WO2000029439A9

WO2000029439A9 - The cxc chemokine h174 and methods for preventing damage to the nervous system

Info

Publication number: WO2000029439A9
Application number: PCT/US1999/027199
Authority: WO
Inventors: Kenneth Jacobs; John M Mccoy; Edward R Lavallie; Lisa A Collins-Racie; Zhijian Lu; Sha Mi; Kerry Kelleher; Mckeough Carlin-Duckett; Martin E Dorf
Original assignee: Genetics Inst; Harvard College
Priority date: 1998-11-16
Filing date: 1999-11-16
Publication date: 2000-11-09
Also published as: EP1133521A1; WO2000029439A1; AU1729900A; CA2351146A1

Abstract

This invention provides polynucleotides comprising sequences encoding the CXC chemokine H174 and modified forms thereof, the encoded CXC chemokine H174 and modified forms thereof, methods of identifying inhibitors of the interaction between H174 and receptors for H174, and methods of treating nervous system conditions involving H174.

Description

THE CXC CHEMOKINE HI 74 AND METHODS FOR PREVENTING DAMAGE TO THE NERVOUS SYSTEM

This invention was made with partial Government support under Grant Nos. CA67416, NS37277, and NS37284, awarded by the National Institutes of Health. The Government may have certain rights in this invention.

Field of the Invention

The present invention provides novel polynucleotides and proteins encoded by such polynucleotides, along with therapeutic, diagnostic and research utilities for these polynucleotides and proteins.

Background of the Invention

Technology aimed at the discovery of protein factors (including e.g., cytokines, such as chemokines, lymphokines, interferons, CSFs, and interieukins) has matured rapidly over the past decade. The now routine hybridization cloning and expression cloning techniques clone novel polynucleotides "directly" in the sense that they rely on information directly related to the discovered factor (i.e., partial DNA/amino acid sequence of the factor in the case of hybridization cloning; activity of the factor in the case of expression cloning). More recent "indirect" cloning techniques such as signal sequence cloning, which isolates DNA sequences based on the presence of a now well- recognized secretory leader sequence motif, as well as various PCR-based or low stringency hybridization cloning techniques, have advanced the state of the art by making available large numbers of DNA/amino acid sequences for factors that are known to have biological activity by virtue of their secreted nature in the case of leader sequence cloning, or by virtue of the cell or tissue source in the case of PCR-based techniques. It is to such secreted factors, particularly chemokines, the polynucleotides encoding them, and therapeutic methods utilizing such proteins and polynucleotides, that the present invention is directed. Chemokines (for cbemotactic cytokines) are a family of small, inducible protein or glycoprotein molecules that play an essential role in evoking inflammatory responses. Perhaps the most important attribute of chemokines is their ability to act as potent selective chemoattractants for monocytes, lymphocytes, eosinophils, and/or neutrophils (Luster, 1998; Schluger and Rom, 1997). Chemokines can also initiate proinflammatory processes in these inflammatory cells, e.g. granule exocytosis and respiratory burst (Baggiolini et al, 1994).

Chemokines and chemokine receptors appear to play important roles in the pathogenesis of many diseases, including inflammatory diseases such as psoriasis and rheumatoid arthritis, and infectious diseases like malaria (Koch et al, 1992; Gillitzer et al, 1993; Horuk et al, 1993). However, chemokines have raised the greatest interest in the study of HIV- 1 infection where selected chemokine receptors serve as co-receptors for HIV-1 and the chemokine ligands can block HIV-1 infection (Alkhatib et al, 1996; Bleul et al, 1996a). The two major families of chemokines (termed CC- and CXC- chemokines) are defined by homologies in the spacing of amino acids between the first two cysteine residues. These structural features generally correlate with distinctive biological activities. CC-chemokines act principally on monocytes but not neutrophils, whereas CXC-chemokines primarily attract neutrophils, not monocytes. However, there are notable exceptions to these findings. Among CXC-chemokines the tripeptide motif - glutamic acid-leucine-arginine (called the ELR motif) - located immediately before the first cysteine residue is essential, though not sufficient, for activity on and binding to neutrophils (Clark-Lewis et al, 1993; Clark-Lewis et al, 1994). The observation that CXC-chemokines (SDF-1, PF4, IP 10, and Mig) that do not possess the ELR motif are unable to activate or attract neutrophils supports this conclusion (Taub et al, 1993; Liao et al, 1995; Bleul et al, 1996b). The CXC-chemokines lacking the ELR motif attract lymphocytes and/or monocytes, a trait not typical of the other CXC-chemokines. Two of these non-ELR containing CXC-chemokines, IP 10 and Mig, are induced by gamma interferon (IFN-γ) and bind a common receptor on activated T-lymphocytes (Luster and Ravetch, 1987; Farber, 1990; Loetscher et al, X 996). Non-ELR CXC-chemokines also appear to inhibit angiogenesis while ELR-containing CXC-chemokines promote angiogenesis (Strieter et al, 1995). These data suggest subdivision within the group of CXC-chemokines into the ELR-containing and the non-ELR subgroups.

Consequently, a continuing need exists for new compositions that will enhance, alter, or inhibit chemokine-receptor interactions, and for methods for their use.

Summary of the Invention

HI 74 is a new member of the non-ELR subgroup of the CXC-chemokine family. HI 74, like IP 10 and Mig, lacks the ELR sequence associated with the neutrophil specificity characteristic of most CXC-chemokines, however, recent experimental results indicate that HI 74, IP 10, and Mig are independently regulated. A cDNA probe containing the entire HI 74 coding region recognized a predominant inducible transcript of approximately 1.5 kb expressed in interferon-activated astrocytoma and monocytic cell lines. HI 74 message was also detected in interferon-treated cultures of primary human astrocytes, but was absent in unstimulated astrocytes. Induction of HI 74 messenger RNA production can be detected following stimulation of cells with IFN-α, IFN-β, or IFN-γ. Recombinantly produced HI 74 is a chemoattractant for monocyte-like cells. HI 74 can also stimulate calcium flux responses. The data support the classification of HI 74 as a member of a subfamily of interferon-inducible non-ELR CXC-chemokines. Here we report the expression of the novel chemokine HI 74 in cells of the central nervous system, in patients with pathological conditions associated with activated astrocytes and demyelination, but not in unaffected patients.

In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:

(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:l;

(b) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:l from nucleotide 67 to nucleotide 348;

(c) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:l from nucleotide 130 to nucleotide 348; (d) a polynucleotide comprising the nucleotide sequence of the full- length protein coding sequence of clone HI 74- 10 deposited under accession number ATCC 69882;

(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone HI 74- 10 deposited under accession number ATCC 69882;

(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone HI 74- 10 deposited under accession number ATCC 69882;

(g) a polynucleotide encoding a mature protein encoded by the cDNA insert of clone HI 74- 10 deposited under accession number ATCC 69882;

(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:2;

(i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:2;

(j) a polynucleotide which is an allelic variant of a polynucleotide of (a)-(g) above;

(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and (1) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i).

Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID NO:l from nucleotide 67 to nucleotide 348; the nucleotide sequence of SEQ ID NO:l from nucleotide 130 to nucleotide 348; the nucleotide sequence of the full-length protein coding sequence of clone H 174- 10 deposited under accession number ATCC

69882; or the nucleotide sequence of a mature protein coding sequence of clone HI 74-10 deposited under accession number ATCC 69882. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA insert of clone HI 74- 10 deposited under accession number ATCC 69882. In yet other preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:2 from amino acid 74 to amino acid 87. In further preferred embodiments, the present invention provides a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID NO:2, or a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity, the fragment preferably comprising the amino acid sequence from amino acid 24 to amino acid 33 of SEQ ID NO:2, or from amino acid 42 to amino acid 51 of SEQ ID NO:2, or from amino acid 57 to amino acid 67 of SEQ ID NO:2, or from amino acid 74 to amino acid 87 of SEQ ID NO.2.

(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:3; (b) a polynucleotide comprising the nucleotide sequence of SEQ ID

NO:3 from nucleotide 75 to nucleotide 356;

(c) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3 from nucleotide 138 to nucleotide 356;

(d) a polynucleotide comprising the nucleotide sequence of the full- length protein coding sequence of clone HI 74-43 deposited under accession number ATCC 69882;

(e) a polynucleotide encoding the full-length protein encoded by the cDNA insert of clone HI 74-43 deposited under accession number ATCC 69882;

(f) a polynucleotide comprising the nucleotide sequence of a mature protein coding sequence of clone H 174-43 deposited under accession number

ATCC 69882;

(g) a polynucleotide encoding a mature protein encoded by the cDNA insert of clone HI 74-43 deposited under accession number ATCC 69882;

(h) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:2; (i) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity, the fragment comprising eight consecutive amino acids of SEQ ID NO:2;

(k) a polynucleotide which encodes a species homologue of the protein of (h) or (i) above ; and

(1) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides specified in (a)-(i). Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID

NO:3 from nucleotide 75 to nucleotide 356; the nucleotide sequence of SEQ ID NO:3 from nucleotide 138 to nucleotide 356; the nucleotide sequence of the full-length protein coding sequence of clone HI 74-43 deposited under accession number ATCC 69882; or the nucleotide sequence of a mature protein coding sequence of clone HI 74-43 deposited under accession number ATCC 69882. In other preferred embodiments, the polynucleotide encodes the full-length or a mature protein encoded by the cDNA insert of clone HI 74-43 deposited under accession number ATCC 69882.

Other embodiments provide the gene corresponding to the cDNA sequences of SEQ ID NO:l and SEQ ID NO:3. The present invention also provides a process for producing an isolated polynucleotide, wherein the process is selected from the group consisting of: (a) a process comprising the steps of:

(i) preparing one or more polynucleotide probes that hybridize in 4X SSC at 65 degrees C to a nucleotide sequence selected from the group consisting of:

(aa) SEQ ID NO: 1 , but excluding the poly(A) tail at the 3' end of SEQ ID NO:l; and

(ab) the nucleotide sequence of the cDNA insert of clone HI 74-10 deposited under ATCC 69882; (ii) hybridizing said probe(s) to human DNA; and (iii) isolating the DNA polynucleotide detected with the probe(s); and

(b) a process comprising the steps of: (i) preparing one or more polynucleotide primers that hybridize in 4X SSC at 65 degrees C to a nucleotide sequence selected from the group consisting of:

(ba) SEQ ID NO: 1 , but excluding the poly(A) tail at the 3' end of SEQ ID NO:l; and (bb) the nucleotide sequence of the cDNA insert of clone H174-10 deposited under ATCC 69882; (ii) hybridizing said primer(s) to human DNA; (iii) amplifying human DNA sequences; and (iv) isolating the polynucleotide product of step (b)(iii). Preferably, the nucleotide sequence of said isolated polynucleotide corresponds to the cDNA sequence of SEQ ID NO:l, and extends contiguously from a nucleotide sequence corresponding to the 5' end of SEQ ID NO:l to a nucleotide sequence corresponding to the 3' end of SEQ ID NO:l but excluding the poly(A) tail at the 3' end of SEQ ID NO:l. In another preferred embodiment, the nucleotide sequence of said isolated polynucleotide corresponds to the cDNA sequence of SEQ ID NO: 1 from nucleotide 67 to nucleotide 348, and extends contiguously from a nucleotide sequence corresponding to the 5' end of said sequence of SEQ ID NO:l from nucleotide 67 to nucleotide 348, to a nucleotide sequence corresponding to the 3' end of said sequence of SEQ ID NO:l from nucleotide 67 to nucleotide 348. In a further embodiment, the nucleotide sequence of said isolated polynucleotide corresponds to the cDNA sequence of SEQ ID NO: 1 from nucleotide 130 to nucleotide 348, and extends contiguously from a nucleotide sequence corresponding to the 5' end of said sequence of SEQ ID NO:l from nucleotide 130 to nucleotide 348. to a nucleotide sequence corresponding to the 3' end of said sequence of SEQ ID NO:l from nucleotide 130 to nucleotide 348. Isolated polynucleotides produced according to the above process are also provided. The present invention also provides a process for producing an isolated polynucleotide, wherein the process is selected from the group consisting of:

(a) a process comprising the steps of:

(aa) SEQ ID NO:3; and

(ab) the nucleotide sequence of the cDNA insert of clone HI 74-43 deposited under ATCC 69882; (ii) hybridizing said probe(s) to human DNA; and

(iii) isolating the DNA polynucleotide detected with the probe(s); and

(ba) SEQ ID NO:3; and

(bb) the nucleotide sequence of the cDNA insert of clone HI 74-43 deposited under ATCC 69882;

(ii) hybridizing said primer(s) to human DNA; (iii) amplifying human DNA sequences; and (iv) isolating the polynucleotide product of step (b)(iii). Preferably, the nucleotide sequence of said isolated polynucleotide corresponds to the cDNA sequence of SEQ ID NO:3, and extends contiguously from a nucleotide sequence corresponding to the 5' end of SEQ ID NO:3 to a nucleotide sequence corresponding to the 3' end of SEQ ID NO:3. In another preferred embodiment, the nucleotide sequence of said isolated polynucleotide corresponds to the cDNA sequence of SEQ ID NO:3 from nucleotide 75 to nucleotide 356, and extends contiguously from a nucleotide sequence corresponding to the 5 ' end of said sequence of SEQ ID NO:3 from nucleotide

75 to nucleotide 356, to a nucleotide sequence corresponding to the 3^' end of said sequence of SEQ ID NO:3 from nucleotide 75 to nucleotide 356. In a further embodiment, the nucleotide sequence of said isolated polynucleotide corresponds to the cDNA sequence of SEQ ID NO:3 from nucleotide 138 to nucleotide 356, and extends contiguously from a nucleotide sequence corresponding to the 5' end of said sequence of SEQ ID NO:3 from nucleotide 138 to nucleotide 356, to a nucleotide sequence corresponding to the 3' end of said sequence of SEQ ID NO: 3 from nucleotide 138 to nucleotide 356. Preferably, these isolated polynucleotides contain one or more intron sequences, the first intron sequence being approximately 600 bp in size and located between nucleotide 103 and nucleotide 153 of SEQ ID NO:l, the second intron sequence being about 130 bp in size and located between nucleotide 230 and nucleotide 261 of SEQ ID NO:l, and the third intron sequence being about 400 bp in size and located between nucleotide 283 and nucleotide 510 of SEQ ID NO: 1. Isolated polynucleotides produced according to the above process are also provided.

In other embodiments, the present invention provides a composition comprising a protein, wherein said protein comprises an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence of SEQ ID NO:2;

(b) the amino acid sequence of SEQ ID NO:2 from amino acid 24 to amino acid 33; (c) the amino acid sequence of SEQ ID NO:2 from amino acid 25 to amino acid 41;

(d) the amino acid sequence of SEQ ID NO:2 from amino acid 30 to amino acid 56;

(e) the amino acid sequence of SEQ ID NO:2 from amino acid 42 to amino acid 51;

(f) the amino acid sequence of SEQ ID NO:2 from amino acid 57 to amino acid 67;

(g) the amino acid sequence of SEQ ID NO:2 from amino acid 74 to amino acid 87; (h) fragments of the amino acid sequence of SEQ ID NO:2 comprising eight consecutive amino acids of SEQ ID NO:2; and (i) the amino acid sequence encoded by the cDNA insert of clone HI 74- 10 or clone HI 74-43 deposited under accession number ATCC 69882; the protein being substantially free from other mammalian proteins. Preferably such protein comprises the amino acid sequence of SEQ ID NO:2. or the amino acid sequence from amino acid 24 to amino acid 33 of SEQ ID NO:2, or the amino acid sequence from amino acid 25 to amino acid 41 of SEQ ID NO:2, or the amino acid sequence from amino acid 30 to amino acid 56 of SEQ ID NO:2, or from amino acid 42 to amino acid 51 of SEQ ID NO:2, or from amino acid 57 to amino acid 67 of SEQ ID NO:2, or from amino acid 74 to amino acid 87 of SEQ ID NO:2. In further preferred embodiments, the present invention provides a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity, the fragment preferably comprising eight (more preferably twenty, most preferably thirty) consecutive amino acids of SEQ ID NO:2, or a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity, the fragment comprising the amino acid sequence from amino acid 24 to amino acid 33 of SEQ ID NO:2, or from amino acid 42 to amino acid 51 of SEQ ID NO:2, or from amino acid 57 to amino acid 67 of SEQ ID NO:2, or from amino acid 74 to amino acid 87 of SEQ ID NO:2.

In certain preferred embodiments, the polynucleotide is operably linked to an expression control sequence. The invention also provides a host cell, including bacterial, yeast, insect and mammalian cells, transformed with such polynucleotide compositions. Also provided by the present invention are organisms that have enhanced, reduced, or modified expression of the gene(s) corresponding to the polynucleotide sequences disclosed herein.

Processes are also provided for producing a protein, which comprise: (a) growing a culture of the host cell transformed with such polynucleotide compositions in a suitable culture medium; and (b) purifying the protein from the culture. The protein produced according to such methods is also provided by the present invention. Protein compositions of the present invention may further comprise a pharmaceutically acceptable carrier. Compositions comprising an antibody which specifically reacts with such protein are also provided by the present invention.

Methods are also provided for preventing, treating or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically effective amount of a composition comprising a protein of the present invention and a pharmaceutically acceptable carrier.

Another embodiment of the invention provides a method of preventing, treating, or ameliorating a condition of the nervous system comprising administering at least one substance to a vertebrate subject, wherein the substance inhibits the interaction of at least one endogenous non-ELR CXC chemokine with at least one chemokine receptor. Preferably, such conditions of the nervous system are conditions of the central nervous system or of the peripheral nervous system, or are selected from the group consisting of: AIDS-related dementia, multiple sclerosis, Miller Fisher syndrome, spongiform encephalopathy, viral encephalomyelitis, post-rabies-vaccine encephalomyelitis, postinfectious encephalomyelitis, paraneoplastic neuronopathy, paraneoplastic cerebellar degeneration, acute inflammatory demyelinating polyradiculo-neuropathy, Guillain-Barre syndrome, experimental auto-immune neuritis, acute inflammatory polyneuropathy, chronic inflammatory polyneuropathy, chronic inflammatory demyelinating poly-neuropathy, chronic relapsing inflammatory polyneuropathy, the poly-neuropathy associated with monoclonal gammopathy, IgM monoclonal anti-myelin-associated glycoprotein-associated demyelinating polyneuropathy, Lambert-Eaton myasthenic syndrome, myasthenia gravis, multifocal motor neuropathy with or without GM1 antibodies, inflammatory myopathy, stiff-man syndrome, and autoimmune neuromyotonia. More preferably, such conditions of the nervous system are AIDS-related dementia or multiple sclerosis. The vertebrate subject is preferably a mammal and more preferably a human subject. The substance is preferably selected from the group consisting of a modified non-ELR CXC chemokine, an antibody or antibody fragment that binds specifically to a non-ELR CXC chemokine, an antisense polynucleotide directed to a polynucleotide expressing a non-ELR CXC chemokine, a nucleotide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, a peptide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, and a small molecule that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor. The substance is more preferably an antibody that specifically binds to HI 74 protein, and still more preferably a monoclonal antibody, or a modified HI 74 chemokine molecule, the modified HI 74 chemokine molecule most preferably comprising an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence of SEQ ID NO:2;

(b) the amino acid sequence of SEQ ID NO:2 from amino acid 24 to amino acid 33;

(c) the amino acid sequence of SEQ ID NO:2 from amino acid 25 to amino acid 41 ;

(d) the amino acid sequence of SEQ ID NO:2 from amino acid 30 to amino acid 56; (e) the amino acid sequence of SEQ ID NO:2 from amino acid 42 to amino acid 51 ;

(f) the amino acid sequence of SEQ ID NO:2 from amino acid 57 to amino acid 67;

(g) the amino acid sequence of SEQ ID NO:2 from amino acid 74 to amino acid 87;

(h) fragments of the amino acid sequence of SEQ ID NO:2 comprising eight consecutive amino acids of SEQ ID NO:2; and

(i) the amino acid sequence encoded by the cDNA insert of clone H174-10 or clone HI 74-43 deposited under accession number ATCC 69882. Preferably, in this method of the invention, the substance inhibits the interaction of at least one of the HI 74, Mig, and IP 10 non-ELR CXC chemokines with at least one chemokine receptor, and preferably the endogenous non-ELR CXC chemokine is HI 74 and the chemokine receptor is CXCR3. A further embodiment of the invention provides a method for producing a modified non-ELR CXC chemokine, which process comprises:

(a) operably linking a polynucleotide encoding a non-ELR CXC chemokine to an expression control sequence; (b) transforming a host cell with the product of step (a);

(c) growing a culture of the host cell in a suitable culture medium;

(d) purifying the non-ELR CXC chemokine from the culture; and

(e) modifying the non-ELR CXC chemokine.

In another embodiment, the invention provides a method of preventing, treating, or ameliorating a condition involving inflammation of the nervous system comprising administering at least one substance to a vertebrate subject, wherein the substance inhibits the interaction of at least one endogenous non-ELR CXC chemokine with at least one chemokine receptor. The present invention also provides a method for preventing, treating, or ameliorating nervous system demyelination which comprises administering at least one substance to a vertebrate subject, wherein the substance inhibits the interaction of at least one endogenous non-ELR CXC chemokine with at least one chemokine receptor.

Yet another embodiment of the invention is a method for identifying molecules capable of interacting with a non-ELR CXC chemokine which comprises: (a) combining a non-ELR CXC chemokine with an indicator molecule and with a composition comprising molecules to be tested for interaction; and

(b) detecting the presence of altered indicator molecules.

The present invention provides as a further embodiment a method for identifying a substance capable of inhibiting the interaction of at least one non-ELR CXC chemokine with at least one chemokine receptor, which method comprises:

(a) combining the substance with a composition comprising at least one chemokine receptor, forming a first mixture;

(b) combining the first mixture with a composition comprising at least one non-ELR CXC chemokine, forming a second mixture; (c) combining a composition comprising at least one non-ELR CXC chemokine with a composition comprising at least one chemokine receptor, under conditions in which at least one said chemokine binds to at least one said chemokine receptor, forming a control mixture; (d) determining the amount of interaction between the non-ELR

CXC chemokine and chemokine receptor molecules in the second mixture and in the control mixture; and

(e) comparing the amount of interaction between the non-ELR CXC chemokine and chemokine receptor molecules in the second mixture with the amount of interaction between the non-ELR CXC chemokine and chemokine receptor molecules in the control mixture, wherein the substance inhibits the interaction of the non-ELR CXC chemokine and chemokine receptor molecules when the amount of interaction between the non-ELR CXC chemokine and chemokine receptor molecules is less in the second mixture than in the control mixture.

In this method of the invention, the non-ELR CXC chemokine preferably is HI 74 and the chemokine receptor is CXCR3.

The present invention also provides a method for altering chemokine receptor function which comprises causing a chemokine receptor to bind at least one substance, wherein the substance is selected from the group consisting of a modified non-ELR

CXC chemokine, an antibody or antibody fragment that binds specifically to a non-ELR CXC chemokine, an antisense polynucleotide directed to a polynucleotide expressing a non-ELR CXC chemokine, a nucleotide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, a peptide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, and a small molecule that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor.

In a further embodiment, the invention provides a method for inhibiting the interaction between a chemokine receptor and a ligand of the receptor which comprises causing the receptor to bind at least one substance, wherein the substance is selected from the group consisting of a modified non-ELR CXC chemokine, an antibody or antibody fragment that binds specifically to a non-ELR CXC chemokine, an antisense polynucleotide directed to a polynucleotide expressing a non-ELR CXC chemokine, a nucleotide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, a peptide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, and a small molecule that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor.

The present invention also provides a method for decreasing receptor function which comprises causing a receptor to bind at least one substance, wherein the substance is selected from the group consisting of: a modified non-ELR CXC chemokine, an antibody or antibody fragment that binds specifically to a non-ELR CXC chemokine, an antisense polynucleotide directed to a polynucleotide expressing a non-ELR CXC chemokine, a nucleotide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, a peptide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, and a small molecule that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, wherein binding the substance results in a decrease in the number of functional receptor molecules.

In another aspect of the present invention is provided a method for preventing, treating, or ameliorating nervous system disorders of a host which comprises:

(a) operably linking a polynucleotide to an expression control sequence, wherein the polynucleotide encodes a product selected from the group consisting of: a modified non-ELR CXC chemokine, an antibody or antibody fragment that binds specifically to a non-ELR CXC chemokine, an antisense polynucleotide directed to a polynucleotide expressing a non-ELR CXC chemokine, a nucleotide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, and a peptide aptamer that affects the binding of at least one non- ELR CXC chemokine to at least one chemokine receptor;

(b) isolating stem cells; (c) transforming the stem cells with at least one operably linked polynucleotide of step (a); and (d) introducing the transformed stem cells into the host.

Brief Description of the Drawings

Fig. 1 is a diagram demonstrating the amino acid similarity of the HI 74 protein to human and murine IP 10 and Mig proteins.

Fig. 2 is a schematic representation of the pNOTs vector used for deposit of clones disclosed herein.

Fig. 3 is an autoradiograph evidencing the expression of clone HI 74 in COS cells (indicated by an arrow). Fig. 4 demonstrates the induction of HI 74 by interferon-gamma (IFN-γ) in cultured astrocytes. Panel A is a Northern blot of IFN-γ-induced HI 74 mRNA expression in THP-1 monocytic cells. Panel B shows levels of HI 74 and Mig transcripts in cells treated with IFN-γ as compared to transcript levels in untreated cells. Panel C shows the time course of induction of HI 74 and Mig transcripts by IFN-γ in cultured human fetal astrocytes.

Fig. 5 shows the expression of HI 74, Mig, and IP 10 transcripts in SW 1783 astrocytoma cells stimulated with graded doses of IFN-α, IFN-β, or IFN-γ.

Fig. 6 shows the expression of HI 74 and Mig transcripts in the brains of patients with AIDS dementia and severe HIV-1 encephalitis, or with multiple sclerosis, and in control patients without CNS pathology.

Fig. 7 demonstrates the purification of HI 74 as shown by SDS-PAGE and immunoblotting experiments.

Fig. 8 is a graph depicting the pertussis-toxin sensitivity of chemotactic responses to HI 74 and MlP-lbeta demonstrated by U-937 cultured monocytic cells. Fig. 9 shows graphs depicting the calcium fluxes induced by HI 74 protein in

HL-60 promyelitic cells.

Detailed Description

Isolated HI 74 Proteins and Polynucleotides Nucleotide and amino acid sequences, as presently determined, are reported below for each HI 74 clone and protein disclosed in the present application. The nucleotide sequence of the HI 74 clone can readily be determined by sequencing of the deposited clone in accordance with known methods. The predicted HI 74 amino acid sequence (both full-length and mature forms) can then be determined from such nucleotide sequence. The amino acid sequence of the protein encoded by a particular clone can also be determined by expression of the clone in a suitable host cell, collecting the protein and determining its sequence. For the disclosed HI 74 protein, applicants have identified what they have determined to be the reading frame best identifiable with sequence information available at the time of filing.

Isolates "HI 74-10" and "H174-43" of Clone H174

Isolated polynucleotides of the present invention have been identified as clone "H174-10" and as clone "H174-43" (collectively referred to herein as clone "H174"). HI 74- 10 and HI 74-43 were isolated from a human peripheral blood mononuclear cell (activated by treatment with phytohemagglutinin, phorbol myristate acetate, and mixed lymphocyte reaction) cDNA library, and were identified as encoding a secreted or transmembrane protein using methods which are selective for cDNAs encoding secreted proteins (U.S. Pat. Nos. 5,536,637 and 5,707,829; and Jacobs et al, 1997). H174-10 and HI 74-43 are full-length clones, each including the entire coding sequence of a secreted protein (also referred to herein as "HI 74 protein"). The nucleotide sequences of H 174- 10 and H 174-43 as presently determined are reported in SEQ ID NO:l and SEQ ID NO:3, respectively, with the coding regions extending from nucleotides 67 to 348 of SEQ ID NO:l and nucleotides 75 to 356 of SEQ ID NO:3. What applicants presently believe to be the proper reading frame and the predicted amino acid sequence of the HI 74 protein corresponding to the foregoing nucleotide sequences is reported in SEQ ID NO:2. Amino acids 9 to 21 of SEQ ID

NO:2 are a predicted leader/signal sequence, with the predicted mature amino acid sequence beginning at amino acid 22.

The EcoRI/Notl restriction fragment containing the cDNA insert in clone HI 74- 10 should be approximately 966 bp, and the EcoRI/Notl restriction fragment containing the cDNA insert in clone HI 74-43 should be approximately 1354 bp. Analysis of HI 74 Nucleotide and Amino Acid Sequences

HI 74 encodes a novel protein. Initial searches comparing the HI 74- 10 sequence against the GenBank and GeneSeq nucleotide sequence databases using FASTA and BLASTN/BLASTX and search protocols, and against the GenPept and GeneSeq amino acid sequence databases using BLASTP/BLASTX search protocols, revealed no exact sequence matches. However, a BLASTX search revealed homology between the HI 74 protein, human IP- 10 (GeneSeq accession number R70791), and murine IP- 10 (also called CRG-2, GenBank accession numbers L07417, M33266, and M86829). Subsequent searches of these databases with the HI 74- 10 sequence revealed sequence similarity with human beta-Rl mRNA (partial coding sequence, GenBank U59286) and mammalian MIG-2 (GeneSeq accession number R25341). Based upon sequence similarity, HI 74 proteins and each similar protein or peptide may share at least some activity.

A group of authors, including some applicants of the present application, have entered the HI 74 sequence into the GenBank database under accession number AF002985. Cole et al (1998) have also subsequently reported an IFN-γ or IFN-β inducible chemokine termed I-TAC (GenBank accession number AF030514), which has the same predicted amino acid sequence as the HI 74 protein previously entered under GenBank accession number AF002985 (Jacobs et al, 1997). HI 74 contains four cysteine residues at positions characteristic of CXC- chemokines. The mature form of HI 74 protein is predicted to contain no potential sites for N-linked glycosylation. Analysis of the HI 74 amino acid sequence by NetOglyc, an algorithm that searches for putative O-glycosylation sites (Hansen et al, 1997), showed no potential sites for O-glycosylation on HI 74. Protein sequence comparison using the Wisconsin Sequence Analysis Package,

GCG Gap program, showed that the closest homologues to HI 74 were the human CXC- chemokines Mig and IP10. For amino acid sequence comparisons, the Gap program uses a scoring matrix with matches scored as 1.5 and mismatches scored according to the evolutionary distance between the amino acids as measured by Dayhoff and normalized by Gribskov (Gribskov and Burgess, Nucl. Acids Res. 14(16); 6745-6763 (1986)).

HI 74 is 38% identical to human Mig and 36% identical to human IP 10 over the 73 amino acids of mature protein that are comparable (see Farber, 1997. for comparisons of the Mig and IPIO sequences; also see Table 1 below).

Table 1. Comparisons of HI 74 with Chemokine Amino Acid Sequences

The sequences of these molecules and their murine counterparts are compared in Fig. 1, with the amino acid sequence numbering in Fig. 1 denoting the position of the residue within the predicted mature protein, and in which stippling indicates conserved residues, as determined by the Gap scoring algorithm, and a consensus sequence for this chemokine subfamily is presented. Sequence comparisons between human and murine Mig or IPIO with HI 74 identified fifteen identical residues dispersed along these molecules plus highly conserved amino acids at eleven additional positions (Fig. 1). Generally, the areas of greatest amino acid similarity appear to be clustered adjacent to the invariant cysteine residues at positions 36 to 46 and 53 to 66 of the predicted mature H174 protein sequence (which are amino acids 57 to 67 and 74 to 87, respectively, of the amino acid sequence of SEQ ID NO:2). Also, a few interesting features are notable in the N-terminal sequences of these non-ELR CXC chemokine proteins. Most CXC chemokines have variable numbers of residues preceding the first cysteine. In contrast, HI 74, IPIO and Mig consistently display only eight amino acids in this region, of which only residues 3. 5 and 8 are highly conserved. Preliminary examination of the genomic organization of HI 74 with a series of PCR primers indicates the locus encoding HI 74 is approximately 1.6 kb. There are at least three introns within the coding region. The first intron is approximately 600 bp in size and is located between residues 103 and 153 of the HI 74 coding (cDNA) sequence shown in SEQ ID NO:l. The second intron (about 130 bp in size) is localized between base pairs 230 and 261 of SEQ ID NO:l, and the third intron (about 400 bp in size) is located between base pairs 283 and 510 of SEQ ID NO:l . This genetic organization is similar to that reported with other CXC chemokines including IP10 and IL8 (Baggiolini et al, 1994).

Deposit of Clones

The HI 74 clone was deposited on August 11, 1995 with the American Type Culture Collection (10801 University Boulevard, Manassas, Virginia 20110-2209 U.S.A.) as an original deposit under the Budapest Treaty and was given the accession number ATCC 69882. All restrictions on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent, except for the requirements specified in 37 C.F.R. § 1.808(b), and the term of the deposit will comply with 37 C.F.R. § 1.806.

The HI 74 clone has been transfected into bacterial cells (E. coli) in this deposit. The HI 74 clone can be removed from the vector in which it was deposited by performing an ΕcoRI/NotI digestion (5' site, ΕcoRI; 3' site, Notl) to produce the appropriate fragment for such clone. The HI 74 clone was deposited in the pNOTs vector depicted in Figure 2. The pNOTs vector was derived from pMT2 (Kaufman et al, 1989, Mol Cell. Biol. 9: 946-958) by deletion of the DHFR sequences, insertion of a new polylinker between ΕcoRI and Notl, and insertion of the M13 origin of replication in the Clal site. In some instances, the deposited clone can become "flipped" (i.e., in the reverse orientation) in the deposited isolate. In such instances, the cDNA insert (e.g., SST cDNAs) can still be isolated by digestion with ΕcoRI and Notl. However, Notl will then produce the 5' site and ΕcoRI will produce the 3' site for placement of the cDNA in proper orientation for expression in a suitable vector. The HI 74 cDNA may also be expressed from the vector in which it was deposited. Bacterial cells containing the HI 74 clone can be obtained from the ATCC deposit, and can be confirmed as containing the HI 74 clone as follows:

An oligonucleotide probe or probes should be designed to the sequence that is known for that particular clone. This sequence can be derived from the sequences provided herein, or from a combination of those sequences.

In preferred oligonucleotide probes/primers the residue at position 2 of the oligonucleotide is a biotinylated phosphoaramidite residue rather than a nucleotide (such as , for example, that produced by use of biotin phosphoramidite (1-dimethoxytrityloxy- 2-(N-biotinyl-4-aminobutyl)-propyl-3-O-(2-cyanoethyl)-(N,N-diisopropyl)- phosphoramadite) (Glen Research, cat. no. 10-1953)).

The design of the oligonucleotide probe should preferably follow these parameters:

(a) It should be designed to an area of the sequence which has the fewest ambiguous bases ("N's"), if any; (b) It should be designed to have a T_m of approx. 80 ° C (assuming 2° for each A or T and 4 degrees for each G or C). The oligonucleotide should preferably be labeled with γ-³ P ATP (specific activity 6000 Ci/mmole) and T4 polynucleotide kinase using commonly employed techniques for labeling oligonucleotides. Other labeling techniques can also be used. Unincorporated label should preferably be removed by gel filtration chromatography or other established methods. The amount of radioactivity incorporated into the probe should be quantitated by measurement in a scintillation counter. Preferably, specific activity of the resulting probe should be approximately 4e+6 dpm/pmole.

The bacterial culture containing the pool of full-length clones should preferably be thawed and 100 μl of the stock used to inoculate a sterile culture flask containing 25 ml of sterile L-broth containing ampicillin at 100 μg/ml. The culture should preferably be grown to saturation at 37°C, and the saturated culture should preferably be diluted in fresh L-broth. Aliquots of these dilutions should preferably be plated to determine the dilution and volume which will yield approximately 5000 distinct and well-separated colonies on solid bacteriological media containing L-broth containing ampicillin at 100 μg/ml and agar at 1.5% in a 150 mm petri dish when grown overnight at 37°C. Other known methods of obtaining distinct, well-separated colonies can also be employed. Standard colony hybridization procedures should then be used to transfer the colonies to nitrocellulose filters and lyse, denature and bake them. The filter is then preferably incubated at 65°C for 1 hour with gentle agitation in

6X SSC (20X stock is 175.3 g NaCl/liter, 88.2 g Na citrate/liter, adjusted to pH 7.0 with NaOH) containing 0.5% SDS, 100 μg/ml of yeast RNA, and 10 mM EDTA (approximately 10 mL per 150 mm filter). Preferably, the probe is then added to the hybridization mix at a concentration greater than or equal to le+6 dpm/mL. The filter is then preferably incubated at 65°C with gentle agitation overnight. The filter is then preferably washed in 500 mL of 2X SSC/0.5% SDS at room temperature without agitation, preferably followed by 500 mL of 2X SSC/0.1% SDS at room temperature with gentle shaking for 15 minutes. A third wash with 0.1X SSC/0.5% SDS at 65°C for 30 minutes to 1 hour is optional. The filter is then preferably dried and subjected to autoradiography for sufficient time to visualize the positives on the X-ray film. Other known hybridization methods can also be employed.

The positive colonies are picked, grown in culture, and plasmid DNA isolated using standard procedures. The clones can then be verified by restriction analysis, hybridization analysis, or DNA sequencing.

Expression of HI 74 protein

Clone H174 was transfected into COS cells labelled with ³⁵S-methionine and protein was expressed. An autoradiograph evidencing expression of the proteins in conditioned media is presented in Fig. 3. The bands of protein expressed from the relevant clone are indicated by arrows.

Expression of HI 74 mRNA Cells and cell lines

The human HL-60 (promyelocytic leukemia), U-937 (monocyte-like), U-373 MG (glioblastoma/astrocytoma), CCF-STTG1 (astrocytoma), and SW

1783 (astrocytoma) cell lines were purchased from the American Tissue Culture Collection. Cells were maintained in RPMI 1640 (Life Technologies, Grand Island, NY) containing 10% fetal calf serum. Dr. F. W. Luscinskas and Dr. Keith Crawford (Harvard Medical School) generously provided human peripheral blood neutrophils and monocytes, respectively.

Cytokines

Human interferon-gamma (IFN-γ) and the CC-chemokine MlP-lβ were purchased from R&D Systems (Minneapolis, MN). Recombinant human IFN-α subtypes A, D and A/D and IFN-β were purchased from Biosource International (Camarillo, CA). Native human interferon-β was purchased from Access Biomedical, San Diego, CA. Recombinant HI 74 protein was prepared by applicants using the method described below in the section entitled "Purification of HI 74 Protein".

Cell stimulation

5 x 10⁶ U-373, SW 1783, CCF, HL-60 cells, or human fetal astrocytes were incubated at 10⁶ cells/ml with or without 1000 U/ml IFN-γ (Sigma) for eight hours at 37°C in a moist 5% CO₂ atmosphere.

Isolation of astrocytes

Purified fetal astrocyte cultures were prepared from the cerebral cortex of 16 to 18 weeks fetal human brain tissue as described (Busciglio et al, 1993). Tissue was procured using an approved protocol in compliance with institutional and federal regulations. The tissue was minced and incubated briefly with 0.25% trypsin, dissociated by trituration, washed, and plated onto plastic culture plates (100 mm) in Dulbecco's modified Eagles' medium supplemented with 10% fetal calf serum. The confluent cells were passaged following removal of the loosely adherent microglial cells by orbital shaking (Tornatore et al, 1991). Experiments were conducted after the third cell passage when fetal neurons and microglia were no longer apparent in the culture. The purity of astrocyte cultures (>99%) was determined by immunostaining with mouse anti-glial fibrillary acidic protein (GFAP) (1 :100, Sigma) followed by FITC-conjugated goat anti-mouse IgG (Sigma).

RNA Isolation RNA was isolated from cell suspensions following an RNA Isolation Kit protocol (Stratagene, La Jolla, CA). Briefly, 5-10 x 10⁶ cells were lysed with a guanidinium thiocyanate solution followed by a phenol-chloroform single-step extraction. The RNA was further cleansed by precipitation followed by washing with isopropanol and 15% ethanol, respectively. RNA was finally resuspended in 50 μl of DEPC-treated water.

Probe Preparation

HI 74 and human β-actin cDNA probes were labeled for hybridization following restriction enzyme digestion and agarose gel purification to remove vector sequences. The H 174 probe, excised from the vector with EcoRI , was 453 bp in length and included the entire coding region. DNA was purified from agarose using a JETSORB (Genomed Inc., Research Triangle Park, NC) protocol, and labeled by random oligonucleotide priming using [α³²P]dCTP (New England Nuclear, Boston, MA), dTTP, dATP. dGTP, and Klenow fragment of DNA polymerase I (New England Biolabs, Beverly, MA).

Northern Blotting

Total RNA was prepared as described above. Twenty micrograms of total RNA were subjected to electrophoresis in 1.5% agarose-formaldehyde gels and blotted onto Genescreen Plus nylon membranes (New England Nuclear). Membranes were hybridized to radiolabeled probe for 48 hours at 42°C in 50% formamide. Blots were washed in SET buffer, pH 8.0 (15 mM NaCl, 0.1 mM Na₃EDTA, 3 mM Tris base) with. 0.1%) sodium pyrophosphate. 0.1 % SDS, and 0.1 M sodium phosphate at room temperature or 55°C, and were then exposed on X-ray film (Kodak, Rochester, NY) with a fluorescent screen at -80°C. RT-PCR

Before cDNA synthesis, 1.5 μg RNA was treated with 1 U DNase-I (bovine pancreas; Sigma Chemical Co.) for 15 minutes at room temperature in 10 μl 20 mM Tris-HCl (pH 8.4) containing 2 mM MgCl, and 50 mM KCl, which was then inactivated by incubation with 2.5 mM EDTA at 65°C for 10 minutes. Single-stranded cDNA was synthesized from the RNA in a 20 μl reaction containing 50 ng of random hexamers, 2.5 mM MgCl₂, 0.5 mM dNTPs, 10 mM 1,4-DTT, 50 mM KCl, 20 mM Tris-HCl (pH 8.4), and 200 U Superscript II reverse transcriptase (Life Technologies, Gaithersburg, MD) for 10 minutes at 25°C, followed by 50 minutes at 42°C. The sample was then incubated with 2 U RNase H for 20 minutes at 37°C. Controls included RNA samples that were not subjected to reverse transcriptase. H174-specific primers were as follows: 5' GCCTTGGCTGTGATATTGTGTGC (SEQ ID NO:8) and 3' TTTTGGTCCTTTCACCCACC (SEQ ID NO:9). The Mig-specific primers were as follows:

5' TCATCTTGCTGGTTCTGATTG (SEQ ID NO:10) and 3' ACGAGAACGTTGAGATTTTCG (SEQ ID NO:l 1).

The IPlO-specific primers were as follows: 5' GGAACCTCCAGTCTCAGCACC (SEQ ID NO: 12) and 3' GCGTACGGTTCTAGAGAGAGGTAC (SEQ ID NO: 13).

The primers for the housekeeping gene control, human rackl (Shan et al, 1992), were as follows:

5' ATGACTGAGCAGATGACCCTT (SEQ ID NO: 14) and 3' CTAGCGTGTGCCAATGGTCA (SEQ ID NO: 15). PCR was carried out in a reaction mixture containing 2 mM MgCl₂, 0.5 μM primers, 10 mM Tris-HCl pH 8.3, 50 mM KCl, and 0.5 U/20 μl Amplitaq DNA Polymerase™ (Perkin Elmer, Modesto, CA). The PCR program for cDNA derived from cell lines and primary astrocyte cultures was as follows: 40 ng cDNA were preincubated at 94°C for 2 min followed by addition of enzyme and amplification with 30 cycles of PCR at 94°C for 45 seconds plus 45 seconds annealing and 50 seconds 72°C extension.

The annealing temperature was 55°C. For patient samples the PCR conditions were modified to include addition of 150 ng cDNA and amplification for 38 cycles with a 50°C annealing temperature. Six μl of the PCR mixtures was visualized on a 3% agarose gel. ΦX174 RF DNA/Hαe III fragments (Life Technologies) were included as molecular weight standards.

Results: Induction of HI 74 in astrocytes

Since the genes most homologous to Η 174 encode chemokines that are inducible following treatment with interferon-gamma (IFN-γ), this method of activation was used to follow gene expression (Fig. 4, panels A-C). Figure 4. panel A. Total RNA was prepared from unstimulated or IFN-γ- stimulated (8 hours with 1000 U/ml) TΗP-1 monocytic cells. Twenty μg RNA were electrophoresed on a 1.5% agarose-formaldehyde gel and blotted onto a nylon membrane which was probed with a 453-bp cDNA radiolabeled probe consisting of the entire HI 74 coding region. A major 1.5-kb species and a minor 4.0 kb band were identified in cells stimulated with IFN-γ, whereas no HI 74 message was detected in unstimulated cells. Subsequently the blot was reprobed with a human actin probe. IFN-γ stimulated U-937 monocyte-like and U-373 astrocytoma cell lines also expressed a major 1.5 kb band, but the weak 4.0 kb band was not detectable in U-373 RNA (data not shown). Figure 4. panel B. The inability of resting astrocyte cell lines to produce HI 74 was confirmed by RT-PCR. CCF (lanes A and B), U-373 (lanes C and D), and SW1783 (lanes E and E) astrocytoma cells were cultured in either medium (lanes A, C, and E), or 1000 U/ml IFN-γ (lanes B, D, and F), for 8 hours. RNA samples were reverse transcribed and amplified by RT-PCR using PCR primers for HI 74 (439 bp), rackl (1093 bp), or Mig (325 bp). The housekeeping gene rackl was used as a positive control for cDNA integrity. A band at the expected size (439 bp) was amplified from IFN-γ treated CCF, U-373, and SW 1783 astrocytoma cells, but not from unstimulated cells. The amount of HI 74 PCR product varied among astrocytoma cell lines; U-373 cDNA consistently yielded the most HI 74 PCR product while CCF cells produced minimal levels. Lane L contains the ladder of size markers. Figure 4. panel C. To establish the presence of HI 74 in primary astrocytes the kinetics of HI 74 expression were evaluated on cultured human fetal astrocytes. Cultured human fetal astrocytes were treated with 1000 U/ml IFN-γ for 0, 4, 18, 24, or 48 hours (lanes A,B,C.D, and E, respectively). The cells were examined for HI 74, rackl, and Mig gene expression by RT-PCR. Lane L contains the ladder of size markers. HI 74 expression was noted after a 4- to 48-hour treatment with IFN-γ. with maximal expression at 24 hours. Again, without IFN-γ treatment no HI 74 PCR products were detected. All samples expressed comparable levels of the control housekeeping gene, rackl, at the predicted size of 1093 bp. Figure 4. panels B and C. The same cDNA samples were examined for expression of another IFN-γ inducible non-ELR chemokine, Mig, by RT-PCR. HI 74 and Mig were both induced by IFN-γ in the series of samples tested.

Comparison of Induction of HI 74 and of Non-ELR CXC Chemokines by Interferons To further compare the regulation of HI 74 and Mig or IP10 expression, cells were treated with type I (IFN-α and IFN-β) or type II (IFN-γ) interferons. SW 1783 astrocytoma cells were stimulated with graded doses of IFN-α, IFN-β. or IFN-γ for 18 hr at 37°C. The cells were harvested and RNA samples were reverse transcribed and amplified with PCR primers for HI 74, Mig, IP10, and rackl . As shown in Figure 5, H 174 PCR products were detected after activation with > 100 Units/ml IFN-γ, > 100

Units/ml IFN-α or >1000 Units/ml IFN-β. In addition to the rIFN-αA used in the above experiment, rlFN-αD and rIFN-αA/D stimulate HI 74 RNA production with similar efficacy (data not shown). Similarly, native INF-β was substituted for the rIFN-β used in the above experiments with identical results (data not shown). Message for another non-ELR CXC chemokine, Mig, was detected in these cells after treatment with ³ 100

U/ml IFN-γ, but was not induced by treatment with up to 5000 U/ml IFN-α or IFN-β. IP10 was not expressed in resting SW 1783 cells but was inducible following stimulation with all types of interferon. The above experiment was repeated with U-373 astrocytoma and U-937 monocytic cells with similar results, although HI 74 was inducible with as little as 1.0 U/ml IFN-γ in the latter cell lines (data not shown). The combined data indicate that HI 74 and IP10 are inducible with all types of interferon. In contrast, Mig expression is strictly IFN-γ-dependent. Recent studies demonstrated IPIO message is constitutively expressed by CaSki cervical carcinoma cells while message for HI 74 and Mig are not detected without IFN-γ treatment (data not shown). Thus, the combined data suggest that these structurally related interferon-inducible non-ELR CXC-chemokines are differentially expressed and regulated.

Analysis of HI 74 and Mig Expression in Diseased and in Unaffected Brain Tissue

Specimens of white matter from the brain of one patient with AIDS dementia and HIV-1 encephalitis (case #2648) and one patient with multiple sclerosis (case #2684) were obtained at autopsy. Specimens that exhibited pathological lesions were selected. The neuropathology was verified by histologic examination of adjacent tissue sections. The tissues from both patients revealed the presence of diffuse reactive astrocytes (i.e. gliosis), perivascular mononuclear cell infiltrates, and demyelination (data not shown). Control samples were obtained from autopsies of two normal control patients without evidence of reactive astrocytes or other brain pathology. cDNA was prepared from each autopsy sample and examined for expression of the housekeeping gene rackl by RT-PCR. White matter from patients with AIDS dementia and severe HIV-1 encephalitis (lane A), multiple sclerosis (lane B), and two normal control patients without CNS pathology (lanes C and D), was examined for HI 74, rackl, and Mig expression by RT-PCR (Fig. 6). There were indications of RNA degradation in all samples, therefore four-fold excess cDNA was used in the PCR reactions. As shown in Fig. 6 each sample expressed the housekeeping gene, rackl, although the level of the PCR product varied among samples. HI 74 and Mig PCR products were detected in AIDS and multiple sclerosis brain tissue specimens, but not in specimens from controls. The level of HI 74 expression in the multiple sclerosis specimen appeared low; however, RNA degradation as evidenced by the low levels of the rackl control product contributed to this result. Rackl was amplified from both control samples but both specimens failed to display the HI 74 or Mig PCR products. Purification of HI 74 Protein

Protein Gel Electrophoresis and Silver Staining

Electrophoresis of protein samples was carried out in 15% SDS-polyacrylamide mini-gels made with a Mini-Protean II gel assembly kit (Bio-Rad, Hercules, CA). Samples were boiled for five minutes in 5% β-mercaptoethanol/2% SDS prior to loading and electrophoresed at 150V for 1.25 to 1.5 hours. Acrylamide gels were fixed in 40% methanol/10% acetic acid for 30 minutes, followed by two 15-minute fixing periods in 30% ethanol/5% acetic acid. Silver staining followed the manufacturer's protocol (Bio- Rad).

Production ofanti-Hl 74 antisera

Ten-week-old female Armenian hamsters were immunized subcutaneously with 100 μg of a 28-amino-acid carboxy-terminus peptide of HI 74 in Complete Freund's Adjuvant (Life Technologies, Grand Island, NY) and were boosted five times at 3 -week intervals with 100 μg of the peptide in Incomplete Freund's Adjuvant (Life

Technologies). Anti-H174 antisera from two separately immunized hamsters were pooled for use in staining immunoblots.

Immunoblotting Proteins separated by SDS-PAGE were transferred to a 0.22-μm pore size nitrocellulose sheet (Bio-Rad). Sheets were then blocked for 2 hours at room temperature with 3% BSA/PBS, washed three times with PBS and, if necessary, stored at -20°C. Nitrocellulose sheets were next reacted with a 1 :1000 dilution in 3% BSA/PBS of anti- H174 antisera for 2 hours at room temperature. The sheets were then washed three times for 10 minutes each with 3% BSA PBS, and reacted for 2 hours at room temperature with a 1:1000 dilution of alkaline-phosphatase-conjugated goat anti-hamster lg antibody (Kirkegaard & Perry Laboratories, Gaithersburg, MD) in 3% BSA/PBS. The nitrocellulose sheet was finally washed three times for five minutes each with PBS and bound antibodies were visualized by incubation with nitro blue tetrazolium/bromochloroindolyl phosphate (Kirkegaard & Perry Laboratories) at room temperature. The reaction was stopped by vigorous washing with PBS. Results: Purification of Recombinant HI 74 Protein

The amino acid sequence of HI 74 predicts that the mature HI 74 protein is secreted and 73 amino acids in size, with a molecular weight of 8.3 kDa. Partial purification of this protein from supernatants of H174-transfected Sf9 cells was achieved by elution from a heparin-agarose column with 10 mM HEPES/2.0 M NaCl. However, this one-step process left several contaminating proteins, as evidenced by the multiple bands observed on SDS-PAGE (Fig. 7, panel A, lane 1). Thus, two milliliters of heparin- purified HI 74 (lane 1) were next applied, after dialysis against 10 mM HEPES, to a reverse-phase Super Pac pep-S C18 column, subjected to reverse-phase chromatography. and fractionated by elution with a gradient of 0 to 70% acetonitrile in 0.1% trifluoroacetic acid. Typically, HI 74 was eluted from the column over a range of 59% to 62%) acetonitrile in 0.1%ι trifluoroacetic acid (lanes 2-7). Two proteins typically co-eluted from the reverse-phase column as a major peak over the range of 59%> to 62% acetonitrile. After elution from the HPLC column, fractions were subjected to 15% SDS-PAGE. Silver-stain visualization indicated the highest concentration of HI 74 eluted at 60% acetonitrile (Fig. 7, panel A, lane 4).

Antisera prepared against the 28-amino-acid carboxy-terminus peptide of H174 enabled the specific identification of HI 74 throughout the various purification steps. Immunoblots indicated HI 74 remained bound to heparin-agarose beads following a wash with 10 mM HEPES/250 mM NaCl buffer, but eluted completely from them with a 10 mM HEPES/2.0 M NaCl solution (data not shown). HI 74 appeared as a peak over a range of 59% to 62% acetonitrile on elution from the reverse-phase column. The anti- H174 serum failed to react with proteins isolated from mock transfected Sf9 cells (data not shown).

SDS-PAGE and silver staining of the HPLC-purified HI 74 revealed two distinct bands that ran at an apparent molecular weight of 8.8 and 10 kDa (Fig. 7, panel A). However, immunoblotting with antisera to the C-terminal peptide revealed a broad band, the lower portion of this band was usually faint or smeared so that a distinct second band could not be clearly distinguished by Western blotting (Fig. 7, panel B). Supernatants from HI 74 baculovirus-infected Sf9 cells were purified as above. Selected HPLC fractions (58 to 63%> acetonitrile) were run on 15% SDS-PAGE then transferred to a nitrocellulose membrane and stained with antisera from hamsters immunized with a 28 amino acid carboxy-terminus peptide of HI 74. Staining of HPLC-purified HI 74 fractions revealed two bands that reacted to differing degrees, or a broad band that correlated with the visualization of HI 74 on silver-stained gels, with the highest concentration of HI 74 having eluted from the reverse-phase column at 60% acetonitrile (panel B, lane 3).

While the predicted HI 74 sequence lacks the required motif for N-linked glycosylation and is not predicted to contain O-linked glycosylation sites, an O- glycosidase digest was performed to evaluate whether O-linked glycosylation was present in the H174 protein. One μg H174 was incubated with 2.5 mU of neuraminidase (New England Biolabs, Beverly, MA) for 2 hours at 37 °C to remove potential sialic acid residues prior to addition of 1 mU of O-glycosidase for an additional 18 hour 37 °C incubation. Fetuin, a control protein that contains O-linked sugars, was treated simultaneously. While fetuin underwent glycosylation cleavages resulting in molecular weight shifts on SDS-PAGE, HI 74 demonstrated no change whatsoever in either of the bands previously isolated (data not shown). Thus, HI 74 appears to be a non- glycosylated protein.

HI 74 Stimulates Chemotaxis

Chemotaxis Assay

Cell migration was evaluated in 48-well Boyden microchambers (Neuroprobe, Cabin John, MD) as previously reported for macrophages (Luo et al, 1994). Cells were washed and resuspended in endotoxin-depleted RPMI 1640 with 1% BSA (hereafter called "chemotaxis medium") to a concentration of 3 x 10⁶ cell/ml. Fifty microliters of cells were added to the upper well of the Boyden chamber, which was separated from the chemokine by a polycarbonate filter with 5-μm pores (Poretics, Livermore, CA) for monocytes or 3-μm pores for neutrophils. All responses were assayed in triplicate. The chamber was incubated for 1.25 hours at 37°C in a moist 5% CO₂ atmosphere. After incubation, the upper surface of the filter was scraped to remove non-migrating cells.

Filters were subsequently fixed in methanol and stained with Diff-Quik (Baxter, McGaw Park, IL). The number of migrating cells per high-powered field was determined microscopically at 400' magnification.

Pertussis Toxin Treatment

U-937 cells were washed twice and resuspended in serum-free medium. The cells were then treated with 100 ng/ml of pertussis toxin (Sigma) for 60 minutes at 37°C. After treatment, the cells were washed twice and suspended in chemotaxis medium. The viability of cells before and after pertussis toxin treatment was greater than 95%> as assayed by staining with trypan blue.

Results: Migration of U-937 Monocytic Cells

Mononuclear leukocytes are among the targets of non-ELR chemokines. Therefore, the ability of rH174 to induce cell migration of U937 monocyte-like cells was evaluated in a 48-well Boyden microchamber. U-937 cells were incubated for 1 hour with or without 100 ng/ml of pertussis toxin and then assayed for chemotaxis toward H174 or MlP-lβ. HPLC-purified rH174 or MlP-lβ were evaluated at a concentration of 1 ng/ml and 10 ng/ml, respectively (approximately 0.1 and 1 nM, respectively). Migratory responses (cells per high power field) were assayed in triplicate. The data shown in Fig. 8 is an average from three experiments, with error bars indicating the standard error of the mean (S.E.M.). Background migration without addition of chemokine is also presented. U937 cells exhibited optimal migratory responses with 1 ng/ml HI 74; a control CC-chemokine, MlP-lβ, demonstrated responses of comparable magnitude under these experimental conditions (Fig. 8). In contrast, HI 74 did not induce migration of human neutrophils (data not shown). The chemotactic responses to HI 74 were completely inhibited by pretreatment of cells for 1 hour with 100 ng/ml pertussis toxin (Fig. 8). The sensitivity of H174-induced chemotaxis to pertussis toxin suggests that HI 74, like most chemokines, acts through Gαi protein-coupled receptors. HI 74 Induces a Calcium Flux

Measurement of Intracellular Calcium Concentration [Ca ⁺]

HL-60 cells (1 x 10⁶ or 2 x 10⁶ cells/ml) were incubated with 2.5 mM fura-2 AM (Molecular Probes, Eugene, OR) in HBSS containing 1% BSA and 1.25 mM CaCl, for 60 minutes at 37°C. Subsequently, the cells were washed twice and resuspended in a light-shielded tube at room temperature until use. Fluorescence measurements were performed at excitations of 340 nm and 380 nm with a fluorescence emission at 510 nm in a fluorospectrophotometer (Hitachi F-4500, Tokyo, Japan) while stirring the cell suspension at 37°C. The data is presented as the relative ratio (R) of fluorescence at 340 and 380 nm. From this ratio, the level of intracellular calcium could be calculated. To calibrate intracellular calcium levels, 0.1 mM digitonin was used to release the indicator dye and 4 mM EDTA to clamp intracellular calcium levels. Calcium concentrations were calculated according to the manufacturer's protocol, using a K_d(Ca²⁺) of 224 nm. Results: HI 74 Induces Calcium Mobilization in HL-60 Cells Chemokine receptors are seven-transmembrane spanning Gαi protein-coupled receptors that, upon binding their appropriate chemokine, provoke a transient rise in intracellular calcium levels. The calcium-sensitive fluorescent dye fura-2 AM was loaded into promyelocytic HL-60 cells and their responses to HI 74 (elevations in [Ca²⁺]j) were assayed in a fluorospectrophotometer. Figure 9, panels A-C demonstrate that 2 x 10⁶ undifferentiated HL-60 cells experienced a transient calcium flux in response to HI 74 at concentrations of 1 μg/ml and 100 ng/ml (approximately 10^"7 M and 10^"8 nM, respectively, panels A and B), but not to 10^"5 M fMLP (panel C). This response was abolished in HL-60 cells that had been differentiated toward a neutrophil phenotype by culture in the presence of 1.25%) v/v DMSO for 2 days (Fig. 9, panel D). In Fig. 9, panels A-B and D, the time of HI 74 addition is indicated with a closed triangle; in Fig.

9, panel C, the time of fMLP addition is indicated with a closed triangle

Discussion

HI 74 is a new member of the CXC-chemokine family. The four cysteine residues characteristic of all CXC-chemokines are conserved in HI 74. The N-terminus of most CXC-chemokines encodes an ELR motif that is critical for neutrophil specificity. The ELR sequence is missing in HI 74. The closest homologues of HI 74 are Mig and IPIO, both of which also lack the ELR motif suggesting that these chemokines may form a subgroup of IFN-inducible non-ELR CXC-chemokines. The structural homologies among these molecules indicate a clustering of conserved residues within the group, and a few interesting features are notable in their N-terminal sequences. Most CXC chemokines have variable numbers of residues preceding the first cysteine. In contrast, HI 74, IPIO and Mig consistently display only eight amino acids in this region of which only residues 3, 5 and 8 are highly conserved. A truncated form of IPIO lacking the first three amino acid residues was non-functional and failed to bind to receptor bearing cells (Piali et al, 1998). Mutational analysis can be used to identify additional critical residues involved in HI 74 binding and function.

Although HI 74, Mig and IPIO are all inducible following IFN-γ stimulation, type I interferons only stimulate expression of HI 74 and IPIO. The observation that some cervical carcinoma cell lines constitutively express IPIO but not HI 74 or Mig suggests that each of these non-ELR CXC chemokines is selectively expressed and regulated. A better understanding of the process controlling chemokine expression can be obtained by comparison of the HI 74 promotor region with those of other interferon- inducible cytokines (see, for example, Wright and Farber, 1991).

Undifferentiated HL-60 promyelocytic cells are targets for HI 74 while HL-60 cells differentiated toward the neutrophil lineage are not responsive to HI 74. However, the major cellular target of IPIO and Mig are activated T lymphocytes (Loetscher et al, 1996). CXCR3 is the T cell receptor for both IPIO and Mig and CXCR3 transfected cells migrate in response to IPIO or Mig (Loetscher et al, 1996). However, CXCR3 is apparently absent on monocytes, U-937, and HL-60 cells (Loetscher et al, 1996). Therefore, an alternative receptor molecule on U-937 and HL-60 cells may be involved in HI 74 responsiveness. We noted that rH174 possessed chemoattractant activity at sub-nanomolar concentrations suggesting a high affinity receptor. The complete inhibition of the migratory response by pretreatment of cells with pertussis toxin is consistent with previous observations that suggest chemokine receptors are coupled to Gθj proteins (Ku ng et al, 1996), as is the finding that recombinant HI 74 protein induces calcium mobilization in target cells (Fig. 9). Cole et al (1998) reported an IFN-γ or IFN-β inducible chemokine termed I-TAC (GenBank accession #AF030514) which has the same sequence as HI 74 that was previously deposited in GenBank under accession number AF002985 (Jacobs et al, 1997). Cole et al (1998) demonstrated that the synthetic H174/I-TAC peptide binds CXCR3 transfected cells with 0.3 nM affinity. However, Cole et al (1998) reported that synthetic H174/I-TAC peptide lacked activity on resting monocytes in both chemotaxis and calcium flux assays. The potential disparity with our data may reflect differences between recombinant and synthetic chemokine and/or differences in the sensitivities of the different target cells used in these experiments. RNA transcripts for HI 74 are inducible by IFN in monocytic and astrocytoma cell lines. In contrast, treatment with bacterial lipopolysaccharide induces only minimal HI 74 expression (data not shown). This implies that HI 74 will be preferentially produced by astrocytes following activation of cellular responses particularly those involving NK, Thl and/or CD8 cells which release IFN-γ. A deduced protein sequence with 93.5% homology to HI 74 was initially reported by Rani et al (1996). These investigators identified a partial nucleic acid sequence from astrocytes stimulated with IFN-β but not IFN-α. In contrast, IFN-α and IFN-β both stimulate HI 74 production (Fig. 5). The basis for these disparities is unclear, although the possibility of alternatively spliced HI 74 products with different interferon-induction profiles remains.

In preliminary studies HI 74 and Mig expression were noted in brain tissue samples from two patients with clinical disease (AIDS dementia and multiple sclerosis) and histological evidence of astrocyte activation and inflammation. Presumably, in these conditions IFN-γ producing CD8, NK, and/or CD4 cells stimulate astrocyte chemokine production within central nervous system (CNS) lesions resulting in amplification of the inflammatory response by recruitment and activation of mononuclear cells which mediate demyelination.

If chemokines such as HI 74, IPIO and Mig function synergistically, stimulation of multiple chemokine species may provide more effective inflammatory responses and may account for the redundancy frequently noted among chemokines. The implications from these hypotheses are that the predominant interferons released in response to viral infection may directly influence the ability of astrocytes to recruit inflammatory cells to the CNS. Perhaps the most vigorous responses resulting in CNS demyelination require expression of all three of these non-ELR CXC chemokines. It has been reported that in the inflammatory demyelinating autoimmune disease murine experimental allergic encephalomyelitis (EAE) astrocytes are the major source of mRNAs encoding IPIO (Ransohoff et al, 1993). The current data demonstrate that MS patients can also produce HI 74 and Mig at inflammatory sites. Thus, the source of expression and the ability to attract mononuclear cells implicate HI 74 as a potential participant in inflammatory responses within the central nervous system in several diseases including AIDS dementia and multiple sclerosis, and in other types of CNS inflammatory response such as Miller Fisher syndrome (MFS), spongiform encephalopathies, viral encephalomyelitis, post-rabies-vaccine encephalomyelitis, postinfectious encephalomyelitis, paraneoplastic neuronopathies and cerebellar degeneration, and other neurological diseases associated with systemic autoimmune conditions, vasculitis, or viral infections. It is also contemplated that HI 74 and other chemkoines are involved in additional disorders involving inflammation or demyelination of the nervous system, such as of the peripheral nervous system, some examples being acute inflammatory demyelinating polyradiculo-neuropathy (Guillain-Barre syndrome, GBS) and its animal model experimental auto-immune neuritis (EAN), other acute inflammatory polyneuropathies, chronic inflammatory polyneuropathies (CIP), chronic inflammatory demyelinating poly-neuropathies (CIDP), chronic relapsing inflammatory polyneuropathies, the poly-neuropathy associated with monoclonal gammopathy, IgM monoclonal anti-myelin-associated glycoprotein-associated demyelinating polyneuropathy, Lambert-Eaton myasthenic syndrome (a disorder of the motor nerve terminal), myasthenia gravis. multifocal motor neuropathy with or without GM1 antibodies, inflammatory myopathies, stiff-man syndrome, and autoimmune neuromyotonia.

In summary, HI 74 is a new member of the non-ELR CXC-chemokine subfamily. HI 74 is inducible in astrocytes and astrocytoma cell lines by treatment with IFN-γ. Recombinant HI 74 is chemotactic for monocytic cells and induces a transient calcium flux in the targets. HI 74 message was detected in the brain lesions from patients with neuropathological conditions associated with activated astrocytes.

Chemotactic/Chemokinetic Activity A protein of the present invention may have chemotactic or chemokinetic activity (e.g., act as a chemokine) for mammalian cells, including, for example, monocytes, fibroblasts. neutrophils, T-cells, mast cells, eosinophils. epithelial and/or endothelial cells. Chemotactic and chemokinetic proteins can be used to mobilize or attract a desired cell population to a desired site of action. Chemotactic or chemokinetic proteins provide particular advantages in treatment of wounds and other trauma to tissues, as well as in treatment of localized infections. For example, attraction of lymphocytes, monocytes or neutrophils to tumors or sites of infection may result in improved immune responses against the tumor or infecting agent. Conversely, inhibiting chemotactic attraction of cells secreting inflammation-inducing substances may reduce undesirable inflammatory responses.

As used herein, "chemokine" includes all protein molecules with chemotactic activity. "Endogenous" chemokines are those that are produced naturally by unaltered cells. A modified chemokine is a chemokine that has been modified from a naturally occuring chemokine by any kind of alteration, addition, insertion, deletion, mutation, substitution, replacement, or other modification. Chemotactic activity for a particular cell population is the direct or indirect stimulation of the directed orientation or movement of such cell population. Preferably, the cell population comprises circulating blood cells, bone marrow stem cells. More preferably, the cell population may include monocytes, B cells, T cells, basophils, eosinophils, neutrophils. natural killer (NK) cells, and bone marrow stem cells. Most preferably, the cell population may include monocytes, T cells, basophils, and bone marrow stem cells. Preferably, the chemokine has the ability to directly stimulate directed movement of cells. Whether a particular polypeptide has chemotactic activity for a population of cells can be readily determined by employing the polypeptide in any known assay for cell chemotaxis. Assays for chemotactic activity (which will identify proteins that induce or prevent chemotaxis) consist of assays that measure the ability of a protein to induce the migration of cells across a membrane as well as the ability of a protein to induce the adhesion of one cell population to another cell population. Suitable assays for movement and adhesion include, without limitation, those described in: Current Protocols in Immunology, Ed. by J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W. Strober, Pub. by Greene Publishing Associates and Wiley-Interscience (Chapter 6.12. Measurement of alpha and beta Chemokines 6.12.1-6.12.28); Taub et al., J. Clin. Invest. 95:1370-1376, 1995; Lind et al., APMIS 103:140-146, 1995; Muller et al., Eur. J. Immunol. 25: 1744-1748; Gruber et al., J. of Immunol. 152:5860-5867, 1994; Johnston et al., J. of Immunol. 153: 1762-1768, 1994; all of which are incorporated herein by reference. As used herein, "covalently attached" means the attachment of molecules to each other by covalent chemical bonds, either directly or through a linker molecule that is itself covalently attached to said molecules.

As used herein, "amino-terminal-modified chemokine" includes the result of covalently attaching any chemical moiety to the N-terminus of a chemokine polypeptide, wherein the chemical moiety may include any amino acid(s) or chemically modified amino acid(s); fragments of or entire chemokines, cytokines, immunoglobulins, antigens, kinases, proteases (including without limitation CD26, HIV proteases, granzymes, or cathepsin G), other enzymes, or structural proteins; polypeptides derived from the foregoing by any form of alteration, addition, insertion, deletion, mutation, substitution, replacement, or other modification, including without limitation alterations to the Leu-25 residue of the mature IL-8 polypeptide (Wells et al, 1996, J. Leukoc. Biol. 59: 53-60), alterations to the corresponding leucine residue of SDF-lα and SDF-lβ (e.g. residue 47 of SEQ ID NO:s 1 and 2, residue 27 of SEQ ID NO:s 10 and 11, residue 48 of SEQ ID NO:s 12 and 13, and residue 26 of SEQ ID NO:s 14 and 15), and alterations to the tyrosine-28 residue of mature MIP- 1 α and MIP- 1 β (Wells et al , 1996, J. Leukoc. Biol 59: 53-60); antibody-binding tags such as His, Flag, or myc; lectin-binding domains; toxins; etc. Preferably, the chemical moiety attached to the N-terminus of the chemokine polypeptide does not interfere with binding of the chemokine polypeptide to its receptor(s). More preferably, the amino-terminal-modified chemokine comprises a methionine residue covalently attached to the amino-terminus of the naturally-occuring mature (or secreted) form(s) of the chemokine. In another more preferred embodiment, a serine or threonine residue is attached to the N-terminus of the chemokine (if its N- terminal residue is not already serine or threonine), and the chemokine is then subjected to a mild periodate oxidation to convert the serine or threonine into an aldehyde, followed by reaction with aminooxypentane (AOP) to form the desired AOP-chemokine oxime (see Simmons et al, 1997, Science 276: 276-279, incorporated herein by reference). Other methods for preparing amino-terminal-modified chemokines are described in U.S. Pat. No. 5,656,456, incorporated herein by reference. In another preferred embodiment, the chemical moiety attached to the N-terminus of the chemokine polypeptide comprises a enzymatic or chemical cleavage site so that the amino-terminal- modified chemokine may be cleaved to produce a molecule or molecule(s) having a desired activity. More preferably, a GroHEK peptid comprising an enterokinase target amino acid sequence is attached to the N-terminus of a chemokine, optionally with additional amino acids(s) linking the GroHek peptide to the chemokine. The GroHEK peptide can be left attached to the chemokine as an N-terminal modification, or it can be cleaved off by enterokinase so that the additional linking amino acid(s) are now the N- terminal additions to the chemokine. Also more preferably, a peptide comprising an HIV protease target amino acid sequence is attached to the N-terminus of a chemokine to form an HIV protease cleavage site, optionally with additional amino acids(s) linking the HIV protease recognition peptide to the chemokine. The HIV protease recognition peptide can be left attached to the chemokine as an N-terminal modification, or it can be cleaved off by the HIV protease so that the additional linking amino acid(s), if any, are now the N-terminal additions to the chemokine. Examples of amino acid sequences cleaved by HIV proteases are described in Tomasselli and Heinrikson, Methods in Enzymology 241: 279-301, 1994, incoφorated herein by reference. In another preferred embodiment, the chemical moiety attached to the N-terminus of the chemokine polypeptide comprises a molecule with a desired activity, so that the N-terminal- modified chemokine also possesses this desired activity. More preferably, the chemical moiety attached to the N-terminus of the chemokine polypeptide comprises a protease. Fragments of the proteins of the present invention which are capable of exhibiting biological activity are also encompassed by the present invention. Fragments of the protein may be in linear form or they may be cyclized using known methods, for example, as described in H.U. Saragovi, et al, Bio/Technology X0, 113-11% (1992) and in R.S. McDowell, et al, J. Amer. Chem. Soc. X X4, 9245-9253 (1992), both of which are incorporated herein by reference. Such fragments may be fused to carrier molecules such as immunoglobulins for many purposes, including increasing the valency of protein binding sites. For example, fragments of the protein may be fused through "linker" sequences to the Fc portion of an immunoglobulin. For a bivalent form of the protein, such a fusion could be to the Fc portion of an IgG molecule. Other immunoglobulin isotypes may also be used to generate such fusions. For example, a protein - IgM fusion would generate a decavalent form of the protein of the invention. As used herein a "secreted" protein is one which, when expressed in a suitable host cell, is transported across or through a membrane, including transport as a result of signal sequences in its amino acid sequence. "Secreted" proteins include without limitation proteins secreted wholly (e.g., soluble proteins) or partially (e.g. , receptors) from the cell in which they are expressed. "Secreted" proteins also include without limitation proteins which are transported across the membrane of the endoplasmic reticulum.

The present invention also provides both full-length and mature forms of the disclosed proteins. The full-length form of the such proteins is identified in the sequence listing by translation of the nucleotide sequence of each disclosed clone. The mature form(s) of such protein may be obtained by expression of the disclosed full- length polynucleotide (preferably those deposited with ATCC) in a suitable mammalian cell or other host cell. The sequence(s) of the mature form(s) of the protein may also be determinable from the amino acid sequence of the full-length form.

The present invention also provides genes corresponding to the polynucleotide sequences disclosed herein. "Corresponding genes" are the regions of the genome that are transcribed to produce the mRNAs from which cDNA polynucleotide sequences are derived and may include contiguous regions of the genome necessary for the regulated expression of such genes. Corresponding genes may therefore include but are not limited to coding sequences, 5' and 3' untranslated regions, alternatively spliced exons, introns, promoters, enhancers, and silencer or suppressor elements. The corresponding genes can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include the preparation of probes or primers from the disclosed sequence information for identification and/or amplification of genes in appropriate genomic libraries or other sources of genomic materials. An "isolated gene" is a gene that has been separated from the adjacent coding sequences, if any, present in the genome of the organism from which the gene was isolated.

The chromosomal location corresponding to the polynucleotide sequences disclosed herein may also be determined, for example by hybridizing appropriately labeled polynucleotides of the present invention to chromosomes in situ. It may also be possible to determine the corresponding chromosomal location for a disclosed polynucleotide by identifying significantly similar nucleotide sequences in public databases, such as expressed sequence tags (ESTs), that have already been mapped to particular chromosomal locations. For at least some of the polynucleotide sequences disclosed herein, public database sequences having at least some similarity to the polynucleotide of the present invention have been listed by database accession number. Searches using the GenBank accession numbers of these public database sequences can then be performed at an Internet site provided by the National Center for Biotechnology Information having the address http://www.ncbi.nlm.nih.gov/UniGene/, in order to identify "UniGene clusters" of overlapping sequences. Many of the "UniGene clusters" so identified will already have been mapped to particular chromosomal sites. Organisms that have enhanced, reduced, or modified expression of the gene(s) corresponding to the polynucleotide sequences disclosed herein are provided. The desired change in gene expression can be achieved through the use of antisense polynucleotides or ribozymes that bind and/or cleave the mRNA transcribed from the gene (Albert and Morris, 1994, Trends Pharmacol. Sci. 15(7): 250-254; Lavarosky et al, 1997, Biochem. Mol. Med. 62(1): 11 -22; and Hampel, 1998, Prog. Nucleic Acid Res.

Mol. Biol. 58: 1-39; all of which are incorporated by reference herein). Transgenic animals that have multiple copies of the gene(s) corresponding to the polynucleotide sequences disclosed herein, preferably produced by transformation of cells with genetic constructs that are stably maintained within the transformed cells and their progeny, are provided. Transgenic animals that have modified genetic control regions that increase or reduce gene expression levels, or that change temporal or spatial patterns of gene expression, are also provided (see European Patent No. 0 649 464 Bl, incoφorated by reference herein). In addition, organisms are provided in which the gene(s) corresponding to the polynucleotide sequences disclosed herein have been partially or completely inactivated, through insertion of extraneous sequences into the corresponding gene(s) or through deletion of all or part of the corresponding gene(s). Partial or complete gene inactivation can be accomplished through insertion, preferably followed by imprecise excision, of transposable elements (Plasterk, 1992, Bioessays 14(9): 629- 633; Zwaal et al, 1993, Proc. Natl. Acad. Sci. USA 90(16): 7431-7435; Clark et al, 1994, Proc. Natl. Acad. Sci. USA 91(2): 719-722; all of which are incoφorated by reference herein), or through homologous recombination, preferably detected by positive/negative genetic selection strategies (Mansour et al, 1988, Nature 336: 348- 352; U.S. Patent Nos. 5,464,764; 5,487,992; 5,627,059; 5,631,153; 5.614, 396; 5,616,491; and 5,679,523; all of which are incoφorated by reference herein). These organisms with altered gene expression are preferably eukaryotes and more preferably are mammals. Such organisms are useful for the development of non-human models for the study of disorders involving the corresponding gene(s), and for the development of assay systems for the identification of molecules that interact with the protein product(s) of the corresponding gene(s).

Where the protein of the present invention is membrane-bound (e.g., is a receptor), the present invention also provides for soluble forms of such protein. In such forms part or all of the intracellular and transmembrane domains of the protein are deleted such that the protein is fully secreted from the cell in which it is expressed. The intracellular and transmembrane domains of proteins of the invention can be identified in accordance with known techniques for determination of such domains from sequence information. For example, the TopPredll computer program can be used to predict the location of transmembrane domains in an amino acid sequence, domains which are described by the location of the center of the transmsmbrane domain, with at least ten transmembrane amino acids on each side of the reported central residue(s).

Proteins and protein fragments of the present invention include proteins with amino acid sequence lengths that are at least 25%(more preferably at least 50%, and most preferably at least 75%) of the length of a disclosed protein and have at least 60% sequence identity (more preferably, at least 75% identity; most preferably at least 90% or 95%o identity) with that disclosed protein, where sequence identity is determined by comparing the amino acid sequences of the proteins when aligned so as to maximize overlap and identity while minimizing sequence gaps. Also included in the present invention are proteins and protein fragments that contain a segment preferably comprising 8 or more (more preferably 20 or more, most preferably 30 or more) contiguous amino acids that shares at least 75% sequence identity (more preferably, at least 85%o identity; most preferably at least 95% identity) with any such segment of any of the disclosed proteins. In particular, sequence identity may be determined using WU-BLAST

(Washington University BLAST) version 2.0 software, which builds upon WU-BLAST version 1.4, which in turn is based on the public domain NCBI-BLAST version 1.4 (Altschul and Gish, 1996, Local alignment statistics, Doolittle ed., Methods in Enzymology 266: 460-480; Altschul et al, 1990, Basic local alignment search tool, Journal of Molecular Biology 215: 403-410; Gish and States, 1993, Identification of protein coding regions by database similarity search, Nature Genetics 3: 266-272; Karlin and Altschul, 1993, Applications and statistics for multiple high-scoring segments in molecular sequences, Proc. Natl. Acad. Sci. USA 90: 5873-5877; all of which are incoφorated by reference herein). WU-BLAST version 2.0 executable programs for several UNIX platforms can be downloaded from ftp://blast.wustl.edu blast/executables. The complete suite of search programs (BLASTP, BLASTN, BLASTX, TBLASTN, and TBLASTX) is provided at that site, in addition to several support programs. WU-BLAST 2.0 is copyrighted and may not be sold or redistributed in any form or manner without the express written consent of the author; but the posted executables may otherwise be freely used for commercial, nonprofit, or academic puφoses. In all search programs in the suite - BLASTP, BLASTN, BLASTX, TBLASTN and TBLASTX — the gapped alignment routines are integral to the database search itself, and thus yield much better sensitivity and selectivity while producing the more easily inteφreted output. Gapping can optionally be turned off in all of these programs, if desired. The default penalty (Q) for a gap of length one is Q=9 for proteins and

BLASTP, and Q=10 for BLASTN, but may be changed to any integer value including zero, one through eight, nine, ten, eleven, twelve through twenty, twenty-one through fifty, fifty-one through one hundred, etc. The default per-residue penalty for extending a gap (R) is R=2 for proteins and BLASTP, and R=10 for BLASTN, but may be changed to any integer value including zero, one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve through twenty, twenty-one through fifty, fifty-one through one hundred, etc. Any combination of values for Q and R can be used in order to align sequences so as to maximize overlap and identity while minimizing sequence gaps. The default amino acid comparison matrix is BLOSUM62, but other amino acid comparison matrices such as PAM can be utilized. Species homologues of the disclosed polynucleotides and proteins are also provided by the present invention. As used herein, a "species homologue" is a protein or polynucleotide with a different species of origin from that of a given protein or polynucleotide, but with significant sequence similarity to the given protein or polynucleotide. Preferably, polynucleotide species homologues have at least 60%> sequence identity (more preferably, at least 75% identity; most preferably at least 90% identity) with the given polynucleotide, and protein species homologues have at least 30%o sequence identity (more preferably, at least 45% identity; most preferably at least 60% identity) with the given protein, where sequence identity is determined by comparing the nucleotide sequences of the polynucleotides or the amino acid sequences of the proteins when aligned so as to maximize overlap and identity while minimizing sequence gaps. Species homologues may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from the desired species. Preferably, species homologues are those isolated from mammalian species. Most preferably, species homologues are those isolated from certain mammalian species such as, for example, Pan troglodytes, Gorilla gorilla,

Pongo pygmaeus, Hylobates concolor, Macaca mulatta, Papio papio, Papio hamadryas, Cercopithecus aethiops, Cebus capucinus, Aotus trivirgatus, Sanguinus oedipus, Microcebus murinus, Mus musculus, Rattus norvegicus, Cricetulus griseus, Felis catus, Mustela vison, Canis familiaris, Oryctolagus cuniculus, Bos taurus, Ovis aries, Sus scrofa, and Equus caballus, for which genetic maps have been created allowing the identification of syntenic relationships between the genomic organization of genes in one species and the genomic organization of the related genes in another species (O'Brien and Seuanez. 1988, Ann. Rev. Genet. 22: 323-351; O'Brien et al, 1993, Nature Genetics 3:103-112; Johansson et al, 1995, Genomics 25: 682-690; Lyons et al, 1997, Nature Genetics 15: 47-56; O'Brien et al, 1997, Trends in Genetics 13(10): 393-399; Carver and Stubbs, 1997, Genome Research 7:1123-1137; all of which are incoφorated by reference herein).

The invention also encompasses allelic variants of the disclosed polynucleotides or proteins; that is, naturally-occurring alternative forms of the isolated polynucleotides which also encode proteins which are identical or have significantly similar sequences to those encoded by the disclosed polynucleotides. Preferably, allelic variants have at least 60%) sequence identity' (more preferably, at least 75% identity; most preferably at least 90% identity) with the given polynucleotide, where sequence identity is determined by comparing the nucleotide sequences of the polynucleotides when aligned so as to maximize overlap and identity while minimizing sequence gaps. Allelic variants may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from individuals of the appropriate species.

The invention also includes polynucleotides with sequences complementary to those of the polynucleotides disclosed herein. Also provided are antisense polynucleotides. including molecules with "mixed-chemistry" backbones that may include other than ribonucleosidal chemical linkages; expression of antisense molecules directed to the polynucleotide sequences of chemokines of the present invention may inhibit expression of such chemokines. (See, for example, Alama et al, 1997, Antisense oligonucleotides as therapeutic agents, Pharmacol. Res. 36(3): 171-178, which is incoφorated by reference herein.)

The present invention also includes polynucleotides that hybridize under reduced stringency conditions, more preferably stringent conditions, and most preferably highly stringent conditions, to polynucleotides described herein. Examples of stringency conditions are shown in the table below: highly stringent conditions are those that are at least as stringent as, for example, conditions A-F; stringent conditions are at least as stringent as, for example, conditions G-L; and reduced stringency conditions are at least as stringent as. for example, conditions M-R.

+ The hybrid length is that anticipated for the hybridized regιon(s) of the hybridizing polynucleotides When hybridizing a polynucleotide to a target polynucleotide of unknown sequence, the hybrid length is assumed to be that of the hybridizing polynucleotide When polynucleotides of known sequence are hybridized, the hybrid length can be determined by aligning the sequences of the polynucleotides and identifying the region or regions of optimal sequence complementarity

⁺ SSPE ( lxSSPE is 0 15M NaCl, lOmM NaH₂P0₄, and 1 25mM EDTA. pH 7 4) can be substituted for SSC (lxSSC is 0 15M NaCl and 15mM sodium citrate) in the hybridization and wash buffers, washes are performed for 15 minutes after hybridization is complete *Tβ - TR The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5- 10°C less than the melting temperature (T_m) of the hybrid, where T_m is determined according to the following equations For hybrids less than 18 base pairs in length, T_m(°C) = 2(# of A + T bases) + 4(# of G + C bases) For hybrids between 18 and 49 base pairs m length, T_m(°C) = 81 5 + 16 6(log₁o[Na⁺]) + 0 41(%G+C) - (600/N), where N is the number of bases in the hybrid, and [Na⁺] is the concentration of sodium ions in the hybridization buffer ([Na+] for lxSSC = 0 165 M)

Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F.M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incoφorated herein by reference.

Preferably, each such hybridizing polynucleotide has a length that is at least 25%(more preferably at least 50%, and most preferably at least 75%) of the length of the polynucleotide of the present invention to which it hybridizes, and has at least 60%> sequence identity (more preferably, at least 75%> identity; most preferably at least 90%) or 95%o identity) with the polynucleotide of the present invention to which it hybridizes, where sequence identity is determined by comparing the sequences of the hybridizing polynucleotides when aligned so as to maximize overlap and identity while minimizing sequence gaps. The isolated polynucleotide of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al, Nucleic Acids Res. .19, 4485-4490 (1991), in order to produce the protein recombinantly. Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R. Kaufman, Methods in Enzymology 185, 537-566 (1990). As defined herein "operably linked" means that the isolated polynucleotide of the invention and an expression control sequence are situated within a vector or cell in such a way that the protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.

A number of types of cells may act as suitable host cells for expression of the protein. Mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CN-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK or Jurkat cells.

Alternatively, it may be possible to produce the protein in lower eukaryotes such as yeast or in prokaryotes such as bacteria. Potentially suitable yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any yeast strain capable of expressing heterologous proteins. Potentially suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins. If the protein is made in yeast or bacteria, it may be necessary to modify the protein produced therein, for example by phosphorylation or glycosylation of the appropriate sites, in order to obtain the functional protein. Such covalent attachments may be accomplished using known chemical or enzymatic methods.

The protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system. Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, California, U.S.A. (the MaxBac® kit), and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987), incoφorated herein by reference. As used herein, an insect cell capable of expressing a polynucleotide of the present invention is "transformed."

The protein of the invention may be prepared by culturing transformed host cells under culture conditions suitable to express the recombinant protein. The resulting expressed protein may then be purified from such culture (i.e., from culture medium or cell extracts) using known purification processes, such as gel filtration and ion exchange chromatography. The purification of the protein may also include an affinity column containing agents which will bind to the protein; one or more column steps over such affinity resins as concanavalin A-agarose, heparin-toyopearl® or Cibacrom blue 3GA Sepharose®; one or more steps involving hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or immunoaffinity chromatography.

Alternatively, the protein of the invention may also be expressed in a form which will facilitate purification. For example, it may be expressed as a fusion protein, such as those of maltose binding protein (MBP), glutathione-S-transferase (GST) or thioredoxin (TRX). Kits for expression and purification of such fusion proteins are commercially available from New England BioLabs (Beverly, MA), Pharmacia (Piscataway, NJ) and Invitrogen Coφoration (Carlsbad, CA), respectively. The protein can also be tagged with an epitope and subsequently purified by using a specific antibody directed to such epitope. One such epitope ("Flag") is commercially available from the Eastman Kodak Company (New Haven, CT).

Finally, one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the protein. Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a substantially homogeneous isolated recombinant protein. The protein thus purified is substantially free of other mammalian proteins and is defined in accordance with the present invention as an "isolated protein."

The protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a nucleotide sequence encoding the protein.

The protein may also be produced by known conventional chemical synthesis. Methods for constructing the proteins of the present invention by synthetic means are known to those skilled in the art. The synthetically-constructed protein sequences, by virtue of sharing primary, secondary or tertiary structural and or conformational characteristics with proteins may possess biological properties in common therewith, including protein activity. Thus, they may be employed as biologically active or immunological substitutes for natural, purified proteins in screening of therapeutic compounds and in immunological processes for the development of antibodies.

The proteins provided herein also include proteins characterized by amino acid sequences similar to those of purified proteins but into which modification are naturally provided or deliberately engineered. For example, modifications in the peptide or DNA sequences can be made by those skilled in the art using known techniques. Modifications of interest in the protein sequences may include the alteration, substitution, replacement, insertion or deletion of a selected amino acid residue in the coding sequence. For example, one or more of the cysteine residues may be deleted or replaced with another amino acid to alter the conformation of the molecule. Techniques for such alteration, substitution, replacement, insertion or deletion are well known to those skilled in the art (see, e.g., U.S. Patent No. 4,518,584). Preferably, such alteration, substitution, replacement, insertion or deletion retains the desired activity of the protein. Other fragments and derivatives of the sequences of proteins which would be expected to retain protein activity in whole or in part and may thus be useful for screening or other immunological methodologies may also be easily made by those skilled in the art given the disclosures herein. Such modifications are believed to be encompassed by the present invention. Also included in the present invention are nucleic acid aptamers and peptide aptamers that mimic the three-dimensional conformation of chemokines of the present invention. (See, for example, Ellington and Conrad, 1995, Aptamers as potential nucleic acid pharmaceuticals, Aptamers: Biotechnol Ann . Rev. 1: 185-214; Colas et al, 1996, Genetic selection of peptide aptamers that recognize and inhibit cyclin-dependent kinase-2. Nature 380(6574): 548-550; all of which are incoφorated by reference herein).

Such aptamers may inhibit the binding of endogenous chemokines to chemokine receptors, or have other effects upon chemokine receptor function. Other types of small organic or inorganic molecules that affect chemokine/chemokine receptor interaction, function, or expresion, and which may have advantages in ease of administration to a subject and in ease of uptake by target tissues or cells, are also included within the present invention. USES AND BIOLOGICAL ACTIVITY

The polynucleotides and proteins of the present invention are expected to exhibit one or more of the uses or biological activities (including those associated with assays cited herein) identified below. Uses or activities described for proteins of the present invention may be provided by administration or use of such proteins or by administration or use of polynucleotides encoding such proteins (such as, for example, in gene therapies or vectors suitable for introduction of DNA).

Research Uses and Utilities

The polynucleotides provided by the present invention can be used by the research community for various puφoses. The polynucleotides can be used to express recombinant protein for analysis, characterization or therapeutic use: as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in disease states); as molecular weight markers on Southern gels; as chromosome markers or tags (when labeled) to identify chromosomes or to map related gene positions; to compare with endogenous DNA sequences in patients to identify potential genetic disorders; as probes to hybridize and thus discover novel, related DNA sequences; as a source of information to derive PCR primers for genetic fingeφrinting; as a probe to

"subtract-out" known sequences in the process of discovering other novel polynucleotides; for selecting and making oligomers for attachment to a "gene chip" or other support, including for examination of expression patterns; to raise anti-protein antibodies using DNA immunization techniques; and as an antigen to raise anti-DNA antibodies or elicit another immune response. Where the polynucleotide encodes a protein which binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the polynucleotide can also be used in interaction trap assays (such as. for example, those described in Gyuris et al, 1993, Cell 75: 791-803 and in Rossi et al, 1997, Proc. Natl. Acad. Sci. USA 94: 8405-8410, all of which are incoφorated by reference herein) to identify polynucleotides encoding the other protein with which binding occurs or to identify inhibitors of the binding interaction. The proteins provided by the present invention can similarly be used in assay to determine biological activity, including in a panel of multiple proteins for high- throughput screening; to raise antibodies or to elicit another immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its receptor) in biological fluids; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); and, of course, to isolate correlative receptors or ligands. Where the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction. Proteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction.

Any or all of these research utilities are capable of being developed into reagent grade or kit format for commercialization as research products.

Methods for performing the uses listed above are well known to those skilled in the art. References disclosing such methods include without limitation "Molecular Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E.F. Fritsch and T. Maniatis eds., 1989, and "Methods in Enzymology: Guide to Molecular Cloning Techniques", Academic Press, Berger, S.L. and A.R. Kimmel eds., 1987.

Nutritional Uses

Polynucleotides and proteins of the present invention can also be used as nutritional sources or supplements. Such uses include without limitation use as a protein or amino acid supplement, use as a carbon source, use as a nitrogen source and use as a source of carbohydrate. In such cases the protein or polynucleotide of the invention can be added to the feed of a particular organism or can be administered as a separate solid or liquid preparation, such as in the form of powder, pills, solutions, suspensions or capsules. In the case of microorganisms, the protein or polynucleotide of the invention can be added to the medium in or on which the microorganism is cultured. Cytokine and Cell Proliferation/Differentiation Activity

A protein of the present invention may exhibit cytokine, cell proliferation (either inducing or inhibiting) or cell differentiation (either inducing or inhibiting) activity or may induce production of other cytokines in certain cell populations. Many protein factors discovered to date, including all known cytokines, have exhibited activity in one or more factor dependent cell proliferation assays, and hence the assays serve as a convenient confirmation of cytokine activity. The activity of a protein of the present invention is evidenced by any one of a number of routine factor dependent cell proliferation assays for cell lines including, without limitation, 32D, DA2, DAIG, TIO, B9, B9/11, BaF3, MC9/G, M+ (preB M+), 2E8, RB5, DAI, 123, T1165, HT2, CTLL2, TF-1 , Mo7e and CMK. The activity of a protein of the invention may, among other means, be measured by the following methods:

Assays for T-cell or thymocyte proliferation include without limitation those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1- 3.19; Chapter 7. Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500. 1986; Bertagnolli et al., J. Immunol. 145:1706-1712, 1990; Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Bertagnolli, et al., J. Immunol. 149:3778-3783. 1992; Bowman et al.N. Immunol. 152: 1756-1761, 1994.

Assays for cytokine production and/or proliferation of spleen cells, lymph node cells or thymocytes include, without limitation, those described in: Polyclonal T cell stimulation, Kruisbeek, A.M. and Shevach, E.M. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John Wiley and Sons, Toronto. 1994; and Measurement of mouse and human Interferon γ, Schreiber, R.D. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and Sons, Toronto. 1994.

Assays for proliferation and differentiation of hematopoietic and lymphopoietic cells include, without limitation, those described in: Measurement of Human and Murine Interleukin 2 and Interleukin 4, Bottomly, K., Davis, L.S. and Lipsky, P.E. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.3.1-6.3.12. John Wiley and Sons, Toronto. 1991; deVries et al., J. Exp. Med. 173:1205-1211, 1991; Moreau et al., Nature 336:690-692, 1988; Greenberger et al, Proc. Natl. Acad. Sci. U.S.A. 80:2931-2938, 1983; Measurement of mouse and human interleukin 6 - Nordan, R. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.6.1-6.6.5, John Wiley and Sons. Toronto. 1991 ; Smith et al, Proc. Natl. Acad. Sci. U.S.A. 83:1857-1861, 1986; Measurement of human Interleukin 11 - Bennett. F., Giannotti, J., Clark, S.C. and Turner. K. J. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.15.1 John Wiley and Sons, Toronto. 1991; Measurement of mouse and human Interleukin 9 - Ciarletta, A., Giannotti, J., Clark, S.C. and Turner, K.J. In

Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.13.1, John Wiley and Sons, Toronto. 1991.

Assays for T-cell clone responses to antigens (which will identify, among others, proteins that affect APC-T cell interactions as well as direct T-cell effects by measuring proliferation and cytokine production) include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley- Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter 6, Cytokines and their cellular receptors; Chapter 7, Immunologic studies in Humans); Weinberger et al, Proc. Natl. Acad. Sci. USA 77:6091-6095, 1980; Weinberger et al.,

Eur. J. Immun. 11 :405-411, 1981; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-512, 1988.

Immune Stimulating or Suppressing Activity A protein of the present invention may also exhibit immune stimulating or immune suppressing activity, including without limitation the activities for which assays are described herein. A protein may be useful in the treatment of various immune deficiencies and disorders (including severe combined immunodeficiency (SCID)), e.g., in regulating (up or down) growth and proliferation of T and/or B lymphocytes, as well as effecting the cytolytic activity of NK cells and other cell populations. These immune deficiencies may be genetic or be caused by viral (e.g., HIV) as well as bacterial or fungal infections, or may result from autoimmune disorders. More specifically, infectious diseases causes by viral, bacterial, fungal or other infection may be treatable using a protein of the present invention, including infections by HIV. hepatitis viruses, heφesviruses, mycobacteria, Leishmania spp., malaria spp. and various fungal infections such as candidiasis. Of course, in this regard, a protein of the present invention may also be useful where a boost to the immune system generally may be desirable, i.e., in the treatment of cancer.

Autoimmune disorders which may be treated using a protein of the present invention include, for example, connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation,

Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes mellitis, myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye disease. Such a protein of the present invention may also to be useful in the treatment of allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems. Other conditions, in which immune suppression is desired

(including, for example, organ transplantation), may also be treatable using a protein of the present invention.

Using the proteins of the invention it may also be possible to immune responses, in a number of ways. Down regulation may be in the form of inhibiting or blocking an immune response already in progress or may involve preventing the induction of an immune response. The functions of activated T cells may be inhibited by suppressing T cell responses or by inducing specific tolerance in T cells, or both. Immunosuppression of T cell responses is generally an active, non-antigen-specific, process which requires continuous exposure of the T cells to the suppressive agent. Tolerance, which involves inducing non-responsiveness or anergy in T cells, is distinguishable from immunosuppression in that it is generally antigen-specific and persists after exposure to the tolerizing agent has ceased. Operationally, tolerance can be demonstrated by the lack of a T cell response upon reexposure to specific antigen in the absence of the tolerizing agent. Down regulating or preventing one or more antigen functions (including without limitation B lymphocyte antigen functions (such as , for example, B7)), e.g., preventing high level lymphokine synthesis by activated T cells, will be useful in situations of tissue, skin and organ transplantation and in graft-versus-host disease (GVHD). For example, blockage of T cell function should result in reduced tissue destruction in tissue transplantation. Typically, in tissue transplants, rejection of the transplant is initiated through its recognition as foreign by T cells, followed by an immune reaction that destroys the transplant. The administration of a molecule which inhibits or blocks interaction of a B7 lymphocyte antigen with its natural ligand(s) on immune cells (such as a soluble, monomeric form of a peptide having B7-2 activity alone or in conjunction with a monomeric form of a peptide having an activity of another B lymphocyte antigen (e.g., B7-1, B7-3) or blocking antibody), prior to transplantation can lead to the binding of the molecule to the natural ligand(s) on the immune cells without transmitting the corresponding costimulatory signal. Blocking B lymphocyte antigen function in this matter prevents cytokine synthesis by immune cells, such as T cells, and thus acts as an immunosuppressant. Moreover, the lack of costimulation may also be sufficient to anergize the T cells, thereby inducing tolerance in a subject. Induction of long-term tolerance by B lymphocyte antigen-blocking reagents may avoid the necessity of repeated administration of these blocking reagents. To achieve sufficient immunosuppression or tolerance in a subject, it may also be necessary to block the function of a combination of B lymphocyte antigens.

The efficacy of particular blocking reagents in preventing organ transplant rejection or GVHD can be assessed using animal models that are predictive of efficacy in humans. Examples of appropriate systems which can be used include allogeneic cardiac grafts in rats and xenogeneic pancreatic islet cell grafts in mice, both of which have been used to examine the immunosuppressive effects of CTLA4Ig fusion proteins in vivo as described in Lenschow et al, Science 257:789-792 (1992) and Turka et al, Proc. Natl. Acad. Sci USA, 89: X 1102-11105 (1992). In addition, murine models of GVHD (see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 846-847) can be used to determine the effect of blocking B lymphocyte antigen function in vivo on the development of that disease. Blocking antigen function may also be therapeutically useful for treating autoimmune diseases. Many autoimmune disorders are the result of inappropriate activation of T cells that are reactive against self tissue and which promote the production of cytokines and autoantibodies involved in the pathology of the diseases. Preventing the activation of autoreactive T cells may reduce or eliminate disease symptoms. Administration of reagents which block costimulation of T cells by disrupting receptor: ligand interactions of B lymphocyte antigens can be used to inhibit T cell activation and prevent production of autoantibodies or T cell-derived cytokines which may be involved in the disease process. Additionally, blocking reagents may induce antigen-specific tolerance of autoreactive T cells which could lead to long-term relief from the disease. The efficacy of blocking reagents in preventing or alleviating autoimmune disorders can be determined using a number of well-characterized animal models of human autoimmune diseases. Examples include murine experimental autoimmune encephalitis, systemic lupus erythmatosis in MRLIlpr/lpr mice or NZB hybrid mice, murine autoimmune collagen arthritis, diabetes mellitus in NOD mice and BB rats, and murine experimental myasthenia gravis (see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 840-856).

Upregulation of an antigen function (preferably a B lymphocyte antigen function), as a means of up regulating immune responses, may also be useful in therapy. Upregulation of immune responses may be in the form of enhancing an existing immune response or eliciting an initial immune response. For example, enhancing an immune response through stimulating B lymphocyte antigen function may be useful in cases of viral infection. In addition, systemic viral diseases such as influenza, the common cold, and encephalitis might be alleviated by the administration of stimulatory forms of B lymphocyte antigens systemically.

Alternatively, anti-viral immune responses may be enhanced in an infected patient by removing T cells from the patient, costimulating the T cells in vitro with viral antigen-pulsed APCs either expressing a peptide of the present invention or together with a stimulatory form of a soluble peptide of the present invention and reintroducing the in vitro activated T cells into the patient. Another method of enhancing anti-viral immune responses would be to isolate infected cells from a patient, transfect them with a nucleic acid encoding a protein of the present invention as described herein such that the cells express all or a portion of the protein on their surface, and reintroduce the transfected cells into the patient. The infected cells would now be capable of delivering a costimulatory signal to. and thereby activate, T cells in vivo. In another application, up regulation or enhancement of antigen function

(preferably B lymphocyte antigen function) may be useful in the induction of tumor immunity. Tumor cells (e.g., sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, carcinoma) transfected with a nucleic acid encoding at least one peptide of the present invention can be administered to a subject to overcome tumor-specific tolerance in the subject. If desired, the tumor cell can be transfected to express a combination of peptides. For example, tumor cells obtained from a patient can be transfected ex vivo with an expression vector directing the expression of a peptide having B7-2-like activity alone, or in conjunction with a peptide having B7-l-like activity and/or B7-3-like activity. The transfected tumor cells are returned to the patient to result in expression of the peptides on the surface of the transfected cell. Alternatively, gene therapy techniques can be used to target a tumor cell for transfection in vivo.

The presence of the peptide of the present invention having the activity of a B lymphocyte antigen(s) on the surface of the tumor cell provides the necessary costimulation signal to T cells to induce a T cell mediated immune response against the transfected tumor cells. In addition, tumor cells which lack MHC class I or MHC class

II molecules, or which fail to reexpress sufficient amounts of MHC class I or MHC class II molecules, can be transfected with nucleic acid encoding all or a portion of (e.g., a cytoplasmic-domain truncated portion) of an MHC class I α chain protein and β₂ microglobulin protein or an MHC class II α chain protein and an MHC class II β chain protein to thereby express MHC class I or MHC class II proteins on the cell surface. Expression of the appropriate class I or class II MHC in conjunction with a peptide having the activity of a B lymphocyte antigen (e.g., B7-1, B7-2, B7-3) induces a T cell mediated immune response against the transfected tumor cell. Optionally, a gene encoding an antisense construct which blocks expression of an MHC class II associated protein, such as the invariant chain, can also be cotransfected with a DNA encoding a peptide having the activity of a B lymphocyte antigen to promote presentation of tumor associated antigens and induce tumor specific immunity. Thus, the induction of a T cell mediated immune response in a human subject may be sufficient to overcome tumor- specific tolerance in the subject.

The activity of a protein of the invention may, among other means, be measured by the following methods:

Suitable assays for thymocyte or splenocyte cytotoxicity include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Herrmann et al., Proc. Natl. Acad. Sci. USA 78:2488-2492, 1981 ; Herrmann et al., J. Immunol. 128:1968-1974, 1982; Handa et al., Immunol. 135:1564-1572, 1985; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-512, 1988; Herrmann et al., Proc. Natl. Acad. Sci. USA 78:2488-2492, 1981; Herrmann et al., J. Immunol. 128:1968-1974, 1982; Handa et al., J. Immunol. 135:1564-1572, 1985; Takai et al., J. Immunol. 137:3494-3500, 1986; Bowmanet al., J. Virology 61 :1992-1998; Takai et al., J. Immunol. 140:508-512, 1988; Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Brown et al., J. Immunol. 153:3079-3092, 1994.

Assays for T-cell-dependent immunoglobulin responses and isotype switching (which will identify, among others, proteins that modulate T-cell dependent antibody responses and that affect Thl/Th2 profiles) include, without limitation, those described in: Maliszewski, J. Immunol. 144:3028-3033, 1990; and Assays for B cell function: In vitro antibody production, Mond, J.J. and Brunswick, M. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 3.8.1-3.8.16, John Wiley and Sons, Toronto. 1994.

Mixed lymphocyte reaction (MLR) assays (which will identify, among others, proteins that generate predominantly Thl and CTL responses) include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek. D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3. In Vitro assays for Mouse Lymphocyte

Function 3.1-3.19; Chapter 7. Immunologic studies in Humans); Takai et al.. J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-512, 1988; Bertagnolli et al., J. Immunol. 149:3778-3783, 1992.

Dendritic cell-dependent assays (which will identify, among others, proteins expressed by dendritic cells that activate naive T-cells) include, without limitation, those described in: Guery et al.. J. Immunol. 134:536-544, 1995; Inaba et al., Journal of Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal of Immunology 154:5071-5079, 1995; Porgador et al., Journal of Experimental Medicine 182:255-260, 1995; Nair et al., Journal of Virology 67:4062-4069, 1993; Huang et al., Science 264:961-965, 1994; Macatonia et al., Journal of Experimental Medicine 169:1255-1264, 1989; Bhardwaj et al., Journal of Clinical Investigation 94:797-807, 1994; and Inaba et al., Journal of Experimental Medicine 172:631 -640, 1990.

Assays for lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in: Darzynkiewicz et al., Cytometry 13:795-808, 1992; Gorczyca et al., Leukemia 7:659-670, 1993; Gorczyca et al., Cancer Research 53:1945-1951, 1993; Itoh et al., Cell 66:233-243, 1991; Zacharchuk, Journal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry 14:891-897, 1993; Gorczyca et al., International Journal of Oncology 1 :639-648, 1992. Assays for proteins that influence early steps of T-cell commitment and development include, without limitation, those described in: Antica et al., Blood 84:111-117, 1994; Fine et al., Cellular Immunology 155:111-122, 1994; Galy et al., Blood 85:2770-2778, 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551, 1991.

Hematopoiesis Regulating Activity

A protein of the present invention may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies. Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g. in supporting the growth and proliferation of erythroid progenitor cells alone or in combination with other cytokines, thereby indicating utility, for example, in treating various anemias or for use in conjunction with irradiation chemotherapy to stimulate the production of erythroid precursors and/or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent myelo-suppression; in supporting the growth and proliferation of megakaryocytes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocytopenia, and generally for use in place of or complimentary to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and all of the above- mentioned hematopoietic cells and therefore find therapeutic utility in various stem cell disorders (such as those usually treated with transplantation, including, without limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria), as well as in repopulating the stem cell compartment post irradiation chemotherapy, either in-vivo or ex-vivo (i.e., in conjunction with bone marrow transplantation or with peripheral progenitor cell transplantation (homologous or heterologous)) as normal cells or genetically manipulated for gene therapy.

Suitable assays for proliferation and differentiation of various hematopoietic lines are cited above.

Assays for embryonic stem cell differentiation (which will identify, among others, proteins that influence embryonic differentiation hematopoiesis) include, without limitation, those described in: Johansson et al. Cellular Biology 15:141-151, 1995; Keller et al., Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al., Blood 81:2903-2915, 1993.

Assays for stem cell survival and differentiation (which will identify, among others, proteins that regulate lympho-hematopoiesis) include, without limitation, those described in: Methylcellulose colony forming assays, Freshney, M.G. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 265-268, Wiley-Liss, Inc., New York, NY. 1994; Hirayama et al., Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992;

Primitive hematopoietic colony forming cells with high proliferative potential, McNiece, LK. and Briddell. R.A. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 23-39, Wiley-Liss. Inc., New York, NY. 1994; Neben et al, Experimental Hematology 22:353-359, 1994; Cobblestone area forming cell assay. Ploemacher, R.E. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 1-21, Wiley-Liss, Inc., New York, NY. 1994; Long term bone marrow cultures in the presence of stromal cells, Spooncer, E., Dexter, M. and Allen, T. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 163-179, Wiley-Liss, Inc., New York, NY. 1994; Long term culture initiating cell assay, Sutherland, H.J. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 139-162, Wiley-Liss, Inc., New York, NY. 1994.

Tissue Growth Activity

A protein of the present invention also may have utility in compositions used for bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration, as well as for wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers.

A protein of the present invention, which induces cartilage and/or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals. Such a preparation employing a protein of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.

A protein of this invention may also be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells. A protein of the invention may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes. Another category of tissue regeneration activity that may be attributable to the protein of the present invention is tendon/ligament formation. A protein of the present invention, which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and other animals. Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue. De novo tendon/ligament-like tissue formation induced by a composition of the present invention contributes to the repair of congenital, trauma induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments. The compositions of the present invention may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament- forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair. The compositions of the invention may also be useful in the treatment of tendinitis, caφal tunnel syndrome and other tendon or ligament defects. The compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.

The protein of the present invention may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i.e. for the treatment of central and peripheral nervous system diseases and neuropathies, as well as mechanical and traumatic disorders, which involve degeneration, death or trauma to neural cells or nerve tissue. More specifically, a protein may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further conditions which may be treated in accordance with the present invention include mechanical and traumatic disorders, such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using a protein of the invention.

Proteins of the invention may also be useful to promote better or faster closure of non-healing wounds, including without limitation pressure ulcers, ulcers associated with vascular insufficiency, surgical and traumatic wounds, and the like.

It is expected that a protein of the present invention may also exhibit activity for generation or regeneration of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac) and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues. Part of the desired effects may be by inhibition or modulation of fibrotic scarring to allow normal tissue to regenerate. A protein of the invention may also exhibit angiogenic activity.

A protein of the present invention may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage.

A protein of the present invention may also be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells; or for inhibiting the growth of tissues described above.

Assays for tissue generation activity include, without limitation, those described in: International Patent Publication No. WO95/16035 (bone, cartilage, tendon); International Patent Publication No. WO95/05846 (nerve, neuronal); International Patent Publication No. WO91/07491 (skin, endothelium ). Assays for wound healing activity include, without limitation, those described in:

Winter, Epidermal Wound Healing, pps. 71-112 (Maibach, HI and Rovee, DT, eds.), Year Book Medical Publishers, Inc., Chicago, as modified by Eaglstein and Mertz, J. Invest. Dermatol 71 :382-84 (1978). Activin Inhibin Activity

A protein of the present invention may also exhibit activin- or inhibin-related activities. Inhibins are characterized by their ability to inhibit the release of follicle stimulating hormone (FSH), while activins and are characterized by their ability to stimulate the release of follicle stimulating hormone (FSH). Thus, a protein of the present invention, alone or in heterodimers with a member of the inhibin α family, may be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in these mammals. Alternatively, the protein of the invention, as a homodimer or as a heterodimer with other protein subunits of the inhibin-β group, may be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary. See, for example, United States Patent 4,798,885. A protein of the invention may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as cows, sheep and pigs.

Assays for activin/inhibin activity include, without limitation, those described in: Vale et al., Endocrinology 91:562-572, 1972; Ling et al., Nature 321:779-782, 1986;

Vale et al., Nature 321:116-119, 1986; Mason et al., Nature 318:659-663, 1985; Forage et al., Proc. Natl. Acad. Sci. USA 83:3091-3095, 1986.

Hemostatic and Thrombolytic Activity A protein of the invention may also exhibit hemostatic or thrombolytic activity.

As a result, such a protein is expected to be useful in treatment of various coagulation disorders (including hereditary disorders, such as hemophilias) or to enhance coagulation and other hemostatic events in treating wounds resulting from trauma, surgery or other causes. A protein of the invention may also be useful for dissolving or inhibiting formation of thromboses and for treatment and prevention of conditions resulting therefrom (such as, for example, infarction of cardiac and central nervous system vessels (e.g., stroke).

The activity of a protein of the invention may, among other means, be measured by the following methods: Assay for hemostatic and thrombolytic activity include, without limitation, those described in: Linet et al., J. Clin. Pharmacol. 26:131-140, 1986; Burdick et al., Thrombosis Res. 45:413-419, 1987; Humphrey et al., Fibrinolysis 5:71-79 (1991); Schaub, Prostaglandins 35:467-474, 1988.

Receptor/Ligand Activity

A protein of the present invention may also demonstrate activity as receptors, receptor ligands or inhibitors or agonists of receptor/ligand interactions. Examples of such receptors and ligands include, without limitation, cytokine receptors and their ligands, receptor kinases and their ligands, receptor phosphatases and their ligands, receptors involved in cell-cell interactions and their ligands (including without limitation, cellular adhesion molecules (such as selectins, integrins and their ligands) and receptor/ligand pairs involved in antigen presentation, antigen recognition and development of cellular and humoral immune responses). Receptors and ligands are also useful for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. A protein of the present invention (including, without limitation, fragments of receptors and ligands) may themselves be useful as inhibitors of receptor/ligand interactions.

The activity of a protein of the invention may, among other means, be measured by the following methods: Suitable assays for receptor-ligand activity include without limitation those described in: Current Protocols in Immunology, Ed by J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W.Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 7.28, Measurement of Cellular Adhesion under static conditions 7.28.1-7.28.22), Takai et al., Proc. Natl. Acad. Sci. USA 84:6864-6868, 1987; Bierer et al., J. Exp. Med. 168:1 145-1156, 1988; Rosenstein et al., J. Exp. Med. 169:149-160 1989; Stoltenborg et al., J. Immunol. Methods 175:59-68, 1994; Stitt et al., Cell 80:661-670, 1995.

Anti-Inflammatory Activity Proteins of the present invention may also exhibit anti-inflammatory activity.

The anti-inflammatory activity may be achieved by providing a stimulus to cells involved in the inflammatory response, by inhibiting or promoting cell-cell interactions (such as, for example, cell adhesion), by inhibiting or promoting chemotaxis of cells involved in the inflammatory process, inhibiting or promoting cell extravasation, or by stimulating or suppressing production of other factors which more directly inhibit or promote an inflammatory response. Proteins exhibiting such activities can be used to treat inflammatory conditions including chronic or acute conditions), including without limitation inflammation associated with infection (such as septic shock, sepsis or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or resulting from over production of cytokines such as TNF or IL-1. Proteins of the invention may also be useful to treat anaphylaxis and hypersensitivity to an antigenic substance or material.

Cadherin/Tumor Invasion Suppressor Activity

Cadherins are calcium-dependent adhesion molecules that appear to play major roles during development, particularly in defining specific cell types. Loss or alteration of normal cadherin expression can lead to changes in cell adhesion properties linked to tumor growth and metastasis. Cadherin malfunction is also implicated in other human diseases, such as pemphigus vulgaris and pemphigus foliaceus (auto-immune blistering skin diseases), Crohn's disease, and some developmental abnormalities.

The cadherin superfamily includes well over forty members, each with a distinct pattern of expression. All members of the superfamily have in common conserved extracellular repeats (cadherin domains), but structural differences are found in other parts of the molecule. The cadherin domains bind calcium to form their tertiary structure and thus calcium is required to mediate their adhesion. Only a few amino acids in the first cadherin domain provide the basis for homophilic adhesion; modification of this recognition site can change the specificity of a cadherin so that instead of recognizing only itself, the mutant molecule can now also bind to a different cadherin. In addition, some cadherins engage in heterophilic adhesion with other cadherins.

E-cadherin, one member of the cadherin superfamily, is expressed in epithelial cell types. Pathologically, if E-cadherin expression is lost in a tumor, the malignant cells become invasive and the cancer metastasizes. Transfection of cancer cell lines with polynucleotides expressing E-cadherin has reversed cancer-associated changes by returning altered cell shapes to normal, restoring cells' adhesiveness to each other and to their substrate, decreasing the cell growth rate, and drastically reducing anchorage- independent cell growth. Thus, reintroducing E-cadherin expression reverts carcinomas to a less advanced stage. It is likely that other cadherins have the same invasion suppressor role in carcinomas derived from other tissue types. Therefore, proteins of the present invention with cadherin activity, and polynucleotides of the present invention encoding such proteins, can be used to treat cancer. Introducing such proteins or polynucleotides into cancer cells can reduce or eliminate the cancerous changes observed in these cells by providing normal cadherin expression.

Cancer cells have also been shown to express cadherins of a different tissue type than their origin, thus allowing these cells to invade and metastasize in a different tissue in the body. Proteins of the present invention with cadherin activity, and polynucleotides of the present invention encoding such proteins, can be substituted in these cells for the inappropriately expressed cadherins, restoring normal cell adhesive properties and reducing or eliminating the tendency of the cells to metastasize. Additionally, proteins of the present invention with cadherin activity, and polynucleotides of the present invention encoding such proteins, can used to generate antibodies recognizing and binding to cadherins. Such antibodies can be used to block the adhesion of inappropriately expressed tumor-cell cadherins. preventing the cells from forming a tumor elsewhere. Such an anti-cadherin antibody can also be used as a marker for the grade, pathological type, and prognosis of a cancer, i.e. the more progressed the cancer, the less cadherin expression there will be, and this decrease in cadherin expression can be detected by the use of a cadherin-binding antibody.

Fragments of proteins of the present invention with cadherin activity, preferably a polypeptide comprising a decapeptide of the cadherin recognition site, and poly- nucleotides of the present invention encoding such protein fragments, can also be used to block cadherin function by binding to cadherins and preventing them from binding in ways that produce undesirable effects. Additionally, fragments of proteins of the present invention with cadherin activity, preferably truncated soluble cadherin fragments which have been found to be stable in the circulation of cancer patients, and polynucleotides encoding such protein fragments, can be used to disturb proper cell-cell adhesion.

Assays for cadherin adhesive and invasive suppressor activity include, without limitation, those described in: Hortsch et al. J Biol Chem 270 (32): 18809-18817, 1995; Miyaki et al. Oncogene 1 1: 2547-2552, 1995; Ozawa et al. Cell 63: 1033-1038, 1990.

Tumor Inhibition Activity

In addition to the activities described above for immunological treatment or prevention of tumors, a protein of the invention may exhibit other anti -tumor activities. A protein may inhibit tumor growth directly or indirectly (such as, for example, via ADCC). A protein may exhibit its tumor inhibitory activity by acting on rumor tissue or tumor precursor tissue, by inhibiting formation of tissues necessary to support tumor growth (such as. for example, by inhibiting angiogenesis), by causing production of other factors, agents or cell types which inhibit tumor growth, or by suppressing, eliminating or inhibiting factors, agents or cell types which promote tumor growth.

Other Activities

A protein of the invention may also exhibit one or more of the following additional activities or effects: inhibiting the growth, infection or function of, or killing, infectious agents, including, without limitation, bacteria, viruses, fungi and other parasites; effecting (suppressing or enhancing) bodily characteristics, including, without limitation, height, weight, hair color, eye color, skin, fat to lean ratio or other tissue pigmentation, or organ or body part size or shape (such as, for example, breast augmentation or diminution, change in bone form or shape); effecting biorhythms or caricadic cycles or rhythms; effecting the fertility of male or female subjects; effecting the metabolism, catabolism, anabolism, processing, utilization, storage or elimination of dietary fat, lipid, protein, carbohydrate, vitamins, minerals, cofactors or other nutritional factors or component(s); effecting behavioral characteristics, including, without limitation, appetite, libido, stress, cognition (including cognitive disorders), depression (including depressive disorders) and violent behaviors; providing analgesic effects or other pain reducing effects; promoting differentiation and growth of embryonic stem cells in lineages other than hematopoietic lineages; hormonal or endocrine activity; in the case of enzymes, correcting deficiencies of the enzyme and treating deficiency- related diseases: treatment of hypeφroliferative disorders (such as. for example, psoriasis); immunoglobulin-like activity (such as, for example, the ability to bind antigens or complement); and the ability to act as an antigen in a vaccine composition to raise an immune response against such protein or another material or entity which is cross-reactive with such protein.

ADMINISTRATION AND DOSING

A protein of the present invention (from whatever source derived, including without limitation from recombinant and non-recombinant sources) may be used in a pharmaceutical composition when combined with a pharmaceutically acceptable carrier. Such a composition may also contain (in addition to protein and a carrier) diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration. The pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, TNF, IL-1. IL-2, IL-3, IL-4, IL-5, IL-6, IL-7. IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15. IFN, TNFO, TNF1, TNF2, G-CSF, Meg-CSF, thrombopoietin, stem cell factor, and erythropoietin. The pharmaceutical composition may further contain other agents which either enhance the activity of the protein or compliment its activity or use in treatment. Such additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with protein of the invention, or to minimize side effects. Conversely, protein of the present invention may be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.

A protein of the present invention may be active in multimers (e.g., heterodimers or homodimers) or complexes with itself or other proteins. As a result, pharmaceutical compositions of the invention may comprise a protein of the invention in such multimeric or complexed form.

The pharmaceutical composition of the invention may be in the form of a complex of the protein(s) of present invention along with protein or peptide antigens. The protein and/or peptide antigen will deliver a stimulatory signal to both B and T lymphocytes. B lymphocytes will respond to antigen through their surface immunoglobulin receptor. T lymphocytes will respond to antigen through the T cell receptor (TCR) following presentation of the antigen by MHC proteins. MHC and structurally related proteins including those encoded by class I and class II MHC genes on host cells will serve to present the peptide antigen(s) to T lymphocytes. The antigen components could also be supplied as purified MHC-peptide complexes alone or with co-stimulatory molecules that can directly signal T cells. Alternatively antibodies able to bind surface immunolgobulin and other molecules on B cells as well as antibodies able to bind the TCR and other molecules on T cells can be combined with the pharmaceutical composition of the invention. The pharmaceutical composition of the invention may be in the form of a liposome in which protein of the present invention is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin. phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No. 4,501,728; U.S. Patent No. 4,837,028; and U.S. Patent No. 4,737,323, all of which are incoφorated herein by reference.

As used herein, the term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.

In practicing the method of treatment or use of the present invention, a therapeutically effective amount of protein of the present invention is administered to a mammal having a condition to be treated. Protein of the present invention may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors. When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, protein of the present invention may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering protein of the present invention in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti- thrombotic factors.

Administration of protein of the present invention used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, topical application or cutaneous, subcutaneous, intraperitoneal, parenteral or intravenous injection. Intravenous administration to the patient is preferred. When a therapeutically effective amount of protein of the present invention is administered orally, protein of the present invention will be in the form of a tablet, capsule, powder, solution or elixir. When administered in tablet form, the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant. The tablet, capsule, and powder contain from about 5 to 95%> protein of the present invention, and preferably from about 25 to 90% protein of the present invention. When administered in liquid form, a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added. The liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. When administered in liquid form, the pharmaceutical composition contains from about 0.5 to 90% by weight of protein of the present invention, and preferably from about 1 to 50% protein of the present invention. When a therapeutically effective amount of protein of the present invention is administered by intravenous, cutaneous or subcutaneous injection, protein of the present invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such parenterally acceptable protein solutions, having due regard to pH, isotonicity. stability, and the like, is within the skill in the art. A preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to protein of the present invention, an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art. The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.

The amount of protein of the present invention in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of protein of the present invention with which to treat each individual patient. Initially, the attending physician will administer low doses of protein of the present invention and observe the patient's response. Larger doses of protein of the present invention may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.01 μg to about 100 mg (preferably about O.lng to about 10 mg, more preferably about 0.1 μg to about 1 mg) of protein of the present invention per kg body weight.

The duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the protein of the present invention will be in the range of 12 to 24 hours of continuous intravenous administration. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention. Protein of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the protein. Such antibodies may be obtained using either the entire protein or fragments thereof as an immunogen. The peptide immunogens additionally may contain a cysteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Methods for synthesizing such peptides are known in the art, for example, as in R.P. Merrifield, J. Amer.Chem.Soc. 85, 2149-2154 (1963); J.L. Krstenansky, et al, FEBS Lett. 2U, 10 (1987). Monoclonal antibodies binding to the protein of the invention may be useful diagnostic agents for the immunodetection of the protein. Neutralizing monoclonal antibodies binding to the protein may also be useful therapeutics for both conditions associated with the protein and also in the treatment of some forms of cancer where abnormal expression of the protein is involved. In the case of cancerous cells or leukemic cells, neutralizing monoclonal antibodies against the protein may be useful in detecting and preventing the metastatic spread of the cancerous cells, which may be mediated by the protein. For compositions of the present invention which are useful for bone, cartilage, tendon or ligament regeneration, the therapeutic method includes administering the composition topically, systematically, or locally as an implant or device. When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or tissue damage. Topical administration may be suitable for wound healing and tissue repair. Therapeutically useful agents other than a protein of the invention which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the composition in the methods of the invention. Preferably for bone and/or cartilage formation, the composition would include a matrix capable of delivering the protein-containing composition to the site of bone and/or cartilage damage, providing a structure for the developing bone and cartilage and optimally capable of being resorbed into the body. Such matrices may be formed of materials presently in use for other implanted medical applications.

The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular application of the compositions will define the appropriate formulation. Potential matrices for the compositions may be biodegradable and chemically defined calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid, polyglycolic acid and polyanhydrides. Other potential materials are biodegradable and biologically well- defined, such as bone or dermal collagen. Further matrices are comprised of pure proteins or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxapatite, bioglass, aluminates, or other ceramics. Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalciumphosphate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability. Presently preferred is a 50:50 (mole weight) copolymer of lactic acid and glycolic acid in the form of porous particles having diameters ranging from 150 to 800 microns. In some applications, it will be useful to utilize a sequestering agent, such as carboxymethyl cellulose or autologous blood clot, to prevent the protein compositions from disassociating from the matrix.

A preferred family of sequestering agents is cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, ethylcellulose. hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl- methylcellulose. and carboxymethylcellulose, the most preferred being cationic salts of carboxymethylcellulose (CMC). Other preferred sequestering agents include hyaluronic acid, sodium alginate, poly(ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer and poly(vinyl alcohol). The amount of sequestering agent useful herein is 0.5- 20 wt%o, preferably 1-10 wt% based on total formulation weight, which represents the amount necessary to prevent desorbtion of the protein from the polymer matrix and to provide appropriate handling of the composition, yet not so much that the progenitor cells are prevented from infiltrating the matrix, thereby providing the protein the opportunity to assist the osteogenic activity of the progenitor cells.

In further compositions, proteins of the invention may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in question. These agents include various growth factors such as epidermal growth factor (EGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-α and TGF-β), and insulin-like growth factor (IGF).

The therapeutic compositions are also presently valuable for veterinary applications. Particularly domestic animals and thoroughbred horses, in addition to humans, are desired patients for such treatment with proteins of the present invention.

The dosage regimen of a protein-containing pharmaceutical composition to be used in tissue regeneration will be determined by the attending physician considering various factors which modify the action of the proteins, e.g., amount of tissue weight desired to be formed, the site of damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue (e.g., bone), the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and with inclusion of other proteins in the pharmaceutical composition. For example, the addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also effect the dosage. Progress can be monitored by periodic assessment of tissue/bone growth and/or repair, for example, X-rays, histomoφhometric determinations and tetracychne labeling.

Polynucleotides of the present invention can also be used for gene therapy. Such polynucleotides can be introduced either in vivo or ex vivo into cells for expression in a mammalian subject. Polynucleotides of the invention may also be administered by other known methods for introduction of nucleic acid into a cell or organism (including, without limitation, in the form of viral vectors or naked DNA).

Cells may also be cultured ex vivo in the presence of proteins of the present invention in order to proliferate or to produce a desired effect on or activity in such cells. Treated cells can then be introduced in vivo for therapeutic piuposes.

Patent and literature references cited herein are incoφorated by reference as if fully set forth. References

Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Muφhy PM, Berger EA (1996). CC-CKR5: A RANTES, MlP-lα, MlP-lβ receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272: 1955-1958. Baggiolini M, Dewald B, Moser B (1994). Interleukin-8 and related chemotactic cytokines - CXC and CC chemokines. Adv Immunol 55: 97-179. Bleul CC, Farzan M, Choe H, Parolin C, Clark-Lewis I, Sodroski J, Springer TA (1996a). The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature 382: 829-833. Bleul CC, Fuhlbrigge RC, Casanovas JM, Aiuti A, Springer TA (1996b). A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J

Exp Med 184: 1101-1 109. Busciglio JB, Gabuzda DH, Matsudaira P, Yankner BA (1993). Generation of beta- amyloid in the secretory pathway in neuronal and nonneuronal cells. Proc Natl Acad Sci USA 90: 2092-2096. Clark-Lewis I, Dewald B, Geiser T, Moser B, Baggiolini M (1993). Platelet factor 4 binds to interleukin 8 receptors and activates neutrophils when its N terminus is modified with Glu-Leu-Arg. Proc Natl Acad Sci (USA) 90: 3574-3577. Clark-Lewis I, Dewald B, Loetscher M, Moser B, Baggiolini M (1994). Structural requirements for interleukin-8 function identified by design of analogs and CXC chemokine hybrids. J Biol Chem 269: 16075-16081. Cole KE, Strick CA, Paradis TJ, Ogborne KT, Loetscher M, Gladue RP. Lin W, Boyd JG, Moser B, Wood DE, Sahagan BG, Neote K (1998). Interferon-inducible T cell alpha chemoattractant (I-TAC): A novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. J Exp Med 187: 2009-2021. Dewald B, Moser B, Barrella L, Schumacher C, Baggiolini M and Clark-Lewis I

(1992). IP-10, a γ-interferon-inducible protein related to interleukin-8, lacks neutrophil activating properties. Immunol Lett 32: 81-84. Farber JM (1990). A macrophage mRNA selectively induced by γ-interferon encodes a member of the platelet factor 4 family of cytokines. Proc Natl Acad Sci USA 87: 5238-5242.

Farber JM (1997). Mig and IP-10: CXC chemokines that target lymphocytes. J

Leukocyte Biol 61: 246-257. Gillitzer R, Wolff K, Tong D, Muller C, Yoshimura T, Hartmann A. Stingl G, Berger R (1993). MCP-1 mRNA expression in basal keratinocytes of psoriatic lesions. J Invest Dermatol 101: 127-131.

Heesen M, Berman MA, Hopken UE, Gerard NP, Dorf ME (1997). Alternate splicing of mouse fusin/CXC chemokine receptor-4. Stromal cell-derived factor- lα is a ligand for both CXC chemokine receptor-4 isoforms. J Immunol 158: 3561-3564. Horuk R, Chitnis C, Darbonne W, Colby T, Rybicki A, Hadley T, Miller L (1993) A receptor for the malarial parasite Plasmodium vivax: the erythrocyte chemokine receptor. Science 261: 1 182-1184. Jacobs KA, Collins-Racie LA, Colbert M, Duckett M, Golden-Fleet M, Kelleher K, Kriz R, LaVallie ER, Merberg D, Spaulding V, Stover J, Williamson MJ, McCoy JM (1997). A genetic selection for isolating cDNAs encoding secreted proteins. Gene 198: 289-296. Koch AE, Kunkel SL, Harlow LA, Johnson B, Evanoff HL, Haines GK, Burdick MD,

Pope RM, Strieter R (1992). Enhanced production of monocyte chemoattractant protein- 1 in rheumatoid arthritis. J Clin Invest 90: 772-779. Kuang Y, Wu Y, Jiang H, Wu D (1996). Selective G protein coupling by C-C chemokine receptors. J Biol Chem 271: 3975-3978. Liao F, Rabin RL, Yannelli JR, Koniaris LG, Vanguri P, Farber JM (1995). Human Mig chemokine: biochemical and functional characterization. J Exp Med 182: 1301- 1314. Loetscher M, Gerber B, Loetscher P, Jones SA, Piali L, Clark-Lewis I, Baggiolini M, Moser B. (1996). Chemokine receptor specific for IP10 and Mig: structure, function, and expression in activated T-lymphocytes. J Exp Med 184: 963-969.

Luo Y, Laning J, Devi S, Mak J, Schall TJ, Dorf ME (1994). Biologic activities of the murine β-chemokine TC A3. J Immunol 153: 4616-4624. Luster AD, Ravetch JV (1987). Biochemical characterization of a gamma interferon- inducible cytokine (IP10). J Exp Med 166: 1084-1097. Luster AD (1998). Mechanisms of disease: chemokines- chemotactic cytokines that mediate inflammation. N Engl J Med 338: 436-445. Piali L, Weber C, LaRosa G, Mackay CR, Springer TA, Clark-Lewis I, and Moser B (1998). The chemokine receptor CXCR3 mediates rapid and shear-resistant adhesion-induction of effector T lymphocytes by the chemokines IP10 and Mig. Eur J Immunol 28: 961-972.

Rani MRS, Foster GR, Leung S, Leaman D, Stark G, Ransohoff RM (1996).

Characterization of β-Rl, a gene that is selectively induced by interferon β (IFN- β) compared with IFN-α. J Biol Chem 271: 22878-22884. Ransohoff RM, Hamilton TA, Tani M, Stoler MH, Shick HE, Major JA, Estes ML, Thomas DM, Touhy VK (1993). Astrocyte expression of mRNA encoding cytokines IPIO and JE/MCP-1 in experimental autoimmune encephalomyelitis. FASEB J 7: 592-600. Sarris AH, Broxmeyer HE, Wirthmueller U, Karasavvas N, Cooper S. Lu L, Krueger J, Ravetch JV (1993). Human interferon-inducible protein 10: expression and purification of recombinant protein demonstrate inhibition of early human hematopoietic progenitors. J Exp Med 178: 1127-1132. Schluger NW, Rom WN (1997). Early responses to infection: chemokines as mediators of inflammation. Current Opin Immunol 9: 504-508. Shan B, Zhu X, Chen PL, Durfee T, Yang Y, Shaφ D, Lee WH (1992). Molecular cloning of cellular genes encoding retinoblastoma-associated proteins: identification of a gene with properties of the transcription factor E2F. Mol Cell Biol 12: 5620-5631. Strieter RM, Polverini PJ, Kunkel SL, Arenberg DA, Burdick MD, Kasper J, Dzuiba J, Van Damme J, Walz A., Marriott D, et al. (1995). The functional role of the 'ELR' motif in CXC chemokine-mediated angiogenesis. J Biol Chem 270:

27348-27357. Taub DD, Lloyd AR, Conlon K, Wang JM, Ortaldo JR, Harada A, Matsushima K, Kelvin DJ, Oppenheim JJ (1993). Recombinant human interferon-inducible protein 10 is a chemoattractant for human monocytes and T lymphocytes and promotes T cell adhesion to endothelial cells. J Exp Med 177: 1809-1814.

Tornatore C, Nath A, Amemiya K, Major EO (1991). Persistent human immunodeficiency virus type 1 infection in human fetal glial cells reactived by T-cell factor(s) or by the cytokines tumor necrosis factor alpha and interleukin- 1 beta. J Virol 65: 6094-6100. Wright TM, Farber JM (1991). 5' regulatory region of a novel cytokine gene mediates selective activation by interferon γ. J Exp Med 173: 417-422.

Claims

What is claimed is:

1. A method of preventing, treating, or ameliorating a condition of the nervous system comprising administering at least one substance to a vertebrate subject, wherein the substance inhibits the interaction of at least one endogenous non-ELR CXC chemokine with at least one chemokine receptor.

2. The method of claim 1 wherein the condition of the nervous system is selected from the group consisting of: AIDS-related dementia, multiple sclerosis, Miller Fisher syndrome, spongiform encephalopathy, viral encephalomyelitis, post-rabies- vaccine encephalomyelitis, postinfectious encephalomyelitis, paraneoplastic neuronopathy, paraneoplastic cerebellar degeneration, acute inflammatory demyelinating polyradiculo-neuropathy, Guillain-Barre syndrome, experimental auto-immune neuritis, acute inflammatory polyneuropathy, chronic inflammatory polyneuropathy, chronic inflammatory demyelinating poly-neuropathy, chronic relapsing inflammatory polyneuropathy, the poly-neuropathy associated with monoclonal gammopathy, IgM monoclonal anti-myelin-associated glycoprotein-associated demyelinating polyneuropathy, Lambert-Eaton myasthenic syndrome, myasthenia gravis, multifocal motor neuropathy with or without GM1 antibodies, inflammatory myopathy, stiff-man syndrome, and autoimmune neuromyotonia.

3. The method of claim 2 wherein the condition of the nervous system is a condition of the central nervous system.

4. The method of claim 2 wherein the condition of the nervous system is a condition of the peripheral nervous system.

5. The method of claim 2 wherein the condition of the nervous system is AIDS-related dementia.

6. The mthod of claim 2 wherein the condition of the nervous system is multiple sclerosis.

7. The method of claim 1 wherein the vertebrate subject is a mammal.

8. The method of claim 7 wherein the vertebrate subject is a human subject.

9. The method of claim 1 wherein the substance is selected from the group consisting of a modified non-ELR CXC chemokine, an antibody or antibody fragment that binds specifically to a non-ELR CXC chemokine, an antisense polynucleotide directed to a polynucleotide expressing a non-ELR CXC chemokine. a nucleotide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, a peptide aptamer that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor, and a small molecule that affects the binding of at least one non-ELR CXC chemokine to at least one chemokine receptor.

10. The method of claim 9 wherein the substance is a modified HI 74 chemokine molecule.

11. The method of claim 10 wherein the modified HI 74 chemokine molecule comprises an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence of SEQ ID NO:2;

(b) the amino acid sequence of SEQ ID NO:2 from amino acid 24 to amino acid 33;

(c) the amino acid sequence of SEQ ID NO:2 from amino acid 25 to amino acid 41;

(f) the amino acid sequence of SEQ ID NO:2 from amino acid 57 to amino acid 67;

(g) the amino acid sequence of SEQ ID NO:2 from amino acid 74 to amino acid 87;

(i) the amino acid sequence encoded by the cDNA insert of clone HI 74-10 or clone HI 74-43 deposited under accession number ATCC 69882.

12. The method of claim 9 wherein the substance is an antibody that specifically binds to HI 74 protein.

13. The method of claim 12 wherein the antibody is a monoclonal antibody.

14. The method of claim 1 wherein the endogenous non-ELR CXC chemokine is HI 74.

15. The method of claim 1 wherein the substance inhibits the interaction of at least one of the HI 74, Mig, and IP10 non-ELR CXC chemokines with at least one chemokine receptor.

16. The method of claim 1 wherein the chemokine receptor is CXCR3.

17. A method of preventing, treating, or ameliorating a condition involving inflammation of the nervous system comprising administering at least one substance to a vertebrate subject, wherein the substance inhibits the interaction of at least one endogenous non-ELR CXC chemokine with at least one chemokine receptor.

18. A method for identifying a substance capable of inhibiting the interaction of at least one non-ELR CXC chemokine with at least one chemokine receptor, which method comprises:

(b) combining the first mixture with a composition comprising at least one non-ELR CXC chemokine, forming a second mixture;

(c) combining a composition comprising at least one non-ELR CXC chemokine with a composition comprising at least one chemokine receptor, under conditions in which at least one said chemokine binds to at least one said chemokine receptor, forming a control mixture; (d) determining the amount of interaction between the non-ELR

19. The method of claim 14 wherein the non-ELR CXC chemokine is HI 74.

20. The method of claim 15 wherein the chemokine receptor is CXCR3.