WO2000011189A1

WO2000011189A1 - Use of leu a promoter of stagonospora nodorum in screening method for fungicides

Info

Publication number: WO2000011189A1
Application number: PCT/GB1999/002770
Authority: WO
Inventors: Stephen George Foster; Russell Neil Cooley
Original assignee: Aventis Cropscience Uk Limited
Priority date: 1998-08-21
Filing date: 1999-08-23
Publication date: 2000-03-02
Also published as: GB9818319D0; AU5437499A

Abstract

The promoter of the gene encoding the enzyme 3-isopropylmalate dehydrogenase (IPMDH) has been cloned from the plant pathogenic fungus, Stagonospora nodorum. This promoter can be used to screen for inhibitors of expression of IPMDH. Inhibitors of the expression of IPMDH are useful as fungicides.

Description

OF LEU A PROMOTER OF STAGONOSPORA NODORUM IN SCREENING METHOD FOR FUNGICIDES

Technical Field of the Invention This invention relates to screening methods for the identification of fungicides.

Background of the Invention

Some induced biochemical mutants of plant pathogenic fungi such as Venturia inaequali s (a hemi-biotroph) are no longer pathogenic (Boone et al . , 1957, American Journal of Botany 44, 791 and Kline et al., ibid, 797). However, in this case, and in other examples, the nature of the lesion both at the genetic and biochemical levels was not defined.

We have shown in International Patent Application No. PCT/GB98/00566 that a mutant of the plant pathogenic fungus Stagonospora nodorum (alternatively known as Septoria nodorum) which is unable to synthesise the amino acid leucine is non-pathogenic. It has further been demonstrated that the loss of pathogenicity is due to the loss of activity of the enzyme 3-isopropylmalate dehydrogenase (IPMDH, EC 1.1.1.85) .

Summary of the Invention

We have isolated the promoter of the gene encoding IPMDH, leuA, from Stagonospora nodorum. We have also linked the promoter to the reporter gene β-glucuronidase (GUS) to study the control of expression of the leuA gene. We have thereby demonstrated that the expression of the l euA gene is repressed by exogenous leucine. The promoter can be fused to a reporter gene and used to screen for compounds with fungicidal activity.

The invention thus provides the promoter, which comprises the sequence of SEQ ID NO: 1, or a functional variant of that sequence. The invention also provides: constructs comprising the promoter operably linked to a heterologous coding sequence such as a reporter gene ; cells harbouring said constructs; a method for identifying an inhibitor of IPMDH expression comprising:

(i) contacting a test substance with a construct of the invention or a cell harbouring a construct of the invention, under conditions that would permit expression of the polypeptide encoded by the construct' s heterologous coding sequence in the absence of the said substance; and (ii) determining whether the said substance inhibits expression of IPMDH.

Additionally the invention also provides inhibitors of IPMDH expression identified by the methods of the invention. These inhibitors can have anti-fungal activity against a plant pathogenic fungus or against a fungal infection or a human or animal cell. For either purpose, they can be formulated as fungicidal compositions comprising an effective amount of the inhibitor and a suitable carrier and/or diluent. The invention also provides: a method of preventing or treating a fungal infection of plants, comprising application to said plants of an inhibitor of IPMDH expression; use as a plant fungicide of an inhibitor of IPMDH expression; and a method of treating a human or animal host suffering from a fungal infection, which method comprises administering to the host a therapeutically effective amount of an inhibitor of IPMDH expression. The inhibitor of IPMDH expression is typically such an inhibitor identified according to a method of the invention.

Brief description of the drawings

Figure 1 shows the DNA sequence of the leuA gene. The gene is numbered with respect to the first nucleotide of the leuA start codon (+1) . The amino acid sequence of IPMDH is indicated below the DNA sequence and putative intron splice sites are marked in bold.

Figure 2 shows a Northern blot analysis of leuA expression. 40μg total RNA from mycelium grown under repression (lane 1) and derepression (lane 2) were probed with a ³²P-labelled leuA-specific fragment.

Figure 3 shows a restriction map of the transcriptional fusion between the promoter region of leuA (light grey) and GUS (dark grey) . Position of restriction sites Ba EI (B) , Apal (A), Xhol (X) and Sstl (S) are shown together with the sequence around the junction of the fusion.

Figure 4 shows GUS expression of leιzA^p-GUS fusion transformant, pSAL215 #21 following transfer to repressing (♦—♦) and derepressing (■—■) conditions.

Figure 5 shows microtitre plate analysis of the effects of leucine concentration on the expression of the IPMDH- GUS fusion. Bars show average change in fluorescence per OD unit (FSU/OD) . Detailed Description of the Invention

Promoters

A promoter means a transcriptional promoter. The promoter of the invention is a transcriptional promoter which comprises the sequence of SEQ ID NO: 1 or a functional variant of that sequence, for example a fragment of the sequence. A promoter of the invention may typically comprise DNA. The promoter having the sequence of SEQ ID NO: 1 is the leuA gene promoter from the plant pathogenic fungus Stagonospora nodorum . The isolation of this promoter is described in the Examples below. The promoter of SEQ ID NO: 1 includes the untranslated region of leuA gene and therefore a promoter of the invention may comprise nucleotide sequences required for the initiation of translation.

The sequence of SEQ ID NO: 1 may be modified by for example 1, 2 or 3 to 10, 25, 50 or 100 nucleotide substitutions to give a functional variant. The sequence of SEQ ID NO: 1 may alternatively or additionally be modified by one or more insertions and/or one or more deletions and/or by an extension at either or both ends. However, the modified promoter sequence must still be capable of acting as a promoter.

A modified promoter may be obtained by introducing such modifications into the sequence, SEQ ID NO:l. This may be achieved by any appropriate technique, including restriction of the natural sequence with one or more endonuclease, insertion of a linker, use of an exonuclease and/or a polymerase, and/or site-directed mutagenesis. A shorter DNA sequence may be obtained by removing nucleotides from the 5 '-terminus or the 3'- terminus of the natural promoter sequence, for example using an exonuclease such as exonuclease III or BaI31. A functional variant promoter sequence may be capable of hybridising selectively or specifically with a sequence complementary to the sequence of SEQ ID NO: 1 or to a fragment of a sequence complementary to the sequence of SEQ ID NO: 1. A functional variant promoter sequence may hybridise to the complementary sequence or complementary sequence fragment at a level above background. Background hybridisation may occur, for example, because of other DNA present in a genomic DNA library. The signal level generated by the interaction between a functional variant promoter sequence of the invention and the complementary sequence or complementary sequence fragment is typically at least 10 fold, preferably at least 100 fold, as intense as interactions between other polynucleotides and the sequence of SEQ ID No: 1. The intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with ³²P. Selective hybridisation is typically achieved using conditions of medium to high stringency (for example 0.03M sodium chloride and 0.03M sodium citrate at from about 50°C to about 60°C) .

A functional variant promoter sequence will generally have at least 60%, at least 70%, at least 80, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the sequence of SEQ ID NO: 1 over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, at least 100 contiguous nucleotides or more preferably over the whole length of SEQ ID NO: 1. Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define promoters of the invention, with the more stringent combinations (i.e. higher sequence identity over longer lengths) being preferred. Thus, for example a promoter which has at least 90% sequence identity over 25, preferably over 30 nucleotides forms one aspect of the invention, as does a promoter which has at least 95% sequence identity over 40 nucleotides, preferably over the whole length of SEQ ID NO: 1. Primers may be derived from a promoter sequence of the invention e.g. a PCR primer, a primer for an alternative amplification reaction. Probes too may be derived from a promoter sequence of the invention. A primer or a probe may be labeled with a revealing label by conventional means using radioactive or non- radioactive labels. Suitable labels include radioisotopes such as ³²P or ³⁵S, enzyme labels, or other protein labels such as biotin. Promoters of the invention may be similiarly labelled. Promoter fragments and also primers and probes will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length. Probes and fragments can be longer than 150 nucleotides in length, for example, up to 200, 300, 400, 500, 600, 700, 800, 900 or even a few nucleotides, such as five or 10 nucleotides, short of the full length sequence of SEQ ID NO: 1. A promoter of the invention may also include synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphate or phosphothiorate backbones, addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that a promoter may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or lifespan of a promoter of the invention. A promoter of the invention can be double stranded. It can thus comprise the sequence of SEQ ID NO: 1 or a sequence which is a functional variant of the sequence of SEQ ID NO:l, and the sequence complementary thereto. Promoters such as a DNA promoter and primers according to the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques. The promoters are typically provided in isolated and/or purified form.

In general, primers will be produced by synthetic means, involving a stepwise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.

Whether a modified version of the sequence of SEQ ID NO:l is capable of acting as a promoter and therefore whether it is a true functional variant may be readily ascertained. The modified sequence is placed upstream of a protein coding sequence, such as the bacterial reporter gene 3-glucuronidase (GUS) . Suitable host cells can then be transformed. Any protein expressed by the transformed cells indicates that the modified sequence is capable of acting as a promoter. The promoter may be operably linked to a heterologous coding sequence to form a construct of the invention. A coding sequence is a nucleotide sequence which, when transcribed and translated, results in the formation of a polypeptide. The term "heterologous" means that the coding sequence is not operably linked to the promoter in nature; the coding sequence is generally from a different organism to the promoter. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence, such as a promoter, "operably linked" to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequences. A terminator sequence may also be present, as may a polyadenylation sequence. Such sequences are placed downstream of the coding sequence. These may ensure that expression of the polypeptide occurs appropriately.

The promoter sequence may be fused directly to a coding sequence or via a linker. The linker sequence may comprise an intron. Excluding the length of any intron sequence, the linker may be composed of from 1 to 45 nucleotides, for example 5 to 30 nucleotides. The linker sequence may comprise a sequence having enhancer characteristics, to boost expression levels. The construct is typically provided in isolated and/or purified form.

Preferably the promoter is operably linked to the coding sequence of a reporter polypeptide. The reporter polypeptide may be, for example, the bacterial polypeptide β-glucuronidase (GUS) , green fluoresent protein (GFP) , luciferase (luc) , chloramphenicol transferase (CAT) or β-galactosidase (lacZ) .

A construct of the invention may also comprise a promoter of the invention operably linked to the coding sequence of any polypeptide, the expression of which it may be important to have control over. Expression of the leuA gene in Stagonospora nodorum is repressed by exogenous leucine and promoters of the invention may be controlled by leucine. Therefore in a construct of the invention, expression of a polypeptide encoded by the heterologous coding sequence may be repressed in the presence of exogenous leucine.

Controlled expression of a polypeptide may thus be achieved by culturing a host cell harbouring a construct of the invention and adding leucine to the culture to repress, preferably stop, expression of the polypeptide encoded by the heterologous coding sequence of the construct. Typically leucine is added to the culture medium to a concentration of from lOμgml^"1 to lmgml^"1.

Preferably leucine is added to a concentration of from 20μgml^-1 to δOOμgml^"1, for example from 200μgml^"1 to 400μgml"¹. The polypeptide thus expressed may be optionally isolated and/or purified. It may be important to have control over the expression of a polypeptide in a fermentation system if for example, the polypeptide is toxic to a host cell when that polypeptide accumulates at high cellular concentrations . A construct such of the invention can be incorporated into a recombinant replicable vector. The vector may be used to replicate the nucleic acid construct in a compatible host cell. The vectors may be, for example, plasmid, virus or phage vectors provided with an origin of replication. The vector may thus be an expression vector. The vectors may contain one or more selectable marker genes, for example an ampicillin resistence gene in the case of a bacterial plasmid or a hygromycin resistance gene for a fungal vector. Such vectors may be used to transfect or transform a host cell, for example, E. coli . Any host cell may be used in which the promoter is functional, but typically the host cell will be a cell of a fungus, especially a plant pathogenic fungus. Stagonospora nodorum cells are preferred.

The constructs of the invention may be introduced into host cells using conventional techniques. For fungal cells generally and Stagonospora nodorum in particular, the technique used to transform host cells is typically the co-transformation technique described in Cooley et al . (1990) Mycological Research 94, 145-151.

Assays

The invention provides a method for identifying an inhibitor of IPMDH expression comprising:

(i) contacting a construct of the invention or a cell harbouring such a construct with a test substance, under conditions that would permit expression of the reporter gene in the absence of the said substance; and

(ii) determining whether the said substance inhibits expression of IPMDH.

Any suitable assay format may be used for identifying an inhibitor of IPMDH expression. In the case of using a construct of the invention, a suitable cell extract will typically be used. The cell extract would be one which allows transcription and translation of the reporter polypeptide in the absence of the test substance.

More usually, the assay of the assay is carried out using a cell harbouring a promoter : reporter polypeptide construct. A typical assay is as follows: - a defined number of cells are inoculated, in for example lOOμl of growth medium, into the wells of a plastics micro-titre plate in the presence of a substance to be tested.

- optical density (OD) at 590nm may be measured as may expression of the reporter polypeptide according to any method appropriate for the reporter polypeptide being used.

- the micro-titre plates are covered and incubated at 28°C for 3 days in the dark. - the OD is read again and expression of the reporter polypeptide assayed. The change in OD is used as a measure of fungal growth.

Control experiments can be carried out, in which the substance to be tested is omitted. Different concentrations of leucine may be provided in step (i) such as from 10 to 800 μgml^"1. Control experiments in which leucine is not present in step (i) may be conducted.

Also the substance may be tested with any other known promoter to exclude the possibility that the test substance is a general inhibitor of gene expression.

Any reporter polypeptide may be used, but typically GUS or GFP are used. GUS is assayed by measuring the hydrolysis of a suitable substrate, for example 5-bromo- 4-chloro-3-indolyl-β-D-glucoronic acid (X-gluc)or 4- methylumbelliferyl-β-glucuronide (MUG) . The hydrolysis of MUG yields a product which can be measured fluorometrically. GFP is quantified by measuring fluorescence at 590nm after excitation at 494nm. These methods are well known to those skilled in the art.

Test Substances

A substance which inhibits the expression of IPMDH may do so by binding directly to the promoter, thus preventing the initiation or completion of transcription. Alternatively a substance could bind to a protein which is associated with the promoter and is required for transcription. This may result in reduced levels of transcription. The promoter : reporter gene constructs of the invention include the untranslated region of the IPMDH gene. Therefore a substance may reduce IPMDH expression by binding to the untranslated region of the IPMDH gene. This could prevent the initiation of translation. Alternatively a substance could bind to a protein associated with the untranslated region and prevent the protein associating with the untranslated region.

Suitable candidate substances for inhibitors of IPMDH expression activity include combinatorial libraries, defined chemical identities, peptide and peptide mimetics, oligonucleotides and natural product libraries. The candidate substances may be used in an initial screen of, for example, ten substances per reaction, and the substance of these batches which show inhibition tested individually. Furthermore, antibody products (for example, monoclonal and polyclonal antibodies, single chain antibodies, chimaeric antibodies and CDR-grafted antibodies) .

Inhibitors of IPMDH expression

An inhibitor of IPMDH expression is one which produces a measurable reduction in reporter gene expression in the assays described above. Preferred substances are those which inhibit IMPDH expression and/or activity by at least 10%, at least 20%, at least 30%, at least 40% at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% at a concentration of the inhibitor of 1 μgml^"1, 10 μgml"¹, 100 μgml^"1, 500 μgml^"1, 1 mgml^"1, 10 mgml^"1, lOOmg ml^"1. The percentage inhibition represents the percentage decrease in expression in a comparison of assays in the presence and absence of the test substance. Any combination of the above mentioned degrees of percentage inhibition and concentration of inhibitor may be used to define an inhibitor of the invention, with greater inhibition at lower concentrations being preferred.

Candidate substances which show activity in assays such as those described above can be tested in in vivo systems, such as a plant or animal model, for anti-fungal activity. In the case of plants candidate inhibitors could be tested for ability to prevent or attenuate fungal infection of plants. In the case of animals candidate inhibitors could be tested for their ability to attenuate fungal infection in mice.

Plant uses

Inhibitors of IPMDH expression may be used for example, to prevent or treat infections of a number of plant pathogenic fungi. Preferred inhibitors are those identified according to the assays of the invention. The plant pathogenic fungi are typically those of commercial significance in terms of crop loss. For example, mildews, particularly cereal powdery mildew ( Erysiphe graminis) and vine downy mildew ( Plasmopara vi ticola) , rice blast ( Pyricaula oryzae) , cereal eyespot (Pseudocerosporella herpotrichoides) , rice sheath blight ( Pellicularia sasakii ) , grey mould (Botrytis cinerea) , damping off (Rhizoctonia solanii ) , wheat brown rust [ Puccinia recondi ta ) , late tomato or potato blight ( Phytophthora infestans) , apple scab ( Venturia inaequalis) , glume blotch ( Leptosphaeria nodorum) , Rynchospori um secalis, Al ternaria mali , Phytophthora sp . , Pythi um sp . and Mycosphoerella tri tici , Gortici um sasakii . Other plant pathogenic fungi are pathogens from the classes: Deutoromycete, including for example the wilt causing pathogens Fusari um and Verticilli um; Ascomycete; Phycomycete; and Basidiomycete, including the smuts (Uredinales) and rusts (Ustilagenales) .

The inhibitors (active ingredients) of the present invention are normally applied in the form of compositions together with one or more agriculturally acceptable carriers or diluents, and can be applied to the crop area or plant to be treated, simultaneously or in succession with, further compounds. These compounds can be both fertilizers or micro-nutrient donors or other preparations that influence plant growth. They can also be selective herbicides, insecticides, fungicides, bactericides, nematicides, mollusicides or mixtures of several of these preparations, if desired together with further carriers, surfactants or application-promoting adjuvants customarily employed in the art of formulation. Suitable carriers and diluents correspond to substances ordinarily employed in formulation technology, e.g. natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackifiers, binders or fertilizers .

A preferred method of applying active ingredients of the present invention or an agrochemical composition which contains at least one of the active ingredients is leaf application. The number of applications and the rate of application depend on the intensity of infestation by the pathogen. However, the active ingredients can also penetrate the plant through the roots via the soil (systemic action) by impregnating the locus of the plant with a liquid composition, or by applying the compounds in solid form to the soil, e.g. in granular form (soil application) . The active ingredients may also be applied to seeds (coating) by impregnating the seeds either with a liquid formulation containing active ingredients, or coating them with a solid formulation. In special cases, further types of application are also possible, for example, selective treatment of the plant stems or buds. The active ingredients are used in unmodified form or, preferably, together with the adjuvants conventionally employed in the art of formulation, and are therefore formulated in known manner to emulsifiable concentrates, coatable pastes, directly sprayable or dilutable solutions, dilute emulsions, wettable powders, soluble powders, dusts, granulates, and also encapsulations, for example, in polymer substances. Like the nature of the compositions, the methods of application, such as spraying, atomizing, dusting, scattering or pouring, are chosen in accordance with the intended objectives and the prevailing circumstances. Advantageous rates of application are normally from 50g to 5kg of active ingredient (a.i.) per hectare ("ha", approximately 2.471 acres), preferably from lOOg to 2kg a.i. /ha, most preferably from 200g to 500g a.i. /ha. The formulations, compositions or preparations containing the active ingredients and, where appropriate, a solid or liquid adjuvant, are prepared in known manner, for example by homogeneously mixing and/or grinding active ingredients with extenders, for example solvents, solid carriers and, where appropriate, surface-active compounds (surfactants) .

Suitable solvents include aromatic hydrocarbons, preferably the fractions having 8 to 12 carbon atoms, for example, xylene mixtures or substituted naphthalenes, phthalates such as dibutyl phthalate or dioctyl phthalate, aliphatic hydrocarbons such as cyclohexane or paraffins, alcohols and glycols and their ethers and esters, such as ethanol, ethylene glycol monomethyl or monoethyl ether, ketones such as cyclohexanone, strongly polar solvents such as N-methyl-2-pyrrolidone, dimethyl sulfoxide or dimethyl formamide, as well as epoxidized vegetable oils such as epoxidized coconut oil or soybean oil; or water. The solid carriers used e.g. for dusts and dispersible powders, are normally natural mineral fillers such as calcite, talcum, kaolin, montmorillonite or attapulgite. In order to improve the physical properties it is also possible to add highly dispersed silicic acid or highly dispersed absorbent polymers. Suitable granulated adsorptive carriers are porous types, for example pumice, broken brick, sepiolite or bentonite; and suitable nonsorbent carriers are materials such as calcite or sand. In addition, a great number of pregranulated materials of inorganic or organic nature can be used, e.g. especially dolomite or pulverized plant residues .

Depending on the nature of the active ingredient to be used in the formulation, suitable surface-active compounds are nonionic, cationic and/or anionic surfactants having good emulsifying, dispersing and wetting properties. The term "surfactants" will also be understood as comprising mixtures of surfactants.

Suitable anionic surfactants can be both water- soluble soaps and water-soluble synthetic surface-active compounds .

Suitable soaps are the alkali metal salts, alkaline earth metal salts or unsubstituted or substituted ammonium salts of higher fatty acids (chains of 10 to 22 carbon atoms) , for example the sodium or potassium salts of oleic or stearic acid, or of natural fatty acid mixtures which can be obtained for example from coconut oil or tallow oil. The fatty acid methyltaurin salts may also be used. More frequently, however, so-called synthetic surfactants are used, especially fatty sulfonates, fatty sulfates, sulfonated benzi idazole derivatives or alkylarylsulfonates .

The fatty sulfonates or sulfates are usually in the form of alkali metal salts, alkaline earth metal salts or unsubstituted or substituted ammoniums salts and have a 8 to 22 carbon alkyl radical which also includes the alkyl moiety of alkyl radicals, for example, the sodium or calcium salt of lignonsulfonic acid, of dodecylsulfate or of a mixture of fatty alcohol sulfates obtained from natural fatty acids. These compounds also comprise the salts of sulfuric acid esters and sulfonic acids of fatty alcohol/ethylene oxide adducts. The sulfonated benzimidazole derivatives preferably contain 2 sulfonic acid groups and one fatty acid radical containing 8 to 22 carbon atoms. Examples of alkylarylsulfonates are the sodium, calcium or trietlianolamine salts of dodecylbenzenesulfonic acid, dibutylnapthalenesulfonic acid, or of a naphthalenesulfonic acid/ formaldehyde condensation product. Also suitable are corresponding phosphates, e.g. salts of the phosphoric acid ester of an adduct of p-nonylphenol with 4 to 14 moles of ethylene oxide .

Non-ionic surfactants are preferably polyglycol ether derivatives of aliphatic or cycloaliphatic alcohols, or saturated or unsaturated fatty acids and alkylphenols, said derivatives containing 3 to 30 glycol ether groups and 8 to 20 carbon atoms in the (aliphatic) hydrocarbon moiety and 6 to 18 carbon atoms in the alkyl moiety of the alkylphenols.

Further suitable non-ionic surfactants are the water-soluble adducts of polyethylene oxide with polypropylene glycol, ethylenediamine propylene glycol and alkylpolypropylene glycol containing 1 to 10 carbon atoms in the alkyl chain, which adducts contain 20 to 250 ethylene glycol ether groups and 10 to 100 propylene glycol ether groups. These compounds usually contain 1 to 5 ethylene glycol units per propylene glycol unit.

Representative examples of non-ionic surfactants re nonylphenolpolyethoxyethanols, castor oil polyglycol ethers, polypropylene/polyethylene oxide adducts, tributylphenoxypolyethoxyetlianol, polyethylene glycol and octylphenoxyethoxyethanol . Fatty acid esters of polyoxyethylene sorbitan and polyoxyethylene sorbitan trioleate are also suitable non-ionic surfactants. Cationic surfactants are preferably quaternary ammonium salts which have, as N-substituent, at least one C₈-C₂₂ alkyl radical and, as further substituents, lower unsubstituted or halogenated alkyl, benzyl or lower hydroxyalkyl radicals. The salts are preferably in the form of halides, methylsulfates or ethylsulfates, e.g. stearyltrimethylammonium chloride or benzyldi(2- chloroethyl) ethylammomiu bromide.

The surfactants customarily employed in the art of formulation are described, for example, in "McCutcheon' s Detergents and Emulsifiers Annual", MC Publishing Corp. Ringwood, New Jersey, 1979, and Sisely and Wood, "Encyclopaedia of Surface Active Agents," Chemical Publishing Co., Inc. New York, 1980. The agrochemical compositions usually contain from about 0.1 to about 99% preferably about 0.1 to about 95%, and most preferably from about 3 to about 90% of the active ingredient, from about 1 to about 99.9%, preferably from about 1 to 99%, and most preferably from about 5 to about 95% of a solid or liquid adjuvant, and from about 0 to about 25%, preferably about 0.1 to about 25%, and most preferably from about 0.1 to about 20% of a surfactant.

Whereas commercial products are preferably formulated as concentrates, the end user will normally employ dilute formulations.

Human or Animal uses

Inhibitors of IPMDH expression may be used to prevent or treat infections of humans or animals. The condition of a patient suffering from a fungal infection can therefore be improved by administration of an inhibitor IPMDH expression. A therapeutically effective amount of the inhibitor may be given to a human or animal host in need thereof. Preferred inhibitors are those identified according to the assays of the invention. Typical human pathogenic fungi include, for example, Candida albicans, Aspergill us fumigatus, Pneumocystis carnii and other pathogens of Deuteromycete, Ascomycete, Phycomycete and Basidiomycete origin.

The formulation of an inhibitor for use in preventing or treating a fungal infection will depend upon factors such as the nature of the substance identified, whether a pharmaceutical or veterinary use is intended, etc. Typically an inhibitor is formulated for use with a pharmaceutically or veterinarily acceptable carrier or diluent. For example it may be formulated for topical, parenteral, intravenous, intramuscular, subcutaneous, intraocular, transdermal or oral administration. A physician or veterinary surgeon will be able to determine the required route of administration for a particular host and the condition. The pharmaceutical carrier or veterinary carrier or diluent may be, for example, an isotonic solution.

The dose of substance used may be determined according to various parameters, especially according to the substance used; whether a human or animal host is being treated; the age, weight and condition of the host to be treated; the route of administration; and the required regimen. A physician or veterinary surgeon will be able to determine the required route of administration and dosage for any particular host and condition.

The following Examples illustrate the invention:

Example 1

Identification and isolation of the StaσonosOora nodorum IPMDH promoter region A genomic clone of the Stagonospora nodorum IPMDH gene (leuA) was isolated from a S . nodorum cosmid library using a leuA cDNA as a probe.

The leuA cDNA was isolated by complementation of an E. coli l euB mutant using an S . nodorum cDNA library constructed from mRNA isolated from the wild-type S. nodorum strain BS171. The insert carried by one of the complementing clones thus identified, pSAL203, was sequenced. This showed that the leuA gene encodes a 365 amino acid polypeptide (International Patent Application No. PCT/GB98/00566) .

The cosmid library was screened according to the methods described by Maniatis et al . (1982, in "Molecular Cloning, A Laboratory Manual", pub. Cold Spring Harbour Laboratory) . Approximately 3 x 10³ clones were plated and screened with a fragment of pSAL203. Two duplicate signals were produced and their corresponding colonies purified and rescreened by probing. Cosmid DNA (pSAL205 and pSAL206) was isolated from these clones and a 7.5kb Pstl fragment was isolated from pSAL206 and subcloned into pBLUESCRIPT SK⁺ to give pSAL208. A 4.4kb Apal-Pstl subclone of pSAL208 was generated by deletion of a 3.1kb Apal fragment to give pSAL209. The promoter region of the IPMDH gene was characterised at the molecular level by sequencing the l.Okb of DNA which lies directly upstream of the IPMDH start codon in pSAL209. The sequencing reactions were done by Alta Biosciences, (School of Biochemistry, University of Birmingham, Edgbaston, Birmingham, B15 2TT, UK) and the sequence of the promoter region of leuA is presented in Figure 1. For reference Figure 1 includes the sequence of the leuA open reading frame.

Example 2

Repression of IPMDH expression by leucine The repression of l euA expression has been demonstrated at the transcriptional level by probing northern blots of RNA isolated from cultures grown under repressing and derepressing conditions with a ³²P- labelled leuA-specific probe.

Repression and derepression was achieved by initially growing 50ml cultures inoculated with approximately 5 x 10⁸ spores in liquid Cz minimal medium (Cz: Czapek Dox Agar [modified] from Oxoid supplied by Unipath Limited, Basingstoke, Hampshire, England. The medium was made according to the manufacturer's instructions) containing leucine at 280 μg/ l for around 44 hr at 28°C in a shaking (200rpm) incubator. Cultures were centrifuged under sterile conditions (9,000 x g, 15 ruin) and the mycelium resuspended in 50ml fresh Cz medium containing either 280μg/ml leucine for repression or no leucine for derepression. Cultures were grown for a further 3 hr at 28°C.

Mycelia were harvested in a nylon gauze, rinsed with distilled water, pressed between paper towels, weighed and frozen in liquid nitrogen. Total RNA was isolated using a Stratagene RNA Isolation Kit (Stratagene Ltd., Cambridge Innovation Centre, 140 Cambridge Science Park, Milton Road, Cambridge, CB4 4GF) . Routinely 0.5g of frozen mycelium were ground to a fine powder in liquid nitrogen and resuspended in 2.5ml RNA isolation buffer (Stratagene Ltd.). Following the second precipitation step, RNA was dissolved in 1ml TELS buffer (lOmM Tris-HCL pH7.6, O.lmM EDTA, 0.2%SDS) and precipitated again by adding 0.25ml 10M LiCl and chilling overnight at 4°C.

This precipitate was recovered by centrifugation (10,000 x g, 4°C, 15 min) , washed twice with 0.1M sodium acetate pH6.0, 70% ethanol and finally redissolved in lOOμl TELS buffer. RNA was electrophoresed on 1.2% agarose MOPS/EDTA gels and northern blotted onto Hybond-N+ nylon filter (Amersham Life Science Ltd., Amersham Place, Little Chalfont, Buckinghamshire, HP7 9NA) as described by the manufacturer. Filters were pre-hybridised for approximately 3 hr at 65°C in 5ml of hybridisation buffer (5 x SSPE, 5 x Denhardt's solution, 0.5% SDS, 40μg/ml salmon sperm DNA) and hybridised overnight under the same conditions following the addition of a denatured leuA- specific probe (isolated, by methods familiar to those skilled in the art from pSAL209 as a 2.2kb Xhol fragment, nucleotides -882 to +1331 in Figure 1) which has been ³²P-labelled using a Rediprime Labelling Kit (Amersham Life Science Ltd., Amersham Place, Little Chalfont, Buckinghamshire, HP7 9NA) . Filters were washed down to 0.2 x SSC, 0.1% SDS at 55°C, wrapped in cling-film and auto-radiographed .

Figure 2 shows a markedly stronger signal from RNA isolated from cultures grown when leucine is absent from the growth medium (derepressing conditions) that those grown when leucine is present (repressing conditions) .

Thus the expression of IeuA is controlled either directly or indirectly by leucine. It is common for gene expression control functions to be present in DNA regions upstream of the coding region of that enzyme, the following examples show this to be the case.

Example 3

Fusion of the IeuA promoter to GUS

A transcriptional fusion between the IeuA promoter region (leuA^p) and the coding region of the E coli β-glucuronidase (GUS) gene (uidA) was constructed by inserting PCR amplified fragment of pSAL209 into the BamHI site of pNOM123. The latter is made up of the vector pAN7-l (Punt et al, 1987, Gene 56, 117-124), containing a cassette which confers resistance to the antibiotic hygromycin B, and a promoterless GUS gene, containing a BamHI site directly upstream of the ATG start codon. The l.Okb IeuA promoter region was PCR amplified from between 4 and 12ng of pSAL209 template DNA using the primers CACAGGATCCTAGGGCGAATTGGGTACC, which recognises a sequence in pBLUESCRIPT (SK⁺) just 5* of the Apal site used to clone the IeuA insert, and CACAGGATCCGCTACAGTACAGGAATCG, which recognises a sequence just 5' of the IeuA start codon (nucleotides -2 to -19, Figure 1) . Both primers contain a BamHI site. PCR amplification was achieved using the programme: one cycle of 93°C for 4 min, 47°C for 1 min, 72°C for 1.5 min; ten cycles for 93°C for 1 min, 47°C for 1 min, 72°C for 1.5 min; ten cycles of 93°C for 1 min, 47°C for 1 min, 72°C for 2 min; ten cycles of 93°C for 1 min, 47°C for 1 min, 72°C for 2.5 min; 72°C for 8 min. Following amplification the products were digested with BamHI and ligated into the BaraHI site of pNOM123 to produce pSAL215 (Figure 3) .

Example 4

Expression of the reporter gene fusion in Stagonospora nodorum

The leuA^p-GUS fusion vector pSAL215 was transformed into a wild type strain of S nodorum using methods described by Cooley et al , (1988, Current Genetics 13, 383-389) selecting for resistance to hygomycin B. Hygromycin resistant transformants were purified through single spore isolation. Transformants were initially tested for expression of GUS on Cz plates containing X- gluc (5-bromo-4-chloro-3-indolyl β-D-glucuronide, cyclohexylammonium salt; Sigma-Aldrich Company Ltd., Fancy Road, Poole, Dorset, BH12 4QH) at 20μg/ml and leucine at varying concentrations. Transformants produced a distinctive blue colour associated with staining for GUS expression when grown on Cz either lacking or containing 40μg leucine/ml. However, on plates containing 280μg leucine/ml this blue staining was either absent or severely reduced. This indicates that leuA^p is repressed by 280μg leucine/ml but derepressed either in its absence or in the presence of 40μg leucine/ml. This repression/derepression is consistent with the signals seen in northern blots from cultures grown in the presence and absence of 280μg leucine/ml (Example 2) .

GUS expression was further tested for one of the transformants (215#21) following growth in liquid media and the production of cell-free extracts on which in vi tro GUS assays were carried out. Cultures were grown under repressing and derepressing conditions as described in Example 2. At time points 5ml samples of each culture were removed, the mycelium harvested by centrifugation (9,000 x g, 2 min, 4°C) resuspended in 1ml 20% glycerol, transferred to micro-centrifuge tube and frozen at -20°C overnight. Mycelium from these samples was again recovered by centrifugation, resuspended in approximately 150μl assay buffer (50mM Na₂HP0₄ pH7.0, lOmM EDTA, lOmM β-mercaptoethanol, 0.1% Triton X-100) and ground to a slurry using a polypropylene pellet pestle (Anachem Ltd., 20 Charles Street, Luton, Bedfordshire, LU2 0EB) following the addition of a small amount of alumina Type A-5 (Sigma-Aldrich Company Ltd., Fancy Road, Poole,

Dorset, BH12 4QH) . This slurry was centrifuged (12,000 x g, 5 min, 4°C) and the supernatant used as a cell-free extract. The protein concentration of each extract was determined using the Bio-Rad Protein Assay (Bio-Rad Laboratories Ltd., Bio-Rad House, Maylands Avenue, Hemel Hempstead, Hertfordshire, HP2 7TD) .

The cell free extracts produced were assayed for GUS activity in a procedure modified from that of Jefferson (1987, Plant Molecular Biology Reporter 5, 387-405) using MUG (4-methylumbelliferyl β-D-glucuronide, Sigma-Aldrich Company Ltd., Fancy Road, Poole, Dorset, BH12 4QH) as a substrate. Routinely 2μg of total protein were assayed in lOOμl assay buffer. The reaction was started by adding lOμl lOmM MUG and sampled at time points following incubation at 37°C by transferring 20μl of reaction mixture to a MicroFLUOR "B" flat bottomed micro-titre plate (Dynatech Laboratories Ltd., Daux Road, Billingshurst, West Sussex, RH14 9SJ) containing 180μl 0.2M Na₂C0₃ per well. The plate was read on a Fluorolite 1000 Micro-titre Plate Fluorometer (Dynatech Laboratories Ltd., Daux Road, Billingshurst, West Sussex, RH14 9SJ) with excitation and emission wavelengths of 365nm and 450nm respectively. Fluorescence was converted into units of methylumbelliferone (MU) produced using a standard curve and GUS activity expressed as nmol MU generated per mg protein per minute. The results of GUS expression upon transfer to repressing and derepressing media can be seen in Figure 4. Typically, derepression lead to a two-fold increase in GUS activity after 3 hr further growth compared to that of repressing conditions. These data demonstrate that leucine-responsive gene expression is controlled by an upstream region of the S nodorum I euA gene.

Example 5

Stagonospora nodorum IPMDH-GUS assay for High Throughput

Screening

S nodorum pSAL215 transformant strain 215#35 was used to develop an in vivo high throughput reporter assay of leuA^p expression. S nodorum spores were produced routinely as described by Newton and Caten (1988, Trans Brit Mycol Soc 90, 199-207), harvested by scraping plates into sterile 20% (v/v) glycerol and stored at -20°C until required. Typically, spores were defrosted, filtered through glass wool to remove mycelial fragments and diluted to approximately 10⁶ spores ml^"1 in Czapek Dox liquid media. To each well of a clear bottomed Optiplate I Black micro-titre plate (Life Sciences International, Unit 5, The Ringway Centre, Edison Road, Basingstoke, Hampshire, RG21 6YH) were added lOOμl of spore suspension and 5μl lOmM MUG. Assay media also contained leucine at final concentrations varying between 0 and 800μg ml^"1. Typically eight replicates were made for each leucine concentration.

Optical density (OD) (Dynatech MR7000 spectrophotometer; 590nm) and fluorescence (Dynatech Fluorolite 1000; excitation wavelength 365nm, emission wavelength 450nm) were measured immediately after the addition of these ingredients. The micro-titre plates were covered, incubated at 28°C in the dark for 3 days and read again for OD and fluorescence. Changes in OD and fluorescence were used as measures of fungal growth (biomass) and GUS activity, respectively. Thus, the ratio of fluorescence to optical density indicates GUS activity per unit biomass. The results of such an analysis of strain 215#35 are shown in Table 1 and represented graphically in Figure 5. Table 1. High throughput analysis of leucine repression in the IPMDH-GUS fusion transformant strain 215#35.

These data demonstrate that the IeuA promoter region is controlled by exogenous leucine. Example 5 demonstrates the utility of the invention in that 215#35 can be used at a micro-titre scale for high throughput screen of inhibitors of IeuA expression a gene essential for pathogenicity (International Patent Application PCT/GB98/00566) .

Claims

1. A promoter which comprises the sequence of SEQ ID NO: 1 or a functional variant of the said sequence.

2. A construct comprising a promoter according to claim 1 operably linked to a heterologous coding sequence.

3. A construct according to claim 2, wherein the coding sequence codes for a reporter polypeptide.

4. A construct according to claim 3, which is in the form of a recombinant replicable vector.

5. A cell harbouring a construct according to any one of claims 2 to 4.

6. A cell according to claim 5 which is a cell of a plant pathogenic fungus.

7. A cell according to claim 6 which is a Stagonospora nodorum cell.

8. A method for identifying an inhibitor of isopropylmalate dehydrogenase (IPMDH) expression comprising:

(i) contacting a substance to be tested with a construct as defined in any one of claims 2 to 4 or a cell as defined in any one of claims 5 to 7, under conditions that would permit expression of the polypeptide encoded by the said heterologous coding sequence in the absence of the said substance; and (ii) determining thereby whether the said substance inhibits expression of IPMDH.

9. An inhibitor of IPMDH expression identified by the method of claim 8.

10. An inhibitor according to claim 9, which has anti-fungal activity against a plant pathogenic fungus .

11. A fungicidal composition comprising a fungicidally effective amount of an inhibitor according to claim 9 and a suitable carrier and/or diluent.

12. A method of preventing or treating a fungal infection of plants, comprising application to said plants of an inhibitor of IPMDH expression.

13. Use as a plant fungicide of an inhibitor of IPMDH expression.

14. An inhibitor of IPMDH expression, for use in a method of treatment of the human or animal body by therapy.

15. An inhibitor as defined in claim 9, for use in a method of treatment of the human or animal body by therapy.

16. An inhibitor according to claim 14 or 15, for use in the treatment of a fungal infection.

17. Use of an inhibitor of IPMDH expression in the manufacture of a medicament for use in the treatment of a fungal infection.

18. Use of an inhibitor as defined in claim 9 in the manufacture of a medicament for use in the treatment of a fungal infection.

19. A method of treating a human or animal host suffering from a fungal infection, which method comprises administering to the host a therapeutically effective amount of an inhibitor of IPMDH expression.

20. A method of treating a human or animal host suffering from a fungal infection, which method comprises administering to the host a therapeutically effective amount of an inhibitor as defined in claim 9.