uses |
US8735111B2 (en) | 2011-12-27 | 2014-05-27 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing hydrocarbon products |
US8809026B2 (en) | 2011-12-27 | 2014-08-19 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
US8921652B2 (en) | 2008-07-21 | 2014-12-30 | Commonwealth Scientific And Industrial Research Organisation | Vegetable oils and uses therefor |
US9127288B2 (en) | 2010-06-28 | 2015-09-08 | Commonwealth Scientific And Industrial Research Organisation | Methods of producing lipids |
US9351507B2 (en) | 2006-07-14 | 2016-05-31 | Commonwealth Scientific And Industrial Research Organisation | Method of preparing food using rice oil |
US10323209B2 (en) | 2012-04-25 | 2019-06-18 | Commonwealth Scientific And Industrial Research Organisation | High oleic acid oils |
US10472587B2 (en) | 2014-07-07 | 2019-11-12 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing industrial products from plant lipids |
US11639507B2 (en) | 2011-12-27 | 2023-05-02 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
US11859193B2 (en) | 2016-09-02 | 2024-01-02 | Nuseed Global Innovation Ltd. | Plants with modified traits |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998055632A1 (fr) * | 1997-06-05 | 1998-12-10 | Calgene Llc | Acyle gras-coa: alcool gras acyltransferase |
WO1999067403A1 (fr) * | 1998-06-24 | 1999-12-29 | The Regents Of The University Of California | Diacylglycerol o-acyltransferase |
-
1999
- 1999-12-03 AU AU21664/00A patent/AU2166400A/en not_active Abandoned
- 1999-12-03 WO PCT/US1999/028825 patent/WO2000032793A2/fr active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998055632A1 (fr) * | 1997-06-05 | 1998-12-10 | Calgene Llc | Acyle gras-coa: alcool gras acyltransferase |
WO1999067403A1 (fr) * | 1998-06-24 | 1999-12-29 | The Regents Of The University Of California | Diacylglycerol o-acyltransferase |
Non-Patent Citations (5)
Title |
---|
CASES, S. ET AL.: "Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 95, no. 22, 27 October 1998 (1998-10-27), pages 13018-13023, XP002122745 * |
EMBL Database, Heidelberg, FRG Empln accession number AB015479 12 June 1998 NAKAMURA, Y.: "Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone: MTE17" XP002138250 cited in the application * |
HOBBS, D.H. ET AL. : "Cloning of a cDNA encoding diacylglycerol acyltransferase from Arabidopsis thaliana and its functional expression" FEBS LETTERS, vol. 452, no. 3, 11 June 1999 (1999-06-11), pages 145-149, XP002122747 * |
KATAVIC, V. ET AL.: "Alteration of Seed Fatty Acid Composition by an Ethyl Methanesulfonate-Induced Mutation in Arabidopsis thaliana Affecting Diacylglycerol Acyltransferase Activity" PLANT PHYSIOLOGY, vol. 108, no. 1, May 1995 (1995-05), pages 399-409, XP002079129 * |
WILSON, R.F. ET AL.: "Recent Developments in the Molecular Biochemistry and Genetics of Diacylglycerol Acyltransferase from Soybean" 1992 , AMERICAN OIL CHEMISTS' SOCIETY , CHAMPAIGN, IL XP000884791 "SEED OILS FOR THE FUTURE" page 117, line 3 - line 23 page 118, line 29 -page 120, line 7 page 125, line 3 -page 133, line 35 page 131; figure 12.12 page 132; figure 12.13 * |
Cited By (30)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000066749A1 (fr) * | 1999-05-04 | 2000-11-09 | Cargill, Incorporated | Acyltransferases de plantes |
US6995301B1 (en) | 1999-05-04 | 2006-02-07 | Cargill, Incorporated | Plant acyltransferases |
US7045326B2 (en) | 2001-02-23 | 2006-05-16 | The Regents Of The University Of California | Mono- and diacylglycerol acyltransferases and methods of use thereof |
US7862819B2 (en) | 2001-02-23 | 2011-01-04 | The J. David Gladstone Institutes | Diacylglycerol O-acyltransferase 2α (DGAT2α) |
EP1543130A2 (fr) * | 2002-07-31 | 2005-06-22 | Monsanto Technology, LLC | Sequences d'acides nucleiques de la diacylglycerol acyltransferase et produits associes |
EP1543130A4 (fr) * | 2002-07-31 | 2006-07-12 | Monsanto Technology Llc | Sequences d'acides nucleiques de la diacylglycerol acyltransferase et produits associes |
US7417176B2 (en) | 2002-07-31 | 2008-08-26 | Monsanto Technology Llc | Diacylglycerol acyltransferase nucleic acid sequences and associated products |
US7935863B2 (en) | 2002-07-31 | 2011-05-03 | Monsanto Technology Llc | Diacylglycerol acyltransferase nucleic acid sequences and associated products |
US7939714B2 (en) | 2002-07-31 | 2011-05-10 | Monsanto Technology Llc | Diacylglycerol acyltransferase nucleic acid sequences and associated products |
US10260021B2 (en) | 2006-07-14 | 2019-04-16 | Commonwealth Scientific And Industrial Research Organisation | Rice plants and methods of producing rice grain |
US9351507B2 (en) | 2006-07-14 | 2016-05-31 | Commonwealth Scientific And Industrial Research Organisation | Method of preparing food using rice oil |
US8921652B2 (en) | 2008-07-21 | 2014-12-30 | Commonwealth Scientific And Industrial Research Organisation | Vegetable oils and uses therefor |
US9057075B2 (en) | 2008-07-21 | 2015-06-16 | Commonwealth Scientific And Industrial Research Organisation | Cottonseed oil and uses |
US8716555B2 (en) | 2008-07-21 | 2014-05-06 | Commonwealth Scientific And Industrial Research Organisation | Cottonseed oil and uses |
US10925293B2 (en) | 2010-06-28 | 2021-02-23 | Commonwealth Scientific And Industrial Research Organisation | Methods of producing lipids |
US9127288B2 (en) | 2010-06-28 | 2015-09-08 | Commonwealth Scientific And Industrial Research Organisation | Methods of producing lipids |
US10246718B2 (en) | 2011-12-27 | 2019-04-02 | The Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
US11639507B2 (en) | 2011-12-27 | 2023-05-02 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
US9512438B2 (en) | 2011-12-27 | 2016-12-06 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing hydrocarbon products |
US10246641B2 (en) | 2011-12-27 | 2019-04-02 | The Commonwealth Scientific And Industrial Research Organisation | Processes for producing hydrocarbon products |
US8735111B2 (en) | 2011-12-27 | 2014-05-27 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing hydrocarbon products |
US9061992B2 (en) | 2011-12-27 | 2015-06-23 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing hydrocarbon products |
US9499829B2 (en) | 2011-12-27 | 2016-11-22 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
US8809026B2 (en) | 2011-12-27 | 2014-08-19 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
US10323209B2 (en) | 2012-04-25 | 2019-06-18 | Commonwealth Scientific And Industrial Research Organisation | High oleic acid oils |
US11124737B2 (en) | 2012-04-25 | 2021-09-21 | Commonwealth Scientific Andn Industrial Research Organisation | High oleic acid oils |
US10472587B2 (en) | 2014-07-07 | 2019-11-12 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing industrial products from plant lipids |
US11365369B2 (en) | 2014-07-07 | 2022-06-21 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing industrial products from plant lipids |
US11814600B2 (en) | 2014-07-07 | 2023-11-14 | Nuseed Global Innnovation Ltd. | Process for producing industrial products from plant lipids |
US11859193B2 (en) | 2016-09-02 | 2024-01-02 | Nuseed Global Innovation Ltd. | Plants with modified traits |
Also Published As
Publication number | Publication date |
---|---|
WO2000032793A3 (fr) | 2000-10-19 |
AU2166400A (en) | 2000-06-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1003882A1 (fr) | Proteines diacylglycerol acyltransferase | |
JP4126102B2 (ja) | 脂肪アシル−CoA:脂肪アルコールアシルトランスフェラーゼ | |
EP1098962B1 (fr) | Proteines de diacylglycerol acyl transferase | |
US5910630A (en) | Plant lysophosphatidic acid acyltransferases | |
US6828475B1 (en) | Nucleic acid sequences encoding a plant cytoplasmic protein involved in fatty acyl-CoA metabolism | |
US5679881A (en) | Nucleic acid sequences encoding a plant cytoplasmic protein involved in fatty acyl-CoA metabolism | |
US5370996A (en) | Fatty acyl reductases | |
WO1993010241A1 (fr) | ACYL-CoA GRAS: ALCOOL ACYLTRANSFERASE GRASSE | |
WO2000032793A2 (fr) | Diacylglycerol acyle transferases | |
US5563058A (en) | Plant lysophosphatidic acid acyltransferases | |
US5723747A (en) | Wax esters in transformed plants | |
US7332311B2 (en) | Fatty acyl-CoA: fatty alcohol acyltransferases | |
US6492509B1 (en) | Fatty acyl-CoA: fatty alcohol acyltransferases | |
US5824858A (en) | Plant lysophosphatidic acid acyltransferases | |
US6093568A (en) | Plant lysophosphatidic acid acyltransferases | |
MXPA99011201A (en) | Diacylglycerol acyl transferase proteins | |
MXPA01005657A (en) | Fatty acyl-coa:fatty alcohol o-acyltransferases | |
MXPA99011202A (es) | Aciltransferasas acilo-coa graso:alcohol graso |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase |