WO2000011137A1 - Acid labile cationic amphiphiles - Google Patents

Abstract

The invention relates to cationic amphiphiles, methods for their synthesis, methods for preparing compositions comprising such amphiphiles and polyanions, methods for delivering polyanions to cells by administering these compositions and treatment or prevention of diseases and disorders using these cationic amphiphiles and compositions.

Description

DESCRIPTION

ACID LABILE CATIONIC AMPHIPHILES

FIELD OF THE INVENTION

The invention relates generally to chemistry, biochemistry, biology, molecular biology and medicine. In particular it relates to novel acid labile cationic amphiphiles capable of delivering polyanions to cells.

BACKGROUND OF THE INVENTION

The following is offered as background information only and is not intended nor admitted to be prior art to the present invention. The transfer of genes into cells of various origins is an important technique for biological research. Gene transfer can facilitate straightforward studies for the function and regulation of genes and proteins in cells cultured in vi tro as well as in cells of multi-cellular organisms. Besides being a powerful research tool, gene transfer also has important economic implications through the genetic engineering of micro-organisms, plants, and animals, for the production of proteins as well as for crop and livestock improvement. Behr, 1994, Bioconjugate Chem . 5 : 382-389. There has been an increasing interest in gene transfer techniques in view of recent advances in gene therapy. Gene therapy is the treatment of diseased organisms by replacing or modifying damaged genes which lead to diseased states. Many ongoing clinical protocols make use of recombinant retroviruses which generally are by far the most efficient vehicles to integrate foreign DNA into the genome of dividing cells. Adenoviral factors have also been shown recently to efficiently transfect a large variety of post-mitotic cells. These and other currently developed biological vectors (HSV, AAV) , however, raise non-assessable long-term risks and have a limited capacity to carry foreign genetic material. Id .

Current non-viral approaches to gene transfer require that a potential therapeutic gene be cloned into plasmids. Large quantities of a bacterial host harboring the plasmid may be fermented and the plasmid DNA may be purified for subsequent use. Current human clinical trials using plasmids utilize this approach. Recombinant DNA Advisory Committee Data Management Report, December, 1994, Human Gene Therapy 6: 535-548. Studies normally focus on the therapeutic gene and the elements that control its expression in the patient when designing and constructing gene therapy plasmids. Generally, therapeutic genes and regulatory elements are simply inserted into existing cloning vectors that are convenient and readily available. For example, the gene encoding interleukin-2 (IL-2) can be cloned into plasmid vectors appropriate for gene therapy applications.

IL-2 is involved in stimulating the proliferation of helper T cells, in particular T_H1 cells by an autocrine mechanism. Secretion of IL-2 can also stimulate the proliferation of other activated helper T cells and cytotoxic T cells.

Based on these and other responses to IL-2, attempts have been made to use IL-2 in anti-tumor therapy. IL-2 polypeptides can be isolated from stimulated T_H1 cells or produced from a recombinant IL-2 gene. Such a recombinant gene is described, for example, in Taniguchi et al . , U.S. Patent Number 4,738,927, along with cells containing the recombinant gene. However, administration of high doses of IL-2 polypeptide can result in significant toxicity-related side effects, such as fever, fluid retention, and vascular leak syndrome. In addition, administration of polypeptide must be repeated at short intervals due to the short half-life of the injected polypeptide. Once an appropriate gene and plasmid-DNA vector are identified for gene therapy techniques, the DNA plasmid must be formulated into a composition appropriate for gene transfer. One of the first compounds used to formulate a composition of plasmid DNA for gene transfer was DOTMA ( (dioleoyloxypropyl) trimethyl -ammonium bromide) . This compound, called a "cationic lipid" can form compositions that efficiently transfer DNA and RNA into eukaryotic cell lines. Feigner et al . , 1987, Proc . Na tl . Acad . Sci . U. S . A . 84 : 7413- 7417 and Malone et al . , 1989, Proc . Natl . Acad . Sci . U. S . A . 86 : , 6077-6081. DOTMA has been commercialized (Lipofectin, Gibco-BRL) as a one to one mixture with DOPE (dioleoylphosphatidylethanolamine) . This mixture has been used to transfect a variety of animal and plant eukaryotic cells. Other cationic lipids have been synthesized in addition to DOTMA, such as DOTB and DOTAP dioleylesters . Levintest et al . 1990, Biochem . Biophys . Acta 1023 : 124-132.

Other examples of cationic lipids are DOGS and DPPES . DOGS and DPPES have been shown to transfect established cell lines and primary neuronal cultures more efficiently than calcium phosphate by at least two orders of magnitude. Behr, 1986, Proc . Natl . Acad . Sci . U. S . A . 86 : 6982-6986.

Cationic lipid molecules generally consist of three functional domains, a positively charged head, a linker group and a hydrophobic anchor group.

The cationic head group, which carries a net positive charge, is capable of interacting with a macromolecule having a net negative charge, an ionic bond being formed between the molecules. It is hypothesized that the composition formed when a cationic lipid interacts with a macromolecule is a generally spherical structure with the macromolecule enveloped by the cationic lipid which forms a membrane-like surface over the macromolecule. If there are more positively charged centers in the head group than there are negatively charged centers in the macromolecule, the membrane-like surface will bear a residual net positive charge. Since the natural lipids which form cell membranes are either zwitterionic or anionic and never cationic, it has been suggested that the head group of the cationic lipid/macromolecule complex, by virtue of its residual net positive charge, is also responsible for the interaction of the complex with a cell membrane thus facilitating the entrance of the complex into the cell.

The hydrophobic anchor group is responsible for holding the complex together and keeping the cationic lipids in good packing order thus giving the positively charged outer surface of the complex a degree of physical integrity.

Intact cationic lipids are suspected to be a cause of the generally lower levels of transfection observed when cationic lipids are used rather than more conventional vector techniques to deliver a macromolecule to a cell. The linker group is incorporated into the molecule to facilitate the separation of the cationic head from the hydrophobic anchor group and cause the disintegration of the cationic lipid. Thus, by virtue of either chemical or metabolic instability, the linker group determines the chemical stability and biodegradability of the cationic lipid molecule. Existing linker groups, however, do not provide a satisfactory balance between chemical stability and biodegradability. For example, many of the known cationic lipids such as DOTMA and DDAB contain ether or C-N bonds in the linker group. These bonds are chemically quite stable but are unlikely to be efficiently biodegraded in a cell. On the other hand, cationic lipids having ester linkers, such as DOTAP and ChoSC, are relatively biodegradable but the ester linkages are not chemically very stable. For example, it has been shown that a composition consisting of a cationic lipid with ester bonds and the co- lipid DOPE has a half-life of only about one day at 4° C. The practical use of such short-lived composition is problematic. Thus, there is a need for cationic delivery agents which are capable of assisting in the delivery of macromolecules to cells, are relatively stable in ex vivo compositions but are degraded rapidly once they have delivered the macromolecule to the cell. The cationic amphiphiles of the present invention are such transfer agents.

SUMMARY

Thus, in one aspect, this invention relates to cationic amphiphiles which are stable in ex vivo compositions but which are labile under the physiological conditions encountered within a cell, a cell compartment or, in some cases, notably, some tumor cells, in the immediate vicinity of such a cell. This invention further relates to the synthesis of the disclosed cationic amphiphiles, to compositions comprising these compounds and to methods for delivering polyanions to cells by administering compositions consisting of complexes of polyanions with cationic amphiphiles of this invention.

The compounds, compositions, and methods of the invention are particularly useful for gene therapy applications.

Specifically, the invention can be applied towards treating cancer. For example, a polypeptide, such as interleukin-2, may be expressed from a DNA plasmid which has been delivered to cells by the methods described herein. The interleukin-2 gene product can significantly reduce the growth rate of tumors in mammals.

Thus, in one aspect, this invention relates to a cationic amphiphile which has three separate functional domains, a cationic head, a linker and a lipophilic anchor; i.e.:

[Head] ⁺- [Linker] - [Lipophilic anchor]

The term " cationic amphiphile " refers to a molecule which contains , at one extreme , i . e . , " end, " of the molecule , a positively charged head group; i.e., a positively charged center which may consist of a single positively charged functional group or a number of positively charged groups. This end of the cationic amphiphile is capable of interacting ionically with negatively charged species such as inorganic ions, polar organic molecules and macromolecules having a net negative charge such as some polypeptides, polynucleotides and lipids .

The other end of a cationic amphiphile, as the term is used herein, is capable of interacting with non-polar, uncharged organic molecules such as, without limitation, non- polar organic solvents, oils, fats, uncharged lipids, petroleum fractions, etc.

Thus, a "positively-charged head group" refers to the end of the amphiphile which interacts with negatively-charged species. The positively-charged head group is comprised of any organic group capable of sustaining a positive charge such as, without limitation, single or polyamine groups. Such amine groups may have different degrees of substitution; i.e., they may be primary amines, secondary amines, tertiary amines, quaternary ammonium groups or combinations thereof. The substituents on the amine groups may be unsubstituted or substituted lower alkyl groups.

The other end of an amphiphile of this invention is called the "hydrophobic anchor group." This end of the amphiphile is characterized by its preference for non-polar environments over polar environments. That is, a hydrophobic anchor group, when contacted with a water-octanol mixture, will preferentially partition into the octanol layer rather than into the water layer. In fact, octanol -water partitioning is a technique well known in the chemical art for determining the hydrophobicity (or, interchangeably, lipophilicity) of a molecule. The positively-charged head group of an amphiphile would, conversely, partition into the water layer of a water- octanol mixture and thus would be characterized as hydrophilic or lipophobic. In an amphiphile the hydrophobic group is called an "anchor" group because, in water, a group of amphiphiles tend to form a more or less ordered structure with the hydrophilic positively charged head groups forming an outer "membrane" and the hydrophobic portions of the amphiphile interacting with one another to form an inner water-repelling environment. Through this interaction, the hydrophobic moieties hold, or "anchor" the structure together. The linker group, as noted previously, links the positively charged head group to the hydrophobic anchor group. By "links" is meant that the linker group is covalently bonded to the cationic head and to the hydrophobic anchor group and is situated between these moieties. Thus, a break in the linker group results in the anchor group separating from the head group which in turn results in destruction of the amphiphile and the dissembling of the ordered structure of a group of amphiphiles in water. As noted above, to enhance the utility of cationic amphiphiles for the delivery of therapeutic molecules to cells and the expression of those molecules within the cell, it is desirable that the linker group be susceptible to cleavage, either chemically or metabolically, so that the amphiphile will disintegrate once it has performed its function of delivering a macromolecule to a cell.

In a further aspect of this invention, the linker group of the amphiphiles disclosed herein is a vinyl ether which is stable in compositions of this invention but is labile under the physiological conditions. As used herein, a "vinyl ether" means a -CH=CR²OCHR³- group wherein the substitutents R² and R³ are described below. "Physiological conditions" as used herein refers to the chemical environment found in the immediate vicinity of or in the interior of a living cell or a subcellular compartment thereof. In particular, it refers to the pH; i.e., the degree of acidity or basicity within or in the immediate vicinity of a living cell, with pH 7.0 being neutral, pH 1.0 being extremely acidic and pH 14.0 being extremely basic. While the pH of blood and most extra-cellular fluids in the human body is approximately 7, the pH within some cells or subcellular compartments and, in the case of certain cells, for example, without limitation, some tumor cells, in the immediate vicinity of the cell, can range from 5.0 to 6.5. It is under this particular physiological condition, a pH of about 5.0 to about 6.5, that the vinyl ether linker group is labile.

As used herein, the term "labile" means that a linker group, under the appropriate physiological conditions, will be rapidly and efficiently broken down thus degrading the cationic amphiphile and limiting, if not eliminating, any inhibitory effect it may have on the expression of the polyanion it has delivered to the cell. By "rapidly and efficiently" is meant that from 90% to 100%, preferably from 95% to 100% and most preferably from 99% to 100% of the cationic amphiphile molecules within, or in the immediate vicinity of, a cell, will be degraded within 1 to 24 hours, preferably 1 to 12 hours and most preferably within 1 to 4 hours of having delivered a polyanion to a cell.

Thus, one aspect of this invention relates to a cationic amphiphile having the chemical structure :

I R¹ is selected from the group consisting of higher alkyl and higher alkenyl . Preferably, R¹ is selected from the group consisting of C₁₂ to C₁₈ alkyl and C₁₂ to C₁₈ alkenyl. R² is selected from the group consisting of hydrogen and, combined with R¹, the "A" ring of cholesteryl .

R³ is selected from the group consisting of hydrogen, unsubstituted lower alkyl, lower alkyl substituted with one or more hydroxy groups and -CH₂OCH=CHR¹. When R¹ and R² combine to form a cholesteryl group, R³ is hydrogen.

X is selected from the group consisting of -(C=0)-, -C(=NH)-, -OC(=0)-, -0P(=0)-, -NHC(=0)- and -NC (=NH) - .

R⁴ and R⁵ are independently selected from the group consisting of hydrogen,

-[(CH₂)_nNH⁺]_p(CH₂)_qN⁺R⁸R⁹R¹⁰ and -(CH₂)_n NH

R⁸, R⁹ and R¹⁰ are independently selected from the group consisting of hydrogen, unsubstituted lower alkyl and lower alkyl substituted with one or more hydroxy groups.

The subscript m is independently 1, 2, 3, or 4.

Likewise, n, q, r, s and t can independently be 2 , 3 or 4.

The subscript v is 0 or 1 wherein, when v is zero R⁶ is hydrogen and when v is 1, R⁶ does not exist.

Finally, p is independently 0, 1, 2 or 3.

In another aspect, this invention relates to a cationic amphiphile having the chemical structure II :

O

R^{1 1} COCH(CH₂)_xOCH=CH(CH₂)_y[X]_zNR⁴R⁵R⁶

R ι₂

I I R¹¹ is selected from the group consisting of higher alkyl and higher alkenyl .

R¹² is selected from the group consisting of hydrogen, unsubstituted lower alkyl, lower alkyl substituted with one or more hydroxy groups and -CH₂OC(=0) -R¹¹.

The subscripts x and y are independently 1, 2, 3 or 4.

X, R⁴, R⁵, R⁶, R⁸, R⁹ and R¹⁰ are the same as described above .

Likewise, z has the same meaning as v, above.

The subscripts n, q, r, s and t are independently 2 , 3 or 4.

Cationic amphiphiles of structure III comprise yet another aspect of this invention:

III

wherein R⁴, R⁵, R⁶, R⁸, R⁹, R¹⁰, y, z, n, p, q, r, s and t are as described above.

An "alkyl" group refers to an all carbon atom group containing any number of carbon atoms from 1 to 24; i.e., 1, 2, 3, 4, etc, up to 24 carbon atoms. A higher alkyl group refers to an alkyl group containing from 9 to 24 carbon atoms. Preferably, a higher alkyl group refers to a carbon chain of from 12 to 18 carbon atoms. The alkyl group may be straight chain or branched. Preferably it is straight chain. The alkyl group may also be substituted or unsubstituted. If substituted, the substituent group is fluorine. Preferably the higher alkyl group is unsubstituted. Examples of higher alkyl groups include, but are not limited to, lauryl (dodecanyl) , myristyl (tetradecanyl) , palmityl (hexadecanyl) , stearyl (octadecanyl) , decanyl (eicosanyl) , behynl (docosanyl) and lignoceryl (tetracosanyl) . "lower alkyl" group refers to a 1 to 4 carbon atom alkyl group. The lower alkyl may likewise be straight chain or branched, substituted or unsubstituted. Preferably, a lower alkyl is straight chain. When substituted, the substituent group is hydroxy. Examples of lower alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, sec-propyl, n-butyl, t-butyl, 2-hydroxypropyl, 1-hydroxy-n-butyl and 1,2- dihydroxypropyl .

An "alkenyl" group refers to a higher alkyl group, as defined above, having one or more double bonds in the carbon atom chain. Examples of alkenyl groups include, but are not limited to, palmitolyl (a 16 carbon atom straight chain alkyl group with a cis double bond between the 7^th and 8^th carbon atoms) , oleoyl (an 18 carbon atom straight chain alkyl group with a cis double bond between the 9^th and 10^th carbon atoms) and ricinolyl (an 18 carbon atom straight chain alkyl with a cis double bond between the 9^th and 10^th carbon atoms and a hydroxy group on the 7^th carbon atom in the chain) .

A "cholesteryl" group refers to a molecule having the structure :

The term "cholesteryl" as used herein also refers to any derivatives of cholesterol including, but not limited to, additions of chemical substituents to the rings of the cholesterol molecule or its branched hydrocarbon moiety. In addition, the term "cholesterol" refers to other sterols and bile salts, such as cholic acids, deoxycholic acids, ergosterol , glycocholic acid, and taurocholic acid. Other examples of sterols and bile salts can be found in Stryer, Biochemistry, 1988, W.H Freeman and Co., New York. "Combined to form the "A" ring of cholesteryl" when referring to R¹ and R² in Structure I, above, means that R¹ and R² are the carbon atoms designated as [C]_R1 and [C] _R2 in the "A" ring of the above cholesteryl group.

An "amino" group refers to an -NR⁸R⁹R¹⁰ group wherein R⁸, R⁹ and R¹⁰ are independently selected from the group consisting of hydrogen and lower alkyl . A primary amino group is one in which both R⁸ and R⁹ are hydrogen and R¹⁰ does not exist . A secondary amino group is one in which R⁸ is lower alkyl, R⁹ is hydrogen and R¹⁰ does not exist. A tertiary amino group is one in which R⁸ and R⁹ are both lower alkyl and R¹⁰ does not exist. A "positively charged" primary, secondary or tertiary amino group refers to each of the above amino groups in which R¹⁰ exists and is hydrogen in which case the group is designated as -⁺NR⁸R⁹H. A "quaternary ammonium" group refers to a -⁺NR⁸R⁹R¹⁰ group in which R⁸, R⁹ and R¹⁰ are each lower alkyl.

A "polyamino" group refers to amine groups which are covalently bonded to each other through one of the R groups . Examples, without limitation, of polyamino groups are -NH₂(CH₂) (CH₂)NH(CH₂) (CH₂)NH₂, putrescine, spermine and spermidine .

A "solvent" as used herein refers to water or to any water miscible organic solvent which is capable of dissolving a component of a complex of this invention. Examples, without limitation of such organic solvents are alcohols, polyalcohols, acetone, dimethylsulfoxide, dimethylformamide and the like.

It is a presently preferred embodiment of this invention that R¹ is oleoyl, R² is hydrogen, R³ is -CH₂OCH=CH-R¹ and m is 1 It is a further presently preferred embodiment of this invention that z is 1 and X is -0C(=0)-.

It is yet another preferred embodiment of this invention that R⁴ and R⁵ are both -CH₂CH₂NH₃ ⁺ . The cationic amphiphile of structure I, II and III is capable of interacting with negatively charged molecules to form a complex. If the number of positively charged groups in the molecule of structure I, II or III exceeds the number of negatively charged groups in the negatively charged molecule being complexed, the complex will carry a net positive charge. A "positively charged complex" refers to an aggregation of one or more non-covalently bonded groups of molecules consisting of from one to four molecules of a compound of structure I, II or III per each molecule of a polyanion. Such a complex is likewise an aspect of this invention.

In a further aspect of this invention, the preceding positively charged complex is capable of entering into the interior of a cell. Such a cell, having in its interior a complex of a compound of structure I, II or III with a negatively charged molecule is likewise an aspect of this invention.

A cell containing in its interior a compound of structure I, II or III alone is another aspect of this invention. It is also a presently preferred embodiment of this invention that the negatively charged molecule with which the compound of structure I, II or III interacts to form a complex is a polyanion.

As used herein, a "polyanion" refers to a polymeric structure wherein more than one monomeric unit of the polymer bears a negative charge and the net charge of the polymer is negative. Examples, without limitation, of polyanions are polypeptides and polynucleotides .

A "biologically active substance" refers to a molecule or mixture of molecules or to a complex or composition of such molecule or molecules which exerts a biological effect in vitro or in vivo. Examples of biologically active molecules included, without limitation, pharmaceuticals, drugs, proteins, vitamins, steroids, nucleosides, nucleotides and polyanions, as defined above.

The term "DNA" as used herein refers to molecules that comprise deoxyribonucleic acids. The DNA may be complexed with other molecules such as proteins or other excipients, such as polyvinylpyrrolidone (PVP) . The DNA might also be part of polydeoxynucleotides, nucleic acid cassettes, and may be utilized as anti-sense DNA molecules. The DNA molecules can exist in single stranded, double stranded, and triple helix forms. The DNA may also be a DNA analog. These are examples and are not to be construed as limiting the scope of this invention in any manner whatsoever.

The term "RNA molecules" as used herein refers to ribonucleic acid molecules. The RNA molecules can be complexed with other molecules. The RNA molecules can be ribozymes or may be utilized as anti-sense RNA molecules. The RNA molecules can exist in single stranded, double stranded, and triple helix forms. The RNA may also be an RNA analog. These are examples and are not to be construed as limiting the scope of this invention in any manner whatsoever.

The terms "DNA analog" and "RNA analog" as used herein refer to DNA or RNA containing chemically-modified forms of adenine, thymidine, cytosine, guanine, and uracil . Chemical moieties may be removed or deleted from these nucleotides. Alternatively, a variety of chemical moieties may be added to these nucleotides. The nucleotide analog molecules may exist in mononucleotide form or as polymers comprising one or more nucleotide analogs among other nucleotide molecules.

A polypeptide refers to a polymer of amino acids that is preferably 40 or less, more preferably 30 or less and, most preferably, 20 or less amino acids in length.

The cationic amphiphiles of this invention can directly target polyanions to specific cells and even to specific compartments within cells by incorporating targeting molecules in the complex. The cationic amphiphiles can target polyanions to specific cells in an unmodified form. These targeting molecules can be tailored to deliver the cationic amphiphile molecules or compositions to any cell type after systemic delivery. Examples of these cells are endothelial cells, cells involved at the sites of angiogenesis, lymph node cells, and antigen presenting cells. These targeting molecules can be selected, for example and without limitation, from molecules that bind receptor proteins. Examples of targeting molecules include interleukin-2 (IL-2), interleukin-12 (IL- 12), angiostatin, cytosine deaminase, VEGF, α-interferon, β- interferon, γ-interferon, vaccines, antibodies, amino acids, peptides, lytic peptides, binding peptides, peptide hormones, transferrin, lactoferrin, and the Flt-3 ligand. Other examples of targeting molecules are discussed in U.S. continuation- in-part application Serial No. 08/167,641, entitled "Nucleic Acid Transporter Systems and Methods of

Use," to Woo et al . , filed December 14, 1993, incorporated by reference herein in its entirety including all figures, tables, and drawings.

The term "binding peptide" as used herein refers to a peptide which is capable of binding to a polyanion. The binding peptide can target the polyanion to a particular compartment within cells. In addition, binding peptides may bind to polyanions and condense the polyanion, such as DNA plasmids . Methods of determining the degree to which a binding peptide condenses polyanions can be accomplished using dynamic light scattering techniques known by persons of ordinary skill in the art. The binding peptide can also harbor one or more hydrophobic moieties which enable the peptide to associate with lipid membranes of cells. Binding peptides can include, but are not limited to, components capable of stabilizing and/or condensing nucleic acid molecules by electrostatic binding, hydrophobic binding, hydrogen binding, intercalation or forming helical structures with the polyanion, preferably a nucleic acid molecule, including interaction with the major and/or minor grove of DNA. The binding peptide can be capable of non-covalently binding to polyanions, preferably nucleic acid molecules. The binding peptides may also be capable of associating with a surface ligand, a nuclear ligand, and/or a lysis agent.

The term "lytic peptide" as used herein refers to a molecule which is capable of fusing with an endosomal membrane or breaking down an endosomal membrane and freeing the contents into the cytoplasm of the cell. The lytic peptide can contain the following elements: (1) a peptide region capable of lysing endosome complexes; and (2) a hydrophobic region or regions capable of conferring a hydrophobic character to the peptide. The hydrophobic region or regions can enable the peptide to associate with lipid membranes of cells. Hydrophobic moieties of certain lytic peptide are preferably fatty alkyl moieties such as, without limitation, lauryl, myristyl, palmityl, stearyl, arachidyl , behenyl , lignoceryl, palmitolyl, olyl , linolyl, linolyl, and arachidonyl moieties. It is preferred that lytic peptides are pH selective, meaning that the lytic properties of the peptides are inactive at pHs close to neutral, i.e., pH 6 through 9, while active at a relatively acidic pH, e . g . , below pH 6. The lytic peptide may also exist in a constitutively active state. It is also preferred that lytic peptides interact with other components of the invention, such as polyanions and binding peptides.

A positively charged complex of a compound of structure I, II or III with a polyanion is likewise an aspect of this invention.

A positively charged complex of a compound of structure I, II or III with a polyanion selected from the group consisting of polypeptides and polynucleotides is a presently preferred embodiment of this invention. In another presently preferred embodiment of this invention, the polynucleotide complexed with a compound of structure I, II or III is DNA or RNA.

In a presently particularly preferred embodiment of this invention, the DNA is a plasmid molecule comprising at least one element for polypeptide expression in eukaryotic cells. The term "plasmid molecule" as used herein refers to a construct comprising genetic material (i.e., nucleic acids) . A plasmid molecule includes genetic elements arranged such that an inserted coding sequence can be transcribed in eukaryotic cells. In addition, at least a portion of the plasmid may be able to incorporate in random or defined regions within cellular genomic DNA. Alternatively, the plasmid may replicate independently of the cellular genomic DNA. Also, while the plasmid may include a sequence from a viral nucleic acid molecule, such a viral sequence may not cause the incorporation of the plasmid into a viral particle, and the plasmid is therefore a non-viral vector. Preferably, a plasmid is a closed circular DNA molecule.

The term "element for polypeptide expression" as used herein refers to a portion on the plasmid made up of nucleic acid molecules that promotes the transcription of a nucleotide sequence of the plasmid into RNA. If the RNA is messenger RNA, the messenger RNA is typically translated into a polypeptide. In some cases, an RNA product may have relevant activity (i.e., a ribozyme) and could thus be regarded as a gene product. The process of expression may involve further processing steps to the RNA product of transcription, such as splicing to remove introns, and/or post-translational processing of a polypeptide product. The term "element for polypeptide expression" may also be referred to as an expression cassette. An expression cassette contains at least one coding sequence along with sequence elements which direct the initiation and termination of transcription. A transcription unit may however include additional sequences, which may include sequences involved in post-transcriptional or post-translational processes.

The term "coding region" or "coding sequence" refers to a nucleic acid sequence which encodes a particular gene product for which expression is desired, according to the normal base pairing and codon usage relationships. Thus, the coding sequence must be placed in such a relationship to transcriptional control elements and to translational initiation and termination codons that a proper length transcript will be produced and will result in translation in the appropriate reading frame to produce a functional desired product .

A method for forming a positively charged complex by mixing a solution of a polyanion with a solution of a compound of structure I, II or III is also an aspect of this invention.

Likewise, methods of delivering a positively charged complex to a cell by incubating the complex with a cell or cell culture in vitro or in vivo comprise aspects of this invention. By "incubating" is meant to bring the complex into contact with a cell or cell culture under environmental conditions of temperature, nutrients, pH, etc. which are conducive to biochemical activity in the cell or cell culture.

By "delivering" a complex to a cell is meant the transportation of a molecule to a cell . The molecule may be delivered to the cell surface, cell membrane, cell endosome, into the cell cytoplasm, into the cell nucleus or other subcellular compartment or any other desired area of the cell. Compositions of the claimed positively charged complexes disclosed herein are another aspect of this invention. By "composition" is meant a mixture of a complex of this invention with, optionally, physiologically acceptable carriers, excipients, etc. as well as, again, optionally, co- lipids wherein the term "co-lipid, " as used herein, refers to a hydrophobic molecule which can be formulated into compositions in conjunction with positively charged liphophiles of the invention. Examples, without limitation, of co-lipids are phospholipids, fatty acids, cholesterol, and cholesterol derivatives. Specific examples of co-lipid include, without limitation, sphinoglomerin, phosphatidylserine, phosphatidylinositol , cephalin, dioleolyphosphatidyl ethanolamine (DOPE), cholesterol, dipalmitoylphosphatidylglycerol (DOPC) palmitolyloleoyl- phosphatidyl choline )P0PC, glycerol ricinoleate, stearylamine, dodecylamine, hexadecyl stearate, isopropyl myristate, alkyl -aryl sulfate polyethoxylated fatty acid amides, amphoteric acrylic polymers and the like.

In yet another preferred embodiment, the invention relates to a composition in which the co-lipid is DOPE. The term "DOPE" as used herein refers to dioleoyl- phosphatidylethanolamine . This phospholipid is zwitterionic, indicating that it has both a positive and a negative charge at neutral pH. Compositions comprising cationic amphiphiles of this invention and DOPE molecules may form liposomes of appropriate diameters for the delivery of the DNA plasmids into cells. However, the cationic amphiphiles of this invention can also adopt micelle conformations, and may form condensed and non-condensed DNA/cationic amphiphile complexes. In another preferred embodiment, the invention relates to a composition wherein the co-lipid is cholesterol.

A method of treating or preventing a disease or disorder in an organism using a positively charged complex of this invention or a composition thereof which is incubated with a cell or cell culture in vitro and then administered to the organism is another aspect of this invention.

As used herein, a "organism" refers to something as simple as a single living cell to complex life forms such as mammals, in particular humans.

Likewise, a method of treating or preventing a disease or disorder in an organism using a complex or composition of this invention which is administered directly to an organism in vivo is an aspect of this invention. Methods for synthesizing cationic amphiphiles is also an aspect of this invention.

Finally, kits containing a compound of this invention together with a polyanion and a cell culture and, optionally, literature describing the methods disclosed herein and FDA approval of the contents of the kit are aspects of this invention.

BRIEF DESCRIPTION OF THE TABLES

1. Table I shows the coding sequence homology of a wild type IL-2 polynucleotide and an optimized IL-2 polynucleotide.

2. Table II shows the translation of the natural coding sequence of the wild type IL-2.

3. Table III shows some cationic lipid formulations the compositions of which might be applicable to compositions of the cationic amphiphiles of the present invention.

4. Table IV shows a comparison of the transfection efficiency of a cationic amphiphile of this invention compared to that of a commercial composition, DOTMA/Cho1. As can be seen, the DOTMA/Chol appears to be more efficient in infecting a cell, as indicated by the Log Mean Fluorescence (labeled plasmid) column, but the vinyl ether compound was far superior in it ability to permit transfection and expression of the delivered plasmid, as indicated by the Log Mean Fluourescence (expressed protein) column.

BRIEF DESCRIPTION OF THE FIGURES

1. Figure 1 shows a comparison of the amount of light emitted as RLUs (relative light units) from cells that were treated with a compound of this invention; i.e., a vinyl ether linked cationic amphiphile, an analog of a compound of this invention which lacks the vinyl ether linkage (Eth) and a commercial cationic lipid composition, DOTMA/CHOL, each delivering a luciferase expressing plasmid to the cell. The first, solid black bar is vinyl ether cationic amphiphile (VE) in the presence of 10% fetal calf serum, the second, right to left diagonally hatched bar is VE in the absence of serum, the third, left to right diagonally hatched bar is Eth in the presence of serum and the fourth, vertically striped bar is Eth in the absence of serum. In the column labeled

"DOTMA/CHOL, " the solid bar is DOTMA/CHOL in the presence of serum and the right to left hatched bar is DOTMA/CHOL in the absence of serum.

2. Figure 2 shows the results of in vivo transfection of cells using iv administration of a complex of a compound of this invention and a chloramphenicol acetyltransferase (CAT) expressing plasmid compared to a complex of a CAT-expressing plasmid and a commercial cationic lipid composition, DOTMA/CHOL.

DETAILED DESCRIPTION OF THE INVENTION

Methods of Delivering Polyanions

In another aspect, the invention features a method for delivering polyanions to one or more cells of an organism. The method comprises the step of administering a composition of this invention to the cells.

The term "administering" as used herein refers to a procedure for introducing a polyanion, preferably a nucleic acid molecule, into the body of an organism. The composition can be administered directly to a target tissue or administered by systemic delivery. Specifically, administration may be accomplished by direct injection into tissue. A molecular complex may also be administered intravenously, intramuscularly, by hypospray, or in conjunction with various excipients, such as polyvinylpyrrolidone (PVP) . Routes of administration include intramuscular, intramural, aerosol, oral, topical, systemic, nasal, ocular, parenteral, intraperitoneal , and/or intratracheal . Compositions of the invention can be administered to an organism by direct injection into the organism or by removing cells from an organism and transforming these cells with the nucleic acid molecules delivered by the methods and compositions of the invention. In addition, the compositions of this invention can be administered by direct microinjection, electroporation, skin grafts and microprojectiles . See, for example, Woo, et al . , International Application No. PCT/US93/02725 , filed March 19, 1993, international Publication No. WO 93/18759 published September 30, 1993 and entitled, "A DNA Transporter System and Method of Use," which is incorporated by reference as if fully set forth herein.

As used herein, "transformation" or "transformed" is a mechanism of gene transfer which involves the uptake of nucleic acid molecules by a cell or organism. It is a process or mechanism of inducing transient or permanent changes in the characteristics (expressed phenotype) of a cell. Such changes are by a mechanism of gene transfer whereby nucleic acid molecules are introduced into a cell in a form where they can express a specific gene product or alter the expression of, or effect, of endogenous gene products.

The term organism includes mammals. A "mammal" as used herein refers to any warm-blooded organism. Such organisms are preferably mice, rats, rabbits, guinea pigs, and goats, more preferably cats, dogs, monkeys and apes, and most preferably humans .

In a preferred embodiment, the invention relates to a method for delivering polyanions to cells, where the composition is administered to the cells in vi tro .

The term "cells in vi tro" as used herein refers to cultured cells. The cells may have been removed from an organism and placed in a culture dish with an appropriate medium that maintains the cellular integrity. These types of cells may be part of a tissue or may exist as rapidly dividing cells that form monolayers in culture dishes. These cells may optionally be placed into an organism after administration of the composition.

In another preferred embodiment, the invention relates to a method for delivering polyanions to cells, where the composition is administered to cells in vivo .

The term "cells in vivo" as used herein refers to cells which exist inside of an organism. The cells may be of the same or different origin as the organism. For example, cultured cells from one organism may be placed and grown within another organism.

In yet another preferred embodiment, the invention relates to a method for delivering polyanions to cells, where the administration results in IL-2 expression in the cells. In other preferred embodiments, the invention relates to a method for delivering polyanions to cells, where the composition is administered by the techniques set forth by the group consisting of direct injection to a tissue, parenteral injection, intravenous injection, oral administration, and administration by inhalation.

Theory

The following explanation of the invention is to aid in understanding various aspects of the invention. The following explanation does not limit the operation of the invention to any one theory.

An important goal of the current invention is to increase the efficacy of gene delivery and gene expression in target cells. Gene delivery is the first step in the process of ultimately obtaining expression of a product encoded by a nucleic acid molecule targeted for delivery to a cell. One method of improving gene delivery is to enhance the uptake of nucleic acid molecules by cells. Accordingly, it would be desirable to find a substance able to complex with nucleic acid molecules, protect them from degradation by nucleases, and enhance uptake of the nucleic acid molecules by the target cells by either non-specific adsorptive mechanisms or receptor mediated endocytosis. In addition, adding other moieties to the composition can enhance the ability of the composition to obtain expression of the product targeted to cells. Furthermore, these substances should be readily available, biocompatible and capable of being modified to alter their physical, chemical, and physiological properties. Such substances should be able to form compositions suitable for administration to an organism by various means such as, but not limited to, injection or oral delivery while maintaining or regaining the physical characteristics necessary to increase cellular uptake and expression of nucleic acids or oligonucleotides.

The cationic amphiphiles of this invention are such substances. The embodiments and examples below demonstrate that cationic amphiphile compositions form complexes with nucleic acid molecules for cell delivery. It was found that though in vi tro transfection results do not necessarily predict effective in vivo delivery, the cationic amphiphiles of this invention can be used in compositions which enhance in vivo delivery, as well as in vi tro transfection of nucleic acid molecules. Thus, the embodiments and examples include in vivo and in vi tro techniques, various cellular or animal models and methods for inserting nucleic acid into cells. Polyanions

A variety of polyanions can be delivered to cells using the molecular complexes of the invention. These polyanions include proteins, peptides, lipids, carbohydrates, peptidomimetics, organic molecules and, preferably, nucleic acid molecules. A preferred type of polypeptide delivered to cells using the molecular complexes of the invention are toxins, such as ricin and other cytotoxic agents. The specific delivery of toxins to cells can potentially eradicate harmful cells in an organism. This application is particularly useful in the treatment of certain cancers.

The term "nucleic acid molecules" as used herein refers to DNA and RNA molecules. The nucleic acid molecules can exist in a state in which they are complexed to other molecules, such as radiolabels or dyes. These molecules can be associated with the nucleic acid molecules in a covalent or non-covalent reversibly associated fashion. The nucleic acid molecules may exist as recombinant vectors containing a variety of nucleic acid elements. These elements can include promoter elements, ribosome binding elements, drug resistance elements, replication binding elements, and genes. A variety of proteins and polypeptides can be encoded by a gene harbored within a nucleic acid molecule of the invention. Those proteins or polypeptides include hormones, growth factors, enzymes, clotting factors, apolipoproteins, receptors, drugs, oncogenes, tumor antigens, tumor suppressors, cytokines, viral antigens, parasitic antigens, bacterial antigens and chemically synthesized polymers and polymers biosynthesized and/or modified by chemical, cellular and/or enzymatic processes. Specific examples of these compounds include proinsulin, insulin, growth hormone, androgen receptors, insulin-like growth factor I, insulin-like growth factor II, insulin growth factor binding proteins, epidermal growth factor, TGF-α, TGF-β, dermal growth factor (PDGF) , angiogenesis factors (acidic fibroblast growth factor, basic fibroblast growth factor and angiogenin) , matrix proteins (Type IV collagen, Type VII collagen, laminin) , oncogenes ( ras, fos, myc, erjb, src, sis, j un) , E6 or E7 transforming sequence, p53 protein, cytokine receptor, IL-1, IL-6, IL-8, IL-2, α-, β-, or γ-IFN, GMCSF, GCSF, viral capsid protein, and proteins from viral, bacterial and parasitic organisms. Other specific proteins or polypeptides which can be expressed include phenylalanine hydroxylase, α-1- antitrypsin, cholesterol -7α-hydroxylase, truncated apolipo- protein B, lipoprotein lipase, apolipoprotein E, apolipopro- tein Al , LDL receptor, scavenger receptor for oxidized lipoproteins, molecular variants of each, VEGF, and combinations thereof. Other examples are clotting factors, apolipoproteins, drugs, tumor antigens, viral antigens, parasitic antigens, and bacterial antigens. Other examples can be found above in the discussion of nucleic acid. One skilled in the art readily appreciates that these proteins belong to a wide variety of classes of proteins, and that other proteins within these classes can also be used. These are only examples and are not meant to be limiting in any way. It should also be noted that the genetic material which is incorporated into the cells from the molecular complex includes (1) nucleic acid molecules not normally found in the cells; (2) nucleic acid molecules which are normally found in the cells but not expressed at physiological significant levels; (3) nucleic acid molecules normally found in the cells and normally expressed at physiological desired levels; (4) other nucleic acid molecules which can be modified for expression in cells; and (5) any combination of the above. In addition, the term "polyanions" may relate to nucleic acid molecules that can cleave RNA molecules in specific regions . The nucleic acid molecules which can cleave RNA molecules are referred to in art as ribozymes, which are RNA molecules themselves. Ribozymes can bind to discrete regions on a RNA molecule, and then specifically cleave a region within that binding region or adjacent to the binding region. Ribozyme techniques can thereby decrease the amount of polypeptide translated from formerly intact message RNA molecules. The methods of the invention can enhance the delivery of ribozyme nucleic acid molecules to cells using the compositions described herein.

Furthermore, the polyanions cited herein may relate to nucleic acid molecules which can bind to specific RNA sequences or DNA sequences. Nucleic acid molecules which are designed to specifically bind to regions on RNA molecules or

DNA molecules are utilized in antisense techniques. Antisense techniques include the delivery of RNA or DNA to cells that are homologous to messenger RNA sequences in the cell or two specific sequences in genomic DNA. The antisense nucleic acid molecules bind to the messenger RNA molecules and block the translation of these messenger RNA molecules. Antisense techniques can thereby block or partially block the synthesis of particular polypeptides in cells. The methods of the invention can enhance the delivery of antisense nucleic acid molecules to cells using the compositions described herein. In addition to the above, a polyanion which may be delivered by the methods of this invention include nucleic acid cassettes which contains a gene, a 5' flanking region including the necessary sequences for expression of the gene; a linker sequence which connects the 5' flanking region to the gene thereby allowing expression of the gene in a cell, the linker itself lacking any coding sequences with which it is naturally associated; and, a 3' flanking region which contains elements necessary for regulation of expression of the gene. Utility

The compositions of the present invention enhance delivery of polyanions into cells. The enhanced delivery can be a function of delivering condensed nucleic acid molecules into the nucleus of cells. These compositions can be used to treat diseases by enhancing the delivery of specific nucleic acid molecules to appropriately targeted cells. These compositions can also be used to create transformed cells, as well as transgenic animals for assessing human disease in an animal model .

The present invention features the use of compositions of cationic amphiphiles with nucleic acid molecules noncovalently bound to the cationic amphiphiles. The amphiphiles may be capable of condensing the nucleic acid molecules or oligonucleotides; that is, causing the nucleic acid or oliognucleotide molecules to condense into a physically smaller space that the molecule would normally take up. Thus the cationic amphiphiles decribed herein may provide small, condensed compositions, or reduced diameter compositions, and more stable nucleic acid particles for delivery, thereby enhancing the transfection efficiency of nucleic acid molecules into cells and their nuclei.

By taking advantage of the characteristics of cationic amphiphilic compositions, the present invention enhances delivery of nucleic acid molecules to cells. The components of the compositions can be used alone, together or with other components of a nucleic acid carrier as disclosed in PCT publication WO 93/18759, Woo et al . , entitled "A DNA Carrier System and Method of Use, " which (including drawings) is incorporated herein by reference in its entirety. The cationic amphiphile compositions may also comprise lipophilic condensing peptides and/or lipophilic lytic peptides, which can enhance the delivery of nucleic acid molecules to cells by facilitating the release of stable, condensed nucleic acid molecules from endosomes into the interior of cells. Such molecules are described in U.S. Patent Application Serial No. 08/584,043, titled "Lipophilic Peptides for Macromolecule Delivery" filed on January 11, 1995, incorporated by reference herein in its entirety, including all figures and drawings. This application also discloses examples of receptor ligands and nuclear ligands, which may also be included in the compositions described herein. These targeting ligands are capable of binding to a cell surface receptor and entering a cell through cytotic mechanisms ( e . g. , endocytosis, potocytosis, pinocytosis) . By using targeting ligands specific to certain cells, nucleic acid molecules can be delivered directly to the desired tissue using the claimed cationic amphiphile compositions. In addition, nuclear localization signals are capable of recognizing and transporting nucleic acid molecules through the nuclear membranes to the nucleus of the cells.

The advantages provided by the above-described cationic amphiphile compositions can be used to dissect molecular carcinogenesis and disease, assess potential chemical and physical carcinogens and tumor promoters, explore model therapeutic avenues for humans, household pets and livestock and for other agricultural purposes, as well by applying the components and techniques described herein to transgenic animal models. Furthermore, the above-described cationic amphiphile compositions may be incorporated into methods for administration and treatment of various diseases. In addition, the above cationic amphiphile compositions can transform cells to produce particular proteins, polypeptides, and/or RNA. Likewise, cationic amphiphile compositions can be used in vi tro with tissue culture cells. In vi tro uses allow the role of various nucleic acids to be studied by targeting specific expression of RNA or polypetides to specific tissue culture cells.

The present invention also encompasses transgenic animals whose cells contain the nucleic acid molecules referenced above, which may be delivered via the cationic amphiphile compositions of this invention. These cells include germ-line or somatic cells. Transgenic animal models can be used for dissection of molecular carcinogenesis and disease, for assessing potential chemical and physical carcinogens and tumor promoters, for exploring model therapeutic avenues and for livestock agricultural purposes. The methods of use also include a method of treating or preventing human disease, which is another aspect of the present invention. The method of treatment or prevention includes the step of administering the cationic amphiphile compositions as described herein to deliver polyanions to a cell or tissue. A method of treatment may include the transcription or translation of products from the nucleic acid molecules delivered to the cells or tissues. Cell or tissue types of interest can include, but are not limited to: liver, muscle, lung, endothelium, joints, skin, bone, tumors, and blood.

The term "preventing" as used herein refers decreasing the probability that an organism contracts or develops the abnormal condition.

The term "treating" as used herein refers to having a therapeutic effect and at least partially alleviating or abrogating the abnormal condition in the organism.

The term "therapeutic effect" as used herein refers to relieving to some extent one or more of the symptoms of the abnormal condition. With respect to cancer, the term "therapeutic effect" can refer to the inhibition of cell growth causing, or contributing to, the cancerous abnormal condition. The term "therapeutic effect" can also refer to the inhibition of growth factors causing, or contributing to, the abnormal condition.

In reference to the treatment of a cancer, a therapeutic effect refers to one or more of the following: (a) a reduction in tumor size; (b) inhibition (i.e., slowing or stopping) tumor metastasis; (c) inhibition of tumor growth; and (d) relieving to some extent one or more of the symptoms associated with the abnormal condition. Compounds demonstrating efficacy against leukemias can be identified as described herein, except that rather than inhibiting metastasis, the compounds may instead slow or decrease cell proliferation or cell growth.

The methods of treatment or use include methods for delivering nucleic acid molecules into a hepatocyte by contacting a hepatocyte with the above-referenced cationic amphiphile compositions. A surface ligand appropriate for this application is one specific for recognition by hepatocyte receptors. In particular, the asialoorosomucoid protein or galactose may be utilized as a cell surface ligand. Furthermore, these methods of use also include delivery of nucleic acid molecules using a cationic amphiphile composition of this invention, which may further comprise the lipophilic lytic or lipophilic condensing peptides or receptor or nuclear ligands described herein.

An embodiment of the methods of treatment or use includes a method for delivering polyanions to muscle cells by contacting the muscle cell with one of the above referenced cationic amphiphile compositions. The surface ligand used is specific for receptors contained in the muscle cell. For example, the surface ligand can be insulin-like growth factor- I. Furthermore, the methods of treatment or use may also include delivery of nucleic acid molecules by using a cationic amphiphile composition. The term "muscle cell" as used herein refers to cells associated with skeletal muscle, smooth muscle or cardiac muscle. Another embodiment of the methods of treatment or use includes a method for delivering macromolecules to bone- forming cells by contacting the bone-forming cells with the cationic amphiphile compositions of the invention. A surface ligand that can be utilized in conjunction with cationic amphiphile compositions is specific for receptors associated with bone-forming cells. In particular, surface ligands can include, but are not limited to, bone morphogenetic protein or cartilage induction factor. In addition, cationic amphiphilic compositions may also include lipophilic peptides and/or lytic peptides as described above. As used herein, the term "bone- forming cell" refers to those cells which promote bone growth.

Non-limiting examples include osteoblasts, stromal cells, inducible osteoprogenitor cells, determined osteoprogenitor cells, chondrocytes, as well as other cells capable of aiding bone formation.

Still another related embodiment of the methods of treatment or use includes a method for delivering nucleic acid molecules to synoviocytes or macrophages using the above referenced cationic amphiphile compositions. The cationic amphiphile composition can comprise lipophilic condensing peptides or lipophilic lytic peptides as described above. The term "synoviocytes" refers to cells associated with the joints or with the fluid space of the joints.

In addition to the above methods, the method of use also includes delivery of polyanions to cells by administering cationic amphiphile compositions comprising nuclear ligand binding complexes . Such nuclear carriers would help direct the cationic amphiphile composition to the nuclei of cells. Furthermore, the above methods of use also include cationic amphiphile compositions that may also comprise any of the following molecules: lipophilic lytic peptides, lipophilic condensing peptides, receptor ligands, and nuclear ligands.

IL-2 Coding Sequences

Another aspect of this invention includes cationic amphiphile compositions which comprise a DNA plasmid harboring an expression cassette with a gene encoding interleukin-2 (IL- 2) . The nucleotide sequence of a natural human IL-2 coding sequences is known, and is provided below, along with a synthetic sequence which also codes for human IL-2.

In some cases, instead of the natural sequence coding for IL-2, it is advantageous to utilize synthetic sequences which encode IL-2. Such synthetic sequences may incorporate alternate codon usage from the natural sequence, and thus have dramatically different nucleotide sequences from the natural sequence. In particular, synthetic sequences can be used which have codon usage at least partially optimized for expression of the IL-2 polypeptide in a human. The natural sequences do not have such optimal codon usage. Preferably, substantially all the codons are optimized.

Optimal codon usage in humans is indicated by codon usage frequencies for highly expressed human genes. The codons, which are most frequently used in highly expressed human genes, are presumptively the optimal codons for expression in human host cells, and thus form the basis for constructing a synthetic coding sequence. An example of a synthetic IL-2 coding sequence is shown as the bottom sequence in Table I . However, rather than a sequence having fully optimized codon usage, it may be desirable to utilize an IL-2 encoding sequence which has optimized codon usage except in areas where the same amino acid is too close together or abundant to make uniform codon usage optimal. In addition, other synthetic sequences can be used which have substantial portions of the codon usage optimized, for example, with at least 50%, 70%, 80% or 90% optimized codons as compared to a natural coding sequence. Other particular synthetic sequences for IL-2 can be selected by reference to a codon usage chart. A sequence is selected by choosing a codon for each of the amino acids of the polypeptide sequences. DNA molecules corresponding to each of the polypeptides can then be constructed by routine chemical synthesis methods. For example, shorter oligonucleotides can be synthesized, and then ligated in the appropriate relationships to construct the full-length coding sequences.

TABLE I

HOMOLOGY OF WILD TYPE AND OPTIMIZED IL-2

Gap Weight: 5.000 Average Match: 1.000 Length Weight: 0.300 Average Mismatch: -0.900

Quality: 235.9 Length: 462

Ratio: 0.511 Gaps : 0

Percent Similarity: 74.242 Percent Identity: 74.242

TOP: WILD TYPE SEQ ID NO. 1

BOTTOM : OPTIMIZED SEQ ID NO. 2

639 ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGT 688

MINI I Mill II III Mill II II II M II M II

1 ATGTACCGCATGCAGCTGCTGAGCTGCATCGCCCTGAGCCTGGCCCTGGT 50 689 CACAAACAGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAAC 738

II Mill II II II M M Mill II Mill II I 51 GACCAACAGCGCCCCCACCAGCAGCAGCACCAAGAAGACCCAGCTGCAGC 100

739 TGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAAT 788

101 TGGAGCACCTGCTGCTGGACCTGCAGATGATCCTGAACGGCATCAACAAC 150 . . . . .

789 TACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCC 838

151 TACAAGAACCCCAAGCTGACCCGCATGCTGACCTTCAAGTTCTACATGCC 200 839 CAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCA 888

111111111111 II Mill II II Mill II M M M II I

201 CAAGAAGGCCACCGAGCTGAAGCACCTGCAGTGCCTGGAGGAGGAGCTGA 250

889 AACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTA 938

251 AGCCCCTGGAGGAGGTGCTGAACCTGGCCCAGAGCAAGAACTTCCACCTG 300 939 AGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAA 988 301 CGCCCCCGCGACCTGATCAGCAACATCAACGTGATCGTGCTGGAGCTGAA 350 989 GGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCA 1038

I I I I I I I I I I M M I I I M M I I M M i l l I I M M

351 GGGCAGCGAGACCACCTTCATGTGCGAGTACGCCGACGAGACCGCCACCA 400 . . . . .

1039 TTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCA 1088

401 TCGTGGAGTTCCTGAACCGCTGGATCACCTTCTGCCAGAGCATCATCAGC 450 1089 ACACTGACTTGA 1100 451 ACCCTGACCTGA 462

It was determined that both the natural coding sequence and the synthetic coding sequence are translated to form the identical polypeptide, the sequence of which is shown in Table II as the translation of the natural coding sequence (SEQ ID NO. 3) .

TABLE II TRANSLATION of WILD TYPE IL-2

1 MYRMQLLSCI ALSLALVTNS APTSSSTKKT QLQLEHLLLD LQMILNGINN

51 YKNPKLTRML TFKFYMPKKA TELKHLQCLE EELKPLEEVL NLAQSKNFHL

101 RPRDLISNIN VIVLELKGSE TTFMCEYADE TATIVEFLNR WITFCQSIIS

151 TLT*

Administration

Administration as used herein refers to the route of introduction of the cationic amphiphile composition into the body of an organism. Administration includes, but is not limited to, parenteral delivery such as intravenous, intramuscular, systemic, subcutaneous, subdermal , interperitoneal , intrathecal and intraarticular injection as well as topical, oral and nasal methods of delivery. Administration can be directly to a target tissue or through systemic delivery. In particular, the present invention can be used for administering nucleic acid for expression of specific nucleic acid sequences in cells. Routes of administration include intramuscular, intrathecal, interperitoneal, intraarticular, aerosol, olfactory, oral, topical, systemic, ocular, and/or intratracheal. A preferred method of administering cationic amphiphile composition is by parenteral delivery. Another preferred method of administration is by direct injection into the cells or by systemic intravenous injection.

The direct transfer of genes has proven to be very effective. Experiments show that administration by direct injection of DNA into joints and thyroid tissue results in expression of the gene in the area of injection. Injection of plasmids containing IL-1 genes into the spaces of the joints results in expression of the gene for prolonged periods of time. The injected DNA appears to persist in an unintegrated extrachromosomal state. This means of transfer is one of the preferred embodiments. In addition, another means to administer the cationic amphiphile compositions of the present invention is by using a dry powder form for inhalation.

Furthermore, administration may also be through an aerosol composition or liquid form into a nebulizer mist and thereby inhaled.

The specific delivery route of any selected vector construct will depend on the particular use for nucleic acid molecules associated with the cationic amphiphile composition. In general, a specific delivery program for each cationic amphiphile composition will focus on uptake with regard to the particular targeted tissue, followed by demonstration of efficacy. Uptake studies will include uptake assays to evaluate cellular uptake of the nucleic acid molecules and expression of the specific nucleic acid molecules of choice. Such assays will also determine the localization of the target nucleic acid molecules after uptake, and establishing the requirements for maintenance of steady-state concentrations of expressed protein. Efficacy and cytotoxicity is then tested. Toxicity will not only include cell viability but also cell function. Examples of these tests and assays are set forth herein.

The chosen method of delivery should result in cytoplasmic accumulation and optimal dosing. The dosage will depend upon the disease and the route of administration but should be between 0.1-1000 mg/kg of body weight/day. This level is readily determinable by standard methods. The level is variable depending on the optimal dosing. The duration of treatment will extend through the course of the disease symptoms, possibly continuously. The number of doses will depend upon disease delivery vehicle and efficacy data from clinical trials.

Establishing therapeutic levels of nucleic acid molecules or oligonucleotides within the cell may be dependent upon the rate of uptake and degradation of these molecules. Decreasing the degree of degradation can prolong the intracellular half- life of the nucleic acid molecules or oligonucleotides.

Cell Transfection One embodiment of the present invention includes cells transfected with nucleic acid molecules associated with the cationic amphiphile compositions described above. Once the cells are transfected, the cells will express the protein, polypeptide, or RNA encoded for by the nucleic acid. Cells include, but are not limited to, liver, muscle, and skin.

This description is not intended to be limiting in any manner. The nucleic acid molecules comprising genetic material of interest may be positionally and sequentially oriented within the host or vectors such that the nucleic acid molecules can be transcribed into RNA and, when desired, be translated into proteins or polypeptides in the transfected cells. A variety of proteins and polypeptides can be expressed by the sequence in the nucleic acid cassette in the transfected cells. These products may function as intracellular or extracellular structural elements, ligands, hormones, neurotransmitters, growth regulating factors, apolipoproteins, enzymes, serum proteins, receptors, carriers for small molecular weight compounds, drugs, immunomodulators, oncogenes, tumor suppressors, toxins, tumor antigens, antigens, antisense inhibitors, triple strand forming inhibitors, ribozymes, or as a ligand recognizing specific structural determinants on cellular structures for the purpose of modifying their activity. Transfection can be accomplished by in vivo or ex vivo techniques. Those skilled in the art are familiar with such techniques for transfection. Transfection by ex vivo techniques includes co-transfecting the cells with nucleic acid molecules that contain a selectable marker. This selectable marker can be used to select those cells which have become transfected. Selectable markers are well known to those skilled in the art.

For example, one approach to polyanion delivery for hepatic diseases is to remove hepatocytes from an affected individual, genetically alter them in vi tro, and re-implant them into a receptive locus. The ex vivo approach can include the steps of harvesting hepatocytes, cultivating the hepatocytes, transducing or transfecting the hepatocytes, and introducing the transfected hepatocytes into the affected individual .

The hepatocytes may be obtained in a variety of ways . They may be taken from the individual who is to be later injected with the hepatocytes that have been transfected or they can be collected from other sources, transfected and then injected into the individual of interest.

Once the ex vivo hepatocyte is collected, it may be transfected by contacting the hepatocytes with media that comprises a cationic amphiphile composition and maintaining the cultured hepatocytes in the media for sufficient time and under conditions appropriate for uptake and transfection of the hepatocytes . The hepatocytes may then be introduced into an orthotopic location (i.e., the body of the liver or the portal vasculature) or heterotopic locations by injection of cell suspensions into tissues. One skilled in the art will recognize that the cell suspension may comprise salts, buffers, or nutrients to maintain viability of the cells as well as proteins to ensure cell stability, and factors to promote angiogenesis and growth of the implanted cells. In an alternative method, harvested hepatocytes may be grown ex vivo on a matrix consisting of plastics, fibers or gelatinous materials which may be surgically implanted in an orthotopic or heterotopic location after transduction. This matrix may be impregnated with factors to promote angiogenesis and growth of the implanted cells. Cells can then be re- implanted. These examples are provided for illustrative purposes and are non-limiting.

Direct Delivery of Macromolecules to the Liver

Cationic amphiphile compositions of the present invention can also be used in reversing or arresting the progression of disease involving the liver, such as liver cancer. One embodiment involves use of intravenous methods of adminis- tration for delivering nucleic acid molecules which encode a necessary molecule that may treat disease in the liver. Cationic amphiphile compositions which express a necessary protein or RNA can be directly injected into the liver or blood supply so as to travel directly to the liver.

Direct Delivery of polyanions to Muscle

The muscular dystrophies are a group of diseases that result in abnormal muscle development, as a result of multiple factors. These diseases can be treated by using the direct delivery of genes with the cationic amphiphile compositions of the present invention resulting in the production of normal gene product. Delivery to the muscle using methods of the present invention is performed to present genes that produce various antigens for vaccines against a multitude of infections of both viral, bacterial, and parasitic origin. The detrimental effects caused by aging can also be treated using the cationic amphiphile-based compositions described herein. Since the injection of the growth hormone protein promotes growth and proliferation of muscle tissue, the growth hormone gene can be delivered to muscle, resulting in both muscle growth and development, which is decreased during the later stages of the aging process . Genes expressing other growth related factors can be delivered, such as Insulin-Like Growth Factor- 1 (IGF-1) . These examples are not to be considered limiting, any number of different genes may be delivered by this method to muscle tissue.

IGF-1 can be used to deliver DNA to muscle, since it undergoes uptake into cells by receptor-mediated endocytosis. This polypeptide is 70 amino acids in length and is a member of the growth factor family and is structurally related to insulin. It is involved in the regulation of tissue growth and cellular differentiation effecting the proliferation and metabolic activities of a wide variety of cell types, since the polypeptide is specific for receptors on many types of tissue. As a result, the cationic amphiphile compositions of the present invention can include IGF-1 as a ligand for tissue-specific nucleic acid delivery to muscle. The advantage of an IGF-1/nucleic acid molecule delivery system is that the specificity and the efficiency of the delivery is greatly increased due to a great number of cells coming into contact with the ligand/composition with uptake through receptor-mediated endocytosis. Use of the cationic amphiphile compositions that comprise the nucleic acid molecules of the invention and/or specific receptor and nuclear ligands described herein provides treatment of diseases and abnormalities that affect muscle tissues.

Direct Delivery of polyanions to Osteogenic Cells One major disfunction associated with the aging process is osteoporosis, which is a decrease in overall bone mass and strength. The direct delivery of cationic amphiphile compositions of the present invention can be utilized to deliver genes to cells that promote bone growth. Osteoblasts are the main bone forming cell in the body, but there are other cells that are capable of aiding in bone formation. The stromal cells of the bone marrow are the source of stem cells for osteoblasts . The stromal cells differentiate into a population of cells known as Inducible Osteoprogenitor Cells (IOPC) , which under induction of growth factors, differentiate into Determined Osteoprogenitor Cells (DOPC) . It is this population of cells that matures directly into bone producing cells. The IOPCs are also found in muscle and soft connective tissues. Another cell type involved in the bone formation process is the cartilage-producing cell known as a chondrocyte .

A factor identified as being involved in stimulating the IOPCs to differentiate is known as Bone Morphogenetic Protein (BMP). This 19,000 Da protein was first identified from demineralized bone. Another similar factor is Cartilage Induction Factor (CIF) , which also functions to stimulate IOPCs to differentiate, thereby initiating cartilage formation, cartilage calcification, vascular invasion, resorption of calcified cartilage, and induction of new bone formation. Cartilage Induction Factor has been identified as being homologous with Transfecting Growth Factor β.

Since osteoblasts are involved in bone production, genes that enhance osteoblast activity could be delivered directly to these cells. Genes could also be delivered to the IOPCs and the chondrocytes , which can differentiate into osteoblasts, leading to bone formation. BMP and CIF are examples of ligands that can be used to deliver genes to these cells. Genes delivered to these cells promote bone formation or the proliferation of osteoblasts. The polypeptide IGF-1 stimulates growth in hypophysectomized rats. This growth stimulation could be due to specific uptake of IGF-1 by osteoblasts or by the interaction of IGF-1 with chondrocytes, which results in the formation of osteoblasts. Other specific bone cell and growth factors can be used through the interaction with various cells involved in bone formation to promote osteogenesis .

Nonlimiting examples of growth factor genes that may induce a therapeutic effect where expressed in osteoblast cells are Insulin, Insulin-Like Growth Factor-2, Insulin-Like Growth Factor-2, Epidermal Growth Factor, Transfecting Growth Factor-α, Transfecting Growth Factor-β, Platelet Derived Growth Factor, Acidic Fibroblast Growth Factor, Basic Fibroblast Growth Factor, Bone Derived Growth Factors, Bone Morphogenetic Protein, Cartilage Induction Factor, Estradiol, and Growth Hormone. All of these factors have been shown to induce the proliferation of osteoblasts, the related stem cells, and chondrocytes. As a result, BMP or CIF can be used as conjugates to deliver genes that express these growth factors to the target cells by the intravenous injection of cationic amphiphile compositions of the present invention. Incorporating the nucleic acid molecules described above in the cationic amphiphile compositions of the present invention, in conjunction with the use of specific ligands for the delivery of nucleic acid molecules to bone cells, may provide treatments for diseases and abnormalities that effect bone tissues .

Direct Delivery of polyanions to Synoviocytes

Inflammation in the joints in animal models and human diseases may be mediated, in part, by secretion of cytokines such as IL-1 and IL-6 which stimulate local inflammatory responses. Inflammatory reactions may be modified by local secretion of soluble fragments of the receptors for these ligands. The complex between ligands and soluble receptors may prevent ligands from binding to the receptors normally present on the surface of cells, thus preventing the stimulation of the inflammatory response. Therapy can consist of the construction of a DNA plasmid comprising the soluble form of receptors for appropriate cytokines (for example, IL-1), together with promoters capable of inducing high level expression in structures of the joint and composition. The plasmid can then be formulated into the composition comprising cationic amphiphiles of this invention. The composition may be injected into affected joints where the secretion of an inhibitor for IL-1, such as a soluble IL-1 receptor or natural IL-I inhibitor, modifies the local inflammatory response and resulting arthritis.

This method may be useful for treating episodes of arthritis which accompany many "autoimmune" or "collagen vascular" diseases. This method can also prevent disabling injury of large joints by inflammatory arthritis. The above-described compositions may also be useful for treating arthritis by incorporating a plasmid which encodes a gene that expresses a genetically modified steroid receptor. Current therapy for severe arthritis involves the administration of pharmacological agents including steroids to depress the inflammatory response. Steroids can be administered systemically or locally by direct injection into the joint space.

Steroids normally function by binding to receptors within the cytoplasm of cells. Formation of the steroid-receptor complex changes the structure of the receptor so that it becomes capable of translocating to the nucleus and binding to specific sequences within the genome of the cell and altering the expression of specific genes. Genetic modifications of the steroid receptor can enable this receptor to bind naturally occurring steroids with higher affinity, or bind non-natural, synthetic steroids, such as RU486. Other modifications can be made to create steroid receptor which is "constitutively active", meaning that it is capable of binding to DNA and regulating gene expression in the absence of steroid in the same way that the natural steroid receptor regulates gene expression after treatment with natural or synthetic steroids.

Of particular importance is the effect of glucocorticoid steroids such as cortisone, hydrocortisone, prednisone, or dexamethasone which are the most important drugs available for the treatment of arthritis. One approach to arthritis treatment is to introduce a DNA plasmid in which the nucleic acid cassette expresses a genetically modified steroid receptor into cells of the joint, e . g. , a genetically modified steroid receptor which mimics the effect of glucocorticoids but does not require the presence of glucocorticoids for effect. This receptor is termed a glucocortico-mimetic receptor. This effect is achieved by expression of a constitutively active steroid receptor within cells of the joint which contains the DNA binding domain of a glucocorticoid receptor. This induces the therapeutic effects of steroids without the systemic toxicity of these drugs. Alternatively, steroid receptors which have a higher affinity for natural or synthetic glucocorticoids, such as RU486, can be introduced into the joint. These receptors exert an increased anti-inflammatory effect when stimulated by non-toxic concentrations of steroids or lower doses of pharmacologically administered steroids. Alternatively, constitution of a steroid receptor which is activated by a novel, normally- inert steroid enables the use of drugs which would affect only cells taking up this receptor. These strategies obtain a therapeutic effect from steroids on arthritis without the profound systemic complications associated with these drugs. Of particular importance is the ability to target these genes differentially to specific cell types (for example synovial cells versus lymphocytes) to affect the activity of these cells. As described in U.S. Patent No. 5,364,791 to Vegeto, et al . , entitled "Progesterone Receptor Having C Terminal Hormone Binding Domain Truncations," and U.S. Application, Serial No. 07/939,246, entitled "Mutated Steroid Hormone Receptors, Methods for Their Use and Molecular Switch for Gene Therapy, " Vegeto, et al . , filed September 2, 1992, both hereby incorporated by reference (including drawings) , genetically modified receptors, such as the glucocortico-mimetic receptor, can be used to create novel steroid receptors including those with glucocortico-mimetic activity. The steroid receptor family of gene regulatory proteins is an ideal set of such molecules. These proteins are ligand activated transcription factors whose ligands can range from steroids to retinoids, fatty acids, vitamins, thyroid hormones and other presently unidentified small molecules. These compounds bind to receptors and either up-regulate or down-regulate transcription.

A preferred receptor of the present invention is a modified glucocorticoid receptor, i.e., a glucocorticoid- mimetic receptor. These modified receptors can bind various ligands whose structure differs from naturally occurring ligands, e . g. , RU486. For example, small C-terminal alterations in amino acid sequence, including truncation, result in altered affinity and altered function of the ligand. By screening receptor mutants, receptors can be customized to respond to ligands which do not activate the host cell's own receptors .

Methods and compositions of the present invention can also be used to treat arthritis when they comprise a gene encoding RNA that specifically binds and inactivates the mRNA for prostaglandin synthase. Drugs which inhibit the enzyme prostaglandin synthase are important agents in the treatment of arthritis. This is due, in part, to the important role of certain prostaglandin in stimulating the local immune response. Salicylates are widely used for this purpose but can be administered in limited doses which are often inadequate for severe forms of arthritis.

Gene transfer using the present invention can be used to inhibit the action of prostaglandin synthase specifically in affected joints by the expression of an antisense RNA for prostaglandin synthase. The complex formed between the antisense RNA and mRNA for prostaglandin synthase may interfere with the proper processing and translation of this mRNA and lower the levels of this enzyme in treated cells. Alternatively, RNA molecules may be used to form a triple helix in regulatory regions of genes expressing enzymes required for prostaglandin synthesis. Furthermore, RNA molecules can be identified which bind the active site of enzymes required for prostaglandin synthesis and thereby inhibit this activity.

Alternatively, genes encoding enzymes which alter prostaglandin metabolism can be transferred into the joint. These have an important anti-inflammatory effect by altering the chemical composition or concentration of inflammatory prostaglandin .

Likewise, the present invention is useful for enhancing repair and regeneration of the joints. The regenerative capacity of the joint is limited by the fact that chondrocytes are not capable of remodeling and repairing cartilaginous tissues such as tendons and cartilage. Further, collagen which is produced in response to injury is of a different type lacking the tensile strength of normal collagen. Further, the injury collagen is not remodeled effectively by available collagenase. In addition, inappropriate expression of certain metalloproteinases is a component in the destruction of the joint .

Gene transfer using promoters specific to chondrocytes (i.e., collagen promoters) is used to express different collagens or appropriate collagenase for the purpose of improving the restoration of function in the joints and prevent scar formation.

Compositions of the invention can facilitate the uptake of nucleic acid molecules into chondrocytes and synovial cells by direct injection of the compositions into the effected joint space. Further, the nucleic acid molecules may permeate into the environment of the joint where they are taken up by fibroblasts, myoblasts, and other constituents of periarticular tissue.

Direct Delivery of Polyanions to the Lungs

Cationic amphiphile compositions of the present invention can be utilized in methods for reversing or arresting the progression of disease involving the lungs, such as lung cancer. One embodiment involves using intravenous methods of administration for delivering nucleic acid molecules that encode a molecule that has a therapeutic effect on lung disease. Cationic amphiphile compositions which express a protein or RNA can be directly injected into the lungs or blood supply so as to travel directly to the lungs. Furthermore, the use of an aerosol or a liquid in a nebulizer mist can also be used to administer the desired nucleic acid to the lungs. A dry powder form of the compositions can also be used to treat disease in the lung. The dry powder form of the compositions is delivered by inhalation. These treatments can be used to control or suppress lung cancer or other lung diseases by expression of a particular protein encoded by the nucleic acid molecules. Importantly, cationic amphiphiles of this invention can be fused to IL-12 or other lung specific targeting molecules for specific delivery of a complex of the invention to the lungs.

Additional organs, tissues, cavities, cell or cells, and spaces for the administration of the molecules mentioned herein may be found in "Nucleic Acid Transporters for Delivery of Nucleic Acids into a Cell"; Smith et al . , U.S. Patent Application Serial No. 08/484,777, filed December 18, 1995, incorporated herein by reference in its entirety including any drawings .

Formulations for In Vivo Delivery

While expression systems such as those described above provide the potential for RNA transcription and polypeptide expression when delivered to an appropriate location, it is beneficial to provide the expression system construct (s) in a delivery system which can assist both the delivery and the cellular uptake of the construct. Thus, the invention also provides particular formulations which include one or more expression system constructs (e.g., DNA plasmids as described above) , a cationic amphiphile, a co-lipid (preferably a neutral co-lipid), and a carbohydrate or other osmolyte (e.g., salts) to make the formulation iso-osmotic and isotonic. In addition to the lipids and lipid combinations described herein for exemplary formulation embodiments, other lipids may be selected. Examples of such lipids are described in Gao & Huang, 1995, Gene Therapy 2:710-722 and are summarized in Table III.

TABLE III

Cationic Composition Manufacturer Transfection Activity

Liposome

A: Commercialized In vitro In vivo

Lipofβctxn DOTMA/DOPE=l : 1 (w/w) GIBCO BR +++ ++

DOTAP DOTAP Boehnnger +++ ++

TransfectAce Mannheim

LlpofectAMINE DDAB/DOPE=l : 3 (m/m) GIBCO BRL +++ NA

DOSPA/DOPE=3: 1 (w/w) GIBCO BRL ++++ NA

Transfectam DOGS Promega ++++ +++

B. Not commercialized

CTAB CTAB/D0PE=1 : (m/m) ++ NA

C₁₂CluPhCnNa C₁₂GluPhCnN'> +++ NA

CuGluCnN? Cι₂GluCnN? +++ NA

Lipopolylysine Lιpopolylysιne/DOPE= 1 : 8 (m/m) +++ NA

Cationic Cationic chol/DOPE=l : 1 (m/m) Yes +++ cholesterols

DC-chol +++ +++

DMRIE +++ +++

DOTMA/Choi

(m/m) +++ NA ysyl-PE Lysyl-PE/β-alanyl cholesterol=l : 1 (m/m) In compositions in which lipids, such as DOTMA and cholesterol, are used, preferably, though not necessarily, the cationic amphiphile and the neutral co-lipid may be formed into liposomes, by, for instance, forcing the lipid and aqueous solution through a membrane with pores of a desired size or by microfluidization. The liposomes may be combined with the DNA to form a DNA/lipid complex, which can then be administered to a mammal by a delivery method appropriate to the desired delivery site. Formation of liposomes by microfluidization provides liposomes of discrete size, i.e., the size distribution is narrower than other preparation methods tested. This preparation method can, as an example, be performed as follows. For the exemplary DOTMA/cholesterol formulations, the liposomes are composed of the cationic lipid DOTMA (1,2- di-O-octadecenyl-3-trimethylammonium-propane, chloride salt) and the uncharged co-lipid cholesterol mixed to give a 50:50 mole percent ratio. DOTMA and cholesterol may be mixed as a 50:50 mole percent ratio, and then lyophilized. The lyophilized material can be analyzed with respect to identity and composition, then rehydrated with "sterile water for irrigation USP" to allow liposome formation. The rehydrated material is microfluidized to generate a homogenous population of small liposomes. The microfluidized material is then 0.2 micron-filtered and analyzed with respect to composition, particle size, and sterility.

During the process of microfluidization, a source of ultrapure nitrogen gas (Air Liquide) is used to drive the air driven pressure system of the microfluidizer MHOS (Microfluidics Corporation) unit, however, other microfluidizers could also be used. The lyophilized lipid mixture is allowed to come to room temperature, then "sterile water for irrigation U.S. P.," approximately 200mL, is added. The mixture is allowed to rehydrate for approximately 1.5 hours before any further processing. Once rehydration is completed and a translucent homogeneous suspension is obtained, the liposomes are microfluidized. For this, a pressure of approximately 50,000 psi is applied to the microfluidizer unit and the sample is cycled through the chamber at least 10 times, which in turn produces a population of vesicles of reduced size. Following microfluidization, a sample is collected for an in-process particle check. After a predetermined particle size is achieved, the material can be removed and filtered through a 0.2 micron filter. At this point, the material may be diluted with "sterile water for irrigation U.S. P." to achieve a desired concentration. The liposome solution may be stored vials under Argon gas.

A description of the use of liposomes for gene transfer is provided in Szala et al . , 1996, Gene Therapy 3:1026-1031. In this report, cationic liposomes using DC-Cholesterol/DOPE and DDAB/DOPE were used to transfer E. coli cytosine deaminase gene into melanoma tumors by direct injection.

As described below, the selection of nonrDNA formulation components, the diameter and size distribution of the liposomes, and the DNA/cationic amphiphile charge ratio can be significant parameters in determining the resulting level of expression.

An additional significant factor relating to the plasmid construct is the percentage of plasmids which are in a supercoiled (SC) form rather than the open circular (OC) form. The in vivo effects of such formulations is particularly notable in comparison with the in vivo effects of an alternative formulation which can produce even higher levels of encoded product, i.e., a DNA:PVP formulation. SYNTHESIS The following synthesis of a representative cationic amphiphile of this invention is presented by way of example only and is not to be construed as limiting the scope of this invention in any manner whatsoever. The synthetic procedures which follow refer to the following reaction sequence:

overall yield 17%

All compounds were purchased from Aldrich and used without further purification unless otherwise stated. 2,2'- Dipyridyl carbonate was purchased from TCI -America. Triethylamine and diisopropylamine were distilled from CaH₂. All solvents were spectophotometric grade and were dried over an appropriate dessicant and distilled before use.

Liquid chromatography was typically performed using a 230-400 mesh silica gel and high grade solvents to elute the compounds. Thin layer chromatography was performed on Baker- flex IB-F plates (J.T. Baker) .

¹H-NMR spectra were recorded on a Varian Gemini 200 Mhz spectrometer. Chemical shifts are reported in PPM relative to residual solvent peak as internal standard.

Fluorescence assisted cell sorting was performed on a BD FACS instrument.

2 ,2-dimethyl-l , 3-dioxolane-4-TBDPS methanol (3).

26.5 g (200.5 mmols) ( S) - (+) -2 , 2 -dimethyl -1 , 3-dioxolane-

4-methanol and 21. Ig (309.9 mmols) imidazole were dissolved in 250 ml THF. 61. Og (222.6 mmols) t-butyl diphenyl silyl chloride was added dropwise via addition funnel over 15 min. A white precipitate formed and mild heat was produced. The reaction was stirred for 2 hours and then divided into two 175 ml portions. Each portion was added to 700 ml ether and extracted three times with 600 ml H₂0. The combined ether layers were dried over MgS0₄, filtered, roto-evaporated, and dried in vacuo. 17 . lg of a faint yellow oil was recovered.

NMR showed this to be essentially pure product with traces of

SiOH and imidazole. This mixture was used without further purification. Yield « 100%. TLC (1:1 Hexane :Ether, UN) : R_f =

0.6. 'H-NMR (ppm, 200 MHz , CDC1₃ ) : 1 . 1 ( s , 9H) , 1 . 38 ( s , 3H) , 1 . 42 ( s , 3H) , 3 . 75 (m, 2H) , 3 . 86 (m, 1H) , 4 . 1 (m, 1H) , 4 . 22 (m, 1H) , 7 . 43 (m, 6H) , 7 . 70 (m, 4H) .

Reference: Hanessian and Lavallee, Can. J. Chem (1975) 53, 2975

( 2R) -3-TBDPS-propanetriol (4).

13.0 g (35.1 μls) R-2 , 2 -dimethyl-1, 3 -dioxolane-4-TBDPS methanol (3) (TBDPS is tert-butyl -diphenyl silyl group) were dissolved in 100 ml ethanol prior to the addition of a mixture of 7 ml cone. HCl and 10 ml H₂0. The reaction was run for 12 min and then quenched with 100 ml 4 M NaOH. The product was extracted with 3 x 100 ml ether. The ether layers were combined, dried over MgS0₄, filtered, roto-evaporated, and dried in vacuo . The crude reaction mixture was then purified via silica gel chromatography (60-200 mesh, 2 cm diameter x 5 cm in length, using 1:1 hexane: ether to remove starting material and then EtOAc to elute the product . 7.1 g of product and 4.8 g starting material were recovered. Yield = 97% (based on recovered starting material) . TLC (1:1 HexanerEther, UN, KMn0₄) : R_f=0.16.

^XH-ΝMR (ppm, 200 MHz, CDC1₃) : 1.1 (s, 9H) , 2.05 (bs, 2H) , 3.6-3.9 (m, 5H) , 7.43 (m, 6H) , 7.70 (m, 4H) .

Reference: Kim A Thompson, Langmuir (1992) 637.

3-TBDPS-l,2-0-dioleoyl-sn-glvcerol (5) .

12.75g (38.6 mmols) of 2#-3-TBDPS-propanetriol (4) and 15.7 ml (193 mmols) pyridine were dissolved in 130 ml THF and cooled to 0° C. Then 45.0ml (115.7 mmols) oleoyl chloride was added dropwise via addition funnel over 10 min. The solution turned brown and a precipitate formed. The solution was stirred at 0° C for 30 minutes then room temperature overnight. Ether (200 ml) was added and the organic phase washed 2 X with 150 ml H₂0. The ether layer was dried over MgS0₄, filtered, roto-evaporated, and dried in vacuo overnight. The crude mixture was purified in two batches via silica gel chromatography (230-400 mesh, 6.5 cm diam. x 16 cm in length, 8:1 hexane: ether) . 31 g of material consisting of product and the anhydride side product from both batches were recovered. This material was further purified via silica gel chromatography (230-400 mesh, 6.5 cm diam x 5 cm length, using hexane to elute the anhydride then ether to elute the product (27 g 82% yield). TLC (6:1 hexane : ether, UV, I₂) : R_f = 0.65. ¹H-NMR(ppm, 200 MHz, CDC1₃) : 0.85 (t, 6H) , 1.05 (s, 9H) ,

1.3 (m, 40H) , 1.6 (m, 4H) , 2.05 (m, 8H) , 2.28 (t, j= 10 hz, 4 H) , 3.78 (d, j = 8hz, 2H) , 4.22 (dd, j_x = 8hz j ₂ = 6hz, 1H) ,

4.4 (dd, j _ = 8hz j₂ = 4hz, 1H) , 5.18 (m, 1H) , 5.35 (t, j = lOhz, 4H) , 7.42 (m, 6H) , 7.65 (m, 4H) .

Bis vinyl phosphate of 3-TBDPS-l , 2-O-dioleoyl-sn-glycerol (6).

18 ml (45 mmols) n-butyl -lithium (2.5 M in hexane) was added dropwise to 10.0 ml (71.3 mmols) diisopropyl amine at -78° C and stirred for 30 min. Then 13.6 g (15.8 mmols) of 1,2 dioleoyl-3-TBDPS-sn-glycerol (5) in 50 ml THF was added dropwise via syringe over 15 min. The reaction was stirred for 1.5 hrs prior to the addition of 9.2 ml ( 63.5 mmols) diethylphosphorochloridate ( (EtO) ₂P (=0) Cl) in 90 ml HMPA in 5 aliquots. The reaction turned dark orange/brown and froze. It was warmed enough to resume stirring then recooled for 30 min. It was then warmed to room temperature, stirred for an additional 1.5 hrs, poured into 200 ml ether, and washed with 2 x 200 ml 5% NaHC0₃. The H₂0 layers were washed with 2 x 200 ml ether and the combined ether layers were dried over MgS0₄, filtered, roto-evaporated, and dried in vacuo . The crude product was purified via silica gel chromatography (230-400 mesh, 5cm x 200 cm long, flash, 1:1 hexane: ether) . 8.36 g of pure product (74% yield), 1.35g, approx. 90% pure product and 5g starting material were recovered. TLC (Ether, UV, I₂) : R_f = 0.38. ^xH-NMR(ppm, 200 MHz, CDC1₃) : 0.85 (t, 6H) , 1.05 (s, 9H) , 1.3 (m, 46H) , 2.05 (m, 12H) , 3.78 (m, 2H) , 4.15 (m, 10H) , 4.3 -4.6 (m, 4H) , 5.35 (t, J = lOhz, 4H) , 7.42 (m, 6H) , 7.65 (m, 4H) .

Reference: Carbonnier, Moyano, and Greene: JOC (1987) 52, 2303-09.

1.2-O-lZ' , 9Z'octadecadiene-3-Q-TBDPS-sn-qlycerol (7) .

1.9g (1.68 mmols) of 6_. and 60mg (52 μmols) of tetrakis

(triphenylphosphine) palladium were dissolved in 20 ml hexane and cooled to 0° C. Then 5.9ml (5.9 mmols) triethylaluminum was added dropwise via syringe. The reaction was stirred at 0° C for 1 hr and then at room temperature for 2 hrs. The reaction mixture was filtered through a small silica plug (1.5 cm diam. x 5 cm long) with ether. A second plug was run to remove traces of palladium by-products that remained. The filtrate was roto-evaporated and purified via silica gel chromatography

(60-200 mesh, 1.5 cm diam x 20 cm long, 9:1 hexane: ether), giving 1.0 g of product (72% yield). TLC (2:1 hexane: ether,

UN, I₂) : R_f=0.64.

'H-ΝMR (ppm, 200 MHz, CDC1₃) : 0.85 (t, 6H) , 1.05 (s, 9H) , 1.3 (m, 40H) , 2.05 (m, 12H) , 3.70-4.0 (m, 5H) , 4.35 (m, 2H) ,

5.35 (t, J^" = lOhz, 4H) , 5.95 (m, 2H) , 7.42 (m, 6H) , 7.65 (m,

4H) .

Reference: Carbonnier, Moyano, and Greene: JOC (1987) 52,

2303-09.

1 , 2-O-lZ ' , 9Z-octadecadiene-sn-glycerol (8) .

33.0 ml (33.0 mmols tetrabutylammonium fluoride was added to a solution of 9 g (10.9 mmols) of 5 in 70 ml THF. Then 0.5 ml tetrabutylammonium hydroxide was added and the reaction stirred for 2 hours. The solution was filtered through a small silica plug with ether and the eluent roto-evaporated and purified via silica gel chromatography (230-400 mesh, 4 cm diam. x 20 cm long, 9:1 hexane: ether) . The silanol side product and 5 have identical R_f values under all conditions examined and thus further purification was not attempted. 4.2 g of product was obtained (66% yield) . This product can be used without additional purification. YIELD = 66%. TLC (1:1 hexane: ether, UV) : R_f = 0.52.

^XH-NMR (ppm, 200 MHz, CDC1₃) : 0 .85 (t, 6H) , 1.3 (m, 40H) , 2.05 ( , 12H) , 3.70-3.9 (m, 5H) , 4.4 (m, 2H) , 5.35 (t, J = lOhz, 4H) , 5.9 (dt, J_ = 6 hz, J₂ = 3hz, 1H) , 6.05 (dt, J_x = 6 hz, J₂ = 3hz, 1H) . Reference: Hanessian and Lavalle, Can J. Chem (1975) 53 , 2975.

1 , 5-diphalimidyldiethylenetriamine (9) .

Synthesized as described by Garrigues, B. and L. Vidaud, Bull. Soc . Chi . Belg. 97, 1988, 775.

O- (1 , 2-O-lZ ' , 9Z-octadecadiene-sn-glycerol) -N- (di-2- pthalamidylethylamino) carbamate (10) .

1,2-O-lZ' , 9Z-octadecadiene-sn-glycerol (8, 308 mg) , 2,2'- dipyridyl carbonate (274 mg) , and triethylamine (1 ml) were stirred for 3 days in 10 ml CH₂C1₂. The reaction mixture was then washed with 25 ml NaHC0₃ and 25 ml saturated brine. The CH₂C1₂ layer was dried over Na₂S0₄, filtered and roto- evaporated. Fresh CH₂C1₂ (10 ml) was added followed by 1,5- diphalamidyldiethylenetriamine . The reaction was stirred for 3 days then roto-evaporated to dryness. The crude mixture was purified via flash chromatography (230-400mesh silica, 3:2 hexane: ether) . 350 mg of product was recovered (69% yield) . 0- (1 , 2-O-lZ ' , 9Z-octadecadiene-sn-glycerol) -N- (bis-2- aminoethylamine) -carbamate (1) .

O- (1, 2-O-lZ ' , 9Z-octadecadiene-sn-glycerol) -N- (bis-2- pthalamidylethylamino) carbamate (10, 306 mg) was dissolved in 60 ml methanol and 100 μl hydrazine hydrate was added. The reaction was stirred for 2 days. The solution was roto- evaporated to dryness yielding an off-white precipitate. 100ml CHC1₃ was added and the remaining white crystals were filtered. The filtrate was roto-evaporated and dried in vacuo overnight. A yellow oil (179 mg, 80% yield) was recovered.

The following synthesis was employed to synthesize a saturated ether analog of the above compound for the purpose of comparison of biological activity:

overall yield= 12%

rac-2 , 2 -dimethyl -1, 3 -dioxolane-4-TBDPS methanol (11) .

26.5 g (200.5 mmols) rac-2 , 2-dimethyl-l , 3-dioxolane-4- methanol and 21. Ig (309.9 mmols) of imidazole were dissolved in 250 ml THF. 61. Og (222.6 mmols) t-butyl diphenyl silyl chloride (TBDPSCl) was added dropwise via addition funnel over 15 min. A white precipitate formed and mild heat was produced. The reaction was stirred for 2 hours then divided into two 175 ml portions. Each portion was added to 700 ml ether and extracted with 3 x 600 ml H₂0. The combined ether layers were dried over MgS04 , filtered, roto-evaporated, and dried in vacuo . 71 . Ig of a faint yellow oil was recovered. NMR showed this to be essentially pure with traces of SiOH and imidazole. The mixture was used without further purification (approx. 100% yield). TLC (1:1 Hexane :Ether, UN) : R_f = 0.6.

'H-ΝMR (ppm, 200 MHz, CDC1₃) : 1.1 (s, 9H) , 1.38 (s, 3H) , 1.42 (s, 3H) , 3.75 (m, 2H) , 3.86 (m, 1H) , 4.1 (m, 1H) , 4.22 (m, 1H) , 7.43 (m, 6H) , 7.70 (m 4H) . Reference: Hanessian and Lavallee, Can. J. Chem (1975) 53, 2975.

rac-3 -TBDPS- 1,2 , 3-propanetriol (12) .

13.0 g (35.1 mmols) rac-2 , 2-dimethyl-l , 3 dioxolane-4- TBDPS methanol (11) was dissolved in 100 ml ethanol and a mixture of 7 ml cone. HCl and 10 ml H₂0 was added. The reaction was run for 12 min then quenched with 100 ml 4 M ΝaOH. The product was extracted with 3 x 100 ml ether. The ether layer was dried over MgS0₄, filtered, roto-evaporated, and dried in vacuo . The crude reaction mixture was then purified via silica gel chromatography (60-200 mesh, 2 cm diam x 5 cm long, using 1:1 hexane: ether to remove starting material, and then EtOAc to elute product. 7.1 g of product (97% yield, corrected for recovered starting material) and 4.8g starting material were recovered. TLC (1:1 hexane: ether, UV, KMn0₄) : R_f = 0.16.

^XH-ΝMR (ppm, 200 MHz, CDC1₃) : 1.1 (s, 9H) , 2.05 (bs, 2H) , 3.6-3.9 (m, 5H) , 7.43 (m, 6H) , 7.70 (m 4H) . Reference: Kim A Thompson, Langmuir (1992 ) 637.

1-O-trifluoromethanesulfonyl -9Z-octadecene (13 ) . 4.19 ml (53.0 mmols) Pyridine in 10 ml CH₂C1₂ was added slowly to 8.75 ml (52.8 mmol) triflic anhydride in 30 ml CH₂C1₂ and a white precipitate formed. Then 10.07 g (37.5 mmols) oleyl alcohol in 50 ml CH₂C1₂ was added to the thick white suspension. The reaction was stirred for one hour then washed with 100 ml water. The water layer was extracted with 3 x 75 ml CH₂C1₂ and the combined organic layers were dried for 3 hours over 50:50 MgS0₄ : Na₂C0₃. The solution was filtered and roto-evaporated yielding a thick brown oil . This oil was purified using a silica plug (5 cm diam. 4 cm long) eluting with hexane. The eluent was roto-evaporated and dried in vacuo yielding 9. Ig (61% yield) oleyl triflate.

^XH-NMR (200 MHz, CDCL₃₎ : 5.37 (m, 2H) , 4.53 (t, J = 6.6 Hz 2H) , 2.02 (bd, 4H) , 1.85 (p, J = 7.6 Hz, 2H) , 1.27 (s, 22H) , 0.89 (t, J = 6.4 Hz, 3H) .

Reference: Aoki and Poulter, JOC (1985) 50, 5634-36

rac-l,2-dioleyl-3-TBDPS-qlycerol (14) .

1.0041g (25 mmols) sodium hydride (60% dispersion in mineral oil) was washed with 3 x 10 ml THF. rac-3-TBDPS- 1,2, 3-propanetriol (12, 1.94 g) in 20 ml THF was added. After bubbling ceased (-10 min), 5.03g (12.6 mmols) oleyl triflate (13) was added and the reaction stirred for 1 hour. The solution was roto-evaporated to dryness, dissolved in hexane and filtered through a small silica plug eluting with hexane. The hexane eluent was roto-evaporated and dried in vacuo giving 4.26g of a clear viscous oil (87% yield) . TLC (2:1 hexane: ether, UV, acid char detection) : R_f = 0 .75.

"H-NMR (ppm, 200 MHz, CDC1₃) : 0.90 (t, j = 6hz, 6H) , 1.05 (s, 9H) , 1.3 (bs, 44H) , 1.55 (m, 4H) , 2.0 (m, 8H) , 3.3-3.75(m, 9H) , 5 . 35 ( t , j = 10hz , 4H) , 7 . 43 (m, 6H) , 7 . 70 (m 4H) .

Reference: Aoki and Poulter, JOC (1985)50, 5634. Thompson et al , JOC (1994)59, 2954.

rac- 1 , 2-dioleylglycerol (15) .

7.3ml (7.2mmols) 1.0 M tetrabutylammonium flouride was added to a solution of 2.043 g (25 mmols) rac-1 , 2-dioleyl-3 - TBDPS-glycerol (14) in 35 ml THF. Then 0.1 ml tetrabutylammonium hydroxide was added and the reaction was run for 10 hrs. The solution was roto-evaporated and the crude reaction mixture purified via silica gel chromatography (60-200 mesh, 3 cm diam x 20 cm long, 10: 1 hexane : ether) . 1.2 g of a viscous oil was obtained (81% yield) . Some product eluted with SiOH and which was later removed via distillation. TLC (6:1 Hexane: Ether, UN, acid char): R_f = 0.22.

^XH-ΝMR (ppm, 200 MHz, CDCl₃) : 0.90 (t, J = 6hz, 6H) , 1.3 (bs, 44H) , 1.58 (m, 4H) , 2.0 (m, 8H) , 2.2 (t, J = 5 hz, 1H) , 3.4-3.8 (m, 9H) , 5.35 (t, J = 5hz, 4H) .

Reference: Hanessian and Lavalle, Can J. Chem (1975)53, 2975.

O- (rac- 1 .2-dioleylglycerol) -N- (di-2-pthalamidylethyl- amino) carbamate (16).

Jac-l,2-dioleyl glycerol (15, 500 mg) , 2 , 2'-dipyridyl carbonate (360 mg) and triethylamine (1 ml) were stirred for 1 day in 10 ml CH₂C1₂. The reaction mixture was then washed with 25 ml NaHC0₃ and 25 ml saturated brine. The CH₂C1₂ layer was dried over Na₂S0₄, filtered, and roto-evaporated. Fresh CH₂C1₂ (10 ml) was added followed by 1 , 5-di-phalamidyldiethyl- enetriamine (9, 340mg) . The reaction was stirred for 2 days then roto-evaporated to dryness. The crude mixture was purified via flash chromatography (230-400 mesh silica, 3:2 hexane: ether) . 160 mg of product were recovered (19 % yield) . O- (rac- 1 , 2-dioleoylglvcerol) - N- (bis-2-aminoethylamino) - carbamate (2) .

O- (rac-1, 2-dioleoylglycerol) -N- (di-2-pthalamidyl- ethylamino) carbamate (16, 160 mg) was dissolved in 60 ml methanol and 1.0 ml hydrazine hydrate was added. The reaction was stirred for 1 day. The solution was roto-evaporated to dryness yielding an-off white precipitate. CHC1₃ (100ml) was added and the remaining white crystals were filtered. The filtrate was roto-evaporated and dried in vacuo overnight. 179 mg of a yellow oil was recovered (99% yield) .

BIOLOGICAL EVALUATION

The biological evaluation methods and data presented below are offered as examples only and are not to be construed as limiting the scope of this invention in any manner whatsoever. Preparation of DNA/cationic amphiphile complex.

_.1.2 mg/ml DNA stock solutions were prepared in 40% ethanol containing 250mM dextrose, and 25 mM NaCl, the pH was adjusted pH 6 using acetic acid. Cationic amphiphile stock solutions were prepared by dissolving the dry amphiphile is water. Cationic amphiphile concentrations were varied depending on the amphiphile used and the desired DNA to amphiphile ratio. Complexes were prepared by slowly adding the DNA stock to an equivalent volume of amphiphile stock solution. The solutions were then evaporated and lyophilized overnight to remove all traces of ethanol. They were then rehydrated in an equivalent volume of sterile water.

In vitro transfection

Twenty-four well plates were seeded with 6 X 10⁴ cells/well and incubated in Dubelco's modified eagle medium (DMEM, GIBCO/BRL) for 24 hrs at 37° C and 5% C0₂. Media was then removed and replaced with 1 ml of fresh media (DMEM) containing 1 or 0.2 g/ ml DNA and incubated for 4 hrs . Fresh DMEM was added and the cells were incubated for 24 hrs prior to expression analysis.

Luciferase assay.

DMEM was removed and the cells washed with 2x 1 ml phosphate buffered saline (PBS, -Mg, -Ca) . 500μl lysis buffer (Promega) was added and the cells stored at -80° C overnight. After thawing, cell lysates were removed from the wells via pipet and transferred to 1.5ml Eppendorf tubes. The tubes were centrifuged for 5 min at 9000 rpm and 20 μl of each supernatent was placed in an opaque 96 well plate. Luminescence was monitored using a luminometer for 30 sec/well following the addition of 100 ul of luciferase assay reagent (Promega) .

Results of In Vi tro Transfection

The effect of the vinyl ether linkage was tested by binding a cationic amphiphile to a plasmid DNA. To optimize transfection conditions, the ratio of amphiphile to plasmid was varied from 1:1 to 1:9 positive amphiphile charge to negative phosphate charge. NIH 3T3 cells were tested for transfection efficiency using a 24-well plate format. The cells were transfected with a luciferase expression plasmid. In vitro transfection was determined with and without serum (10% fetal calf serum). The results are shown in Figure 1. The optimal charge ratio was aproximately 6:1 positive to negative charge. The results also show that the vinyl ether amhiphiles transfected cells better in serum that without serum.

A second lipid in which the vinyl ether was replaced with a normal saturated ether was used as a comparison vehicle. The saturate ether linkage is not acid labile. A commercially available cationic lipid, DOTMA, was formulated with cholesterol and used as a control. Transfection in three cell types was compared: squamous cell carcinoma (SCCVII) , renal cell carcinoma (Renca) and human umbilical vein endothelial cells (HUVEC) . In Renca and SCVII, both the vinyl ether and saturated ether linked amphiphiles yielded higher degrees of transfection than DOTMA/Cholesterol . Furthermore, the vinyl ethyl linked amphiphile afforded a higher degree of transfection than the saturated ether. A similar trend was observed in HUVECs but the difference in transfection activity between the formulations was not as great as with the other cell types. During the course of these experiments it was shown that the vinyl ether formulations were stable in that formulations tested one week after preparation were as active as freshly prepared formulations.

One possible explanation for the difference in transfection activity is differences in the uptake of the complex by the various cells. To test this, a fluorescence- labeled plasmid was formulated with each of the preceding amphiphiles and with the cationic lipid. Uptake by the cells was measured one hour after incubation by FACS analysis. The number of transfected cells was determined using a green fluorescent protein (GFP) -expressing plasmid. NIH 3T3 cells (1

X 10⁶ cells) were incubated with 4 μg of fluorescently labeled DNA plasmid/cationic amphiphile complex for 4 hours. Cells were washed three times with PBS, trypsinized, centrifuged, resuspended in PBS-1% albumin and analyzed by FACS for plasmid positive cells. A second set of cells was incubated under the same conditions with green fluorescent protein expressing DNA plasmid/cationic amphiphile complex. Media containing complexes was removed and replaced with complete media. Cells were analyzed for GFP expression 18 hours later by FACS. The results are shown in Table IV. TABLE IV

The DOTMA/Cholesterol formulation had the highest degree of uptake followed by the vinyl ether formulation and, lastly, the ether formulation. However, the vinyl ether formulation afforded the highest number of transfected cells (50%) followed by the saturated ether formulation (30%) and then the DOTMA/Cholesterol formulation (10%) . The level of GFP expression was also highest for the vinyl ether formulation followed by the saturated ether and the DOTMA/Cholesterol formulations .

In Vivo Transfection The above three formulations were compared in vivo . The complexes were formulated at 0.3 mg of DNA per ml. A 90 μg dose of DNA was administered intravenously to C3H mice genetically engineered to express CAT and which had SCCVIII subcutaneous tumors. The vinyl ether complex had a lower level of expression in lung cells that the DOTMA/Cholesterol but, in the tumor, the vinyl ether complex and DOTMA/Cholesterol afforded equivalent levels of expression. The saturated ether formulation was quite toxic; none of the mice treated with it survived.

CONCLUSION One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The molecular complexes and the methods, procedures, treatments, molecules, specific compounds described D O herein are presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention are defined by the scope of the claims.

It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. All patents and publications mentioned in the specification are indicative of the levels of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference .

The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims . In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. For example, if X is described as selected from the group consisting of bromine, chlorine, and iodine, claims for X being bromine and claims for X being bromine and chlorine are fully described.

Other embodiments are within the following claims.

Claims

CLAIMSWhat is claimed is:

1. A cationic amphiphile comprising: a positively charged head group; a hydrophobic anchor group; and, a linker group covalently bonded to said positively charged head group and to said hydrophobic anchor group, said linker group being chemically labile under physiological conditions.

2. The cationic amphiphile of claim 1 wherein said physiological conditions comprise a cellular pH of from 5.0 to 6.5.

3. The compound of claim 1 wherein said positively charged head group comprises a positively charged amino group.

4. The compound of claim 3 wherein said positively charged amino group is selected from the group consisting of positively charged primary amino, positively charged secondary amino, positively charged tertiary amino and quaternary ammonium.

5. The compound of claim 3 wherein said positively charged amino group comprises a positively charged polyamino group .

6. The compound of claim 4 wherein each amino group of said polyamino group is individually selected from the group consisting of positively charged primary amino, positively charged secondary amino, positively charged tertiary amino and quaternary ammonium.

7. The compound of claim 1 wherein said hydrophobic anchor group is selected from the group consisting of higher alkyl, higher alkenyl and cholesteryl.

8. The hydrophobic anchor group of claim 7 wherein said higher alkyl group is selected from the group consisting of unsubstituted 12 to 18 carbon atom straight chain alkyl.

9. The hydrophobic anchor group of claim 7 wherein said higher alkenyl group is selected from the group consisting of unsubstituted 12 to 18 carbon atom straight chain alkenyl.

10. The compound of claim 1 wherein said linker group comprises a vinyl ether.

11. The cationic amphiphile of claim 1 having the chemical structure:

wherein,

R¹ is selected from the group consisting of higher alkyl, higher alkenyl and, combined with R², the "A" ring of cholesteryl ;

R² is selected from the group consisting of hydrogen and, combined with R¹, the "A" ring of cholesteryl;

R³ is selected from the group consisting of hydrogen, unsubstituted straight chain lower alkyl, straight chain lower alkyl substituted with one or more hydroxy groups and -CH₂OCH=CHR¹ wherein, when R^: and R² combine to form the "A" ring of cholesteryl, R³ is hydrogen or unsubstituted straight chain lower alkyl ;

X is selected from the group consisting of -C(=0)-, -C(=NH)-, -OC(=0)-, -OP(=0)-, -NHC(=0)- and -NC(=NH)-;

R⁴ and R⁵ are independently selected from the group consisting of hydrogen,

-[(CH₂)_nNH⁺]_p(CH₂)_qN^╧äR^sR^yR^l╧ï and -(CH₂)_n NH⁺

R⁸, R⁹ and R¹⁰ are independently selected from the group consisting of hydrogen, unsubstituted straight chain lower alkyl and straight chain lower alkyl substituted with one or more hydroxy groups; m is 1, 2, 3 or 4; n, q, r, s and t are independently 2, 3 or 4; p is 0, 1, 2 or 3 ; and, v is 0 or 1 wherein, when v is 0, R⁶ is hydrogen and when v is

1, R^╬┤ does not exist.

12. The cationic amphiphile of claim 11 wherein R¹ is selected from the group consisting of 12 to 18 carbon atom unsubstituted straight chain alkyl.

13. The cationic amphiphile of claim 11 wherein R¹ is selected form the group consisting of 12 to 18 carbon atom unsubstituted straight chain alkenyl.

14. The compound of claim 11 wherein, R¹ is oleoyl; R² is hydrogen ;

R³ is -CH₂OCCH=CH-oleoyl ; and , m is 1 .

15. The compound of claim 14 wherein:

X is -OC(=0) - .

16. The compound of claim 15 wherein R⁴ and R⁵ are

ΓûáCH₂CH₂NH₃'

17. The cationic amphiphile of claim 1 having the chemical structure :

O R^1ICOCH(CH₂)_xOCH=CH(CH₂)_y[X]_zNR⁴R⁵R⁶

R¹²

wherein,

R¹¹ is selected from the group consisting of higher alkyl and higher alkenyl ;

R¹² is selected from the group consisting of hydrogen, unsubstituted straight chain lower alkyl , straight chain lower alkyl substituted with one or more hydroxy groups and -CH₂0C(=0)

-R ; x and y are independently 1, 2, 3 or 4 ; z is 0 or 1 wherein, when z is 0, R⁶ is hydrogen and when z is 1, R⁶ does not exist; X is selected from the group consisting of -C(=0)-, -C(=NH)-, -OC(=0)-, OP(=0)-, -NHC(=0)- and -NC(=NH) -;

R* and R⁵ are independently selected from the group consisting of hydrogen, -[(CH₂)_nNH⁺]_p(CH₂)_qN⁺R⁸R⁹R¹⁰ and -(CH₂)_n ^ΓûáNH

p is 0 , 1 , 2 or 3 ; q, n, r, s and t are independently 2, 3 or 4 ; and, R⁸, R⁹ and R¹⁰ are independently selected from the group consisting of hydrogen, unsubstituted straight chain lower alkyl and straight chain lower alkyl substituted with one or more hydroxy groups .

18. The cationic amphiphile of claim 17 wherein R¹ is selected from the group consisting of 12 to 18 carbon atom unsubstituted straight chain alkyl .

19. The cationic amphiphile of claim 17 wherein R¹ is selected from the group consisting of 12 to 18 carbon atom unsubstituted straight chain alkenyl .

20. The cationic amphiphile of any of claims 1, 11, 17 or 60 wherein said cationic amphiphile is capable of interacting with a polyanion to form a positively-charged complex.

21. A positively charged complex comprising a cationic amphiphile of claim 1 and a polyanion.

22. The positively-charged complex of claim 21 wherein said complex is capable of entering into the interior of a cell with which it comes in contact .

23. A cell comprising a positively charged complex of a cationic amphiphile of claim 1 and a polyanion.

24. The cell of claim 23 wherein said polyanion comprises a biologically active substance.

25. The cell of claim 24 wherein said biologically active substance is selected from the group consisting of polynucleotide and polypeptide.

26. The complex of claim 25 wherein said polynucleotide is selected from the group consisting of DNA and RNA.

27. The complex of claim 26 wherein said DNA comprise a plasmid.

28. The complex of claim 26 wherein said DNA comprises a DNA cassette.

29. A method for delivering a polyanion to a cell comprising : forming a positively-charged complex between a cationic amphiphile of claim 1 and said polyanion; and, incubating said positively-charged complex with a cell.

30. The method of claim 29 wherein said forming said positively charged complex comprises: dissolving a cationic amphiphile of claim 1 in a first solvent to form a cationic amphiphile solution; dissolving a polyanionic compound in a second solvent to form a polyanion solution; mixing said polyanion solution with said cationic amphiphile solution to form a solution of said positively- charged complex; and, removing said solvents from said solution of said positively-charged complex.

31. The method of claim 29 wherein said incubating is performed in the presence of one or more co-lipids.

32. The method of claim 31 wherein said co-lipid is selected from the group consisting of DOPE and cholesterol.

33. The method of claim 29 wherein said positively- charged complex comprises between 1 and 4 molecules of said cationic amphiphile of claim 1 per molecule of said polyanion.

34. The method of claim 29 wherein said incubating is performed in vitro.

35. The method of claim 29 wherein said incubating is performed in vivo.

36. The method of claim 29 wherein said cell is present in a cell culture.

37. The method of claim 29 wherein said polyanion comprises a biologically active substance.

38. The method of claim 37 wherein said biologically active substance comprises a polynucleotide or a polypeptide.

39. The method of claim 38 wherein said polynucleotide comprises DNA or RNA.

40. The method of claim 39 wherein said DNA is selected from the group consisting of a DNA plasmid and DNA cassette.

41. A method for the treatment or prevention of a disease or disorder in an organism in need of such treatment comprising : forming a complex between a cationic amphiphile of claim 1 and a polyanion therapeutically effective against said disease or disorder; and administering said complex to said organism.

42. The method of claim 41 comprising: preparing a composition of said complex; and, administering said composition to said organism.

43. The method of claim 42 wherein said composition comprises a co-lipid.

44. The method of claim 43 wherein said co-lipid is selected from the group consisting of DOPE and cholesterol.

45. The method of claim 41 wherein said complex comprise from 1 to 4 molecules of said cationic amphiphile of claim 1 per molecule of said therapeutically effective polyanion.

46. The method of claim 41 wherein administering is by parenteral injection.

47. The method of claim 46 wherein said parenteral injection is selected from the group consisting of interperitoneal, intrathecal and intraarticular injection.

48. The method of claim 41 wherein said administering is by inhalation.

49. A method for the treatment or prevention of a disease or disorder in an organism in need of such treatment or prevention, comprising: forming a complex between a cationic amphiphile of claim 1 and a polyanion therapeutically effective against said disease or disorder; incubating said complex with a cell or cell culture in vitro ; and administering said cell or said cell culture to said oganism.

50. The method of claim 49 wherein said complex comprises from 1 to 4 molecules of said cationic amphiphile of claim 1 per molecule of polyanion.

51. The method of claim 49 comprising: preparing a composition of said complex; and, administering said composition to said organism.

52. The method of claim 42 or claim 51 wherein said preparing a composition of said complex comprises mixing a solution of a polyanion with a solution of a cationic amphiphile of claim 1.

53. A cell comprising a compound of any of claims 1, 11, 17 or 60.

54. The method of claim 51 wherein said composition comprises a co-lipid.

55. The method of claim 54 wherein said co-lipid is selected from the group consisting of DOPE and cholesterol .

56. A kit comprising: a compound of any of claims 1, 11, 17 or 60; a polyanion; and, a cell culture.

57. The kit of claim 56 comprising: a package insert describing the method of use of the kit; and, a package insert describing FDA approval of said kit and said method of use .

58. The method of any of claims 41, 42, 49 or 51 wherein said organism is a mammal .

59. The .method of claim 58 wherein said mammal is a human .

60. The cationic amphiphile of claim 1 having the chemical structure:

wherein : y is independently 1 , 2 , 3 or 4 ; v is 0 or 1 wherein, when v is 0, R⁶ is hydrogen and when v is

1, R⁶ does not exist;

X is selected from the group consisting of -C(=0)-, -C(=NH)-,

-0C(=0)-, 0P(=0)-, -NHC(=0)- and -NC(=NH)-_;

R⁴ and R⁵ are independently selected from the group consisting of hydrogen,

-[(CH₂)_nNH⁺]_p(CH₂)_qN⁺R⁸R⁹R¹⁰ and -(CH₂)_n- NH

p is 0 , 1 , 2 or 3 ; and, n, q, r, s and t are independently 2 , 3 or 4