WO2000017370A1 - HUMAN COMPLEMENT C3-DEGRADING POLYPEPTIDE FROM $i(STREPTOCOCCUS PNEUMONIAE) - Google Patents

Abstract

The present invention relates to the identification and use of a family of human complement C3-degrading polypeptides expressed by S.pneumoniae. The polypeptides have molecular weights of about 15 kD to about 25 kD or about 75 kDa to about 95 kDa, for example. Preferred polypeptides of this invention include the amino acid sequences of SEQ ID NO:2 and SEQ ID NO:5.

Description

HUMAN COMPLEMENT C3-DEGRADING POLYPEPTIDE FROM STREPTOCOCCUS PNEUMONIAE

Field of the Invention

This invention relates to Streptococcus pneumoniae and in particular this invention relates to the identification of an S. pneumoniae polypeptide that is capable of degrading human complement protein C3.

Background of the Invention

Respiratory infection with the bacterium Streptococcus pneumoniae (S. pneumoniae) leads to an estimated 500,000 cases of pneumonia and 47,000 deaths annually. Those persons at highest risk of bacteremic pneumococcal infection are infants under two years of age, individuals with a compromised immune system and the elderly. In these populations, S. pneumoniae is the leading cause of bacterial pneumonia and meningitis. Moreover, S. pneumoniae is the major bacterial cause of ear infections in children of all ages. Both children and the elderly share defects in the synthesis of protective antibodies to pneumococcal capsular polysaccharide after either bacterial colonization, local or systemic infection, or vaccination with purified polysaccharides. S. pneumoniae is the leading cause of invasive bacterial respiratory disease in both adults and children with HIV infection and produces hematogenous infection in these patients (Connor et al. Current Topics in AIDS 1987;1:185-209 and Janoff et al. Ann. Intern. Med. 1992; 117(4):314-324).

Individuals who demonstrate the greatest risk for severe infection are not able to make antibodies to the current capsular polysaccharide vaccines. As a result, there are now four conjugate vaccines in clinical trial. Conjugate vaccines consist of pneumococcal capsular polysaccharides coupled to protein carriers or adjuvants in an attempt to boost the antibody response. However, there are other potential problems with conjugate vaccines currently in clinical trials. For example, pneumococcal serotypes that are most prevalent \v the United States are differ^"., from the serotypes tb~' -αe most c " ..non in places such as Israel, Western Europe, South Africa, or Scandinavia. Therefore, vaccines that may be useful in one geographic locale may not be useful in another. The potential need to modify currently available capsular polysaccharide vaccines or to develop protein conjugates for capsular vaccines to suit geographic serotype variability entails prohibitive financial and technical complications. Thus, the search for immunogenic, surface-exposed proteins that are conserved worldwide among a variety of virulent serotypes is of prime importance to the prevention of pneumococcal infection and to the formulation of broadly protective pneumococcal vaccines. Moreover, the emergence of penicillin and cephalosporin-resistant pneumococci on a worldwide basis makes the need for effective vaccines even more exigent (Baquero et al. J. Antimicrob. Chemother. 1991;28S;31-8).

Several pneumococcal proteins have been proposed for conjugation to pneumococcal capsular polysaccharide or as single immunogens to stimulate immunity against S. pneumoniae. Surface proteins that are reported to be involved in adhesion of S. pneumoniae to epithelial cells of the respiratory tract include PsaA, PspC/CBPl 12, and IgAl proteinase (Sampson et al. Infect. Immun. 1994;62:319-324, Sheffield et al. Microb. Pathogen. 1992; 13: 261-9, and Wani, et al. Infect. Immun. 1996; 64:3967-3974). Antibodies to these adhesins could inhibit binding of pneumococci to respiratory epithelial cells and thereby reduce colonization. Other cytosolic pneumococcal proteins such as pneumolysin, autolysin, neuraminidase, or hyaluronidase are proposed as vaccine antigens because antibodies could potentially block the toxic effects of these proteins in patients infected with S. pneumoniae. However, these proteins are typically not located on the surface of S. pneumoniae, rather they are secreted or released from the bacterium as the cells lyse and die (Lee et al. Vaccine 1994; 12:875-8 and Berry et al. Infect. Immun. 1994; 62:1101-1108). While use of these cytosolic proteins as immunogens might ameliorate late consequences of S. pneumoniae infection, antibodies to these proteins would neither promote pneumococcal death nor prevent initial or subsequent pneumococcal colonization.

A prototypic surface protein that is being te^c+r-d as a pneυr lococcal vaccine is the pneumococcal surface protein A (PspA). PspA is a heterogeneous protein of about 70-140 kDa. The PspA structure includes an alpha helix at the amino terminus, followed by a proline-rich sequence, and terminates in a series of 11 choline-binding repeats at the carboxy-terminus. Although much information regarding its structure is available, PspA is not structurally conserved among a variety of pneumococcal serotypes, and its function is entirely unknown (Yother et al. J. Bacteriol. 1992;174:601-9 and Yother J. Bacteriol. 1994;176:2976-2985). Studies have confirmed the immunogenicity of PspA in animals (McDaniel et al. Microb. Pathogen. 1994; 17;323-337). Despite the immunogenicity of PspA, the heterogeneity of PspA, its existence in four structural groups (or clades), and its uncharacterized function complicate its ability to be used as a vaccine antigen.

In patients who cannot make protective antibodies to the type-specific polysaccharide capsule, the third component of complement, C3, and the associated proteins of the alternative complement pathway constitute the first line of host defense against S. pneumoniae infection. Because complement proteins cannot penetrate the rigid cell wall of S pneumoniae, deposition of opsonic C3b on the pneumococcal surface is the principal mediator of pneumococcal clearance. Interactions of pneumococci with plasma C3 are known to occur during pneumococcal bacteremia, when the covalent binding of C3b, the opsonically active fragment of C3, initiates phagocytic recognition and ingestion (Johnston et al. J. Exp. Med 1969;129:1275-1290, Hasin HE, J. Immunol. 1972; 109:26-31 and Hostetter et al. J. Infect. Dis. 1984; 150:653-61). C3b deposits on the pneumococcal capsule, as well as on the cell wall. This method for controlling S. pneumoniae infection is fairly inefficient. Methods for augmenting S. pneumoniae opsonization could improve the disease course induced by this organism. There currently exists a strong need for methods and therapies to limit S. pneumoniae infection.

Summary of the Invention

This invention relates to the identification ' .ϋ use of « ..nily of human complement C3-degrading polypeptides (e.g., proteins) expressed by S. pneumoniae. The polypeptides preferably have a molecular weight of about 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa, as determined, for example, on a 10% SDS polyacrylamide gel. The invention includes a number of polypeptides isolatable from different C3-degrading strains of S. pneumoniae. In one aspect, the invention relates to an isolated polypeptide having at least 80% sequence identity with SEQ ID NO:2 or SEQ ID NO:5. In a preferred embodiment, the polypeptide is isolated from S. pneumoniae or alternatively the polypeptide is a recombinant polypeptide. Preferably, the isolated polypeptide degrades human complement protein C3. A preferred polypeptide of this invention is an isolated polypeptide having an amino acid sequence that includes SEQ ID NO:2 or SEQ ID NO:5, and more preferably, is SEQ ID NO:2 or SEQ ID NO: 5. The term "isolated" as used herein refers to a naturally occurring species that has been removed from its natural environment, as well as to synthetic species. The term "polypeptide" as used herein includes peptides, polypeptides, and proteins, regardless of length. Preferably, the polypeptides of the invention include one or more functional units, which encompasses polypeptides that degrade human complement protein C3.

Thus, the invention also relates to polypeptide fragments isolated from a C3 -degrading protein of this invention. Such fragments are encompassed by the term "polypeptide" as used herein. Preferably, the invention provides polypeptides of at least 15 sequential amino acids derived from a protein that has at least 80% sequence identity with SEQ ID NO:2 or SEQ ID NO:5, and more preferably, polypeptides of at least 15 sequential amino acids of SEQ ID NO:2 or SEQ ID NO:5. In another aspect of this invention, preferred polypeptides are capable of degrading human complement protein C3.

In another aspect, the invention relates to an isolated polypeptide that preferably degrades human complement protein C3, wherein nucleic acid encoding the isolated polypeptide hybridizes to at least a portion of SEQ ID NO:l or SEQ ID NO:4 or their complementary strands under highly stringent hybridization conditions. Preferably, the polypeptide includes at least 15 sequential amino acids, which are, more preferably, of SEQ ID NO:2 or SEQ ID NO:5.

In an additional aspect, this invention relates to polypeptides that have reduced human C3 degradation activity or which do not degrade human C3; however, the nucleic acids encoding this group of polypeptides each include a nucleotide sequence that hybridizes to either the nucleic acids that encode human C3 degrading polypeptides, or the complementary strands for each nucleic acid. This latter group of polypeptides having reduced or no human C3 degrading activity are referred to herein as "non-degrading" polypeptides. The non- degrading polypeptides may differ from C3 degrading polypeptides by one or more amino acids. This amino acid change may be a substitution, alteration, or deletion of one or more amino acids. Various types of amino acid changes are discussed herein. Nucleic acids encoding the non-degrading polypeptides are alternatively preferred embodiments of this invention. The invention also relates to an immune system stimulating composition

(preferably, a vaccine) comprising an effective amount of an immune system stimulating polypeptide of the present invention, which is preferably isolated from S. pneumoniae, and a therapeutically acceptable carrier. In one embodiment, the immune system stimulating composition or vaccine further comprises at least one other immune system stimulating polypeptide isolated from S. pneumoniae.

The invention further relates to an antibody capable of binding (typically, specifically binding) to a polypeptide (at least a portion thereof) of the present invention. In one embodiment, the antibody is a monoclonal antibody and in another embodiment, the antibody is a polyclonal antibody. In another embodiment the antibody is an antibody fragment. The antibody or antibody fragments can be obtained from a mouse, a rat, a goat, a chicken, a human, or a rabbit.

The invention also relates to an isolated nucleic acid molecule (i.e., a polynucleotide, which can be single stranded or double stranded, and which can be a part, or fragment, of a larger molecule such as a vector) capable of hybridizing to at least a portion of SEQ ID ^τO:l or SEO D NO:4 or their complimentary strands under highly stringent hybridization conditions. As used herein, highly stringent hybridization conditions include, for example, 6XSSC, 5X Denhardt, 0.5% SDS, and 100 μg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at 65°C for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 3-5 minutes. In one embodiment, the nucleic acid molecule is isolated from S. pneumoniae and in another embodiment, the nucleic acid molecule encodes a polypeptide. In one embodiment, the polypeptide degrades human complement protein C3. In another embodiment, the nucleic acid molecule encodes a polypeptide that does not degrade human complement C3.

In another embodiment, the nucleic acid molecule is in a vector (i.e., it is a fragment of a nucleic acid vector). The vector can be an expression vector capable of producing a polypeptide. Cells containing the nucleic acid molecule are also contemplated in this invention. In one embodiment, the cell is a bacterium or a eukaryotic cell.

The invention further relates to an isolated nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:l or SEQ ID NO:4, or their complementary strands. The invention further relates to an RNA molecule transcribed by a double-stranded DNA sequence comprising SEQ ID NO:l or SEQ IDNO:4.

In another aspect of this invention, the invention relates to a method for producing an immune response to S. pneumoniae in a mammal (particularly a human). The method includes: administering to a mammal a composition comprising a therapeutically effective amount of a polypeptide of the present invention, and a pharmaceutically acceptable carrier, to produce an immune response to the polypeptide. The immune response can be a B cell response, a T cell response, an epithelial response, or an endothelial response. In a preferred embodiment, the composition is a vaccine composition. Preferably the polypeptide is at least 15 amino acids in length and also preferably the composition further comprises at least "' „ other mm- . e system stimulating polypeptide from S. pneumoniae. In one embodiment, the polypeptide comprises at least 15 amino acids of SEQ ID NO:2 or SEQ ID NO: 5.

The invention further relates to an isolated polypeptide of about 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa, from Streptococcus pneumoniae that is capable of degrading human complement C3 and to a method for inhibiting Streptococcus pneumoniae-mediεΛtd C3 degradation. The method includes contacting a Streptococcus pneumoniae bacterium with antibody capable of binding to a polypeptide (at least a portion thereof) of the present invention. The invention also relates to a method for inhibiting C3-mediated inflammation and rejection in xenotransplantation. The method includes expressing on the surface of an organ of an animal used in xenotransplantation a polypeptide of the present invention. This method is particularly advantageous for causing, for example, the kidneys of pigs to express the polypeptide described herein and thereby to inhibit C3 mediated inflammation after xenotransplantation.

The invention also relates to an isolated nucleic acid molecule that contains a region of at least 15 nucleotides which hybridize under highly stringent hybridization conditions to at least a portion of a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO:4 or their complementary strands.

The invention also relates to isolated DNA molecules or primers having the nucleic acid sequences as shown in SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 AND SEQ ID NO:9.

Brief Description of the Figures

Figure 1 provides the nucleic acid sequence of the translated portion of a C3-degrading polypeptide (approximately 20 kDa) gene of this invention (SEQ ID NO:l).

Figure 2 provides the amino acid sequence of a C3 -degrading polypeptide (approximately 20 kDa) of this invention (SEQ ID NO:2). Figure 3 diagrams the amino acid sequence of a C3-dεgrading polypeptide (approximately 20 kDa *^* onioned v"?. the nucleic acid sequence (double stranded) encoding a C3-degrading polypeptide according to this invention (SEQ ID NOS: 1-3 wherein SEQ ID NO:3 is the complement of SEQ ID NO.l).

Figure 4 provides the nucleic acid sequence for a predicted 92 kDa amino acid sequence (SEQ ID NO:4).

Figure 5 provides the predicted 92 kDa amino acid sequence (SEQ ID NO:5).

Figure 6 shows sequence alignments of SEQ ID NO:l and a portion of SEQ ID NO:4. Figure 7 shows sequence alignment of SEQ ID NO: 2 with a portion of

SEQ ID NO:5.

Figure 8. Western blot analysis of several pneumococcal whole cell lysate with polyclonal anti-~r20 kDa sera. Molecular weight markers were run in lane 1 ; recombinant 20 kDa polypeptide from pDF122 was run in lane 2; recombinant 92 kDa polypeptide from Type 7 was run in lane 3; lane 4 was a blank; CP1200 whole cell lysate was run in lane 5; Type 3 whole cell lysate was run in lane 6; and Type 7 whole cell lysate was run in lane 7. The antisera recognizes the recombinant polypeptides of approximately 20 kDa and approximately 92 kDa, but only recognized the larger polypeptide in whole cell ly sates.

Figure 9. Autoradiogram showing degradation of biotinylated C3 by 20 kDa and 92 kDa polypeptides of the present invention.

Figure 10. Coomassie Blue-Stained 7.5% SDS-PAGE analysis of C3 degradation by the 20 kDa (Lane A8) and the 92 kDa (Lane C8) polypeptides of the present invention.

Figure 11 is a chart which shows the survival of CB A/CAHN xid/5 mice immunized SC (subcutaneous) with r79 kDa protein adjuvanted with MPL and challenged IN (intranasal) with S. pneumoniae Type 3.

Figure 12 is a SDS-PAGE gel described in Example 8. Detailed Description of the Preferred Embodiments

The present invention relates to the identification and isolation of a human complement C3 degrading polypeptide fragment of a larger polypeptide of about 75 kD to about 95 kD. This fragment has a molecular weight of about 20 kDa (± 5 kDa) on a 10% SDS-PAGE gel. It also relates to nucleic acids encoding C3 degrading polypeptides.

It has been observed that exponentially growing cultures of pneumococci from several serotypes were able to first degrade the β -chain then degrade the chain of C3 without producing defined C3 cleavage fragments (Angel, et al. J. Infect. Dis. 170:600-608, 1994). This pattern of degradation without cleavage differs substantially from that of other microbial products such as the elastase enzyme of Pseudomonas aeruginosa and the cysteine proteinase oϊEntamoeba histolytica.

The term "degrade" is used herein to refer to the removal of amino acids from proteinaceous molecules, generating peptides or polypeptides. The polypeptide of this invention degrade C3 without generating the cleavage fragments known as C3b, iC3b, or C3d. There is at least some preference of the C3-degrading polypeptides of this invention for C3 in that, for example, the C3- degrading polypeptide does not appear to degrade other proteins, such as albumin.

A C3 -degrading polypeptide of about 20 kDa was isolated from a library of insertionally interrupted pneumococcal genes by identifying those clones that had decreased C3 degrading activity as compared to wild type S. pneumoniae. An exemplary assay for assessing C3-degrading activity of clones is provided in Example 1. Clones with decreased C3 -degrading activity were identified and a 546 bp Smal insert was selected, based on the sequence of the clones that had demonstrated decreased C3-degrading activity. This Smal fragment was used to probe an S. pneumoniae library made from strain CP1200. Positive clones from the S. pneumoniae library that hybridized to the Smal fragment were isolated and the open reading frame of the gene associated with C3 -degrading activity was identified. The following oligonucleotide (SEQ ID NO: 10), which has sequence identify with a portion of PspA, was used to oiifirm, by differential hybridization, that the gene encoding the C3 -degrading protinease was distinct from the gene encoding PspA.

SEQ ID NO: 10 GAAAACAATAATGTAGAAGACTACTTTAAAGAAGGTTAGA

An open reading frame of a 20 kDa polypeptide spans an area of approximately 500 base pairs (SEQ ID NO:l) predicting a polypeptide of molecular weight of about 20 kDa (+/- 5 kDa) or about 168 amino acids (SEQ ID NO:2). An exemplary gene sequence encoding a C3-degrading polypeptide is provided in Figure 1 as SEQ ID NO:l and an amino acid sequence of the polypeptide is provided in Figure 2 as SEQ ID NO:2. Figure 3 combines a preferred gene sequence with a corresponding preferred translated polypeptide as SEQ ID NOS:l-3. Using SEQ ID NO:2, the amino acid sequence of the approximately 20 kDa polypeptide, was determined to be unrelated to other polypeptides in the GenBank or Swiss Prot databases. The predicted polypeptide encompasses a proline-rich sequence characteristic of membrane domains in prokaryotes, particularly between amino acids 80-108 suggesting that the polypeptide is expressed at the surface. The amino acid sequence exhibits no apparent choline- binding repeats. Electrophoresis of pneumococcal lysates and supernatants from cultures of CP 1200 on SDS-PAGE gels impregnated with C3 identified a lytic band at about 20 kDa (± 5 kDa) in both supernatants and lysates, confirming that a polypeptide of a size predicted by SEQ ID NO:2 had C3-degrading activity (see Example 2). As provided in Example 3, the gene encoding the 20 kDa C3- degrading polypeptide is conserved in at least two dozen pneumococcal isolates representing five serotypes (serotypes 1, 3, 4, 14, and 19F).

The nucleotide sequence encoding the C3 -degrading polypeptide of this invention was inserted into a gene expression vector for expression in E. coli. Recombinant C3 -degrading polypeptide was isolated as described in the examples. Those of ordinary skill in the art recognirc that, given a particular gene sequence such as that ^• .vided in^'SJ⁷ „; ID NO:l, there are a variety of expression vectors that could be used to express the gene. Further, there are a variety of methods known in the art that could be used to produce and isolate the recombinant polypeptide of this invention and those of ordinary skill in the art also recognize that the C3 degrading assay of this invention will determine whether or not a particular expression system, in addition to those expression systems provided in the examples, is functioning, without requiring undue experimentation. A variety of molecular and immunological techniques can be found in basic technical texts such as those of Sambrook et al. (Molecular Cloning, A Laboratory Manual, 1989 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) and Harlow et al. (Antibodies; A Laboratory Manual. Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 1988).

The polynucleotide encoding the C3 degrading polypeptide of this invention was identified using a plasmid library made with pneumococcal genomic DNA fragments from strain CP1200. Although there are a variety of methods known for obtaining a plasmid library, in a preferred strategy, a plasmid library was constructed with Sau 3A digested pneumococcal genomic DNA fragments (0.5 -4.0 kb) from pneumococcal strain CP 1200 (obtained from D.A. Morrison, University of Illinois, Champagne-Urbana, Illinois and described in Havarstein LF, et al. Proc. Natl. Acad. Sci. (USA) 1995;92:11140-11144) and inserted into the Bam HI site of the integrative shuttle vector pVA 891 (erm^r, cm^r; has origin of replication for E colϊ). This library was transformed into an E coli DH5α MCR strain by electroporation. Plasmid extractions of some randomly selected E. coli transformants revealed that all of them contained recombinant plasmids. Plasmid library DNA can be extracted from the E. coli transformants and used to transform the CP 1200 parent pneumococcal strain using insertional mutagenesis by homologous recombination.

The pneumococcal strain CP 1200 cells can be made competent using a pH shift with HC1 procedure in CTM medium. The competent cells are frozen at -70°C in small aliquots until needed.

The isolated polypeptide of this invention can be incubated with human complement C3 for 4 he - -^'_, or longer ,. 37°C in the presence of PBS to detect C3 degradation. Control samples without the isolated pneumococcal polypeptide are used as controls for comparative purposes.

The polypeptides of this invention have an apparent molecular weight on a 10% SDS-polyacrylamide gel of either about 15 kDa to about 25 kDa; and preferably about 20 kDa; or about 75 kDa to about 95 kDa; and preferably about 92 kDa. Exemplary polypeptides sequences are provided by SEQ ID NO: 2 and SEQ ID NO: 5. Those of ordinary skill in the art will recognize that some variability in amino acid sequence is expected and that this variability should not detract from the scope of this invention. For example, conserved mutations do not detract from this invention nor do variations in amino acid sequence identity of less than about 80% amino acid sequence identity and preferably less than about 90% amino acid sequence identity where the polypeptide is capable of degrading human complement protein C3, and particularly where the polypeptide is isolated or originally obtained from an S. pneumoniae bacterium. Proteins and fragments thereof (all referred to as polypeptides) are also within the scope of the present invention, particularly if they are capable of degrading human complement protein C3.

Some nucleic acid sequence variability is expected among pneumococcal strains and serotypes as is some amino acid variability. Conserved amino acid substitutions are known in the art and include, for example, amino acid substitutions using other members from the same class to which the amino acid belongs. For example, the nonpolar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, and tryptophan. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations are not expected to affect apparent molecular weight as determined by polyacrylamide gel electrophoresis or isoelectric point. Particularly preferred conservative substitutions include, but are not limited to, Lys for Arg and vice verse to maintain a positive charge; Glu for Asp and vice versa to maintain a negative charge; Ser for Thr so that a free -OH is maintained; and Gin for Asn to maintain a free NH₂. Preferred polypeptides of this invention includes polypeptides with the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:5. Other polypeptides include those degrading human complement polypeptide C3 and having nucleic acid encoding the polypeptide that hybridizes to SEQ ID NO:l or SEQ ID NO:4 under highly stringent hybridization conditions such as 6XSSC, 5X Denhardt, 0.5% SDS (sodium dodecyl sulfate), and 100 μg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at, 65°C for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 3-5 minutes are also contemplated in this invention. Typically, an SSC solution contains sodium chloride, sodium citrate, and water to prepare a stock solution.

The polypeptides of this invention can be isolated or prepared as recombinant polypeptides. That is, nucleic acid encoding a protein, or a portion thereof, can be incorporated into an expression vector or incorporated into a chromosome of a cell to express the polypeptide in the cell. The polypeptide can be purified from a bacterium or another cell, preferably a eukaryotic cell and more preferably an animal cell. Alternatively, the polypeptide can be isolated from a cell expressing the polypeptide, such as a S. pneumoniae cell. Thus, proteins, peptides, or polypeptides are all considered within the scope of this invention when the term "polypeptide" is used. The polypeptides are preferably at least 15 amino acids in length and preferred polypeptides have at least 15 sequential amino acids from SEQ ID NO:2 or SEQ ID NO:5.

Nucleic acid encoding the about 15 kDa to about 20 kDa polypeptide and the about 75 kD to about 95 kD polypeptide are also part of this invention. SEQ ID NOS:l and 4 are preferred nucleic acid molecules encoding a C3-degrading polypeptide. Those of ordinary skill in the art will recognize that some substitution will not alter the C3 -degrading polypeptide sequence to an extent that the character or nature of the C3-degrading polypeptide is substantially altered. For example, nucleic acid with an identity of at least 80% to SEQ ID NO:l is contemplated in this invention. A method for determining whether a particular nucleic 1J sequenc within the scope of this invention is to consider whether or not a particular nucleic acid sequence encodes a C3- degrading polypeptide and has a nucleic acid identity of at least 80% as compared with SEQ ID NO:l or SEQ ID NO:4. Other nucleic acid sequences encoding the C3 polypeptide include nucleic acid encoding the C3 polypeptide where the C3 polypeptide has the same sequence or at least a 90% sequence identity with SEQ ID NO:2 or SEQ ID NO:5 but which includes degeneracy with respect to the nucleic acid sequence. A degenerate codon means that a different three letter codon is used to specify the same amino acid. For example, it is well known in the art that the following RNA codons (and therefore, the corresponding DNA codons, with a T substituted for a U) can be used interchangeably to code for each specific amino acid:

Phenylalanine (Phe or F) UUU, UUC, UUA or UUG

Leucine (Leu or L) CUU, CUC, CUA or CUG Isoleucine (He or I) AUU, AUC orAUA Methionine (Met or M) AUG Valine (Val or V) GUU, GUC, GUA, GUG Serine (Ser or S) AGUorAGC Proline (Pro or P) CCU, CCC, CCA, CCG Threonine (Thr or T) ACU, ACC, ACA, ACG Alanine (Ala or A) GCU, GCG, GCA, GCC Tryptophan (Tip) UGG Tyrosine (Tyr or Y) UAUorUAC Histidine (His or H) CAU or CAC Glutamine (Gin or Q) CAA or CAG Asparagine (Asn or N) AAUorAAC Lysine (Lys or K) AAA orAAG Aspartic Acid (Asp or D) GAU or GAC Glutamic Acid (Glu or E) GAA or GAG Cysteine (Cys or C) UGU orUGC Arginine (Arg or R) AGA orAGG Glycine (Gly or G) GGU orGGC or GGAor GGG Tόrminatior odon UAA, UAG orUGA Further, a particular DNA sequence can be modified to employ the codons preferred for a particular cell type. For example, the preferred codon usage for E. coli is known, as are preferred codons for animals including humans. These changes are known to those of ordinary skill in the art and therefore these gene sequences are considered part of this invention. Other nucleic acid sequences include at least 15, and preferably, at least 30 nucleic acids in length from SΕQ ID NO:l or SΕQ ID NO:4 or other nucleic acid fragments of at least 15, and preferably at least 30 nucleic acids in length where these fragments hybridize to SΕQ ID NO:l or SΕQ ID NO:4 under highly stringent hybridization conditions such as 6XSSC, 5X Denhardt, 0.5% SDS, and 100 μg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at, 65°C for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 3-5 minutes.

The nucleic acid molecules of this invention can encode all, none (i.e., fragments that cannot be transcribed, fragments that include regulatory portions of the gene, or the like), or a portion of SΕQ ID NO:2 or SΕQ ID NO:5 and preferably containing a contiguous nucleic acid fragment that encodes at least nine amino acids from SΕQ ID NO:2 or SΕQ ID NO:5. Because nucleic acid molecues encoding a portion of a C3 degrading polypeptide are contemplated in this invention, it will be understood that not all of the nucleic acid molecules will encode a protein or peptide or polypeptide with C3 degrading activity. Further, the nucleic acid of this invention can be mutated to remove or otherwise inactivate the C3 degrading activity of this polypeptide. Therefore, nucleic acid molecules that encode polypeptides without C3 degrading activity that meet the hybridization requirements described above are also contemplated. Methods for mutating or otherwise altering nucleic acid sequences are well described in the art and the production of an immunogenic, but enzymatically inactive polypeptide can be tested for therapeutic utility.

The nucleic acid molecules of this invention can be incorporated into nucleic ^r'^ vectors o^r ' tbly incorporated into host genomes to produce recombinant polypeptides including recombinant chimeric polypeptides. In one embodiment, the C3-degrading polypeptide is encoded by a gene in a vector and the vector is in a cell. Preferably, the cell is a prokaryotic cell such as a bacterium. The genes and gene fragments can exist as the fusion of all or a portion of the gene with another gene and the C3-degrading polypeptide can exist as a fusion protein of one or more proteins where the fusion protein is expressed as a single protein. A variety of nucleic acid vectors of this invention are known in the art and include a number of commercially available expression plasmids or viral vectors. The use of these vectors is well within the scope of what is ordinary skill in the art. Exemplary vectors are employed in the examples, but should not be construed as limiting on the scope of this invention.

This invention also relates to antibodies capable of binding (typically specifically binding) to polypeptides of about 15 kDa to about 25 kDa; and preferably about 20 kDa; and about 75 kDa to about 95 kDa; and preferably about 92 kDa, from S. pneumoniae and preferably where the polypeptides are capable of degrading human complement C3. Polyclonal or monoclonal antibodies can be prepared to all or part of the polypeptides of the invention Methods for preparing antibodies to polypeptides are well known and well described, for example, by Harlow et al., (Antibodies; A Laboratory Manual. Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 1988). In a preferred example, the antibodies can be human derived, rat derived, mouse derived, goat derived, chicken derived, or rabbit derived. Polypeptide-binding antibody fragments and chimeric fragments are also known and are within the scope of this invention. The invention also relates to the use of immune stimulating compositions. The term "immune stimulating" or "immune system stimulating" composition refers to protein, peptide, or polypeptide compositions according to the invention that activate at least one cell type of the immune system in a subject, such as a mammal. Preferably, the immune stimulating composition provides an immunizing response or prophylactic benefit in a normal, i.e., uninfected subject, typically a vaccine. However, any measurable immune response is beneficial to the subject in a therapy application or protocol. Preferred activated cells of the immune system include phagocytic cells such as neutrophils or macrophages, T cells, B cells, epithelial cells and endothelial cells. Immune stimulating compositions comprising the peptides, polypeptides or proteins of the invention can be used to produce antibody in an animal such as a rat, mouse, goat, chicken, rabbit, or a human or an animal model for studying S. pneumoniae infection. Preferred immune stimulating compositions include an immune stimulating amount, e.g, a therapeutically effective amount, of at least one peptide or polypeptide including at least 15 amino acids from the C3 degrading polypeptide. The term "vaccine" refers to a composition for immunization. This process can include the administration of a protein, peptide, polypeptide, antigen, nucleic acid sequence or complementary sequence, e.g., anti-sense, or antibody, or suspensions thereof, wherein upon administration, the molecule will produce active immunity and provide protection against an S. pneumoniae infection or colonization. Typically, such vaccines are prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. The vaccine preparation may optionally be emulsified, or encapsulated in liposomes.

The immune stimulating composition (such as a vaccine) can further include other polypeptides in a pharmaceutically acceptable buffer or carrier, such as PBS (phosphate buffer saline) or another buffer recognized in the art as suitable and safe for introduction of polypeptides into a host to stimulate the immune system. The immune stimulating compositions can also include other immune system stimulating polypeptides such as adjuvants or immune stimulating proteins, peptides, or polypeptides from S. pneumoniae or other organisms. For example, a cocktail of peptides or polypeptides may be most useful for controlling S. pneumoniae infection. Preferably one or more of the polypeptides, or fragments thereof, of this invention are used in a vaccine preparation to protect against or limit S. pneumoniae colonization or the pathogenic consequences of S. pneumoniae colonization.

A "therapeutically effective amount," as used herein, refers to that amon- 1 "diat is ef e- i ve for production of a desired result. This amount varies depending upon the health and physical condition of a subject's immune system, i.e., to synthesize antibodies, the degree of protection desired, the formulation prepared and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials. The active immune stimulating ingredients are often mixed with excipients or diluents that are pharmaceutically acceptable as carriers and compatible with the active ingredient. The term "pharmaceutically acceptable carrier" refers to a carrier(s) that is "acceptable" in the sense of being compatible with the other ingredients of a composition and not deleterious to the recipient thereof. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the immune stimulating composition (including vaccine) may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the immune stimulating compostion.

Examples of adjuvants or carriers that may be effective include but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D- isoglutamine (thr-MDP); N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L- alanine-2-(l '-2 '-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835 A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL + TDM + CWS) in a 2% squalene/Tween 80 emulsion. This invention also relates to a method for inhibiting Streptococcus pneumoniae-mediated C3 degradation comprising contacting a Streptococcus pneumonie bacterium with a polypeptide, such as an antibody or another polypeptide that is capable of binding to an isolated polypeptide (typically, at least a portion thereof) of about 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa, from Streptococcus pneumoniae. The protein capable of binding to an isolated polypeptide of about 15 kDa to about 25 kDa, or about 75 kDa to P _;; 95 kDa ^r :i be an antibody or a fragment thereof, or the protein can be a chimeric protein that includes the antibody binding domain, such as a variable domain, from antibody that is capable of specifically recognizing an isolated polypeptide of about 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa, from Streptococcus pneumoniae having C3 degrading activity. The isolated S. pneumoniae polypeptide of this invention can be isolated, and optionally purified, and the isolated polypeptide or immunogenic fragments thereof can be used to produce an immunologic response, including, in one example, an antibody response in a human or an experimental animal. Polypeptides without C3 degrading ability can be tested for their ability to limit the effects of S. pneumoniae infection. Similarly, the polypeptides of this invention can be modified, such as through mutation to interrupt or inactivate the C3 degrading activity of the polypeptides. Antibody capable of inhibiting the C3-degrading activity of the polypeptides of this invention may be used as a strategy for preventing C3 degradation and for promoting clearance of S. pneumoniae through the opsonic pathway. Isolated polypeptides can be used in assays to detect antibody to S. pneumoniae or as part of a vaccine or a multi- valent or multiple protein, peptide, or polypeptide-containing vaccine for S. pneumoniae therapy.

Thus, the term "treatment," as used herein, refers to prophylaxis and/or therapy of either normal mammalian subjects or mammalian subjects colonized with, diagnosed with, or exhibiting characteristics or symptoms of various S. pneumoniae infections. The term "therapy" refers to providing a therapeutic effect to a mammalian subject such that the subject exhibits few or no symptoms of a pneumococcal infection or other related disease. Such treatment can be accomplished by administration of nucleic acid molecules (sense or antisense), • proteins, peptides or polypeptides or antibodies of the instant invention.

It is further contemplated that the polypeptides of this invention can be surface expressed on vertebrate cells and used to degrade C3, for example, where complement deposition (or activation) becomes a problem, such as in xenotransplantation or in complement-mediated glomerulonephritis. For example, the entire pne rnococcal polypeptide, a recombinant polypeptide, or a „riion of ei^fl ,:, can be incorporated into xenotransplant cells and expressed as a surface polypeptide or as a secreted polypeptide to prevent or minimize complement deposition (and/or complement-mediated inflammation).

Another specific aspect of the present invention relates to using a vaccine vector expressing an isolated protein, and peptides or polypeptides therefrom. Accordingly, in a further aspect this invention provides a method of inducing an immune response in a mammal, which comprises providing to a mammal a vaccine vector expressing at least one, or a mixture of an isolated protein and/or peptide or polypeptide of the invention. The protein and peptides or polypeptides of the present invention can be delivered to the mammal using a live vaccine vector, in particular using live recombinant bacteria, viruses or other live agents, containing the genetic material necessary for the expression of the protein and/or peptides or polypeptides as a foreign polypeptide. Particularly, bacteria that colonizes the gastrointestinal tract, such as Salmonella, Shigella, Yersinia, Vibrio, Escherichia and BCG have been developed as vaccine vectors, and these and other examples are discuessed by J. Holmgren et al., Immunobiol.. 184. 157-179 (1992) and J. McGhee et al., Vaccine. JO, 75-88 (1992).

An additional embodiment of the present invention relates to a method of inducing an immune response in a subject, e.g,. mammal, comprising administering to the subject an amount of a DNA molecule encoding an isolated protein and/or peptide or polypeptide therefrom of this invention, optionally with a transfection-facilitating agent, where the protein and/or peptides or polypeptides retain immunogenicity and, when incorporated into an immune stimulating composition, e.g, vaccine, and administered to a human, provides protection without inducing enhanced disease upon subsequent infection of the human with S. pneumoniae pathogen. Transfection-facilitating agents are known in the art.

It is further contemplated that the antisense sequence of the gene encoding the about 15 kDa to about 25 kDa polypeptide, and the about 75 kDa to about 95 kDa polypeptide may be used as a vaccine or as a therapeutic treatment for pneumococcal infection. Antisense DNA is defined as a non-coding sequence that is complementary, i.e., a complementary strand, to all or a portion of SEQ T¹"¹ I O:l or SEQ ID NO:4. For example, the antisense sequence for 5'- ATGTCAAGC-3' is 3'-TACAGTTCG-5'. Delivery of antisense sequence or oligonuclotides into an animal may result in the production of antibody by the animal or in the incorporation of the sequence into living bacteria or other cells whereby transcription and/or translation of all or a portion of the 92 kDa gene product is inhibited.

Introduction of an antisense nucleic acid sequence can be accomplished, for example, by loading the antisense nucleic acid into a suitable carrier, such as a liposome, for introduction into pneumococci or infected cells. Typically, an antisense nucleic acid sequence having eight or more nucleotides is capable of binding to the bacterial nucleic acid or bacterial messenger RNA. The antisense nucleic acid sequence, typically contains at least about 15 nucleotides, preferably at least about 30 nucleotides or more nucleotides to provide necessary stability of a hybridization product of bacterial nucleic acid or bacterial messenger RNA. Introduction of the sequences preferably inhibit the transcription or translation of at least one endongenous S. pneumoniae nucleic acid sequence. Methods for loading antisense nucleic acid is known in the art as exemplified by U.S. Patent 4,242,046.

The present invention also provides nucleic acid having an open reading frame of 2478 bases (SEQ ID NO:4) that encompasses the open reading frame of a nucleic acid sequence (SEQ ID NO: 1 ) that encodes a polypeptide that has a molecular weight of about 20 kDa (SEQ ID NO:2). The 20 kDa polypeptide, described herein, is further characterized as a C3 -degrading polypeptide. The larger open reading frame, e.g., 2163 bp (SEQ ID NO:4), encodes for a putative polypeptide of about 92 kDa (SEQ ID NO:5). All references and publications cited herein are expressly incorporated by reference into this disclosure. There are a variety of alternative techniques and procedures available to those of skill in the art which would similarly permit one to successfully perform the intended invention in view of the present disclosure. It will be appreciated by those skilled in the art that while the invention has been described above in connection with particular embodiments and examples, the invention is not necessarily so limited and that numerous other embodiments, examn '^" ., uses, modifications and departures from the embodiments, example? and uses may be made without departing from the inventive scope of this application.

Example 1

Identification of Insertional Mutants with Reduced C3-Degrading Activity

Insertional mutants were received from Dr. Elaine Tuomanen, (Rockefeller Inst, New York, New York). The clones with insertions were tested in an assay to detect reduced C3-degrading activity. 137 clones were tested by growing the cells in Todd Hewitt broth overnight at room temperature in microtitre plates. The cells were diluted 1:10 in synthetic medium for pneumococci (see Sicard A. M., Genetics 50:31-44, 1984) and the remainder of the cells were frozen in the microtiter plate. Either 63 ng or 83 ng of C3 (purified from human plasma according to the method of Tack et al., Meth. Enzymol. 80:64-101, 1984) per 100 μl of medium containing 1 mg/ml of 0.1% BSA in phosphate buffered saline (PBS) was added to about 200 μl of diluted cells. The cells were incubated at 37°C for 4 hrs. One hundred μl of the mixture was added to ELISA plates and incubated overnight at 4°C. The plates were washed three times with wash buffer and the wells were filled with 0.05% Tween 20 in PBS with five minute incubations between the washes. One hundred μl of antibody to C3 (polyclonal horse-radish peroxidase-conjugated goat antibody specific to human C3-IgG fraction, ICN Cappel, Costa Mesa, CA) was diluted 1 : 1200 with 3% BSA in PBS. The ELISA plate was incubated at 37°C for about 30 minutes to 1 hr in the dark and washed with wash buffer as above. The assay was developed using 12 mg of OPD in 30 ml of 0.1 M sodium citrate buffer with 12 μl of 30% hydrogen peroxide. Assay results were determined by optical density readings at 490 nm on an ELISA plate reader.

Each clone was tested four times. Nineteen clones were selected that had less than 40% C3 degradation as compared to nonmutated controls. These 19 clones were screened 6 times by the assay described above and from these resu¹⁺' o clones were selected with less than 30% C3-degrading activity as compared to controls. These 6 clones were screened eleven times each and the two clones with the lowest C3-degrading activity were selected for further study.

A partial sequence of one of the clones was received and a Smal fragment of 546 bp was labeled with P by random primer labeling (kit available from Stratagene, La Jolla, CA). The 546bp Smal fragment from SEQ ID NO:l was hybridized to EcoRl and Kpnl digests of numerous pneumococcal strains on Southern blots. This same fragment was also used to screen a library of Sau3A fragments of genomic DNA from S. pneumoniae strain CP1200.

A 3.5 kb insert was identified from the CP1200 library. The insert was sequenced and an open reading frame of 492 base pairs, including the stop codon, was identified. The open reading frame coded for a polypeptide of 168 amino acids and a predicted molecular weight of about 18,500 daltons.

PCR primers were constructed to amplify the open reading frame; the 5' PCR primer incorporated a BamHI site; the 3' primer incorporated a Pstl site. The amplified insert was ligated in frame to a His-Tagged E. coli expression vector pQE30 (Qiagen, San Diego, CA). The resulting plasmid was used to transform E. coli strain BL21 (Novagen, Madison, WI) containing the lac repressor plasmid pREP4 (Qiagen). E. coli cultures were induced to express the His-Tagged polypeptide and the polypeptide was column purified with Ni-NTA resin (Qiagen). The purified polypeptide was confirmed by SDS-PAGE gel.

Example 2 Identification of a 20kDa C3-Degrading Polypeptide

To determine the C3-degrading capability of the 20 kDa polypeptide, 0.5 mg/ml of C3 (prepared according to Tack et al., Meth. Enzymol. 80:64-101,

1984) was copolymerized in a sodium dodecyl sulfate (SDS) gel-containing 15% acrylamide (15% SDS-PAGE gel). Pneumococcal supernatants were obtained from cultures of S. pneumoniae strain CP1200 grown to exponential phase in

Todd Hewitt broth; pneumococcal lysates were obtained by incubating 5 x 10 cells with 5% SDS for 30 minutes at room temperature. The lysate was concentrated 10 fold using a Centricon filtration device with a 10,000 mw cutoff (* r_^icon, Beverly, MA). The samples were not heated before electrophoresis. Samples of supernatants and lysates were added to the 15% C3-containing SDS- PAGE gels and electrophoresis was carried out at 4°C at 150 V until the dye front ran out. The gel was washed successively with 50 ml of 2.5% Triton X- 100 in water (2 times, 10 minutes), 2.5 % Triton X-100 in 50 mM Tris-HCl, pH 7.4 (2 times, 10 minutes), and 50 mm Tris-HCl, pH 7.4 (2 times, 10 minutes) to remove SDS. After washes, 50 ml of 50 mM Tris-HCl, pH 7.4, was poured into dishes containing the gels, and the dishes were covered and incubated at 37°C for 1.5 hour and overnight (about 16 hours). The gels were stained with Coomassie blue for 10 minutes and destained totally. Two lytic bands were visualized, one of which was about 20 kDa in size, against the dark blue background in both lysates and supernatant. C3 degrading activities in the pneumococcal lysates were observed after a 1.5 hour incubation at 37°C, while C3 degrading activities in the Pn supernatant were observed after an overnight incubation. Therefore, C3 degrading activities appeared to be mainly cell associated.

Example 3 The gene encoding the 20 kD polypeptide is conserved in a number of S. pneumoniae strains. DNA was obtained from a variety of S. pneumoniae strains (Clinical isolates of Type 1, Type 3, LOO2 and LOO3 (type 3), Type 4, Type 14 and Laboratory isolates CP1200, WU2, R6X, 6303,109,110, JY1119, JY182, and JY53) and SEQ ID NO:3 was used as a probe to detect the presence of nucleic acid encoding the 20 kD polypeptide in DNA from these strains. Isolated chromosomal DNA was digested with EcoRI and separated by electrophoresis. The DNA was transferred to a solid support and hybridized to end-labeled SEQ ID NO:3 under the hybridization and washing conditions of 6X SSC, 5X Denhart's, 0.5% SDS, 100 μg/ml denatured fragmented salmon sperm DNA hybridized at 65 °C overnight and washed in 2X SSC, 1 time at room temperature for 10 minutes and in 2X SSC, 0.1% SDS 1 time at 65°C for 15 minutes followed by two washes in 0.2X SSC, 0.1% SDS for 3 minutes each at υom temperature. Results indicated that SEQ ID NO: 3 hybridized identically in each of the DNA samples tested indicating that the polypeptide appears to be conserved among strains. In some strains, the DNA encoding the 20 kDa C3-degrading polypeptide appears to be part of a larger open reading frame of 2478 bp that putatively encodes a 92 kDa polypeptide.

Example 4 Southern blot of S. pneumoniae DNA probe

Five ug samples of genomic DNA were obtained from 11 strains ofS. pneumoniae. Each sample was digested with the restriction enzyme Kpnl. The samples were subsequently loaded onto an agarose gel and resolved by electrophoresis. The samples contained in the gel were subsequently transferred to a Hybond-N+ membrane available from Amersham (Upsalla, Sweden) by capillary transfer. A 540 bp Smal fragment from the open reading frame was random primer labeled with P using a ⁷QuickPrime kit (Pharmacia,

Piscathaway, NJ) and purified from non-incorporated nucleotides using NucTrap column (Stragene, La Jolla, CA) and hybridized.

The hybridization conditions were 6XSSC, 5X Denhardt, 0.5% SDS, and 100 μg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS once at room temperature for about 10 minutes followed by 1 time at, 65°C for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 3-5 minutes. The blot demonstrated that the 20 kDa gene was present in all tested strains of S. pneumoniae.

Example 5 Two DNA primers were prepared from SEQ ID NO:l and utilized to amplify the nucleotide sequence encoding the 20 kDa polypeptide from S. pneumoniae (serotype 3) genomic DNA. The first primer, a 5'-primer, SEQ ID NO:6, includes an ATG start codon of the 5' end of the nucleotide sequence, inserts a Ncol site, and had an Ala residue inserted after the ATG start codon to maintain a correct reading frame. The second primer, a 3'-primer LQ ID NO:7, includes a termination codon at the 3' end of the nucleotide sequence and inserts a BamHl site.

5'-GGGGG CCA TGG CC TCA AGC CTT TTA CGT GAA TTG-3'; (SEQ ID NO:6)

5'-GGGGG GGA TCC CTA GCT ATA TGA GAT AAA CTT TCC TGC T-3'; (SEQ ID NO:7) The two primers were synthesized on an Applied Biosystems 380A DNA synthesizer (Foster City, CA) using reagents purchased from Glen Research (Sterling, VA). Amplifications were performed utilizing a Perkin Elmer Thermocycler (ABI) according to the manufacturer's directions. The identified PCR product was ligated into the TA tailed PCR cloning vector PCR2.1, available from Invitrogen, Carlsbad, CA, and used to transform OneShot

Topi OF' competent cells (Invitrogen). Kanamycin resistant transformants were screened by restriction enzyme analysis of plasmid DNA prepared by alkaline lysis. An approximately 500 bp insert fragment was identified and subsequently excised with restriction enzymes Ncol and BamHl. The 500 bp fragment was purified from a low melting agarose gel, and subsequently ligated into the Ncol- BamHl sites of the T7 promoted expression vector pET 28a, available from Novagen ( Madison, WI).

The ligation mixture was subsequently transformed into ToplOF'cells (Invitrogen), and the kanamycin resistant transformants were screened by restriction enzyme analysis of plasmid DNA prepared by alkaline lysis. A recombinant plasmid (pLP505) was subsequently tranformed into BL21 (Novagen) cells and grown in SOB media supplemented with 30 μg/ml kanamycin. Cells were grown to an O.D.₆₀₀ of 0.6, and were subsequently induced with 0.4mM IPTG (Boehringer Mannheim, Indianapolis, Indiana) for 2- 4 hours. Whole cell lysates were prepared and electrophoresed on a 14% SDS- PAGE gel. The gel was stained with Coomassie and the expression product was detected. The coomassie stained gel revealed a band between the 28 kDa and the 18 kDa molecular weight markers, and was determined to be approximately 20 kDa.

The DNA sequence of the insert in the recombinant pLP505 plasmid was obtained using the ABI 370 A DNA sequencer. The DNA sequence was aligned with the DNA sequence of SEQ ID NO: 1 , using the Pustell DNA matrix plot feature of MacVector (Oxford Molecular Group, Campbell, CA). Alignment of the DNA sequence obtained from the pLP505 plasmid, SEQ ID NO:l, and the S. pneumoniae (serotype 4) genome, revealed that the open reading frame (ORF) that codes for the 20 kDa polypeptide may be part of a larger ORF, i.e., a 2478 bp in the serotype 4 genome, that codes for a polypeptide with a predicted MW of approximately 92 kDa (SEQ ID NO: 4). DNA SEQ ID NO:4 encodes for a predicted amino acid sequence as shown in SEQ ID NO:5.

The S. pneumoniae (serotype 4) genome sequence was obtained from

The Institute for Genomic Research at www.tigr.org and/or through NCBI at www.ncbi.nlm.nih.gov, using the ClustalW feature of MacVector, (Oxford

Molecular Group, Campbell CA). A sequence comparison was made between the 20 kDa amino acid sequence (SEQ ID NO:2) and the predicted 92 kDa amino acid sequence (SEQ ID NO:5).

Based upon the available genomic DNA (serotype 4) sequence, two primers flanking the 2478 bp ORF were designed and subsequently synthesized using the ABI 380A DNA synthesizer (SEQ ID NOS:8 and 9). SEQ ID NO:8 was an S. pneumoniae 5'-primer having an inserted Ncol site and a "Glu" residue added after the ATG start codon to maintain a correct reading frame.

SEQ ID NO:9, was an S. pneumoniae 3'-primer having an inserted Hindlll site.

5'- CCC GGG CCA TGG CTA AAA TTA ATA AAA AAT ATC TAG -3*; (SEQ ID NO:8)

5'-CCG GGC AAG CTT TTA CTT ACT CTC CT-3'-; (SEQ ID NO:9)

An approximately 2400 bp DNA fragment was then amplified from the 4 different S. pneumoniae serotypes (serotype 3, 5, 6B and 7) resulting in 4 fragments. Each of the 4 fragments were subsequently ligated into the PCR cloning vector PCR2.1 (Invitrogen), and used to transform OneShot Top 10F' cells (Invitrogen). Kanamycin resistant transformants were screened by restriction analysis of the plasmid DNA prepared by alkaline lysis. A recombinant plasmid containing the serotype 7 PCR product was identified, e.g., pLP512. The DNA sequence was obtained from the serotype 7 clone using the ABI model 370 A DNA sequencer. The DNA sequence was essentially identical to SEQ ID NO:4 and encoded a predicted amino acid sequence essentially identical to SEQ ID NO:5.

Example 6 Western blot detection of 92 kDa Polypeptide in Whole Pneumococci

Recombinant approximately 20 kDa C3 degrading polypeptide was purified from Escherichia coli strain BLR containing plasmid pDF122. Plasmid pDF122 contains the polynucleotide shown in SEQ ID NO: 1 expressed under control of the T7 phage promoter system. The bacterial cells were grown to mid- log phase in Hy-Soy/yeast Extract medium containing ampicillin to select for the plasmid. Expression of the recombinant polypeptide was induced by adding IPTG to a concentration of ImM and continuing incubation for an additional 3 hours. The bacterial cells were harvested by centrifugation and resuspended in Tris buffered saline, pH 7.2. Cells were mechanically lysed in a French Pressure cell and the insoluble material including inclusion bodies were pelleted in a centrifuge. The pellet was solubilized in 3 M Urea buffered with lOOmM NaPO₄, pH 8.0 containing 0.1% Triton X-100. After pelleting and discarding insoluble material (centrifuged at ~100,000 x g), the soluble r 20kDa polypeptide was exchanged into 0.1% Zwittergent 3-12 (Calbiochem-Behrng) replacing the Urea and then into 100 mM NaPO₄ pH 8.0 replacing the detergent. SDS-PAGE analysis confirmed that the -20 kDa material remained soluble. The His-tagged recombinant polypeptide was dialyzed into 50 mM NaPO₄ buffer, pH 8.0 and absorbed onto a Ni column equilibrated with the same buffer. The column was sequentially washed with 50 mM NaPO₄ at pH 7.0, 6.6, and 5.5 until baseline absorbances (OD₂₈₀) were reached with each buffer. The bound ~r20 kDa polypeptide was eluted with 50 mM NaPO₄, pH 4.5. The eluted polypeptide was approximately 90% homogeneous in SDS-PAGE analysis.

This polypeptide was used to immunize Swiss- Webster mice. Five μg doses of the polypeptide were mixed with 50 μg of Monophosphoryl lipid A (Ribi Immunochemicals) and injected intramuscularly into mice. Animals were immunized at weeks 0, 4, and 6 and exsangruinated at week 8. The sera were pooled together and found to contain high titered antisera against the immunogen.

Pneumococcal strains CP1200, T3, and T7 were grown in Todd-Hewitt broth containing yeast Extract and the cells pelleted by centrifugation.

Pneumococcal cells were lysed in SDS-PAGE cracking buffer under reducing conditions by boiling for 5minutes. The lysates were loaded onto a 10% SDS- PAGE gel and electrophoresed. Separated polypeptides were electroblotted onto Nitrocellulose and the filter blocked with 5% BLOTTO in phosphate buffered saline, pH 7.4. The polyclonal antisera was diluted 1 :2000 in BLOTTO and used to probe the separated polypeptides. Bound antibodies were detected with Alkaline phosphatase conjugated goat anti-mouse IgG. The Western Blot is shown in Figure 8 and described further in the brief description of the figures.

Example 7 Evidence of that the 20 kDa and 92 kDa Polypeptides Degrade C3

The gel shown in Figure 9 is a Western blot. This data were obtained by incubating a 20 kDa polypeptide and a 92 kDa polypeptide with biotinylated and methylamine-treated C3 as shown in the table below. These polypeptides were expressed from a T7 vector.

METHYLAMINE-TREATED C3: 500 μl of purified human C3 at concentration of 4.46 mg/ml (prepared according to the method of Tack et al., Meth. Enzymol. 80:64-101, 1984) was incubated with 55 μl of 1 M methylamine (CH₃NH₂) in 0.1 M TRIS/0.01 M EDTA, pH 8.0 for 80 minutes at 37°C, then diaiyzed overnight in 0.1 M TRIS/0.01 M EDTA, pH 8.0, at 4°C . The following day, the C3 was incubated again with 60 μl of 1 M methylamine in 0.1 TRIS/0.01 M EDTA for 80 minutes at 37°C, then dialyzed overnight in 50 mM NaHCO₃ at 4°C .

BIOTINYLATION of METHYLAMINE-TREATED C3: 2 mg of methylamine-treated C3, prepared above, was incubated with 75 μl of NSC- biotin (Pierce) made as 1 mg NSC biotin in 1 ml H₂0 for 30 minutes at room temperature. The biotinylated C3 was dialyzed overnight in 50 mM NaHCO₃, pH 8.0 at 4°C.

Samples from Tubes A and C were removed after 66 hours of incubation, reduced by boiling for 2 minutes in reducing buffer with β mercaptoethanol, electrophoresed on 7.5% SDS-PAGE, and transferred to nitrocellulose paper for Western blotting. Western blotting was carried out for one hour according to standard procedures (Tobin et al. PNAS USA 76:4350-4354, 1979). Membranes were incubated with horseradish-peroxidase-avidin (1 : 10,000 dilution) and developed with the Supersignal CL-HRP Substrate System (Amersham) to detect biotinylated C3 fragments.

In Figure 9 lane 1 is C3 alone (control), lanes 2 and 3 are the 20 and 92 kDa polypeptides, and lanes 4 and 5 are again C3 alone (controls). Along the right margin the position of the α-chain of C3, the β-chain of C3, and the C3 fragment present in the control samples are shown. The position of a C3 fragment in the 20 kDa digest and several fragments in the 92 kDa digest are identified.

The second experiment used the reagents of the first (expressed polypeptides, biotinylated C3, and buffer) in the s? _ proportion as shown in the table above. C3 control samples were removed at time 0, 2 hours, 8 hours, and 24 hours. However, instead of doing a Western blot, the samples were reduced on 7.5% SDS-PAGE, reasoning that some additional degradation fragments might not be biotinylated and would therefore show up on a Coomassie stained SDS-PAGE gel. Indeed, that is what was observed. Only the 20 (lane A8) and 92 (lane C8) kDa polypeptides were analyzed on this gel. The gel of Figure 10 shows along the right margin the position of the α-chain of C3 and the β-chain of C3, and the 92 kDa polypeptide in lane C8. In lane C8 are at least two fragments ranging in size from -90 kDa to 75 kDa. There are also several fragments beneath the β-chain at 75 kDa. In lane A8 is a major degradation fragment just below the β-chain of C3. Thus, both the 92 kDa polypeptide in lane C8 and the 20 kDa polypeptide in lane A8 degrade C3.

Example 8

Preparation of recombinant 92 kDa protein and generation of poyclonal anitsera

The insert in plasmid pLP512 (see Example 5) was excised with Ncol and Hindlll. A fragment of the expected size was purified from low melting point agarose, and subsequently ligated into the Ncol- Hindlll sites of the T7 promoted expression vector pET28a (Novagen, Madison, WI).

The ligation mixture was subsequently transformed into Topi OF' cells (Invitrogen) and the kanamycin resistant transformants were screened as described previously in Example 5. A recombinant plasmid (pLP515) was subsequently transformed into BL21 cells (Novagen) and grown in SOB media supplemented with 30 μg/ml kanamycin. Cells were grown to an O.D. ₆₀o of 0.6, and were subsequently induced with 0.4 mM IPTG (Boehringer Mannheim, Indianapolis, IN) for 2-4 hours. Whole cell lysates were prepared and electrophoresed on a 10% SDS-PAGE gel. Coomassie staining of the gel revealed a new band of approximately 80 kDa as compared to a pre-induction sample. Recombinant protein coded by the -92 kDa ORF was purified from E. coli strain BL21 (Novagen) containing the plasmid pLP515. Bacterial cells were grown to mid log phase in SOB medium containing 50 μg/ml kanamycin to select for the plasmid. Εxpresssion of the recombinant polypeptide was induced by addition IPTG to 0.4 mM and continuing incubation for 3 hours. The bacterial cells were harvested by centrifugation and resuspended in Tris-Buffered Saline, pH7.2. Cells were mechanically lysed in a French Pressure Cell and the insoluble material including inclusion bodies were pelleted in a centrifuge at 7700 x g at 4 degrees for 10 minutes. The pellet containing the inclusion bodies was resolubilized and the soluble protein was purified by ion exchange chromatography. Recombinant protein was used to generate polyclonal antibodies in mice. Briefly, 5 μg of protein was adjuvanted for each dose with 20 μg QS21 and injected subcutaneously into the necks of a 6-8 weeks Swiss Webster mice. The mice were bled and vaccinated at week 0, vaccinated at week 4, then bled and exsanguinated at week 6. 10 mice were vaccinated with the recombinant 92 kDa protein adjuvanted with QS21. Pooled sera were used at a 1:1000 dilution to examine whole cell lysates and concentrated culture supernatants from several serotypes of S. pneumoniae on a Western Blot. The sera reacted specifically to a protein in whole cell lysates and concentrated culture supernatants whose molecular weight was approximately 90 kDa.

Example 9

The chart of Figure 11 summarizes the results from an intranasal (IN) challenge of CB A/CAHN xid/J mice vaccinated with r92 kDa protein, prepared as described in Example 8 (SEQ ID NO:5) adjuvanted with monophosphoryl lipid A (MPL).

10 mice per group were vaccinated subcutaneously in the neck region at weeks 0, 3,and 5, with either 5 μg each of 92 kDa adjuvanted with 50 μg MPL, 1 μg each of Type 3 capsule conjugated to the protein carrier CRM197 adjuvanted with 100 μg aluminum phosphate, or phosphate buffered saline (PBS) alone, m a sample volume of 10 μl. CRM 197 is a genetically detoxified version of diptheria toxin. Each mouse was challenged in at week 7 with 1 x 10⁶ cfu's of Type 3 S. pneumoniae in a 10 μl sample volume. Nasal tissue was isolated 3 days after challenge and the number of type 3 S. pneumoniae colony- forming units per gram of nasal tissue determined by plating on selective media. Type 3 is capsule isolated from S.pneumoniae serotype 3, and then conjugated to protein carrier CRM 197, through reductive animation (see U.S. Patent No. 5, 360,897 for preparation of the Type 3 control; see U.S. Patent No. 5,614,382 for genetically detoxified version of ditheria toxin; see U.S. Patent 4,902,506 with regard to using CRM 197 as a carrier).

The chart in Figure 11 shows that in this model, both the negative controls, mice adjuvanted with MPL and naive mice at 6 weeks of age, had a survival rate of approximately 30% when challenged intranasally, while the positive control, the Type 3 conjugate adjuvanted with aluminum phosphate, offered 100% protection against death to the end of the study, approximately 14 days. When mice immunized with r92 kDa were challenged, 100% survived to the end of the study, indicating that r92 kDa protein does offer protection against death from intranasal challenge by Type 3 S. pneumoniae.

Example 10 METHODS Recombinant 92 kDa (r92 kDa) polypeptide (SEQ ID NO : 5) were incubated with purified human C3 for 2 hours, 6 hours, and 26 hours at 37°C in the following ratios:

Tube A rContron : C3 - 3μl [7.2x10-12 moles] PBS/0.01% bovine serum albumin (BSA) - 100 μl; Tube B: r92 kDa - 50 μl [5.6x10-10 moles] C3 - 3 μl [7.2x10-12 moles] PBS/0.01% BSA - 50 μl.

At each time point (2, 6, and 26 hours), 20 μl samples were removed from Tubes A and B reducing buffer was added, and the samples were boiled at 100°C for 2 minutes.

After boiling, samples were electrophoresed on 7.5% SDS-PAGE under reducing conditions. The SDS-PAGE gel was stained with Coomassie blue. The resultant gel is shown in Figure 12. Lane 1 - molecular weight standards (reading from top of gel: 200 kDa, 116 kDa, 97 kDa, 66 kDa, 45 kDa); Lanes 2 and 4 - 2 hour incubation; Lane 2 - C3 control (Tube A); Lane 4 - r92 kDa sample (Tube B); Lanes 5 and 7 - 6 hour incubation; Lane 5 - C3 control (Tube A); Lane 7 - r92 kDa sample (Tube B); Lanes 8 and 10 - 26 hour incubation; Lane 8 - C3 control (Tube A); Lane 10 - r92 kDa sample (Tube B).

INTERPRETATION of GEL The α-chain of C3 runs at about 115 kDa. The β-chain of C3 runs at about 75 kDa. These are marked on the gel. The band at about 66 kDa is albumin. Lanes 2 and 4 are the 2-hour incubation. Compared to Lane 2 (C3 control), Lane 4 shows cleavage of the C3 α-chain - new fragment at -97 kDa. Lanes 5 and 7 are the 6-hour incubation. There is the same new 97 kDa cleavage fragment in Lane 7. Lanes 8 and 10 are the 26-hour incubation. Compared to Lane 8 (C3 control), Lane 10 shows continued cleavage of the α-chain.

It will be appreciated by those skilled in the art that while the invention has been described above in connection with particular embodiments and examples, the invention is not necessarily so limited and that numerous other embodiments, examples, uses, modifications and departures from the embodiments, examples and uses may be made without departing from the inventive scope of this application.

Claims

What is claimed is:

1. An isolated polypeptide comprising an amino acid sequence; wherein the nucleic acid sequence encoding the amino acid sequence of the isolated polypeptide hybridizes under highly stringent hybridization conditions to at least a portion of either (a) the nucleotides in SEQ ID NO:l or a complementary strand thereof, or (b) the nucleotides in SEQ ID NO:4 or a complementary strand thereof.

2. The polypeptide of claim 1 which is isolated from S. pneumoniae.

3. The polypeptide of claim 1 which is a recombinant polypeptide.

4. The polypeptide of claim 1 having a molecular weight of about 15 kDa to about 25 kDa.

5. The polypeptide of claim 1 having a molecular weight of about 75 kDa to about 95 kDa.

6. The polypeptide of claim 1 which degrades human complement protein C3.

7. The polypeptide of claim 1 comprising at least 15 sequential amino acids.

8. An isolated polypeptide comprising at least 15 sequential amino acids of SEQ ID NO:2 or SEQ ID NO:5.

9. An isolated polypeptide comprising SEQ ID NO:2 or SEQ ID NO:5.

10. An immune system stimulating composition comprising an effective amount of the polypeptide of claim 1 and a therapeutically acceptable carrier.

11. The immune system stimulating composition of claim 10 wherein the polypeptide is isolated from S. pneumoniae.

12. The immune system stimulating composition of claim 11 further comprising at least one other immune system stimulating polypeptide isolated from S. pneumoniae.

13. The immune system stimulating composition of claim 10 wherein the polypeptide is effective to immunize or treat a mammalian subject against S. pneumoniae infection or colonization.

14. The immune system stimulating composition of claim 13 wherein the polypeptide is provided in an amount effective to provide a therapeutic effect to the mammalian subject.

15. An antibody capable of binding to the polypeptide of claim 1.

16. The antibody of claim 15 which is a monoclonal antibody.

17. The antibody of claim 16 which is obtained from a mouse, a rat, a goat, a chicken, a human, or a rabbit.

18. An isolated nucleic acid molecule which hybridizes under highly stringent hybridization conditions to at least a portion of either (a) the nucleotides in SEQ ID NO:l or a complementary strand thereof, or (b) the nucleotides in SEQ ID NO:4 or a complementary strand thereof.

19. The nucleic acid molecule of r' ini 18 isolated from S. pneumoniae.

20. The nucleic acid molecule of claim 19 which encodes a polypeptide that degrades human complement C3.

21. A vector comprising the nucleic acid molecule of claim 18.

22. A cell comprising the nucleic acid of claim 18.

23. The cell of claim 22 which is a bacterium or a eukaryotic cell.

24. An isolated nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1 or its complementary strand or SEQ ID NO:4 or its complementary strand.

25. An RNA molecule transcribed by a double-stranded DNA sequence comprising SEQ ID NO:l or SEQ ID NO:4.

26. A method for producing an immune response to S. pneumoniae in a mammal, the method comprising administering to a mammal a composition comprising:

(a) a therapeutically effective amount of the polypeptide of claim 1; and

(b) a pharmaceutically acceptable carrier.

27. The method of claim 26 wherein the immune response is a B cell response, a T cell response, an epithelial cell response, or an endothelial cell response.

28. The method of claim 26 wherein the polypeptide is at least 15 amino acids in length.

29. The method of claim 26 wherein the composition further comprises at least one other immune system stimulating polypeptide from S. pneumoniae.

30. A method for inhibiting S. pneumoniae-mediated C3 degradation, the method comprising contacting an S. pneumoniae bacterium with an antibody capable of binding to the polypeptide of claim 1.

31. A method for inhibiting C3 -mediated inflammation and rejection in xenotransplantation, the method comprising expressing on the surface of an organ of an animal used in xenotransplantation the polypeptide of claim 1.

32. An isolated nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9.

33. An isolated polypeptide having at least 80% sequence identify to SEQ ID NO:2 or SEQ ID NO:5.

34. An isolated polypeptide of about 15 kDa to about 25 kDa from S. pneumoniae that degrades human complement protein C3.

35. An isolated polypeptide of about 75 kDa to about 95 kDa from S. pneumoniae that degrades human complement protein C3.