WO2000015265A1 - Compositions et techniques permettant d'utiliser des mecanismes d'incorporation pour des applications diagnostiques et therapeutiques d'oligonucleotides ciblant des bacteries - Google Patents

Compositions et techniques permettant d'utiliser des mecanismes d'incorporation pour des applications diagnostiques et therapeutiques d'oligonucleotides ciblant des bacteries Download PDF

Info

Publication number
WO2000015265A1
WO2000015265A1 PCT/US1999/021950 US9921950W WO0015265A1 WO 2000015265 A1 WO2000015265 A1 WO 2000015265A1 US 9921950 W US9921950 W US 9921950W WO 0015265 A1 WO0015265 A1 WO 0015265A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
antisense oligonucleotide
seq
uptake
antisense
Prior art date
Application number
PCT/US1999/021950
Other languages
English (en)
Inventor
Wilfried Seifert
Original Assignee
Vitagenix, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vitagenix, Inc. filed Critical Vitagenix, Inc.
Priority to AU62589/99A priority Critical patent/AU6258999A/en
Publication of WO2000015265A1 publication Critical patent/WO2000015265A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01005—Urease (3.5.1.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3513—Protein; Peptide

Definitions

  • This invention relates generally to the field of therapeutic and diagnostic compositions and methods and more specifically to antisense oligonucleotides as antibiotics and antibacterial agents.
  • transformation in which extracellular DNA is taken up by recipient bacteria
  • conjugation in which genetic information is passed from one bacterium to another by cell-to-cell contact
  • Competence allows the acquisition of traits from genetically distinct organisms or by mutation and can aid the repair of damaged chromosomes (2,6).
  • the acquisition of natural competence is regulated by proteins that are not expressed all the time. The exception to this is N. gonorrhoeae, which appears to be constitutively competent.
  • H. influenzae the development of competence seems to be cell autonomous, meaning each cell appear to be able to develop into the competent state without any regulatory input from other cells.
  • competence development in S. pneumoniae and B. subtilis is regulated by cell- cell signals.
  • Transformation can facilitate evasion of the host defenses (4), aid the repair of damaged chromosomes and magnify the horizontal transfer of antibiotic resistance determinants (5).
  • Current understanding of transformation process comes mainly from studies with Gram-negative species N. gonorrhoeae, H. influenzae and Gram-positive species S. pneumoniae, B. Subtilis (7-10).
  • the present invention provides an antisense oligonucleotide which interacts with and inhibits translation of a target nucleic acid sequence in a bacteria, wherein the target nucleic acid sequence encodes a protein selected from the group consisting of enzymes for biosynthesis of cell wall proteins, ribosomal RNA, ribosomal proteins, proteins essential for nutrient uptake, proteins associated with pathogenesis, subunits of DNA-dependent RNA polymerase and DNA polymerase.
  • the bacteria can be a gram-negative bacteria selected from Haemophilus influenzae, Helicobacter pylori, Neisseria gonorrhoeae, E.
  • the antisense oligonucleotide is DNA or RNA.
  • the antisense oligonucleotide has a sequence selected from the group consisting of SEQ ID Nos 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 and wherein the sequence interacts with a babA2 polynucleotide sequence of Helicobacter pylori.
  • the antisense oligonucleotide has a sequence selected from the group consisting of SEQ ID Nos 13, 14, 15, 16, 17, 18, 19, 20, 21, and 22, and wherein the sequence interacts with a babA2 polynucleotide sequence of Helicobacter pylori.
  • the antisense oligonucleotide has a sequence selected from the group consisting of SEQ ID Nos 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, and 42 and wherein the sequence interacts with a urease polynucleotide sequence of Helicobacter pylori.
  • the antisense oligonucleotide has a sequence selected from the group consisting of SEQ ID Nos 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, and 60 and wherein the sequence interacts with a PTS operon polynucleotide sequence of Haemophilus influenzae.
  • the antisense oligonucleotide also includes a sequence selected from the group consisting of SEQ ID Nos 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, and 72.
  • the antisense oligonucleotide can also be operable linked to a nucleic acid uptake sequence as set forth in SEQ ID NO: 73, or 74 or modifications thereof.
  • the present invention provides a method for inhibiting a disease associated with a bacterial infection, comprising administering to a subject having the disease a therapeutically effective amount of a composition containing an antisense oligonucleotide which interacts with and inhibits translation of a target nucleic acid sequence in a bacteria, wherein the target nucleic acid sequence encodes a protein selected from the group consisting of enzymes for biosynthesis of cell wall proteins, ribosomal RNA, ribosomal proteins, proteins essential for nutrient uptake, proteins associated with pathogenicity, subunits of DNA-dependent RNA polymerase or DNA polymerase.
  • the subject can be a mammal and is preferably a human.
  • the present invention provides a method of inhibiting bacterial cell growth and pathogenesis, comprising contacting a sample with an inhibiting effective amount of an antisense oligonucleotide which interacts with and inhibits translation of a target nucleic acid sequence in a bacteria, wherein the target nucleic acid sequence encodes a protein selected from the group consisting of enzymes for biosynthesis of cell wall proteins, ribosomal RNA, and ribosomal proteins, subunits of DNA-dependent RNA polymerase or DNA polymerase.
  • the present invention provides oligonucleotide uptake sequence linked to antisense oligonucleotides (which may be chemically modified) for both therapeutic and diagnositic applications.
  • the present invention provides a chimeric antisense oligonucleotide, comprising an antisense oligonucleotide linked to an uptake sequence.
  • the present invention provides a pharmaceutical combination comprising the chimeric antisense oligonucleotide of claim 48 and a pharmaceutically acceptable carrier.
  • Figure 1 is a schematic representation of the chimeric antisense molecule of the invention. 1) Shows the uptake sequence linked to the antisense molecule via a linker sequence or moiety. 2) Shows uptake sequences present at both the 5' and 3' end of the antisense molecule of the invention. 3) Shows a peptide uptake sequence linked to an antisense molecule of the invention. 4) Shows a peptide uptake sequence at both the 5' and 3' end of an antisense molecule of the invention.
  • the present invention is based upon the inventor's discovery that therapeutic oligonucleotides and diagnostic molecules are capable of directed uptake by pathogenic and non-pathogenic bacteria.
  • the uptake mechanism allows for species specific uptake of novel oligonucleotide sequences useful as antibiotics and diagnostic molecules.
  • antibiotic oligonucleotides include, for example, antisense molecules and ribozymes (see, for example, WO 98/03533, the disclosure of which is incorporated herein by reference).
  • Diagnostic molecules include any number of reporter constructs containing, for example, fluorescent moieties and chemicals.
  • the methods and compositions of the invention are applicable to a wide range of prokaryotes, including, for example, gram-negative and gram-positive bacteria.
  • the present invention is directed to therapeutic oligonucleotides useful in treating diseases or disorders associated with a bacterial infection.
  • bacteria have natural mechanisms for directed uptake of nucleic acid sequences.
  • the inventor has discovered that by linking a therapeutic oligonucleotide sequence (e.g., an antisense or ribozyme sequence) to the directed uptake sequence, the therapeutic molecules can be actively taken up by the pathogenic bacteria resulting in bacterial cell death or loss of virulence.
  • diagnostic molecules can be linked to the directed uptake sequences and are useful in differentiating between bacterial species in a sample, as well as, determining the presence or absence of a bacteria in a sample.
  • Naturally transformable bacteria species have developed specific systems that increase the efficiency of transformation. Those processes are mediated in general in Gram-positive bacteria by cell density signals and in Gram-negative bacteria by uptake signal sequences.
  • gram-positive bacteria e.g., S. pneumoniae and B. subtilis
  • cells release a competence activator protein into the medium and synthesize binding proteins, which are a single stranded DNA- binding proteins directly involved in DNA transfer (11).
  • a 17 amino acid activator has been purified and chemically synthesized from culture supernatants of S. pneumoniae (14). DNA is bound, with no apparent sequence specificity, at a finite number of sites on the cell surface.
  • the DNA undergoes double-strand cleavage (12) and one strand, chosen at random, is taken into the cell while the other strand is degraded outside the cell (13).
  • the single strand makes a complex with mentioned earlier protein to gain the protection against nucleases and then integrates in homologous regions of the recipient chromosome.
  • the heteroduplex is thought to be formed by the assimilation of the donor strand concomitant with the displacement of the corresponding recipient strand.
  • B. subtilis about 70% of the single-stranded homologous DNA taken up into the cytoplasm is integrated (10). Since those Gram-positive bacteria take up DNA independent of nucleotide sequence, species-specific signaling factor would limit competence development to the presence of their own species allowing DNA exchange between similar cells.
  • Gram-negative bacteria contain an outer membrane not present in Gram-positive, which dictates different mechanism of DNA uptake.
  • DNA binding to the cell is sequence specific and translocation across the outer membrane is promoted by pore-forming proteins (13). DNA binding specificity is due to the recognition of species-specific, short uptake sequences in the DNA.
  • the various members of the Hemophilus species group are preferentially transformed by DNA bearing a sequence containing a nine-pair core sequence AAGTGCGGT (SEQ ID NO:73) within an extended consensus region of 29 base-pairs.
  • the H. influenzae genome contains 1465 copies of this core sequence, which stimulate the process of DNA uptake into the recipient cell (15-17).
  • D ⁇ A transfer in this Gram-negative bacteria is different than in other species (26).
  • Exogenous D ⁇ A containing uptake sequences is encapsulated into a membraneous vesicle called "transformasome" containing uptake sites, and transported to cytoplasm.
  • transformasome a membraneous vesicle containing uptake sites
  • double stranded D ⁇ A is degraded to single strands before one of them is released into the recipient cell's cytoplasm.
  • target specific sequences or "uptake sequences” is meant a polypeptide or oligonucleotide sequence used for uptake of nucleic acids into a cell.
  • sequences include, for example, SEQ ID ⁇ O:73 and SEQ ID NO:74.
  • SEQ ID ⁇ O:73 and SEQ ID NO:74.
  • a polynucleotide or “nucleic acid sequence” refers to a polymeric form of nucleotides at least 8 bases in length.
  • isolated nucleic acid sequence is meant a polynucleotide that is not immediately contiguous with either of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent of other sequences.
  • the nucleotides of the invention can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide.
  • the term includes single and double stranded forms of DNA.
  • polynucleotide(s) generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or
  • polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide includes DNAs or RNAs as described herein that ⁇ _ contain one or more modified bases.
  • DNAs or RNAs with backbones or sugars modified for stability or for other reasons are "polynucleotides" as that term is intended herein.
  • DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples are polynucleotides as the term is used herein.
  • polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia.
  • sequences containing less than or more than the number of nucleotide bases of SEQ ID Nos: 73 and 74 are encompassed by the present invention. For example, shorter or longer sequences may be synthesized by any number of techniques and assayed for the requisite biological activity
  • the present invention has applicability to a large number of bacterial species and in the treatment and diagnosis of a number of bacterial associated diseases.
  • Helicobacter pylori is an important human pathogen which causes both gastric and duodenal ulcers and has also been associated with gastric cancer and lymphoma.
  • Helicobacter pylori (HP) is now recognized as the human-specific gastric pathogen isolated first in 1982 (27). This microorganism has been shown to express cell surface glycoconjugates including Lewis X, Lewis Y, and sialyl Lewis X. These bacterial oligosaccharides are structurally similar to tumor-associated carbohydrate antigens found in mammals.
  • H. pylori isolate has been associated with an increased risk for development of gastric cancer (Wirth, H.-P., Yang, M., Karita, M., and Blaser, M. J. (1996) Infect. Immun. 64, 4598-4605).
  • This pathogen is highly adapted to colonize human gastric mucosa and may remain in the stomach with or without causing symptoms for many years.
  • H pylori elicits local as well as systemic antibody responses, it escapes elimination by the host immune response due to its sequestered habitation within human gastric mucosa.
  • Another mechanism by which H. pylori may protect itself from the action of the host immune response is the production of surface antigens mimicking those in the host.
  • HP infection is also associated with gastric carcinoma (31) and gastric lymphoma (32).
  • HP has a unique affinity for the gastric epithelium, adhering to those cells easily (33), in particular to the antral mucosa, This mechanism protects the bacteria from the extreme acidity and displacement from the stomach by gastric emptying and peristalsis forces.
  • HP can reduce both the viscosity of the mucus and the thickness of the mucus layer covering the gastric epithelium (34).
  • the adherence to human gastric epithelial cells is mediated by the fucosylated blood group antigens Lewis b (Le-b) and H-l (35).
  • Various strains of HP are found to bind fucosylated blood group antigens, which correlated with their adherence properties in situ ( 35,36).
  • High prevalence of blood group antigen-binding (BAB) activity at 66% are found among 95 clinical isolates of HP (37).
  • the BabA adhesin is detected on the bacterial cell outer membrane by probing with Le-b antigen and shows conserved molecular mass in strains from Sweden, Australia and South America.
  • the functional babA2 gene contains an insert of 10 base pairs with a repeat motif in the signal peptide sequence, which created a translational initiation codon (37). It is suspected that BabA-mediated adherence of HP to gastric epithelium plays a crucial role in damaging host tissue leading to ulcer disease. HP utilizes a uniquely inhospitable environment of gastric epithelium with very acidic milieus, adapts to it and proliferates using another special developmental characteristic. The ability to colonize the mucus layer overlying the gastric epithelium (38), where a pH gradient ranges from pH 2 to nearly neutral (39).
  • HP The movement within the viscous mucus layer permits HP to escape from extremely low pH.
  • HP must survive exposure to very acidic pH producing large amounts of urease, which hydrolyzes urea to ammonia and carbon dioxide (40).
  • the survival of HP at low pH is dependent on urease activity (41) by producing a protective alkaline cloud or by providing a bacterial nitrogen source (42).
  • HP mutants defective in production of urease subunits (43) are more sensitive to low pH and fail to colonize gnotobiotic piglets (44).
  • HP survival in vitro at a pH of below 4 is significantly enhanced in the presence of urea (40).
  • Genes encoding HP urease revealed a high degree of homology to all other known ureases.
  • HP urease is composed of six copies each of the 66-kDa (UreB) and 29.5-kDa (UreA) subunits (44).
  • HP urease gene cluster contains nine genes, including UreA and UreB structural genes, as well as regulatory genes involved in the synthesis and assembly of the enzyme (45).
  • Individual HP strains show a strong diversity in their genome, which indicate the ability for acquiring exogenous DNA through the natural competence. Many HP strains are naturally competent for transformation in vitro (53), however other mechanism of conjugation-like involving cell-to-cell contact is suggested (54). Since HP is a Gram-negative bacteria it is possible that DNA transformation is mediated specific uptake sequence. The whole genome sequence of H. pylori 26695 had been published, which will undoubtedly facilitate the genetic studies of H. pylori.
  • the methods and compositions of the invention are applicable to a large number of bacteria.
  • the Gram-negative bacteria are a diverse group of organisms and include Spirochaetes such as Treponema and Borrelia, Gram-negative bacilli including the Pseudomonadaceae, Legionellaceae, Enter obacteriaceae, Vibrionaceae, Pasteurellaceae, Gram-negative cocci such as Neisseriaceae, anaerobic Bacteroides, and other Gram-negative bacteria including Rickettsia, Chlamydia, and Mycoplasma.
  • Gram-negative bacilli (rods) are important in clinical medicine.
  • the Gram- negative bacilli are the principal organisms found in infections of the abdominal viscera, peritoneum, and urinary tract, as well secondary invaders of the respiratory tracts, burned or traumatized skin, and sites of decreased host resistance. Currently, they are the most frequent cause of life-threatening bacteremia. Examples of pathogenic Gram-negative bacilli are E.
  • coli (diarrhea, urinary tract infection, meningitis in the newborn), Shigella species (dysentery), Salmonella typhi (typhoid fever), Salmonella typhimurium (gastroenteritis), Yersinia enterocolitica (enterocolitis), Yersinia pestis (black plague), Vibrio cholerae (cholera), Campylobacter jejuni (enterocolitis), Helicobacter jejuni (gastritis, peptic ulcer), Pseudomonas aeruginosa (opportunistic infections including burns, urinary tract, respiratory tract, wound infections, and primary infections of the skin, eye and ear), Haemophilus influenzae (meningitis in children, epiglottitis, otitis media, sinusitis, and bronchitis), and Bordetella pertussis (whooping cough).
  • Vibrio is a genus of motile, Gram-negative rod-shaped bacteria (family Vibrionaceae). Vibrio cholerae causes cholera in humans; other species of Vibrio cause animal diseases. E. coli colonize the intestines of humans and warm blooded animals, where they are part of the commensal flora, but there are types of E. coli that cause human and animal intestinal diseases. They include the enteroaggregative E. coli (EaggEC), enterohaemorrhagic E. coli (EHEC), enteroinvasive E.coli (EIEC), enteropathogenic E. coli (EPEC) and enterotoxigenic E. coli (ETEC). Uropathogenic E.
  • EaggEC enteroaggregative E. coli
  • EHEC enterohaemorrhagic E. coli
  • EIEC enteroinvasive E.coli
  • EPEC enteropathogenic E. coli
  • ETEC enterotoxigenic E. coli
  • UPEC urinary tract infections.
  • NMEC neonatal meningitis E. coli
  • animal diseases including: calf septicaemia, bovine mastitis, porcine oedema disease, and air sac disease in poultry.
  • the pathogenic bacteria in the Gram-negative aerobic cocci group include Neisseria, Moraxella (Branhamella) , and the Acinetobacter.
  • the genus Neisseria includes two important human pathogens, Neisseria gonorrhoeae (urethritis, cervicitis, salpingitis, proctitis, pharyngitis, conjunctivitis, pharyngitis, pelvic inflammatory disease, arthritis, disseminated disease) and Neisseria septicemia, pneumonia, arthritis, urethritis).
  • Gram-negative aerobic cocci that were previously considered harmless include Moraxella (Branhamella) catarrhalis (bronchitis and bronchopneumonia in patients with chronic pulmonary disease, sinusitis, otitis media) has recently been shown to be an common cause of human infections.
  • the Neisseria species include N. cinerea, N. gonorrhoeae, N. gonorrhoeae subsp. kochii, N lactamica, N. meningitidis, N. polysaccharea, N mucosa, N. sicca, N. subflava, the asaccharolytic species N. flavescens, N. caviae, N. cuniculi and N. ovis.
  • the strains of Moraxella (Branhamella) catarrhalis are also considered by some taxonomists to be
  • Neisseria Other related species include Kingella, Eikenella, Simonsiella, Alysiella, CDC group EF-4, and CDC group M-5.
  • Veillonella are Gram-negative cocci that are the anaerobic counterpart of Neisseria. These non-motile diplococci are part of the normal flora of the mouth.
  • infectious bacteria which are subject to the methods and compositions of the present invention include: Helicobacter pylons, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A
  • Streptococcus Streptococcus
  • Streptococcus agalactiae Group B Streptococcus
  • Streptococcus viridans group
  • Streptococcus faecalis Streptococcus bovis
  • Streptococcus anaerobic sps.
  • Streptococcus pneumoniae pathogenic Campylobacter sp.
  • Enterococcus sp. Haemophilus influenzae
  • Bacillus antracis corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae
  • Clostridium perfringers Clostridium tetani
  • Enterobacter aerogenes Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp.
  • oligonucleotide e.g., antisense
  • the antisense oligonucleotides of the present invention can effectively kill or inhibit the growth of bacteria, including gram-positive and gram-negative bacteria and can be used to treat disease associated with bacterial infections as well as for diagnostics to identify bacterial cell types.
  • the antisense oligonucleotides can be delivered to cells in culture or to cells or tissues in humans or delivered in animal models having these diseases. Binding of a targeted polynucleotides sequence by an antisense oligonucleotide of the invention can be used to inhibit bacterial cell growth and/or bacterial cell infection.
  • antisense oligonucleotide means any RNA or DNA molecules which can bind specifically with a targeted polynucleotide sequence, interrupting the expression of that gene's protein product.
  • the antisense molecule binds to either the messenger RNA or pre- mRNA forming a double stranded molecule which cannot be translated by the cell (which may be subsequently degraded by RNaseH) or to the DNA or other polynucleotide encoding a targeted polynucleotide sequence or protein thought to be associated with pathogenicity
  • Antisense oligonucleotides of about 8 to 40 nucleotides and more preferably about 10-30 are preferred since they are easily synthesized and have an inhibitory effect just like antisense RNA molecules.
  • chemically reactive groups such as iron-linked ethylenediaminetetraacetic acid (EDTA-Fe) can be attached to an antisense oligonucleotide, causing cleavage of the RNA at the site of hybridization.
  • Transcript RNA is RNA which contains nucleotide sequence encoding a protein product.
  • the transcript RNA is messenger RNA (mRNA).
  • mRNA messenger RNA
  • mRNA is a single-stranded RNA molecule that specifies the amino acid sequence of one or more polypeptide chains.
  • Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific transcript RNA molecule (Weintraub, Scientific American, 262:40,
  • the antisense nucleic acids hybridize to the corresponding transcript RNA, forming a double-stranded molecule.
  • the antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate a mRNA that is double- stranded.
  • Mechanisms involved in the antisense approach to therapeutics include, for example, the hybridization arrest mechanism (Miller et al., Anti-Cancer Drug Design 2:117- 128, 1987) or cleavage of hybridized RNA by the cellular enzyme ribonuclease H (RNase H) (Walder, R.
  • Antisense oligomers of about 10 to 25 nucleotides are preferred, since they are easily synthesized and are less likely to cause problems than larger molecules when introduced into the targeted bacterial cell.
  • the use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus- Sakura, Anal.Biochem. , 172:289, 1988).
  • triplex strategy Use of oligonucleotides to stall transcription is known as the triplex strategy since the oligomer winds around double-helical DNA, forming a three-strand helix. Therefore, these triplex compounds can be designed to recognize a unique site on a chosen gene (Maher, et al, 1991, Antisense Res. and Dev., 1(3):227; Helene, C, 1991, Anticancer Drug Design, 6(6 ⁇ :569).
  • nucleic acid refers to a polymer of deoxyribonucleotides or ribonucleotides, in the form of a separate fragment or as a component of a larger construct.
  • nucleic acids can be assembled from cDNA fragments or from polynucleotides to generate a synthetic gene which is capable of being expressed in a recombinant transcriptional unit.
  • Oligonucleotide or nucleic acid sequences of the invention include DNA, RNA, and cDNA sequences.
  • a “promoter” is a minimal DNA sequence sufficient to direct transcription of a DNA sequence to which it is operably linked.
  • a “promoter” also includes promoter elements sufficient for promoter-dependent gene expression controllable for cell-type specific __ expression, tissue-specific expression, or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the native gene.
  • inhibit or “inhibiting” activity is to reduce that activity a measurable amount, preferably a reduction of at least 30%) or more. Where there are multiple different activities that may be inhibited, the reduction of any single activity (with or without the other activities) is sufficient to fall within the scope of this definition.
  • To “specifically bind” is to preferably hybridize to a particular polynucleotide species.
  • the specificity of the hybridization can be modified and determined by standard molecular assays known to those skilled in the art.
  • a “suppressive-effective" amount is that amount of the antisense construct, administered in an amount sufficient to suppress the expression of the target, e.g. , inhibit translation of mRNA, by at least 75% of the normal expression, and preferably by at least 90%o.
  • the effectiveness of the construct can be determined phenotypically or by standard Northern blot analysis or immunohistochemically, for example. Other standard nucleic acid detection techniques or alternatively immunodiagnostic techniques will be known to those of skill in the art (e.g. , Western or Northwestern blot analysis).
  • the present invention provides a method for ameliorating or inhibiting diseases associated with a bacterial infection. Inhibition is achieved by administering to the cell, tissue or subject an antisense oligonucleotide sequence which is capable of hybridizing to the nucleic acid sequence of a target polynucleotide sequence (e.g., a gene, or gene-transcript associated with pathogenicity, replication or growth).
  • a target polynucleotide sequence e.g., a gene, or gene-transcript associated with pathogenicity, replication or growth.
  • the invention additionally provides antisense oligonucleotides which reduce expression of genes associated with pathogenicity, replication, and growth in various bacterial species as described more fully herein.
  • An antisense oligonucleotide of the invention has a sequence that is complementary to, and thus hybridizes with the nucleic acid sequence of the target polynucleotide. However, absolute complementarity is not required.
  • the polynucleotide sequence of the target sequence can be either a DNA or an RNA sequence.
  • the target includes sequence upstream from the 5' terminus of the structural gene, such as regulatory sequences, and sequences downstream from the 3' terminus of the structural gene as well as sequences in the coding region of the gene.
  • An antisense oligonucleotide is "complementary" to the target oligonucleotide, and thus useful according the invention, if it is capable of forming a stable duplex or triplex with, at least part of, the target polynucleotide sequence of the target so that processing, transcription or translation of the polynucleotides is inhibited, or capable of forming a complex, such as a triplex, with genomic DNA of the gene so that promotion of transcription is inhibited or premature transcript termination is produced. (Green et al, 1990 Clinical Biotechnology, 2:75).
  • the antisense molecule hybridizes to the target polynucleotide
  • stable duplex or triplex formation depends on the sequence and length of the hybridizing polynucleotide and the degree of complementarity between the antisense molecule and the target sequence.
  • the system can tolerate less fidelity (complementarity) when a longer oligonucleotide is used.
  • oligonucleotides of about 8 to about 40 bases in length and having sufficient complementarity to form a duplex having a melting temperature of greater than about 40 °C under physiological conditions are particularly well suited for practice of the invention (Thoung, et al, 1987 PNAS USA, 84:5129; Wilson et al, 1988 Nucleic Acids Res., 16:5137; Maniatis, et al, Molecular Cloning: A Laboratory Manual, Old Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1982). Accordingly, such oligonucleotides are preferred.
  • the antisense molecules of the invention have a specific substrate binding portion which is complementary to a target region of the polynucleotide being targeted, and have nucleotide sequences within or surrounding the substrate binding site which impart the ability to selectively hybridize to relative portions of the target polynucleotide. Seventy-two illustrated target binding sequences, corresponding to antisense molecules having SEQ ID NOs: 1-72 are provided and described herein. These exemplary antisense molecules were designed to hybridize to different sites on various polynucleotide sequences corresponding to pathogenicity, replication and growth.
  • the antisense oligonucleotides employed may be unmodified or modified RNA or DNA molecules. Suitable modifications include, but are not limited to, the ethyl or methyl phosphorate modification disclosed in U.S. Pat. No. 4,469,863, the disclosure of which is incorporated by reference, and the phosphorothioate modifications to deoxynucleotides described by LaPlanche, et al, 1986 Nucleic Acids Research, 14:9081, and by Stec, et al, 1984 J Am. Chem Soc. 106:6077.
  • the modification to the antisense oligonucleotides is preferably a terminal modification in the 5 ' or 3' region. Preferred are modifications of the 3' terminal region.
  • Phosphodiester-linked oligonucleotides are particularly susceptible to the action of nucleases in serum or inside cells, and therefore in a one embodiment the antisense molecules of the present invention are phosphorothioate or methyl phosphonate-linked analogues, which have been shown to be nuclease-resistant.
  • Specific examples of oligonucleotides envisioned for this invention may contain phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar ("backbone”) linkages.
  • phosphorothioates include those with CH 2 NHOCH 2 , CH 2 N(CH 3 )OCH 2 , CH 2 ON(CH 3 ) CH 2 , CH 2 N(CH 3 )N(CH 3 )CH 2 and ON(CH 3 )CH 2 CH 2 backbones (where phosphodiester is OPOCH 2 ). Also included are oligonucleotides having morpholino backbone structures (Summerton, J.E. and Weller, D.D., U.S. Pat. No. 5,034,506).
  • 2'-methylribonucleotides Inoue, et al, 1987 Nucleic Acids Research, 15:6131
  • chimeric oligonucleotides that are composite RNA-DNA analogues Inoue, et al, 1987 FEBS Lett., 215:327) may also be used for the purposes described herein.
  • DNA analogues such as peptide nucleic acids (PNA) are also included (Egholm, et al, 1993 Nature 365:566; P.E. Nielsen, M. Egholm, R.H. Berg, O. Buchardt, 1991 Science, 254:1497) and can be used according to the invention.
  • PNA peptide nucleic acids
  • oligonucleotides may contain alkyl and halogen-substituted sugar moieties comprising one of the following at the 2' position: OH, SH, SCH 3 , F, OCN, OCH 3 OCH 3 , OCH 3 O(CH 2 )nCH 3 , O(CH 2 ) nNH 2 or O(CH 2 )nCH3 where n is from 1 to about 10; Cl to CIO lower alkyl, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF 3 ; OCF 3 ; O , S , or N-alkyl; O, S or N alkenyl; SOCH 3 ; SO 2 CH 3 ; ONO 2 ; NO 2 ; N 3 ; NH 2 ; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a cholesteryl group; a
  • Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
  • Other embodiments may include at least one modified base form or "universal base” such as inosine.
  • the preparation of base-modified nucleosides, and the synthesis of modified oligonucleotides using said base-modified nucleosides as precursors, has been described, for example, in U.S. Patents 4,948,882 and 5,093,232. These base-modified nucleosides have been designed so that they can be incorporated by chemical synthesis into either terminal or internal positions of a oligonucleotide.
  • nucleosides present at either terminal or internal positions of a oligonucleotide, can serve as sites for attachment of a peptide or other molecule.
  • Nucleosides modified in their sugar moiety have also been described (e.g., U.S. Patent 5,118,802 and U.S. Patent 5,681,940) and can be used similarly. Persons of ordinary skill in this art will be able to select other linkages for use in the invention. These modifications also may be designed to improve the cellular uptake and stability of the oligonucleotides.
  • the modification or site of modification will vary (e.g., 5' or 3' modification).
  • the cells In order for the target cell, tissue or subject to be rendered susceptible to the antisense oligonucleotides in accordance with the method of the invention, the cells must be exposed to the oligonucleotide under conditions that facilitate their uptake by the cell, tissue or subject.
  • In vitro therapy may be accomplished by a number of procedures, including, for example, simple incubation of the cells or tissue with the oligonucleotide in a suitable nutrient medium for a period of time suitable to inhibit expression or production of housekeeping genes, genes associated with pathogenicity, and/or replication.
  • the present invention includes antisense sequences described herein, which are operably linked to a targeting sequence (e.g., SEQ ID Nos: 73 and 74, or variations thereof).
  • a targeting sequence e.g., SEQ ID Nos: 73 and 74, or variations thereof.
  • the antisense oligonucleotides of the invention can be delivered alone or in conjunction with other agents such as antibiotics, immunosuppressive drugs, ribozymes or other antisense molecules.
  • Anti-inflammatory agents such as non-steroidal anti-inflammatory drugs, corticosteroids, and hydroxychloroquine, immunosuppressive agents such as cyclosporine, and cytotoxic drugs such as cyclophosphamide, azathioprine, may also be used in conjunction with the antisense molecules of the invention.
  • the antisense oligonucleotides of the present invention may be administered ex vivo by harvesting cells or tissue from a subject, treating them with the antisense oligonucleotide, then returning the treated cells or tissue to the subject.
  • the present invention provides method for the treatment of a disease which is associated with infection by a pathogenic bacteria. Such therapy would achieve its therapeutic effect by introduction of the appropriate antisense oligonucleotide which binds polynucleotides encoding pathogenic genes or genes associated with growth and replication.
  • delivery of the antisense molecules of the invention can be achieved by any number of means.
  • Such delivery can include the chimeric antisense construct of the invention (e.g., the targeting sequence operably linked to the antisense molecule) or the antisense molecule alone.
  • Targeted delivery system for antisense oligonucleotides that bind polynucleotides include a colloidal dispersion system.
  • Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • the preferred colloidal system of this invention is a liposome.
  • Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 ⁇ m can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules.
  • LUV large unilamellar vesicles
  • RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al, 1981 Trends Biochem. Scl, 6:77).
  • a liposome In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1) encapsulation of the genes of interest at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino, et al, 1988 Biotechniques, 6:682).
  • the composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used.
  • the physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.
  • lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidyletha- nolamine, sphingolipids, cerebrosides, and gangliosides. Particularly useful are diacylphosphatidylglycerols, where the lipid moiety contains from 14-18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
  • Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphos- phatidylcholine.
  • the targeting of liposomes has been classified based on anatomical and mechanistic factors.
  • Anatomical classification is based on the level of selectivity, for example, organ- specific, cell-specific, and organelle-specific.
  • Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries.
  • RES reticulo-endothelial system
  • Active targeting involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.
  • a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein
  • the surface of the targeted delivery system may be modified in a variety of ways.
  • lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer.
  • Various linking groups can be used for joining the lipid chains to the targeting ligand.
  • the compounds bound to the surface of the targeted delivery system will be ligands and receptors which will allow the targeted delivery system to find and "home in" on the desired cells.
  • a ligand may be any compound of interest which will bind to another compound, such as a receptor.
  • Another delivery system for the antisense oligonucleotides of the invention at particular sites in a subject includes the use of gene-activated matrices.
  • the antisense molecule is coated on a biocompatible matrix, sponge or scaffold and implanted at the tissue site wherein cells proliferate and grow on the scaffold, taking up the antisense oligonucleotide (See for example U.S. Patent No. 5,763,416, which is incorporated herein by reference).
  • antisense oligonucleotides according to the invention may also be administered in vivo.
  • Antisense oligonucleotides can be administered as the compound or as a pharmaceutically acceptable salt of the compound, alone or in combination with pharmaceutically acceptable carriers, diluents, simple buffers, and vehicles.
  • pharmaceutically acceptable carriers diluents, simple buffers, and vehicles.
  • expression vectors that produce antisense molecules can be engineered from DNA duplexes in the laboratory and introduced into cells (Weintraub, et al., 1990 Sci. Amer. 1:40).
  • antisense oligonucleotides are mixed individually or in combination with pharmaceutically acceptable carriers to form compositions which allow for easy dosage preparation.
  • An antisense oligonucleotide of the invention can be administered to provide in vivo therapy to a subject having a disease or disorder associate with a bacterial infection at the site of the infection or systemically. Such therapy can be accomplished by administering ex vivo and in vivo as the case may be, a therapeutically effective amount of antisense oligonucleotide.
  • therapeutically effective means that the amount of antisense oligonucleotide administered is of sufficient quantity to suppress, to some beneficial degree, replication or growth of the bacteria, or symptoms associated with a disease brought about by the infection.
  • Antisense oligonucleotide according to the present invention can be administered to the patient in any acceptable manner including orally, by injection, using an implant, nasally and the like.
  • Oral administration includes administering an oligonucleotide of the present invention in tablets, suspension, implants, solutions, emulsions, capsules, powders, syrups, water composition, and the like.
  • Nasal administration and administration to the nasal lining includes administering the composition of the present invention in sprays, solutions, aerosols and the like. Injections and implants are preferred because they permit precise control of the timing and dosage levels useful for administration, with injections being most preferred.
  • Antisense oligonucleotides are preferably administered parenterally.
  • the therapeutic agents useful in the method of the invention can be administered parenterally by injection or by gradual perfusion over time. Administration may be intravenously, intra- peritoneally, intramuscularly, subcutaneously, intra-cavity, or transdermally.
  • Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride
  • lactated Ringer's intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like.
  • Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents and inert gases and the like.
  • the invention also includes a composition for therapy comprising an effective amount of an enzymatic RNA of the invention or combination thereof, and a physiologically acceptable excipient or carrier.
  • Physiologically acceptable and pharmaceutically acceptable excipients and carriers are well known to those of skill in the art.
  • physiologically or pharmaceutically acceptable carrier as used herein is meant any substantially non-toxic carrier for administration in which an antisense oligonucleotide of the invention will remain stable and bioavailable when used.
  • the antisense oligonucleotide of the invention can be dissolved in a liquid, dispersed or emulsified in a medium in a conventional manner to form a liquid preparation or is mixed with a semi-solid (gel) or solid carrier to form a paste, ointment, cream, lotion or the like.
  • Suitable carriers include water, petroleum jelly (vaseline), petrolatum, mineral oil, vegetable oil, animal oil, organic and inorganic waxes, such as microcrystalline, paraffin and ozocerite wax, natural polymers, such as xanthanes, gelatin, cellulose, or gum arabic, synthetic polymers, such as discussed below, alcohols, polyols, water and the like.
  • the carrier is a water miscible carrier composition that is substantially miscible in water.
  • Such water miscible carrier composition can include those made with one or more ingredients set forth above but can also include sustained or delayed release carrier, including water containing, water dispersable or water soluble compositions, such as liposomes, microsponges, microspheres or microcapsules, aqueous base ointments, water-in-oil or oil-in-water emulsions or gels.
  • sustained or delayed release carrier including water containing, water dispersable or water soluble compositions, such as liposomes, microsponges, microspheres or microcapsules, aqueous base ointments, water-in-oil or oil-in-water emulsions or gels.
  • the carrier can comprise a sustained release or delayed release carrier.
  • the carrier is any material capable of sustained or delayed release of the antisense molecule specifically directed against a targeted polynucleotide to provide a more efficient administration resulting in one or more of less frequent and/or decreased dosage of the antisense molecule, ease of handling, and extended or delayed effects.
  • the carrier is capable of releasing the oligomer when exposed to the environment of the area for diagnosis or treatment or by diffusing or by release dependent on the degree of loading of the oligonucleotide to the carrier in order to obtain release of the antisense oligonucleotide of the invention.
  • Non-limiting examples of such carriers include liposomes, microsponges, microspheres, gene-activated matrices , as described above, or microcapsules of natural and synthetic polymers and the like.
  • suitable carriers for sustained or delayed release in a moist environment include gelatin, gum arabic, xanthane polymers; by degree of loading include lignin polymers and the like; by oily, fatty or waxy environment include thermoplastic or flexible thermoset resin or elastomer including thermoplastic resins such as polyvinyl halides, polyvinyl esters, polyvinylidene halides and halogenated polyolefins, elastomers such as brasiliensis, polydienes, and halogenated natural and synthetic rubbers, and flexible thermoset resins such as polyurethanes, epoxy resins and the like.
  • the sustained or delayed release carrier is a liposome, microsponge, microsphere or gel.
  • the compositions of the invention are administered by any suitable means, including injection, implantation, transdermal, intraocular, transmucosal, bucal, intrapulmonary, and oral.
  • the carrier is a pH balanced buffered aqueous solution for injection.
  • the preferred carrier will vary with the mode of administration.
  • compositions for administration usually contain from about 0.0001%> to about 90%> by weight of the antisense oligonucleotide of the invention compared to the total weight of the composition, preferably from about 0.5% to about 20% by weight of the antisense oligonucleotide of the invention compared to the total composition, and especially from about 2% to about 20% by weight of the antisense oligonucleotide of the invention compared to the total composition.
  • the effective amount of the antisense oligonucleotide of the invention used for therapy or diagnosis can vary depending on one or more of factors such as the age and weight of the patient, the type of formulation and carrier ingredients, frequency of use, the type of therapy or diagnosis preformed and the like. It is a simple matter for those of skill in the art to determine the precise amounts to use taking into consideration these factors and the present specification.
  • the term "subject” means any mammal, preferably a human.
  • the present invention has applicability to in vitro cell culture techniques. For example, in treating a cell culture infection, it may be appropriate to administer the antisense oligonucleotides of the invention to prevent or inhibit the infection.
  • the antisense molecule is linked to an appropriate targeting sequence (e.g., SEQ ID Nos: 73 or 74) it is possible to promote bacterial species specific uptake of the antisense molecule.
  • Ribozymes are RNA molecules possessing the ability to specifically cleave other single- stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences which encode these RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, J.Amer.Med. Assn., 260:3030, 1988). A major advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated.
  • ribozymes There are two basic types of ribozymes namely, tetrahymena-type (Hasselhoff, Nature, 334:585, 1988) and "hammerhead"-type. Tetrahymena-type ribozymes recognize sequences which are four bases in length, while “hammerhead” -type ribozymes recognize base sequences 11-18 bases in length. The longer the recognition sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species.
  • hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating a specific mRNA species and 18-base recognition sequences are preferable to shorter recognition sequences. It is understood that, with regard to antisense molecules of the invention, that T can be replaced with U when the target sequence is a RNA or DNA sequence.
  • an effective amount of the antisense or chimeric antisense (i.e., targeting sequence operably linked to an antisense molecule) of the invention is generally determined by the physician in each case on the basis of factors normally considered by one skilled in the art to determine appropriate dosages, including the age, sex, and weight of the subject to be treated, the condition being treated, and the severity of the medical condition being treated.
  • compositions of the present invention are advantageously administered in the form of injectable compositions.
  • a typical composition for such purpose comprises a pharmaceutically acceptable solvent or diluent and other suitable, physiologic compounds.
  • the composition may contain polynucleotides and about 10 mg of human serum albumin per milliliter of a phosphate buffer containing NaCl.
  • the present inventor contemplates using at least one of the following antisense oligonucleotides to target an HP babA2 gene: 5' AAAGGATGTGTTTTTTCA 3' (SEQ. ID. NO. 1)
  • the present inventor further contemplates using at least one of the following circular antisense oligonucleotides to target HP babA2 gene: 5'CCTAAAGTTAATGAAAGGATGTGTTTTTTCATGTTTTTTTC3' (SEQ. ID. NO. 13) 5'TTATACCTGTTCAAACTGCAAGTGATGGAAGTGGATCGAT3' (SEQ. ID. NO. 14) 5'GCTTGAGCGCTATCAGGCACACCGTCTAATTTGTTAGTGA3' (SEQ. ID. NO. 15) 5'CTAGATTGAGCATTTTGGCTTGCGCACTAGCGTTAGCGAG3' (SEQ. ID. NO.
  • the present inventor contemplates using at least one of the following oligonucleotides to target HP urease gene:
  • the present inventor further contemplates using at least one of the following circular antisense oligonucleotides to target HP urease gene: 5'CAGGAAACATCGCTTCAATACCCACTTCATGGATCATGCT3' (SEQ. ID. NO. 33) 5'TACCATTGGCCTCAATAGGGGTATGCACGGTTACGAGTTT3' (SEQ. ID. NO. 34) 5'TGATAGTGATGTCTTCATTTTTTAAGAACAACTCACCAGG3' (SEQ. ID. NO. 35) 5'CAATGTCTAAGCGTTTACCGAAAGTTTTTTCTCTGTCAAA3' (SEQ. ID. NO. NO.
  • the present inventor contemplates using at least one of the following antisense oligonucleotides to target genes of the PTS operon (coding for the phosphoenolpyruvate- sugar phosphotransferase system) in Haemophilus Influenzae:
  • the antisense molecules may be linked (with or without a linker molecule) to the DNA uptake sequences mentioned above, or variations thereof (e.g., SEQ ID NO:73 for Haemophilus and SEQ ID NO:74 for Neisseria).
  • the uptake sequence can be conjugated to an antisense molecule or other small active molecules (e.g., antibiotics) to develop therapeutic and diagnostic applications.
  • the known Haemophilus and Neisseria uptake sequences can be mutated in length to determine the minimum sequence required for uptake of oligonucleotides by a prokaryotic organism.
  • the uptake sequence can be further mutated in base order/sequence (using techniques known in the art) to obtain a heterologous population of sequences for determination of receptor binding and bacterial uptake.
  • the specific DNA uptake sequences for different species of bacteria are then conjugated as single- or double- stranded DNA with antisense oligonucleotides targeting essential bacterial genes coding for survival and virulence.
  • the active DNA uptake sequence and antisense oligonucleotide complexes can be further chemically modified (as described above, e.g., backbone and/or sugar modifications) and utilized to develop systemic or topical therapeutic treatments.
  • One or more uptake sequence in sense or antisense orientation can be attached directly or through a linker (46) to the 5' or 3' end or both ends of gene specific oligonucleotides.
  • the antisense sequence of the present invention can be administered alone or in combination (e.g., a combination of any one or more of the sequences identified herein).
  • any one or more of the sequences listed can be excluded from the present invention and appended claims.
  • the present inventor further contemplates developing diagnostic tests using known DNA uptake sequences and new identified uptake sequences as detection and identification systems of various bacteria in a biological specimen or sample (e.g., body fluids, contaminated materials).
  • Uptake sequences or derivative sequences are conjugated with a molecule, which is a substrate for detectable reaction development (e.g. biotin-avidin, acid phosphatase, fluorescent dye etc.).
  • One or more uptake sequences are attached directly or through a linker (46) to one or more detection molecule, or alternatively a chain of multiple uptake sequence-detection molecules is created.
  • the length of an uptake sequence can vary from about 1 to 40 base pairs, about 5 to 40 base pairs or about 10 to 50 base pairs.
  • uptake sequence is specific for a bacteria species, only one type of bacteria takes the detection molecule up through the cell's membrane, revealing the identification of particular species. This process causes the depletion of conjugated sequences in the medium, which is measured by the decreased level of detection (absorbance, fluorescence or other signal emission induced by reaction).
  • the uptake sequence conjugated with dye (fluorescent or other) after passing through the bacteria membrane is visualized under the microscope in the matter of seconds or minutes.
  • Different recognition color dyes may be designated to particular species of bacteria, e.g.. gonococci - red, haemophilus - blue, helicobacter -green.
  • uptake sequences to identify bacterial presence in any number and types of specimens utilizing enzyme hybridization assay (49) and other strategies previously described (50, 51, 52).
  • antisense oligonucleotides according to the present invention will be about 15 to about 35 nucleic acid base units in length, but can vary to about 7 and 25 nucleic acid base units, or about 10 and 20 nucleic acid base units. It is also contemplated that circular oligonucleotides according to the present invention will include from about 15 to about 50 nucleic acid base units.
  • oligonucleotides can be synthesized on an automated DNA synthesizer as phosphodiester oligonucleotides, using standard phosphodiester chemistry, and subsequently purified by HPLC using a reverse phase semiprep C8 column with linear gradient of 5% acetonitrile in 0.1 M trithylammonium acetate and acetonitrile. The purity of the products can be checked by HPLC using an analytical C18 column. Screening of the oligonucleotide sequences thus produced can be carried out on bacterial strains and human cell lines provided by American Type Culture Collection (ATCC) or other commercial vendor.
  • ATCC American Type Culture Collection
  • the bacterial cells are routinely propagated in culture in a incubator at 37°C using bacterial medium brain-heart infusion broth (BHI) supplemented with 10 ⁇ g/ml of hemin and 2 ⁇ g/ml of NAD.
  • BHI brain-heart infusion broth
  • Human cells are propagated in culture in a incubator at 37°C with 5% CO 2 and 95% O 2 using culture medium according to ATCC recommendations and requirements.
  • Uptake assay for uptake-sequence-antisense conjugate in bacteria Competent H. influenzae or N. gonorrhoeae at concentration of 1 x 10 8 cells in 360 ⁇ l of MIV medium (55) are mixed with 1 x 10 6 cpm of radioactive uptake-sequence-antisense conjugate in 40 ⁇ l of TE buffer and incubated at 37°C for 25 minutes. Then cells are chilled to 0°C and treated with 100 ⁇ g/ml of DNase I for 20 minutes. After this incubation cells are washed three times with 1 ml of 0.5M NaCl in MIV medium and once with TE buffer.
  • Next cells are resuspended in 360 ⁇ l of TE buffer and 40 ⁇ l of 10% SDS is added and the mixture is incubated at 65°C for 10 minutes to lyse the cells.
  • the radioactivity in the lysate is measured on liquid scintillation counter.
  • the time response uptake studies are performed in 1, 5 and 25 minutes intervals with the same optimal conjugate dose.
  • Cells are seeded in 96-well microtiter plates at 2000 cells concentration per well in 200 ⁇ l of medium and subsequently treated with various concentrations (0.25, 0.5, 1.0 ⁇ M) of the uptake-sequence-antisense oligonucleotides. After 72h of culture in a incubator at 37°C. with 5% CO 2 and 95% O 2 , 40 ⁇ l of MTS solution is added to each well and incubated for 2 hours. After this incubation period, the absorbance in each well is measured on the reader to determine the cell metabolic activity (56). The most active oligos are tested for time-dependent cytotoxic effect over a period of five days.
  • RNA isolation column The sequence specificity can be advantageously examined using RT-PCR (57), starting from the isolation of total bacterial RNA using Qiagen RNA isolation column.
  • Bacterial cells are first harvested by centrifugation at full speed for 1 minute and resuspended in 250 ⁇ l of lysozyme-containing TE buffer, vortex and incubated in room temperature for 5 minutes. Then 1 ml of lysing buffer is added and mixture is homogenized by vortexing. After the dilution with 9 ml of binding buffer, sample is applied to the isolation column and binds to the resin. Column is washed with 12 ml of washing buffer and than RNA is eluted with 6 ml of preheated to 45°C elution buffer.
  • RNA is precipitated with 1 volume of ice cold isopropanol and then reconstituted in desired volume of RNase-free water.
  • RNA from antisense-treated bacteria is used for synthesis of cDNA using reverse transcription method and amplification of target DNA using primers specific for particular gene target.
  • the amount of PCR product is examined by hybridization with specific radiolabelled probe and southern blot analysis (58).
  • an animal model for bacterial infections or any pathological manifestation of bacteria prevalence described above can be treated by administering antisense oligonucleotides in accordance with this invention. It is recognized, of course, that there are some difficulties in administering effective doses of oligonucleotides due to the effects of nucleases.
  • the oligos of this invention may be prepared using a non-native backbone which conveys a relatively longer life to the molecule, such as a phosphorothioate or a 3'amine-phosphorothioate backbone, or a mixed backbone (chimeric) oligonucleotide containing 5 to ten phosphorathioate nucleotides in the middle to allow RNase H action and modified sugar nucleotides at both 3' and 5' sites.
  • a non-native backbone which conveys a relatively longer life to the molecule
  • a mixed backbone (chimeric) oligonucleotide containing 5 to ten phosphorathioate nucleotides in the middle to allow RNase H action and modified sugar nucleotides at both 3' and 5' sites.
  • the particular oligos of this invention can include one or more of the following characteristics: (a) hairpin structure; (b) internal loop or loops, preferably 10-20 bases, and an annealing temperature from about 37°C to about 47°C.
  • Formulations for parenteral administration may include sterile aqueous solutions which may contain buffers, liposomes diluents and other suitable additives. Dosing is dependent on severity and responsiveness of the condition to be treated, but will normally be one or more doses per day, with course of treatment lasting from several days to several months or until a cure is effected or a diminution of disease state is achieved. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates.
  • the oligos may be administered intravenously in a dose of 1 to 100 mg/kg once per day.
  • the oligos may be administered in a 1 - 5% solution once per day.
  • liver D et al Science, (1998), 279, 373.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des séquences d'oligonucléotides qui sont utiles comme substances thérapeutiques et diagnostiques pour le traitement ou le diagnostic des infections bactériennes. Les oligonucléotides de l'invention sont des molécules antisens qui peuvent être liées à des séquences ou à des peptides d'incorporation reconnus par les bactéries, en vue de l'incorporation par ces dernières de certaines séquences d'acides aminés.
PCT/US1999/021950 1998-09-16 1999-09-15 Compositions et techniques permettant d'utiliser des mecanismes d'incorporation pour des applications diagnostiques et therapeutiques d'oligonucleotides ciblant des bacteries WO2000015265A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU62589/99A AU6258999A (en) 1998-09-16 1999-09-15 Compositions and methods of use of uptake mechanisms for diagnostic and therapeutic applications of oligonucleotides targeting bacteria

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US10062598P 1998-09-16 1998-09-16
US10059898P 1998-09-16 1998-09-16
US10059198P 1998-09-16 1998-09-16
US10059998P 1998-09-16 1998-09-16
US60/100,598 1998-09-16
US60/100,599 1998-09-16
US60/100,591 1998-09-16
US60/100,625 1998-09-16

Publications (1)

Publication Number Publication Date
WO2000015265A1 true WO2000015265A1 (fr) 2000-03-23

Family

ID=27493144

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/021950 WO2000015265A1 (fr) 1998-09-16 1999-09-15 Compositions et techniques permettant d'utiliser des mecanismes d'incorporation pour des applications diagnostiques et therapeutiques d'oligonucleotides ciblant des bacteries

Country Status (2)

Country Link
AU (1) AU6258999A (fr)
WO (1) WO2000015265A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018506272A (ja) * 2014-12-31 2018-03-08 オレゴン ステート ユニバーシティ アンチセンス抗細菌性化合物および方法
US10421967B2 (en) 2014-05-15 2019-09-24 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
EP3978610A3 (fr) * 2014-03-19 2022-08-24 Ionis Pharmaceuticals, Inc. Compositions permettant de moduler l'expression de l'ataxine 2
WO2023213943A1 (fr) 2022-05-06 2023-11-09 The University Of Bristol Procédé et kit de diagnostic
US11926825B2 (en) 2018-07-25 2024-03-12 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN2 expression

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5294533A (en) * 1988-07-05 1994-03-15 Baylor College Of Medicine Antisense oligonucleotide antibiotics complementary to the macromolecular synthesis operon, methods of treating bacterial infections and methods for identification of bacteria
WO1998032467A2 (fr) * 1997-01-24 1998-07-30 Antivirals, Inc. METHODE ET CONJUGUE DE TRAITEMENT D'INFECTIONS A $i(H. PYLORI)
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5807746A (en) * 1994-06-13 1998-09-15 Vanderbilt University Method for importing biologically active molecules into cells

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5294533A (en) * 1988-07-05 1994-03-15 Baylor College Of Medicine Antisense oligonucleotide antibiotics complementary to the macromolecular synthesis operon, methods of treating bacterial infections and methods for identification of bacteria
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5807746A (en) * 1994-06-13 1998-09-15 Vanderbilt University Method for importing biologically active molecules into cells
WO1998032467A2 (fr) * 1997-01-24 1998-07-30 Antivirals, Inc. METHODE ET CONJUGUE DE TRAITEMENT D'INFECTIONS A $i(H. PYLORI)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3978610A3 (fr) * 2014-03-19 2022-08-24 Ionis Pharmaceuticals, Inc. Compositions permettant de moduler l'expression de l'ataxine 2
US11834660B2 (en) 2014-03-19 2023-12-05 Ionis Pharmaceuticals, Inc. Compositions for modulating Ataxin 2 expression
US10421967B2 (en) 2014-05-15 2019-09-24 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US10767181B2 (en) 2014-05-15 2020-09-08 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US11591598B2 (en) 2014-05-15 2023-02-28 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
JP2018506272A (ja) * 2014-12-31 2018-03-08 オレゴン ステート ユニバーシティ アンチセンス抗細菌性化合物および方法
JP6994941B2 (ja) 2014-12-31 2022-02-04 オレゴン ステート ユニバーシティ アンチセンス抗細菌性化合物および方法
JP2022040131A (ja) * 2014-12-31 2022-03-10 オレゴン ステート ユニバーシティ アンチセンス抗細菌性化合物および方法
US11293024B2 (en) * 2014-12-31 2022-04-05 Board Of Regents, The University Of Texas System Antisense antibacterial compounds and methods
US11926825B2 (en) 2018-07-25 2024-03-12 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN2 expression
WO2023213943A1 (fr) 2022-05-06 2023-11-09 The University Of Bristol Procédé et kit de diagnostic

Also Published As

Publication number Publication date
AU6258999A (en) 2000-04-03

Similar Documents

Publication Publication Date Title
EP1238071B1 (fr) Oligonucleotides antisens non-charges diriges contre des arn ribosomiques 16s et 23s bacteriens et leurs utilisations
US7049431B2 (en) Antisense antibacterial cell division composition and method
Schnappinger et al. Tetracyclines: antibiotic action, uptake, and resistance mechanisms
Skurnik et al. The lipopolysaccharide outer core of Yersinia enterocolitica serotype O: 3 is required for virulence and plays a role in outer membrane integrity
Rajakumar et al. Use of a novel approach, termed island probing, identifies the Shigella flexneri she pathogenicity island which encodes a homolog of the immunoglobulin A protease-like family of proteins
Bhasin et al. Identification of a gene essential for O‐acetylation of the Staphylococcus aureus type 5 capsular polysaccharide
Muller et al. Relationship between plasmid and chromosomal hemolysin determinants of Escherichia coli
Hershfield Plasmids mediating multiple drug resistance in group B streptococcus: transferability and molecular properties
HU228700B1 (en) Streptococcus suis vaccines and diagnostic tests
WO1998003533A1 (fr) Oligonucleotides anti-sens utilises comme agents antibacteriens
Roberts et al. Characterization of tetracycline and erythromycin resistance determinants in Treponema denticola
Müller et al. Relationship between plasmid and chromosomal hemolysin determinants of Escherichia coli
Xu et al. Lipopolysaccharide dependence of cyanophage sensitivity and aerobic nitrogen fixation in Anabaena sp. strain PCC 7120
Tummuru et al. Characterization of the Campylobacter fetus sapA promoter: evidence that the sapA promoter is deleted in spontaneous mutant strains
Yamanaka et al. Biofilm-like structures and pathogenicity of Escherichia hermannii YS-11, a clinical isolate from a persistent apical periodontitis lesion
Ouellette et al. Acquisition by a Campylobacter-like strain of aphA-1, a kanamycin resistance determinant from members of the family Enterobacteriaceae
Hsu et al. Antimicrobial susceptibility, plasmid profiles and haemocin activities of Avibacterium paragallinarum strains
Chatterjee et al. Lipopolysaccharides of Vibrio cholerae: II. Genetics of biosynthesis
WO2000015265A1 (fr) Compositions et techniques permettant d'utiliser des mecanismes d'incorporation pour des applications diagnostiques et therapeutiques d'oligonucleotides ciblant des bacteries
US6485973B1 (en) Oligonucleotides specific for the marORAB operon
Jabbari et al. Polymerase chain reaction typing of Pasteurella multocida capsules isolated in Iran
Rowe‐Magnus et al. The evolution of antibiotic resistance
WO2002065089A2 (fr) Gene de regulation de la repression catabolique (crc) et virulence de pseudomonas
Warnecke et al. The 5′‐proximal hairpin loop of lbi RNA is a key structural element in repression of d‐galactan II biosynthesis in Klebsiella pneumoniae serotype O1
dos Santos Pinheiro Development of a Streptococcus pneumoniae system to control exposure of immature peptidoglycan

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US US US US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase