WO2000003004A2 - Presenilin 2 specific ribozyme - Google Patents

Abstract

The present invention relates to substances capable of inhibiting presenilin 2 expression in neurodegenerative diseases and in Alzheimer's disease. Ribozymes capable of cleaving presenilin 2-specific RNA are disclosed. Preferably, the invention concerns fusion ribozymes comprising a presenilin 2-specific ribozyme and an autocatalytical hammerhead ribozyme. Furthermore, recombinant DNA molecules coding for said ribozymes, a recombinant vector comprising the cDNA corresponding to said ribozymes and a host cell comprising said recombinant vector are disclosed. Additionally, the invention pertains to pharmaceutical compositions comprising said substance or ribozyme or recombinant vector and a pharmaceutically acceptable carrier. The invention also comprises the use of said substance or ribozyme or recombinant vector for the treatment of neurodegenerative diseases or for the treatment of Alzheimer's disease.

Description

Presenilin 2 specific ribozyme

Technical Field of the Invention

The present invention belongs to the field of presenilins and neurodegenerative diseases The invention relates to a substance capable of inhibiting presenilin 2 expression in neurodegenerative diseases and in Alzheimer's disease The invention is furthermore concerned with ribozymes capable of cleaving presenilin 2-specific RNA. Additionally, the invention pertains to recombinant vectors comprising specified ribozyme sequences and microorganisms comprising such recombinant vectors

Background Art

Neurodegenerative diseases are characterized by neuronal and synaptic cell loss Neuronal cell loss is caused at least in part by apoptotic cell death Neurodegenerative diseases include the chronic forms as Alzheimer's disease (AD), Parkinson's disease, Huntington's chorea and the acute form as stroke The majority of Alzheimer's disease cases are late in onset so far lacking an obvious genetic linkage and are characterized as sporadic, whereas a small percentage (approximately 10%) of cases belonging to the subgroup of familiar Alzheimer's disease (FAD) are earlier in onset and segregate strongly within families suggesting a genetic etiology AD is a neurodegenerative disorder marked by the gradual formation of extracellular neuritic plaques in the brain, particularly in the hippocampus and the adjoining cortex In AD research, one small peptide has long claimed a large share of attention Known as β amyloid (Aβ), it is the major constituent of the abnormal structures called 'amyloid plaques' that stud the brain of AD patients Mutations in the gene that encodes the amyloid precursor protein (APP), which is cleaved by two secretases (β- and γ-secretase) to release Aβ, account for some inherited cases of the disease (Chartier-Harlin et al , 1991, Goate et al , 1991, Murrell et al , 1991, Hendriks et al , 1992, Mullan et al , 1992)

The discovery in 1995 that a new gene family - the presenilins - is responsible for the majority of early-onset autosomal dominant cases of familial AD has led to the expectation that a fundamental understanding of the disease mechanism may not be far off (Levy-Lahad et al , 1995, Rogaev et al , 1995, Sherrington et al , 1995) It has been shown, both in vivo, in fibroblasts and plasma of FAD patients as well as in transgenic animals and cell lines that the presenilin (PS) mutations cause a specific increase in the production of extracellular Aβ42, the long form of Aβ ending at residue 42 (Borchelt et al , 1996, 1997, Duff et al , 1996, Scheuner et al , 1996) Aβ42 was shown to be deposited early and selectively in the disease process and to be more fibrillogenic m vitro than the more prevalent species of Aβ ending at residue 40, termed Aβ40 (Jarret et al ,

1993; Mann et al , 1996)

Several reports described the proapoptotic behaviour of PS based on data observed in cells transiently or stably overexpressing PS (Deng et al , 1996, Vito et al , 1996, Wolozin et al , 1996,

Janicki et al , 1997, Kim et al , Science 1997, 277 373-376, Loetscher et al , 1997)

Overexpression of PS2 increases the susceptibility of neurons to apoptotic stimuli and thus lead to neuronal death (Kim et al , Science 1997, 277 373-376)

The presenilins undergo regulated proteolytic cleavage into the normal N-terminal (NTF) and C- terminal fragments (CTF), 22-30 kDa and 18-26 kDa, respectively, in size (Thinakaran et al ,

1996, Kim et al , J Biol Chem 1997, 272, 11006-11010, Podlisny et al , 1997) Furthermore, the

PS proteins constitute substrates of a member of the caspase 3 protease family (CPP32) after its activation late in the course of apoptosis and are cleaved into alternative fragments (Kim et al ,

Science 1997, 277 373-376, Loetscher et al , 1997) One of these alternative fragments is

CTF₁₆

If these normal or alternative PS fragments played an active role in the apoptotic process, then one would expect that, by inhibiting the generation of these fragments, apoptosis would be largely reduced It could be demonstrated that inhibition of caspase 3 activation using specific peptide inhibitors leads to both, an inhibition of the formation of CTFi g and apoptotic cell death (Kim et al , Science 1997, 277 373-376, Loetscher et al , 1997)

Currently there exists only symptomatic treatment of neurodegenerative diseases and in particular of AD However, there is no disease-modifying treatment to cope with the pathology of said diseases At present, there is no therapeutic way of preventing the neuronal cell death due to apoptosis As descπbed supra, PS are involved in apoptosis and thus also a cause for neuronal cell death

The problem underlying the present invention therefore is to provide agents to decrease neuronal cell death due to apoptosis which thus can be used to treat neurodegenerative diseases, in particular AD Summary of the invention

The above-captioned technical problem is solved by the embodiments characterized in the claims. It was surprisingly found that the expression of PS2 which renders cells more vulnerable to apoptotic neuronal cell death in neurodegenerative diseases and in particular in AD can be selectively reduced or eliminated by using substances of the present invention which are capable of inhibiting presenilin 2 expression. According to the present invention, these substances are in particular ribozymes capable of cleaving presenilin 2-specific RNA. Preferably, said ribozymes are fusion ribozymes comprising a presenilin 2-specific ribozyme and an autocatalytical hammerhead ribozyme. Furthermore, it is an object of the present invention to provide recombinant DNA molecules coding for said ribozymes, a recombinant vector comprising the cDNA corresponding to said ribozymes and a host cell comprising said recombinant vector. Additionally, this invention pertains to pharmaceutical compositions comprising said substances or said ribozymes or said recombinant vector and a pharmaceutically acceptable carrier. Advantageously, said substances or said ribozymes or said recombinant vector can be used for the treatment of neurodegenerative diseases and preferably for the treatment of Alzheimer's disease. Said treatments are also embraced by this invention.

Brief description of the figures

Figure 1 a) Sequence and structure of a general hammerhead ribozyme-target RNA complex. The hammerhead ribozyme contains two domains, the substrate binding domain through which it recognizes and binds its target RNA via base pairing (marked by asterisks), and its catalytic domain that possesses the catalytic activity to cleave its target RNA at the 3'end of the trinucleotide GUX [X=C, A, U]. b) Secondary structure of PS2 mRNA. The secondary structure of a part of the PS2 mRNA starting with nucleotide 1 in the 5' untranslated region and ending at position nt 1236 in the translated region, was predicted by "mfold" (described infra in Example 1). Open loops that are good candidate regions suitable for targeting ribozymes are shown as black circles. The cleavage sites at the target trinucleotides are indicated with arrows. The numbering of the nucleotides corresponds to the sequence of human PS2 in the EMBL Data Bank, Accession No. L43964. The prediction for the secondary structure of the remaining part of the PS2 mRNA (nts 1001-2236) did not yield suitable open loop regions (data not shown) c) Location of ribozymes and the corresponding substrate RNAs. Three different trinucleotides were chosen and the appropriate synthetic ribozymes designed for in vitro ribozyme cleavage studies and the exogenous use in cell culture experiments A ribozyme targeted to a trinucleotide was designed with flanking substrate binding domains of various lengths, i e 5 ribozymes (rzl 173/13 3, rzl 173/12, etc ) targeted to the GUC1 173 trinucleotide (nucleotide numbering according to EMBL Data Bank, Accession No L43964) As substrate RNAs (target sites) for in vitro cleavage studies we routinely used short synthetic, 5' [-^P] -labeled (indicated by asterisks), RNAs (shown as black bars with an arrow directing to the right site indicating sense RNA) In addition, as target site GUCi 173 we generated a larger substrate RNA (367 bp), in vitro transcribed from plasmid pBSK+/PS2 Ncol with T7 poiymerase (Fig 4b) and [32p-CTP]- labeled (indicated by asterisks) The only ribozyme we used endogenously for further functional analyses was ribozyme rzl 173 (indicated with "+") In order to screen positive rzl 173 overexpressing cell clones for PS2 mRNA levels, we used an antisense RNA containing the ribozyme target site of PS2 (shown as black bars with an arrow directing to the left site indicating antisense RNA) as RNA probe for the RNase protection assay This probe was generated by in vitro transcπption from plasmid pBSK+/PS2 Ncol with T3 poiymerase (Fig 4b) and [32p-CTP]- labeling

Figure 2

In vitro cleavage studies of different synthetic ribozymes targeted to various regions in the

PS2 mRNA. a) Three synthetic πbozymes (rzl 173, rz232, rz308, nucleotide numbering according to EMBL Data Bank. Accession No L43964) were targeted to various regions in the PS2 mRNA. and analyzed for their cleavage capacity in vitro with synthetic, 5' [32p]-i_abeled RNA substrates containing the specific target trinucleotide Each ribozyme was used with different lengths of the flanking substrate binding region (1 e rzl 173/13 3, 12, 9, etc ) For rzl 173 and rz232 so-called 'antisense πbozvmes', as- 12 and as- 15 1, respectively, were generated (descπbed infra in Example 1) The nbozyme cleavage reaction was carried out under standard conditions and ribozyme target molar ratios were used as indicated As controls substrate RNAs were used without πbozvme treatment (lane"-") Reactions were stopped and loaded onto a 20 % SDS- polyacrvlamide 6 M urea gel, dried onto filter paper and exposed on X-Omat AR films (Kodak) b) Three different ribozymes, rzl 173, rz232 and rz308, with a substrate binding domain in between 15-16 b were used for further detailed analyses concerning the required ribozyme: target molar ratio for efficient cleavage in vitro. The ribozyme cleavage reaction was carried out under standard conditions (described infra in Example 1) with ribozyme:target molar ratios as indicated As controls substrate RNAs were used without ribozyme treatment (lane "-"). Reactions were stopped and loaded onto a 20 % SDS-polyacrylamide/ 6 M urea gel, dried onto filter paper and exposed on X-Omat AR films (Kodak).

Figure 3 a) In vitro efficiency of ribozyme rzl 173 with substrate binding domains varying in length at different ribozyme:target molar ratios. Ribozyme rzl 173 was used with flanking substrate binding domains in between 9-16 b in length (rzl 173/13.3, 12, 9) The corresponding synthetic RNA substrate was 5' [32p]-l_abeled. The ribozyme cleavage reaction was carried out under standard conditions (described infra in Example 1) with ribozyme target molar ratios as indicated Reactions were stopped and loaded onto a 20 % SDS-polyacrylamide/ 6 M urea gel, dried onto filter paper and exposed on X-Omat AR films (Kodak). Cleavage efficiencies were calculated with the Phospor Imaging System (BioRad). b) Kinetics of the in vitro ribozyme cleavage of synthetic rzll73/13.3. The ribozyme cleavage reaction was carried out under standard conditions (described infra in Example 1) with a concentration of ribozyme:target RNA of 100 1 As RNA substrate a 5' [32p]-l_abeled synthetic RNA was used containing the target trinucleotide GUCi 173 Aliquots were taken at the indicated time points and loaded onto a 20 % SDS-polyacrylamide/ 6 M urea gel. The cleavage kinetic of ribozyme rzl 173/13 3 is shown in the upper figure Ribozyme cleavage in percentage was calculated with the Phosphor Imaging System (BioRad) and is shown in the lower figure

Figure 4 a) Sequence and structure of the ribozyme rzll73/13.3auto - PS2 mRNA complex. The binding of hammerhead ribozyme rzl 173/13 3auto to a specific sequence of the PS2 mRNA is shown (nucleotide numbering according to EMBL Data Bank, Accession No L43964). Base pairing between the flanking regions of the substrate binding domain of rzl 173 and the surrounding nucleotides of GUC1 173 ^{m tne} PS2 mRNA is indicated by asterisks, the Wobble base pair "G-U" is marked by points The ribozyme rzl 173/13 3auto is an example for a fusion ribozyme comprising the PS2-specific ribozyme rzl 173/13 3 and the autocatalytical hammerhead- ribozyme directly fused with its 5' end to the 3' end ofthe PS2-specific ribozyme rzl 173/13 3 b) Vector constructs for in vitro and in vivo expression of rzl 173/13.3 and the corresponding substrates. In vitro transcription from the plasmid pBSK+/PS2 rzl 173 13 3 yielded the biosynthetic ribozyme rzl 173 that was then tested for in vitro cleavage activity in comparison to the synthetic ribozyme Plasmid pBSK+/PS2 rzl 173 13.3auto encodes the ribozyme construct box that was finally cloned into the response plasmid (pUHD 10-3) of the tetracycline-sensitive gene expression system (H Bujard, Heidelberg) used for the PS2 'knockdown' in HeLa cells This ribozyme construct box contained the PS2 specific ribozyme rzl 173/13 3 and an autocatalytic ribozyme (see a) Transcription from the T3 promotor of construct pBSK+/PS2 Ncol generated the sense PS2/NcoI fragment containing the ribozyme rzl 173 target sequence of PS2 that was used in in vitro ribozyme cleavage reactions Transcription from the T7 promotor yielded the antisense PS2/NcoI fragment that was used as probe in the RNasel protection assay for quantification of PS2 mRNA levels in rzl 173/13 3 expressing HeLa cell clones

Figure 5

In vitro transcribed ribozyme rzl 173/13.3 cleaved 367 b long PS2 transcript. The in vitro transcribed ribozyme rzl 173 was incubated in increasing amounts (0,1; 0,3, 0,5, 1, 3, 5 μl of the total in vitro transcription reaction) together with the 367 b long, 2p] beled PS2 transcript under standard conditions (described infra in Example 1) The first lane shows the substrate RNA without treatment In lane "-" substrate RNA was incubated under standard conditions without ribozyme Marker RNA of known size was loaded onto the polyacrylamide gel for comparison

Figure 6 a) PS2 mRNA levels of various cell clones inducibly expressing rzll73/13.3. 49 clones that were stably transfected with the construct pUHD 10-3/PS2-rzl 173 13 3auto were tested for PS2 expression after omission of doxycycline with the RNase protection assay (RPA) The first two lanes are control reactions, in which tRNA is used for hybridization with the [32p]-l beled antisense RNA probe of PS2 These hybridization reactions were carried out in the absence (-) or presence (+) of RNases mRNA from the control cell line HtTA was used in the RPA as standard and indicated the endogenous PS2 mRNA level Cell line HtTA/PS2 rzl 173 40 was selected for further detailed analyses on the protein level b) PS2 protein levels in the selected cell line HtTA/PS2 rzl 173.40. Extracts were made from the PS2 'knock-down' cell line at different time points after omission of doxycycline For comparison with the endogenous PS2 protein level in HeLa cells, extracts were prepared from cells growing in standard medium supplemented with doxycycline at day 0 and 14 Proteins were immunoprecipitated using antibody 3711, separated on SDS/ polyacrylamide gels, blotted onto PVDF membranes and hybridized with the monoclonal antibody BI.HF5C (1 2000 dilution) Both antibodies recognize the hydrophilic loop of PS2

Figure 7

The PS2 'knock-down' HeLa cell line was less sensitive against an apoptotic stimulus as calculated by ethidiumbromide/ acridine orange staining. Three HeLa cell lines (the PS2 'knock-down' cells [PS2 k d ] and cell lines overexpressing wildtype [PS2 wt] or mutant PS2 [PS2 mut]) were used for determination of their apoptotic sensitivity to staurosporine (a) Overexpression of wildtype or mutant PS2 was demonstrated by immunofluorescence with antibody 2972 (1 300 dilution), that recognizes the N-terminus of PS2, in the presence (+Dox) or the absence (-Dox) of doxycycline (b) After treatment with staurosporine in concentrations as indicated for 18 h, the cells were fixed and incubated with ethidiumbromide and acridine orange as described infra in Example 1

Figure 8

The PS2 'knock-down' caused an inhibition of apoptosis.

The three transfected HeLa cell lines (the PS2 'knock-down' cells [PS2 k d ] and two cell lines overexpressing wildtype [PS2 wt] or mutant PS2 [PS2 mut]) as well as the original HeLa cell line were treated with indicated concentrations of staurosporine for 18 h under standard conditions (described infra in Example 1) As a control, cells were not treated with staurosporine (lane "0") (a) Apoptosis sensitivity. Analyses were carried out using a cell death detection ELISA (Boehringer Mannheim, described infra in Example 1) The degree of apoptosis was expressed directly as the absorbance at 405-490 nm (b) Alamar Blue reduction assay. Cell viability was measured using the Alamar Blue reduction (see Example 1) and given in percentage of the control (c) LDH release. LDH release was determined (Boehringer Mannheim, described infra in Example 1) and given as optical densities Figure 9

The PS2 'knock-down' seemed to have no influence on the caspase 3 (CPP32) activation following an apoptotic stimulus. The three HeLa cell lines (the PS2 'knock-down' cells [PS2 k d ] and cell lines overexpressing wildtype [PS2 wt] or mutant PS2 [PS2 mut]) were treated with 1 μM staurosporine under standard conditions (described infra in Example 1). As a control, extracts were made of cells not treated with staurosporine (lane "c") (a) Extracts were prepared at the indicated time points and identical protein amounts were loaded onto a 12 % SDS/ polyacrylamide gel After blotting onto PVDF membranes, hybridization with a CPP32-specific antibody (Transduction Laboratories, 1 500 dilution) was carried out This antibody recognizes the CPP32 holoenzyme and the 17 kDa active N-terminal fragment (shown in a as an example) that is generated upon proteolytic cleavage (b) The CPP32 holoenzyme is indicated by an arrow

Figure 10

The PS2 'knock-down' seemed to have no influence on PARP cleavage following an apoptotic stimulus. The three HeLa cell lines (the PS2 'knock-down' cells [PS2 k d ] and cell lines overexpressing wildtype [PS2 wt] or mutant PS2 [PS2 mut]) were treated with 1 μM staurosporine under standard conditions (described infra in Example 1) As a control, extracts were made of cells not treated with staurosporine (lane "c") (a) Extracts were prepared at the indicated time points and identical protein amounts were loaded onto a 12 % SDS/ polyacrylamide gel After blotting onto PVDF membranes hybridization with a PARP-specific antibody (Boehringer Mannheim, 1 2000 dilution) was carried out This antibody recognizes the PARP holoenzyme and the proteolytic fragments (indicated by arrows) (b) PARP holoenzyme and the 85 kDa fragment are marked by arrows

Figure 11

Inhibition of apoptosis by PS2 'knock-down' - time-course experiments. The three HeLa cell lines (the 'PS2 knock down' cells [PS2 k d ] and cell lines overexpressing wildtype [PS2 wt] or mutant PS2 [PS2 mut]) were treated with 1 μM staurosporine under standard conditions As a control, extracts were made of cells not treated with staurosporine (lane "c") a) No CTF16 could be detected during apoptosis in the PS2 'knock-down' cell line. Extracts were prepared at the indicated time points and identical protein amounts were used for immunoprecipitation with the polyclonal PS2/loop-specific antibody 3711 After 12 % SDS/ polyacrylamide gel electrophoresis and blotting onto PVDF membranes, hybridization with the monoclonal antibody BI.HF5C (1 :2000 dilution), that was also raised against the loop region, was carried out. b) The PS2 'knock-down' showed an inhibitory effect on apoptosis compared with the overexpression of wildtype or mutant PS2. In parallel to extract preparations (a) the cells were analyzed for apoptosis using the cell death detection ELISA (Boehringer Mannheim). The degree of apoptosis was expressed directly as the absorbance at 405-490 nm.

Figure 12

No CTF_jg generation occured at subtoxic staurosporine concentration after 18 h. HeLa cells overexpressing wildtype (PS2 wt) or mutant PS2 (PS2 mut) were treated with staurosporine concentrations as indicated under standard conditions. As a control, cells were not treated with staurosporine (lane „c"). Extracts were prepared after 18 h and identical protein amounts were used for immunoprecipitation with the polyclonal PS2/loop-specific antibody 3711. After 12 % SDS/ polyacrylamide gel electrophoresis and blotting onto PVDF membranes, hybridization with the monoclonal antibody BI.HF5C (1 :2000 dilution), that was also raised against the loop region, was carried out.

Detailed description of the invention

The invention pertains to a substance capable of inhibiting presenilin 2 expression in neurodegenerative diseases. Neurodegenerative diseases include, but are not limited to, Alzheimer's disease (AD), Parkinson's disease, Huntington's chorea and stroke. The gene encoding the transcript of presenilin 2 which maps to human chromosome 1 as well as the gene product presenilin 2 are known in the art. As used herein, the term "presenilin 2 gene" or "PS2 gene" means the mammalian gene first disclosed and described in US 5840540 A, and later described in Rogaev et al. (1995) and Levy-Lahad et al. (1995), and WO 96/34099 Al (all herein incorporated by reference) including any allelic variant and heterospecific mammalian homologues. Additional human splice variants as described in WO 96/34099 Al have been found in which a single codon or a region encoding thirty-three residues may be spliced-out in some transcripts. The term "presenilin-2 gene" or "PS2 gene" primarily relates to a coding sequence, but can also include some or all of the flanking regulatory regions and/or introns. The term PS2 gene specifically includes artificial or recombinant genes created from cDNA or genomic DNA including recombinant genes based upon splice variants. The presenilin 2 gene has also been referred to as the E5-1 gene (e g US 5840540 A) or the STM2 gene (e.g , Levy-Lahad et al , 1995)

The invention further comprises a substance capable of inhibiting presenilin 2 expression in Alzheimer's disease (AD) The invention particularly comprises a substance capable of inhibiting presenilin 2 expression in familiar Alzheimer's disease The term "AD" refers to a neurodegenerative disorder marked by the gradual formation of extracellular neuritic plaques in the brain, particularly in the hippocampus and the adjoining cortex The majority of Alzheimer's disease cases are late in onset lacking an obvious genetic linkage and are characterized as sporadic The term "familiar Alzheimer's disease (FAD)" refers to a subgroup of AD comprising a small percentage (approximately 10%) of cases which are earlier in onset and segregate strongly within families suggesting a genetic etiology

The term "substance" as used herein means a chemical, pharmaceutical or biotechnological compound, preferably a nucleic acid molecule

The invention particularly relates to a substance consisting of an anti-sense oligonucleotide Anti-sense oligonucleotides are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, 1990) In the cell, anti-sense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule The anti-sense nucleic acids interfere with the translation of the mRNA since the cell will not translate a mRNA that is double-stranded The use of anti-sense methods to inhibit the in vitro or in vivo (also in the animal model) translation of genes is well known in the art (e g Marcus- Sekura, 1988) An anti- sense core nucleic acid may at least contain 10 nucleotides complementary to the target message Said anti-sense oligonucleotides also comprise peptide nucleic acids, phosphodiester anti-sense oligonucleotides and phosphorothioate oligonucleotides (Boado RJ et al, 1998) Anti-sense nucleic acids have been described in the art to inhibit the expression of proteins associated with toxicity or gene products introduced into the cell, such as those introduced by an infectious agent (e g a virus) They furthermore are useful to block expression of a mutant protein or a dominantly active gene product such as amyloid precursor protein in AD as described in WO 9818811 Al

Similarly, the anti-sense oligonucleotide of the present invention may be used to block the PS2 expression in neurodegenerative diseases or preferably in AD or FAD

The present invention further provides a ribozyme capable of cleaving presenilin 2-specific mRNA The term "ribozyme" used in the present invention relates to an RNA capable of specifically interacting with a target RNA and of irreversibly cleaving it at a defined site Preferably, the ribozyme has a central sequence not complementary to the target RNA that is responsible for its catalytic activity (catalytic domain or region (a)), and two flanking sequences essentially complementary to two neighboring sequences of the target RNA (substrate binding domain or hybridization region (b)) so as to allow binding ofthe ribozyme via base-pairing and thus selective cleavage ofthe target RNA

Thus, according to the present invention, said ribozyme preferably comprises a catalytic region (a) and at least one hybridization region (b), with the hybridization region (b) essentially being complementary to a region ofthe mRNA that is transcribed from the presenihn 2 gene

The ribozyme according to the invention is preferably characterized in that the hybridization region (b) consists of two domains flanking the catalytic region (a) and being essentially complementary to the target nucleic acid region so as to be capable of selectively binding to all mRNAs that are transcribed by the preseni n 2 gene in order to selectively cleave these RNAs

(see figure 1 for a hammerhead πbozyme according to the present invention)

The term "essentially complementary" as used in the present invention is to be understood such that the complementanty between πbozyme and target nucleic acid region is so high that it allows the specific binding of the ribozyme via hybridization and selective cleavage of the target nucleic acid region under those conditions under which the ribozyme is used The ribozymes are preferably completely complementary to the target nucleic acid region

The term "selectι\e cleavage" as used in the invention is to be understood such that the expression of the PS2 gene is suppressed to such an extent that the desired therapeutical effect is achieved

The selective inhibition of the gene expression in cells by the πbozyme according to the invention does therefore not mean that the target gene will be irreversibly damaged or eliminated Rather the use of the πboz\mes advantageously only leads to the selective inhibition of the translation of said gene The property of πbozymes to specifically bind target RNA and to inactivate them by cleavage has been successfully demonstrated several times for the case of specific inhibition of

HIV-RNA (Lisziewicz et al , 1993, Yu et al 1993 Morgan and Anderson, 1993, Yamada et al

1994) In a preferred embodiment of the ribozyme according to the invention, said ribozyme can be presented by the following general formula:

(b) (a) (b)

5' [N₃.20] [CUGANGARN_0-30SGAAA] [N₃.₂₀] 3', wherein N is G, C, A or U, R is a purine, and S is a pyrimidine, and wherein the central region N₀.

₃o of sequence (a) can be replaced by a linker which is different from nucleic acid, e.g., a hydrocarbon chain (Thomson et al., 1993).

The conserved nucleotides within the catalytic region are essential for the catalytic effect but can be optionally modified by the person skilled in the art with the below-mentioned method (Joyce,

1992; Yuan and Altman, 1994) such that ribozyme effectivity and selectivity is favorably influenced. The length of the hybridization region (b) (N3-20) depends on many factors and is selected such that a sufficient hybridization to the RNA to be cleaved is achieved under the selected conditions (such as temperature, ion environment) in order to allow efficient cleavage, but, if the difference between the target RNA and non-target RNA does not comprise the cleavage motif per se, there is no sufficient hybridization to the non-target RNA. The choice of the length ofthe hybridization region thus depends on, e.g., the GC content of the RNAs and the number of nucleotides differing between target RNA and non-target RNA. Preferably, the lengths of the 5' hybridization region and the 3' hybridization region are equal, but they can be asymmetrical, e.g.. a combination of three and 20 nucleotides. The overall length of the hybridization region (b) is 12 to 30 nucleotides.

In a particularly preferred embodiment of the present invention, the ribozyme contains the following nucleotide sequence (5 'to 3') in the catalytic domain:

CUGAUGAXXXXYYYYZZZZGAAAC wherein:

CUGAUGA and GAAAC are conserved nucleotide sequences;

X is any nucleotide selected from A, G, C and U which is complementary to Z, so that G is paired with C and A is paired with U or C is paired with G and U is paired with A;

Y is any nucleotide selected from A, G, C and U;

Z is any nucleotide selected from A G, C and U which is complementary to X, so that G is paired with C and A is paired with U or C is paired with G and U is paired with A.

The ribozyme according to the invention can be a hammerhead, hairpin or axehead ribozyme. The structure of hammerhead ribozyme in general is known to the person skilled in the art and is described in, e.g.. Symons (1992), and Rossi (1993). As outlined below, the skilled practitioner may modify the catalytic structure such that it yields optimum results for the projected use in terms of effectivity and substrate specificity

Hairpin ribozymes were originally identified to be part of the minus strand of the TRSV (tobacco ringspot virus) satellite RNA In the meantime, it has been shown that these ribozymes can effectively cleave target RNAs in trans, the mechanism of action being similar to that of the hammerhead ribozymes The regions being responsible for substrate binding and catalytic effect were determined and the invariable structure or sequence motifs characterized The cleavage motif of the target RNA is N'GNPy (N is G, C, U or Py is C or U) (see, e g , Rossi, 1993, and Hampel et al , 1990) On the basis ofthe requirements with respect to the structure and sequence of the hairpin ribozyme necessary for an effective cleavage and with respect to the cleavage motif on the target RNA explained in the art, the skilled practitioner can construct a ribozyme using standard techniques that possesses the desired properties

Axehead ribozymes were originally defined to be part of the genomic and antigenomic RNA of the hepatitis delta virus Here, too, it was possible to determine the minimum sequence and/or structure necessary for a cleavage in trans, and, as described above for hammerhead and hairpin ribozymes, the person skilled in the art can construct axehead ribozymes on the basis of the data described in the art which exhibit the properties required for the purpose according to the invention (see, e g Been, 1994, and Wu et al , 1993)

Determined target sequences with the pertaining, highly specific ribozyme were observed to allow a considerably increased catalytic activity by adapting the catalytic region (Koizumi et al , 1989, Koizumi and Ohtsuka, 1992) If the kinetic data show a too low ribozyme efficiency, the person skilled in the art can optimize the ribozyme structure by well-established in vitro evolutionary processes (Joyce, 1992, Yuan and Altman, 1994)

According to the present invention, the ribozyme may be modified such that resistance to nucleases is achieved, increasing the retention time and thus the effectivity of the ribozyme at the target site, e g , in certain cells of a patient Furthermore, the amount of ribozyme to be applied and, if any, related side-effects can be reduced

Examples of such modifications are the substitution of the 2'-OH groups of the ribose by 2'-H, 2'-O-methyl, 2'-O-allyl, 2'-fluoro or 2'-amino groups (Paolella et al , 1992, and Pieken et al , 1991) or the modification of phosphodiester compounds, by, e g , replacing one or two oxygen atoms by sulphur atoms (phosphorous thioate or phosphorous dithioate, Eckstein, 1985, and Beaton et al , in Eckstein, F (ed ) Oligonucleotides and analogues - A practical approach - Oxford, JRL Press (1991), 109-135 or by a methyl group (methyl phosphonate, Miller, loc cit , 137-154). Further modifications include conjugation of the RNA with poly-L-lysine, polyalkyl derivatives, cholesterol or PEG. Preferably, the ribozymes according to the invention contain at least one of the above-described phosphate modifications and/or at least one of the above- described ribose modifications.

The invention preferably comprises a ribozyme that cleaves downstream of the GUU232 site of presenilin 2-specific RNA.

The invention also preferably comprises a ribozyme that cleaves downstream of the GUC308 site of presenilin 2-specific RNA.

The invention also preferably comprises a ribozyme that cleaves downstream ofthe GUCi 173 site of presenilin 2-specific RNA.

The numbering of the nucleotides of said GUU or GUC sites corresponds to the PS2 sequence in the EMBL Data Bank, Accession No. L43964.

The invention more preferably pertains to a ribozyme which is a fusion-ribozyme comprising a presenilin 2-specific ribozyme and an autocatalytical hammerhead-ribozyme fused with its 5' end to the 3' end ofthe presenilin 2-specific ribozyme (see figure 4).

The invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof

UUCUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGCG

Furthermore, the invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAG

Furthermore, the invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof UUGGCUGAUGAGGCCGUGAGGCCGAAACAC

Furthermore, the invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAA

Furthermore, the invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof UGGUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUCG

Furthermore, the invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof GUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGU Furthermore, the invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof

UUUUCUGAUGAGGCCGUUAGGCCGAAACACGU

Furthermore, the invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof

GAAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGG

Furthermore, the invention preferably pertains to a ribozyme wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof

GAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUG

Furthermore, the invention preferably pertains to a ribozyme wherein the autocatalytical hammerhead-ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof

GAUCCGUCGACGGACUCGAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUC

The term "bioequivalent" as used herein means, that a ribozyme with a nucleotide sequence different from the before-mentioned sequences carries out the same desired biological function

The skilled practitioner can synthesize a ribozyme or modify the ribozymes disclosed in the present invention using standard techniques and examine the obtained ribozymes with the test systems disclosed in the examples of the present application in order to establish the bioequivalent function of said ribozymes A "bioequivalent" ribozyme may contain additional nucleotides at the

5' end (in particular the PS-2 specific ribozymes) or at the 3' end (in particular the autocatalytical ribozyme) which do not hybridize with the target RNA. Said additional nucleotides may be added during to the cloning process of the ribozyme Such additional nucleotides are exemplified in fig

4a) with the ribozyme rzl 173/13 3auto. see the PS2-specific ribozyme rzl 173/13 3 (AAG at the

5' end) and the autocatalytical ribozyme (UCUAG at the 3' end)

In a preferred embodiment, the present invention relates to a ribozyme having the sequence

UUCUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGCGor

CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAG or

UUGGCUGAUGAGGCCGUGAGGCCGAAACAC or

CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAAor UGGUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUCG or

GUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGU or

UUUUCUGAUGAGGCCGUUAGGCCGAAACACGU or

GAAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGG or

GAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUG or

GAUCCGUCGACGGACUCGAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUC or

UUCUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGCGGAUCCGUCGACGGACUC GAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUC or

CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGGAUCCGUCGACGGACUCGAGU CCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

UUGGCUGAUGAGGCCGUGAGGCCGAAACACGAUCCGUCGACGGACUCGAGUCCGU CCUGAUGAGUCCGUGAGGACGAAACGGAUC or

CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAAGAUCCGUCGACGGACUCGAGU CCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

UGGUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUCGGAUCCGUCGACGGACUC GAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUC or

GUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUGAUCCGUCGACGGACUCGAGU CCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUC or

UUUUCUGAUGAGGCCGUUAGGCCGAAACACGUGAUCCGUCGACGGACUCGAGUCC GUCCUGAUGAGUCCGUGAGGACGAAACGGAUC or GAAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGGGAUCCGUCGACGGACUCG AGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

GAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGGAUCCGUCGACGGACUCGAG UCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUC.

The invention additionally pertains to a recombinant DNA molecule coding for any one of the ribozymes according to the present invention.

The invention further relates to a recombinant cDNA molecule coding for any one of the ribozymes according to the present invention.

A recombinant vector comprising the cDNA corresponding to any one of the ribozymes is also included in the invention.

More particularly, a recombinant vector comprising the cDNA corresponding to any one of the ribozymes fused to the cDNA sequence corresponding to the autocatalytical hammerhead- ribozyme is included in the invention.

Suitable vectors comprise plasmids, viruses (including phage) and integratable DNA fragments (i.e., integratable into the host genome by recombination). In the present specification, "vector" is generic to "plasmid"; but plasmids are the most commonly used form of vectors at present. However, all other forms of vectors which serve an equivalent function and which are, or become, known in the art are suitable for use herein. Suitable vectors will contain replicon and control sequences which are derived from species compatible with the intended expression host. The present invention additionally pertains to a host cell comprising the recombinant vector comprising the cDNA corresponding to any one ofthe ribozymes.

Suitable host cells are any prokaryotes, yeasts or higher eukaryotic cells which have been transformed or transfected with the nucleic acids of the present invention so as to cause clonal propagation of those nucleic acids and/or expression of the proteins or peptides encoded thereby. Such cells or cell lines will have utility both in the propagation and production of the nucleic acids and proteins of the present invention but also, as further described herein, as model systems for diagnostic and therapeutic assays. As used herein, the term "transformed cell" is intended to embrace any cell, or the descendant of any cell, into which has been introduced any of the nucleic acids of the invention, whether by transformation, transfection, infection, or other means. Methods of producing appropriate recombinant vectors, transforming cells with those recombinant vectors, and identifying transformants are well known in the art and are only briefly reviewed here (see, for example, Sambrook et al. 1989).

Prokaryotic cells useful for producing the transformed cells of the invention include members of the bacterial genera Escherichia (e.g., E. coli), Pseudomonas (e.g., P. aeruginosa), and Bacillus (e.g., B. subtillus, B. stearothermophilus), as well as many others well known and frequently used in the art. Bacterial cells (e.g., E. coli) may be used with a variety of expression vector systems including, for example, plasmids with the T7 RNA polymerase/promoter system, bacteriophage λ regulatory sequences, or Ml 3 Phage mGPI-2. Bacterial hosts may also be transformed with fusion protein vectors which create, for example, lacZ, trpE, maltose-binding protein, poly-His tags, or glutathione-S-transferase fusion proteins. All of these, as well as many other prokaryotic expression systems, are well known in the art and widely commercially available (e.g., pGEX-27 (Amrad, USA) for GST fusions). Eukaryotic cells and cell lines useful for producing the transformed cells of the invention include mammalian cells and cell lines (e.g., PC12, COS, CHO, fibroblasts, myelomas, neuroblastomas, hybridomas, human embryonic kidney 293, oocytes, embryonic stem cells), insect cells lines (e.g., using baculovirus vectors such as pPbac or pMbac (Stratagene, La Jolla, CA)), yeast (e.g., using yeast expression vectors such as pYESHIS (Invitrogen, CA)), and fungi.

To accomplish expression in eukaryotic cells, a wide variety of vectors have been developed and are commercially available which allow inducible (e.g., LacSwitch expression vectors, Stratagene, La Jolla, CA) or cognate (e.g., pcDNA3 vectors, Invitrogen, Chatsworth, CA) expression of presenilin nucleotide sequences under the regulation of an artificial promoter element. Such promoter elements are often derived from CMV of SV40 viral genes, although other strong promoter elements which are active in eukaryotic cells can also be employed to induce transcription of presenilin nucleotide sequences. Typically, these vectors also contain an artificial polyadenylation sequence and 3' UTR which can also be derived from exogenous viral gene sequences or from other eukaryotic genes. Furthermore, in some constructs, artificial, non- coding, spliceable introns and exons are included in the vector to enhance expression of the nucleotide sequence of interest (in this case, PS2 sequences). These expression systems are commonly available from commercial sources and are typified by vectors such as pCDNA3 and pZeoSV (Invitrogen, San Diego, CA). Innumerable commercially-available as well as custom- designed expression vectors are available from commercial sources to allow expression of any desired presenilin transcript in more or less any desired cell type, either constitutively or after exposure to a certain exogenous, stimulus (e.g., withdrawal of tetracycline or exposure to IPTG). Recombinant vectors may be introduced into the recipient or "host" cells by various methods well known in the art including, but not limited to, calcium phosphate transfection, strontium phosphate transfection, DEAE dextran transfection, electroporation, Hpofection (e.g., Dosper Liposomal transfection reagent, Boehringer Mannheim, Germany), microinjection, ballistic insertion on micro-beads, protoplast fusion or, for viral or phage vectors, by infection with the recombinant virus or phage

The invention also pertains to a pharmaceutical composition comprising a substance or a ribozyme or a DNA molecule or a recombinant vector as described above and a pharmaceutically acceptable carrier therefor. The term "pharmaceutically acceptable carrier" as used herein refers to conventional pharmaceutic excipients or additives used in the pharmaceutical manufacturing art Said pharmaceutical composition ofthe present invention may contain said recombinant vector to be used for gene therapy and may contain a colloidal dispersion system or liposomes for targeted delivery ofthe pharmaceutical composition.

One example of a targeted delivery system for antisense polynucleotides is said colloidal dispersion system Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes or liposome formulations. The preferred colloidal system of this invention is a liposome. Liposomes are artificial membrane vesicles which are useful as delivery verhicles in vitro and in vivo These formulations may have net cationic, anionic or neutral charge characteristics are useful characteristics with in vitro, in vivo and ex vivo delivery methods. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4 0 μm can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., 1981). In addition to mammalian cells, liposomes have been used for delivery of polynucleotides in plant, yeast and bacterial cells. In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present (1) encapsulation of the genes of interest at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non- target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino et al , 1988)

The composition of the liposome is usually a combination of phospholipids, particularly high- phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.

The pharmaceutical composition of the present invention may contain said recombinant vector as a naked "gene expression vector". This means that the construct is not associated with a delivery vehicle (e.g. liposomes, colloidal particles and the like). One of the principal advantages of naked

DNA vectors is the lack of a immune response stimulated by the vector itself.

The present invention comprises the use of a substance or a ribozyme or a DNA molecule or a recombinant vector as described above in the manufacture of a medicament for the treatment of neurodegenerative diseases.

The present invention more particularly comprises the use of a substance or a ribozyme or a DNA molecule or a recombinant vector as described above in the manufacture of a medicament for the treatment of Alzheimer's disease.

The present invention most particularly comprises the use of a substance or a ribozyme or a DNA molecule or a recombinant vector in the manufacture of a medicament for the treatment of familiar Alzheimer's disease.

The invention also pertains to a process for the production of a ribozyme characterized in that a

DNA molecule is expressed in a host.

The invention more specifically pertains to a process for the production of a ribozyme, characterized that a DNA molecule is synthesized in an automatic synthesizer.

The following examples serve to further illustrate the present invention; but the same should not be construed as limiting the to the scope ofthe invention disclosed herein. The examples illustrate specific substances/ribozymes as claimed in the present invention, corresponding nucleic acid molecules and recombinant vectors and the use of said substances/ribozymes for the inhibition of apoptosis in neurodegenerative diseases and thus for the treatment of said diseases.

Example 1 - General Methods cDNA constructs

Human wildtype (wt) PS2 cDNA (Science 269: 973-977, 1995). The N141V mutation in the human PS2 cDNA was generated by site-directed mutagenesis (Stratagene). Both full length PS2 cDNA sequences were cloned into the EcoRI restriction site of the tTA-response plasmid pUHD 10-3 (Gossen and Bujard, 1992) to generate the tetracycline-regulated expression vectors pUHD10-3/PS2wt and pUHD10-3/PS2mut for inducible expression in cells A 297 bp PS2 Ncol cDNA fragment (nts 960-1257 according to the EMBL Data Bank, Accession No L43964) was cloned into the pBluescriptII/SK+ plasmid (pBSK+/PS2 Ncol) and used for in vitro transcription

Oligoribonucleotide sequences

Ribozyme sequences. rz 1173/13.3 5'-UUCUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGCG-3', rz 1173/12 5'-CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAG-3', rz 1173/9 5'-UUGGCUGAUGAGGCCGUGAGGCCGAAACAC-3', rz 1173/11.12 5'-CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAA-3', as 1173/12 5'-CUUUGGCUGAUUCGGCCGUGAGGCCGAUACACA-3', rz 232/15.1 5'-UGGUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUCG-3', rz 232/12 5'-GUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGU-3', rz 232/10 5'-UUUUCUGAUGAGGCCGUUAGGCCGAAACACGU-3', as 232/15.1 5'-UGGUUUUUCUGAUUCGGCCGUUAGGCCGAUACACGUC-3', rz 308/15 5'-GAAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGG-3', rz 308/12 5'-GAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUG-3'

Autonbozyme sequence. 5'-GAUCCGUCGACGGACUCGAGUCCGUCCUGAUGAGUC

CGUGAGGACGAAACGGAUC-3 '

RNA substrate sequences. 1173 5'-CGCUGUGUCCCAAAGAA-3', 232

5'-CGACGUGUUAAAAACCA-3', 308 5'-CCAAGGUCCGGGAUUC-3'

Ribozyme numbeπng corresponds to the nucleotide position in the PS2 mRNA ofthe guanidine in the target GUX (indicated in the RNA substrate sequences in bold), after which the phosphodiester bond is cleaved The numbeπng of the nucleotides correponds to the PS2 sequence in the EMBL Data Bank, Accession No L43964 The RNA substrates, which represent partial sequences of the PS2 mRNA are named accordingly The number of base pairs formed by hybridization of the substrate binding domain of the ribozyme to the target mRNA is indicated in numbers, wobble base pairs in numbers behind the point (i e rzl 173/13 3) Synthetic and in vitro transcribed ribozymes and RNA substrates were strictly handled under RNase free conditions DEPC (diethylpyrocarbonate) water or nuclease free water (Promega, Heidelberg) was used Oligoribonucleotide purification was done either by HPLC (reversed phase, trityl on) or on denaturing SDS-PAGE/ 8 M urea

Synthesis of synthetic ribozymes and RNA substrates Oligoribonucleotides were synthesized using standard phosphoramidite chemistry (Boehringer Ingelheim Pharma KG, Department of Chemical Reseach, Biberach, Interactiva Inc , Ulm) The ribozymes contained stabilizing 2'- methylnucleosides and 3'-terminal modifications, namely 3 ',3 '-inverted termini and 2',3'- dideoxynucleosides, making them suitable for the cell transfections 2'-0-methyl-ribonucleotides were introduced in order to prevent endonucleolytic degradation, while 3 '-terminal dideoxynucleotides (ddA and ddC) or 3 ',3 '-inverted dG residues protected the sequence from exonucleolytic degradation These modifications have been reported to increase stability several thousand fold over native ribozymes, while the catalytic activity is only minimally impaired The ribozymes were synthesized with flanking substrate binding regions of varying length (between 6- 8 nts) which hybridize to the PS2 mRNA by base pairing The catalytic domain of the designed hammerhead ribozymes contained the minimal set of conserved ribonucleotides. Cloning of ribozyme DNA into plasmids and in vitro transcription. The DNA coding for the ribozyme rzl 173/13 3 was cloned into pBluescriptII/SK+ (Stratagene) The resulting plasmid pBSK+/PS2-rzl 173 13 3 (see Fig 4b) was transcribed in vitro using T7 poiymerase according to manufacturer's instructions (Clontech) and the purity of the ribozyme RNA was controlled by OD260/280 measurement and gel electrophoresis (20 % SDS-PAGE/ 8 M urea) For the tetracycline-regulated expression in HeLa cells, the DNA encoding a self-splicing ribozyme was attached directly at the 3' end of rzl 173/13 3 cDNA to generate pBSK+/PS2-rz 1173 13 3 auto (see Figs 4a, b) The rzl 173/13 3 auto DNA sequence was cloned into the tTA-responsive plasmid pUHD 10-3 to generate plasmid pUHD10-3/PS2-rzl l73 13 3auto (Fig 4b)

The prediction of secondary structure ofthe PS2 mRNA

The most probable secondary structure of the PS2 mRNA was determined by the method of Zuker et al (1989) by using the SQUIGGLES software included in the Wisconsin Sequence Analysis Package (Genetic Computer Group Inc )

[^•*2p/-labeling of substrate and ribozyme RNA

As RNA substrates for the in vitro cleavage reaction we used either short 16-17 base (b), 5'[32p]- labeled synthetic oligoribonucleotides or a 367 b long RNA substrate that was radioactively labeled upon in vitro transcription The phosphorylation reaction was carried out in a total of 20 μl containing 20 pmol synthetic substrate RNA 3 μl (lOμCi μl) [γ-³²P]-ATP, 2 μl lOx phosphorylation buffer, 13 μl H2O and 10 U polynucleotide kinase (Boehringer Mannheim) by incubation at 37°C for 1 hour For in vitro transcription, the plasmid pBSK+/PS2 Ncol (Fig 4b) was linearized with Xhol, phenol/ chloroform-extracted, and ethanol-precipitated In vitro transcription was carried out in 20 μl of a mixture containing lμl 10 mM GTP, lμl 10 mM ATP, lμl 10 mM UTP, 2 μl 10 x transcription buffer, 1 μl 0 2 M DTT, 1 μl RNase inhibitor (20 U), 5 μl -³²P-CTP (10 mCi ml), 1 μl 0 1 mM CTP, 5 μl H₂O, 1 μl (10 U) T7 RNA Poiymerase (in vitro transcription kit, Clontech) The reactions were incubated for 45 min at room temperature (RT) To degrade the template DNA, 1 μl RNase-free DNase I was added and incubated at 37°C for 30 min After phenol/chloroform extraction, both, the 5'[32p]-l_abeled synthetic as well as the in vitro transcribed, [32p]-l beled RNA substrates were purified by 20% SDS-PAGE/ 6M urea, eluted from the gel, precipitated and resuspended in DEPC water An aliquot was counted in a scintillation counter (Amersham) to determine the specific radioactivity

In vitro ribozyme cleavage assay

[32p]-l_abeled substrate RNA (20 OOOcpm/reaction) and ribozyme RNA were incubated in 50 mM Tris-HCl (pH 7 5) and 10 mM MgCl₂ for 5 min at 95°C followed by a 60 min incubation at 37°C Reactions were stopped by addition of formamide gel-loading buffer (80 % formamide, 10 mM EDTA pH 8 0, 0,002 % bromphenol blue and xylene cyanol) Substrates and cleavage product(s) were separated by electrophoresis on a 20 % SDS-polyacrylamide/ 6 M urea denaturing gel and detected by autoradiography (X-OMAT AR films, Kodak)

Cell culture, cell lines and DNA transfection

Cell culture Control cells and all transfected HeLa cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10 % heat-inactivated FCS, 100 units/ml penicillin, (100 μg) streptomycin and 1 mM L-glutamine at 37°C in humidified air atmosphere with 5 % CO₂

Cell lines. The HtTa cell line, stably stably transfected with the pUHD 15-1/neo DNA plasmid encoding the tetracycline-sensitive transactivator (tTA) of the "Tet-ofT' expression system (Gossen, M and Bujard, H 1992) The HtTa cell line was transfected with the plasmids pUHD10-3/PS2 wt (wildtype PS2), pUHD10-3/PS2 mut (mutant (N141V) PS2) or pUHDlO- 3/PS2-rzl l73 13 3auto (ribozyme rzl 173/13 3) to give rise to the double stable cell lines HtTA/PS2-wt 13, HtTA/PS2-mut 5, and HtTA/PS2-rzl l73 40, respectively DNA transfection Stable DNA transfections were performed by the calcium-phosphate precipitation method with 50 μg of purified DNA (Qiagen, Hilden) and 5 μg of pCEP4 plasmid DNA for hygromycin selection Hygromycin-resistant clones were obtained after 2 weeks of selection in medium containing 200 μg/ml hygromycin Individual cell clones were isolated, s expanded, and tested for either wildtype or mutant PS2 overexpression by Western blotting and immunocytochemistry using PS2-specific antibodies PS2 'knock-down' cell clones were identified by quantitation of the PS2 mRNA level (RNase protection assay, Boehringer Mannheim) and the PS2 protein level (immunoprecipitation/ Western blotting)

ιo Antibodies, immunoprecipitation and Western blotting

Antibodies. To recognize PS2, the following three antibodies were used polyclonal antibodies 3711 and 2972 raised against PS2/loop- and PS2/N-terminus-GST fusion proteins, respectively, monoclonal antibody BI.HF5C raised against the same PS2 loop - GST fusion protein as 3711 To recognize the C-terminus of PS1, the polyclonal antibody 3875 raised against a PSl/loop - i GST fusion protein, and the monoclonal antibody BI 3D7 raised against the same fusion protein were used The polyclonal antibodies were a kind gift of C Haass (Mannheim) For the analysis of poly(ADP-ribose) poiymerase (PARP) cleavage and caspase 3 activation, we used a polyclonal antibody against recombinant full-length PARP (Boehringer Mannheim) and a monoclonal antibody against the N-terminus of CPP32 (Transduction Laboratories), respectively

20 Immunoprecipitation. Cells that were grown in 6 cm2-dishes to confluence were lysed with a mixture of 50 mM Tris-HCl, pH 7 6, 150 mM NaCl, 2 mM EDT 0.2 % NP-40, 1 mM PMSF and 5 μg/ml leupeptin (buffer A) Immunoprecipitations were done with 3 μl of antibody 371 1 and 20 μl pre-washed protein A-Sepharose (Pharmacia) for 2 h at 4°C Immunoprecipitates were sequentially washed in buffer A, high salt buffer (buffer A with 500 mM NaCl) and in buffer A

25 containing 0 1 % SDS The precipitates were solubilized with 2x SDS sample buffer and electrophoresed on 12 % SDS-PAGE/ 6 M urea The proteins were blotted onto PVDF membranes for 1 h at 400 m and membranes were treated with antibodies according to the Western blotting protocol Western blotting. Cells were grown in 6 cm2-dishes to confluence Cell lysis were carried out in a so buffer containing 150 mM NaCl, 50 mM Tris-HCl, pH 7 6, 2 mM EDTA 0,2 % (v/v) NP40, 1 mM PMSF, and 5 μg/ml Leupeptine Triton X-100 and Nonidet P-40 were added to a final concentration of 1 % 30 μg of protein extract was loaded onto a 10-12 % SDS-PAGE and electrophoresed After blotting of proteins onto PVDF membranes for 1 h at 400 mA, filters were blocked with 5% low-fat milk powder in 10 mM Tris-HCl, 170 mM NaCl, pH 8 0 / 0 1 % Tween (TBST) at 4°C overnight After washing the filters with TBST, the membranes were probed with the primary antibodies in 5 % milk powder/ TBST at RT Following a washing step with TBST, filters were incubated for 1 h at RT with the peroxidase-conjungated secondary antibodies (Amersham) in 5 % milk powder/ TBST Chemiluminescence was detected using the ECL detection system (Amersham) and exposition to X-ray films (BioMax MR, Kodak)

RNA isolation and quantification by RNase protection assay

RNA isolation. mRNA isolation was carried out as described by the manufacturer's instructions (Boehringer Mannheim) Cells were grown in 75 cm2-culture flasks and washed twice with ice cold phosphate-buffered saline (PBS) (1,7 M KH₂PO , 5 mM Na₂HPO₄, 0,15 M NaCl, pH 7,4) Cells were trypsinized, pelleted by centrifugation, and lysed in 3 ml lysis buffer (0 1 M Tris-HCl, pH7 5, 0 3 M LiCl, 10 mM EDTA 1 % lithium dodecylsulfate, 5 mM DTT) The DNA was mechanically sheared by passing the extracts six times through a 21 gauge needle 1 5 ml of a biotin-labeled oligo (dT)20 probe was added and mixed with pre- washed 150 μl streptavidine magnetic particles After separating and washing of the generated biotin-streptavidine complex, the poly (A+)-selected mRMA was eluated with 25 μl H2O and its concentration measured RNAse protection assay (RPA) For RPA the plasmid pBSK+/PS2 Ncol was linearized with Xhol and in vitro transcription was carried out as described before with the T3 poiymerase RPAs were performed according to manufacturer's instructions (Boehringer Mannheim) Radioactively labeled antisense RNA probes (5x10^ cpm) were coprecipitated with 1 μg isolated mRNA in 30 μl hybridization buffer (40 mM Pipes (1,4-Pιperazindiethane-sulfoneacid), 400 mM NaCl, 1 mM EDTA, 80 % formamid, pH 6 4) and incubated at 45°C overnight The same amount of mRNA was incubated with 1 μl yeast tRNA (5 μg/μl) as control reaction After digestion with RNase A (5 μg/μl) and 2,5 μl RNase Tl (lOU/μL) for 30 min at 37°C, the protected RNA hybrid- fragments were extracted by phenol/chloroform/isoamyl-alcohol (25 24 1) After ethanol precipitation the fragments were resolved on 5 % SDS-polyacrylamide/8 M urea gels and exposed overnight at -80°C to X-Omat AR films (Kodak)

Induction and analysis of apoptosis

Induction of apoptosis- Apoptosis was induced in HeLa cells that were 80 % confluent Staurosporine was added at different concentrations for various periods After incubation, cells were tested for viability and apoptotic parameters Cell viability After apoptosis induction, cell viability was determined using Alamar Blue reduction assay In addition, cell membrane integrity was determine by measuring the LDH- release (Boehringer Mannheim)

Qualitative analysis of morphological changes of apoptotic cells Morphological changes of apoptotic cells were determined by labeling the cells with different dyes Cells were plated onto glass slides which were covered with poly-L-lysine (100 μg/ml, Sigma) and laminin (2 μl ml, Sigma). After incubation with staurosporine, cells were rinsed with PBS and stained with 20 μl of a mixture of 100 μg/ml acridine orange (Sigma) and 100 μg/ml ethidium bromide (Sigma) and viewed by fluorescence microscopy Apoptotic cells were scored based on characteristic changes of chromatin condensation and nuclear fragmentation Alternatively, staining with Hoechst 33258 (0 5 μg/ml) was carried out, and apoptotic cell nuclei were detected by fluorescence microscopy Quantitative analysis by ELISA. DNA fragmentation was measured by quantification of cytosolic oligonucleosome-bound DNA using a cell death detection ELISA kit (Boehringer Mannheim) following the manufacturer's instructions

Example 2

Ribozyme strategy for the 'knock-down ' ofPS2 mRNA

Requirement for cleavage activity of hammerhead ribozymes is the presence of a GUX (X=C,A,U) triplet in the target RNA (Haseloff and Gerlach, 1988, Ruffner et al , 1990) The hammerhead ribozymes consist of two domains, the substrate binding domain (i e the hybridization region (b)) and the catalytic domain or region (a) (Fig la) (Haseloff and Gerlach, 1988) They represent an advanced class of antisense oligonucleotides since they combine the substrate specificity of complementary nucleic acids with the potential not only to hybridize to but also to degrade susceptible substrate RNAs catalytically Due to their catalytic activity less ribozyme RNA molecules need to be present in the cell than antisense RNA molecules for an efficient 'knock-down' ofthe target mRNA

The PS2 mRNA was searched for potential GUX consensus sites (Fig lb) Several factors were taken into consideration when designing the most suitable PS2-cleaving ribozymes (l) the accessibility of the mRNA target sites for the ribozyme, (ii) the strength of the ribozyme-target RNA binding, and (iii) the stability of the ribozyme (i) To select the most accessible target sites of the PS2 mRNA the most probable mRNA secondary structures were calculated using the "mfold" software (described supra in Example 1, Zuker et al , 1989) (Fig lb) By that, three GUX triplets (GUU232, GUC308, and GUC1173, numbering of nucleotides according to EMBL Data Bank, Accession No L43964) were identified in open loop regions of the PS2 mRNA that should be accessible to ribozymes in v vo (Figs lb, lc) One of these ribozymes was targeted to the coding region of PS2, whereas two ribozymes were directed to the 5' untranslated region of the mRNA (Fig lc) For these three target sites, synthetic PS2-specific ribozymes (rz 232, 308, 1173) were designed for in vitro cleavage reactions (ii) It is known that the length of the substrate binding domain of a hammerhead ribozyme effects both its specificity and its turnover number However, strong interactions between a ribozyme and the substrate RNA can prevent rapid dissociation of the ribozyme following cleavage of the target that could significantly reduce the catalytic activity of the ribozyme The optimum length of the substrate binding domain has been reported to be in the order of 12-16 nucleotides In order to carefully select the most efficient ribozyme for cell culture experiments we designed ribozymes targeted to the same site in the PS2 mRNA but with flanking regions of various lengths (Fig lc). As a control for the specificity of the ribozyme reaction, we used a so-called 'antisense ribozyme' (i e. rz232/as-15 1) that comprises the exact sequence ofthe respective ribozyme, but carries mutations of conserved bases in the catalytic domain, thus disabling this ribozyme to cleave its target RNA Any effect on the PS2 protein level observed with the 'antisense-ribozyme' is related to an antisense effect rather than a ribozyme effect As a further control, we used a ribozyme with a randomized substrate binding sequence to evaluat non-specific effects (iii) To increase ribozyme stability in cell culture experiments, the synthetic ribozymes have been chemically modified (described supra in Example 1)

Selection ofthe most effective synthetic ribozyme in vitro

To study the cleavage activity of the ribozymes and to compare their efficiencies we started to optimize the in vitro ribozyme cleavage reaction (see Example 1) The magnesium dependence of the ribozyme reaction was determined (final concentration of 20 mM MgCl2 data not shown) and was in concordance with previous observations that hammerhead ribozymes have an absolute requirement for divalent metal ions, preferentially Mg2⁺ or Mn2⁺, in order to fulfil their cleavage activity (Uhlenbeck, 1987)

In vitro cleavage reactions for the selection of the most efficient ribozyme were carried out using different partial sequences of the PS2 mRNA as substrates (Fig lc), that were short 16-17 b in size, synthetic oligoπbonucleotides Each RNA substrate containing the GUC (rz308, rzl 173) or the GUU (rz232) tπnucleotide was targeted by appropriate ribozymes varying in the length ofthe flanking substrate binding domain (Fig la, c, 2a, length in bases indicated in numbers, i e 13 3, 12, 9) In standard in vitro cleavage reactions, we could detect the expected 5', end-labeled cleavage products of the RNA substrates (GUC1 173, GUC232, GUU308) (Fig. 2a) This was true for all active ribozymes (rz232, rz308, rzl 173) The synthetic ribozymes with the longer substrate binding domains ranging up to 15-16 b exhibited a higher in vitro cleavage activity than those with shorter flanking arms (Fig 2a) When the [32p]-l_abeled RNA substrates were incubated with the corresponding 'antisense ribozymes', no cleavage product was detected (Fig 2a) In addition, incubation of the RNA substrates without ribozyme did not give rise to a cleavage product (Fig 2a, lanes "-") We further analyzed the ribozyme target ratios required for efficient in vitro RNA cleavage for the three selected ribozymes rzl 173/13 3, rz232/15 1 and rz308/15 As shown in figure 2b, both, rzl 173/13 3 and rz308/15, cleaved the target PS2 RNA substrate at a molar ratio of ribozyme to target of 1 1 under standard in vitro cleavage conditions, though with a lower efficiency than at a greater molar excess of the ribozyme. In contrast, ribozyme rz232/15 1 cleavage products were only detectable, when the ribozyme was in a 50 fold molar excess over the target RNA (Fig 2b)

Since ribozyme rzl 173 very effectively cleaved the PS2 mRNA in the coding region, we selected this ribozyme for the PS2 'knock-down' in cultured cells and investigated the optimal length of its substrate binding domain in more detail (described supra in Example 1) Whereas rzl 173/13 3 (substrate binding domain 13 bases and 3 bases forming wobble base pairs with the target mRNA) produced significant amounts of the expected cleavage product within lh at a molar ribozyme target ratio of 1 1, much higher molar ratios were required when the binding domain was shortened to 9 bases (Fig 3a) Time course studies with ribozyme rzl 173/13 3 revealed that ribozyme-mediated target RNA cleavage could be detected already after 5 min of incubation (Fig 3b) After 6 h the RNA substrate was almost completely degraded (Fig 3b)

In vitro transcribed ribozyme rzll 73/13.3 also cleaves longer substrate RNAs

To ensure that ribozyme rzl 173 also cleaves longer substrate RNA molecules that might already adopt a secondary structure, we in vitro transcribed plasmid pBSK+/PS2 Ncol into a 367 b RNA and studied the cleavage of this substrate RNA by the in vitro transcribed ribozyme rzl 173/13 3auto (Fig 5) The autocatalytic ribozyme should be able to splice itself out of the initial transcπpt to generate ribozyme rzl 173 with a defined 3' end This approach was reported to keep the ribozyme in the nucleus, because of an inhibition of the transport into the cytoplasm, where it can directly act on newly transcribed substrate RNA (Liu and Carmichael, 1994) Calculations with the "mfold" software (described supra in Example 1) predicted the same secondary structure for the 367 b in vitro transcribed substrate RNA as for the same sequence stretch in the context of the full length PS2 mRNA Incubation of the substrate RNA (PS2 Ncol mRNA fragment) with increasing amounts of biosynthetic ribozyme rz 1 173/13.3 resulted in a cleavage of the target RNA into the predicted fragments of 259 and 108 bases (Fig 5) The cleavage ofthe longer RNA substrate was not as efficient as the cleavage of the shorter synthetic oligoribonucleotides (compare to Figs 2 and 3)

'Knock-down' of endogenous PS2 in a ribozyme expressing HeLa cell line

For the PS2 'knock-down' in cells we applied the inducible "Tet-off" expression system The efficacy of ribozyme rzl 173/13 3 in cells was first tested in transient transfection experiments HtTA cells transiently transfected with the plasmid pUHD10-3/PS2-rzl l73 13 3auto (Fig 4b) resulted in an about 30% reduction of PS2 mRNA (data not shown). We then produced over 49 clonal cell lines and analyzed their PS2 mRNA level in RNase protection assays (RPA) using the [32p]-i beled antisense PS2 Ncol mRNA fragment as probe The PS2 mRNA levels of a number of cell clones are shown in figure 6a The PS2 RNA contents of these clones were analyzed after complete induction of ribozyme expression by omission of doxycycline for 3 days The time course ofthe induction of ribozyme expression after the system was shut off with either 1 μg or 2 ng doxycycline/ml was experimentally determined in detail (data not shown) We selected clone 40 for further analyses and demonstrated the 'knock-down' of PS2 also on the protein level (Fig 6b) Expression of ribozyme rzl 173/13 3 resulted in an almost complete extinction of the PS2 protein 2 days after omission of doxycycline Although cells were continously cultivated under doxycycline-free conditions, the PS2 protein, surprisingly, returned to basal level within 2 weeks (Fig 6b) Therefore, further functional analyses in PS2 k d cells were performed 2 days after doxycycline omission

Apoptosis sensitivity is decreased in PS2 'knock-down' cells and increased in cells overexpressing wildtype or mutant PS2

It has been reported in the literature that wildtype and mutant PS2 have a proapoptotic potential, when overexpressed in various cell lines (Deng et al , 1996, Vito et al , 1996, Wolozin et al , 1996, Janicki et al , 1997) Furthermore, cells expressing mutant forms of PS2 show an increased sensitivity to apoptotic stimuli compared to wildtype PS2 expressing cells (Wolozin et al , 1996, Janicki et al , 1997) To address the question whether PS2 is actively involved in apoptosis, we studied the sensitivity of PS2 k d HeLa cells to staurosporine compared HeLa cells inducibly overexpressing wildtype and mutant PS2 The level of induced PS2 expression was determined by immunocytochemistry (Fig 7a) and biochemical analyses (data not shown) Various methods were used to assess apoptosis, including fluorescence microscopy, cell death detection ELISA caspase 3 activation, and proteolytic cleavage of PARP and PS2 For determination of cell viability, Alamar Blue reduction and LDH release was measured

Apoptosis was induced by increasing concentrations of staurosporine Cells were incubated with an ethidiumbromide/ acridine orange mixture that staines living cells green Apoptotic cells showed a characteristic chromatin condensation, nuclear fragmentation and the generation of apoptotic bodies, and their chromatin was stained orange upon ethidiumbromide intercalation (Fig 7b) In the absence of an apoptotic stimulus, no apoptotic cells could be detected in the PS2 'knock-down' cells (PS2 k d ) and in the wildtype (PS2 wt) or mutant PS2 (PS2 mut) overexpressing cells (Fig 7b, lane K) At very low concentrations of staurosporine (1 pM), apoptotic cells appeared in the PS2 wt and PS2 mut cultures, with a higher frequency of apoptotic cells in the PS2 mut cell line (Fig 7b) No apoptotic cells were observed at the same staurosporine concentration in the PS2 k d cell line (Fig 7b). Higher concentrations of staurosporine yielded a comparable number of apoptotic cells in the PS2 wt and PS2 mut cultures (Fig 7b). In the ribozyme-mediated PS2 k d cells only the highest concentration of staurosporine (1 nM) resulted in the occurence of apoptotis Thus, the sensitivity of HeLa cells to the apoptotic stimulus, staurosporine, is dependent on the PS2 expression level The N141V PS2 mutation caused an earlier onset, rather than an increase in the extent of cell death Interestingly, the PS2 'knock-down' resulted in a significant reduction of apoptosis sensitivity Similar data were obtained when cells were stained with Hoechst 33258 to visualize apoptotic cells (data not shown)

Since visualization of apoptotic cells with ethidiumbromide/ acridine orange staining is not a quantitative method, we applied a cell death detection ELISA that determines mono- and oligonucleosomes in the cytoplasmic fraction of cell lysates (Fig 8 a) In addition, cell viability was assessed using an Alamar Blue reduction assays (Fig 8b) To distinguish between apoptosis and necrosis, the release of LDH was measured (Fig 8c) As shown in figure 8a, PS2 wt and PS2 mut cells exhibited a more pronounced response to subtoxic concentrations of staurosporine ( 1 - 100 pM) than HeLa cells expressing endogenous PS2 levels At higher concentrations of staurosporine (>lnM), secondary necrosis set in, and the difference between these cell lines became blurred A lower degree of apoptosis (Fig 8a) together with the increased LDH release (Fig 8c) clearly indicated that at staurosporine concentrations >10 nM, necrosis instead of apoptosis was the prevailing mode of cell injury

The ELISA results reflected the marked resistance of PS2 k d cells to apoptosis stimulation by 1 pM - 1 nM staurosporine, compared to cells expressing normal levels of PS2 (Fig 8a) In this concentration range, staurosporine had no significant effect on cell viability (Fig 8b)

The PS2 expression level does not affect the kinetics of caspase 3 activation and PARP cleavage

To establish whether PS2 'knock-down' or overexpression changes the kinetics of processes characteristic of the execution phase of apoptosis, we studied the time-course of caspase 3 activation and poly(ADP)ribose poiymerase (PARP) cleavage following the induction of apoptosis with 1 μM staurosporine It is known that the final step in the cascade of protease activation during apoptosis is the activation of caspase 3 that in turn leads to the cleavage of specific proteins that either are actively involved in the apoptosis or just 'innocent bystanders' (Martin and Green, 1995, Alnemri et al , 1996, Chinnaiyan and Dixit, 1996) Kim et al (Science 1997, 277 373-376) and Loetscher et al (1997) reported that presenilin 1 and 2 are both cleaved during apoptosis by a protease that belongs to the caspase 3 protease family The caspase 3, or CPP32, is activated by cleavage into two proteolytic fragments (17 and 10 kDa in size) The antibody used for immunoprecipitation of caspase 3 recognizes the uncleaved CPP32-holoenzyme and the 17 kDa fragment, but not the 10 kDa C-terminal fragment (example shown in Fig 9a) No difference in caspase 3 activation following induction of apoptosis could be detected between PS2 wt, PS2 mut and PS2 k d cells (Fig 9b) PARP constitutes one downstream target of activated caspase 3 and is cleaved into two proteolytic fragments, 85 and 27 kDa in size (Kim et al , Science 1997, 277 373-376) Therefore, PARP is quite often used as marker for apoptosis (example shown in Fig 10a) We then analyzed the kinetics of PARP cleavage in the three HeLa cell lines Again, there was no significant difference in the time-course of the appearance of the proteolytic PARP fragments (Fig 10)

Normal proteolytic, not alternative PS2 fragments seemed to be directly involved in apoptosis

The 'knock-down' of endogenous PS2 resulted in a marked inhibition of apoptosis 18 h after the induction with subtoxic staurosporine concentrations (Figs 7 and 8) On the other hand, no difference could be observed between the ribozyme-mediated PS2 k d cell line and control cells regarding the kinetics of caspase 3 activation and PARP cleavage using 1 μM staurosporine in time-course experiments (Figs 9 and 10) The analysis of CTF generation in the course of cell death revealed that the PS2 k d reduced both, the normal proteolytic PS2 fragments and also the alternative PS2 fragments (Fig 11a) The generation of CTF _jg occured at earlier time points in the PS2 mut than in the PS2 wt cultures, pointing to an earlier onset of apoptosis caused by the N141V mutation in PS2 (compare to Fig 7b) The presence or absence of the PS2 alternative fragments can account for the difference in the sensitivity to an apoptotic stimulus (Fig l ib), arguing for a direct involvement of the alternative fragments in the execution of apoptosis Another implication of our findings would be that the 'knock-down' of endogenous normal PS2 CTF22 renders cells less vulnerable to apoptotic stimuli suggesting normal CTF22 as active mediator of cell death In order to address the question whether normal or alternative PS2 fragments are actively involved in programmed cell death, we analyzed fragment formation at subtoxic staurosporine concentrations (Fig 12) Surprisingly, at low concentrations of the apoptotic stimulus, at which cells clearly underwent apoptosis without loss of cell viability and at which PS2 'knock-down' exerted a strong inhibitory effect on apoptosis (see Fig 8), no alternative CTFi g generation could be observed This finding speaks against an active role of the alternative PS2 fragments in the apoptotic cascade and rather suggests that the normal endoproteolytic cleavage products are active mediators of programmed cell death

References

Alnemri, ES, Livingston, DJ, Nicholson, DW, Salvesen, G, Thornberry, NA, Wong, WW, and Yuan, JY (1996) Human ICE/CED-3 protease nomenclature Cell 87, 171

Beaton et al (1991), in Eckstein, F (ed ) Oligonucleotides and analogues - A practical approach - Oxford, JRL Press, 109-135

Been MD (1994) Cis- and trans-acting ribozymes from a human pathogen, hepatitis delta virus Trends Biochem Sci 19, 251-256

Boado RJ, Tsukamoto H, Pardridge WM (1998) Drug delivery of antisense molecules to the brain for treatment of Alzheimer' s disease and cerebral AIDS J Pharm Sci 87 1308-1315 Borchelt DR, Thinakaran G, Eckman CB, Lee MK, Davenport F, Ratovitsky T, Prada CM, Kim G, Seekins S, Yager D, Slunt HH, Wang R, Seeger M, Levey Al, Gandy SE, Copeland NG, Jenkins N Price DL, Younkin SG (1996) Familial Alzheimer's disease-linked presenilin 1 variants elevate ABetal-42/1-40 ratio in vitro and in vivo Neuron 17, 1005-1013

Borchelt DR, Ratovitski T, Van Lare J, Lee MK, Gonzales V, Jenkins N Copeland NG, Price DL, Sisodia SS (1997). Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins Neuron 19, 939-945

Chartier-Harlin, MC, Crawford, F, Houlden, H, Warren, A, Hughes, D, Fidani, L, Goate, A Rossor, M, Roques, P, Hardy, J, and Mullan, M (1991) Early-onset Alzheimer's disease caused by mutations at codon 717 ofthe beta amyloid precursor protein gene Nature 353, 844-846

Chinnaiyan, AM, and Dixit, VM (1996) The cell-death machine Curr Biol 6, 555-562

Deng GM, Pike CJ, Cotman CW (1996) Alzheimer-associated presenilin-2 confers increased sensitivity to apoptosis in PC12 cells FEBS Lett 397, 50-54

Duff K, Eckman C, Zehr C, Yu X, Prada CM, Perez-Tur J, Hutton M, Buee L, Harigaya Y, Yager D, Morgan D, Gordon MN, Holcomb L, Refolo L, Zenk B, Hardy J, Younkin S (1996) Increased amyloid-Beta42(43) in brains of mice expressing mutant presenilin 1 Nature 383, 710- 713

Eckstein F (1985) Nucleoside phosphorothioates Annu Rev Biochem 54, 367-402

Fraley R and Papahadjopoulos D (1981) New generation liposomes - The engineeπng of an efficient vehicle for intracellular delivery of nucleic acids Trends Biochem Sci 6, 77-80

Goate, Chartier-Harlin, MC, Mullan, M, Brown, J, Crawford, F, Fidani, L, Giuffra, L, Haynes, A Irving, N, James, L, et al (1991) Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease Nature 349, 704-706 Gossen M, and Bujard H (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promotors Proc Natl Acad Sci USA 89, 5547-5551

Hampel Tritz R, Hicks M, Cruz P (1990) 'Haiφin' catalytic RNA model evidence for helices and sequence requirement for substrate RNA Nucleic Acids Res 18, 299-304

Haseloff, J, and Gerlach, WL (1988) Simple RNA enzymes with new and highly specific endoribonuclease activities Nature 334, 585-591

Hendriks, L, van Duijn, CM, Cras, P, Cruts, M, Van Hul, W, van Harskamp, F, Warren, Mclnnis, MG, Antonarakis, SE, Martin, JJ, et al (1992) Presenile dementia and cerebral haemorrhage linked to a mutation at codon 692 of the beta-amyloid precursor protein gene Nature Genet 1, 218-221

Janicki S, Monteiro MJ (1997) Increased apoptosis arising from increased expression of the Alzheimer's disease-associated presenilin-2 mutation (N141I) J Cell Biol 139, 485-495

Jarrett, JT, Berger, ET, and Lansbury, PT (1993) The carboxy terminus of the beta amyloid protein is critical for the seeding of amyloid formation implications for the pathogenesis of Alzheimer's disease Biochemistry 32, 4693-4697

Jarvis TC, Wincott FE, Alby LJ, McSwiggen JA, Beigelman L, Gustofson J, DiRenzo Levy K, Arthur M, Matu c-Adamic J, Karpeisky A, Gonzalez C, Woolf TM, Usman N, and Stinchcomb DT (1996) Optimizing the cell efficacy of synthetic ribozymes J Biol Chem 271, 29107-29112

Joyce (1992) In Murray J A H (Ed ,) Antisense RNA and DNA, Wiley-Liss, New York 353-

372

Kim TW, Pettmgell WH, Jung YK, Kovacs DM, Tanzi RE (1997) Alternative cleavage of Alzheimer-associated presenilins during apoptosis by a caspase-3 family protease Science 277, 373-376 Kim TW, Pettingell WH, Hallmark OG, Moir RD, Wasco W, and Tanzi RE (1997) Endoproteolytic cleavage and proteasomal degradation of presenilin 2 in transfected cells J Biol Chem 272, 1 1006-11010

Koizumi M, Hayase Y, Iwai S, Kamiya H, Inoue H, Ohtsuka E (1989). Design of RNA enzymes distinguishing a single base mutation in RNA Nucleic Acids Res 17, 7059-7071

Koizumi M, and Ohtsuka E (1992) In Murray J A H (Ed ), Antisense RNA and DNA Wiley- Liss, New York, 373-381

Levy-Lahad E, Wasco W, Poorkaj P, Romano DM, Oshima J, Pettingell WH, Yu CE, Jondro PD, Schmidt SD, Wang K, Crowley AC, Fu Y, Guenette SY, Galas D, Nemens E, Wijsman EM, Bird TD, Schellenberg GD, Tanzi RE (1995) Candidate gene for the chromosome 1 familial Alzheimer's disease locus Science 269, 973-977

Lisziewicz J, Sun D, Smythe J, Lusso P, Lori F, Louie Markham P, Rossi J, Reitz M, Gallo RC (1993) Inhibition of human immunodeficiency virus type 1 replication by regulated expression of a polymeric Tat activation response RNA decoy as a strategy for gene therapy in AIDS Proc Natl Acad Sci USA 90, 8000-8004

Liu Z, and Carmichael GG (1994) Nuclear antisense RNA Mol Biotechnol 2, 107-118

Loetscher H, Deuschle U, Brockhaus M, Reinhardt D, Nelboeck P, Mous J, Gruenberg J, Haass C, Jacobsen H (1997) Presenilins are processed by caspase-type proteases J Biol Chem 272. 20655-20659

Mann, DMA, Iwatsubo, T, Cairns, NJ, Lantos, PL, Nochlin, D, Sumi, SM, Bird, TD, Poorkay, P, Hardy, J, Hutton, M, Prihar, G, Crook, R, Rossor, MN, and Haltia, M (1996) Amyloid beta protein (Abeta) deposition in chromosome 14-linked Alzheimer's disease predominance of Abeta42(43) A n ^eurol 40, 149-156

Mannino RJ, and Gould-Fogerite S (1988) Liposome mediated gene transfer BioTechniques 6, 682-690 Marcus-Sekura, CJ (1988) Techniques for using antisense ohgodeoxyribonucleotides to study gene expression Anal Biochem 172, 289-295

Martin, SJ, and Green, DR (1995) Protease activation during apoptosis death by a thousand cuts Cell 82, 349-352

Miller et al (1991), in Eckstein, F (ed ) Oligonucleotides and analogues - A practical approach - Oxford, JRL Press, 137-154

Morgan RA, and Anderson WF (1993) Human gene therapy Annu Rev Biochem 62, 191-217

Mullan, M, Crawford, F, Axelman, K, Houlden, H, Lilius, L, Winblad, B, and Lannfelt, L (1992) A pathogenic mutation for probable Alzheimer's disease in the APP gene at the N-terminus of beta-amyloid Nature Genet 1, 345-347

Murrell, J, Farlow, M, Ghetti, B, and Benson, MD (1991) A mutation in the amyloid precursor protein associated with the hereditary Alzheimer disease with a guanine to thymine missence change at position 1924 ofthe APP gene Science 254, 97-99

Paolella G, Sproat BS, Lamond Al (1992) Nuclease resistant ribozymes with high catalytic activity EMBO J 11, 1913-1919

Pieken WA Olsen DB, Benseler F, Aurup H, Eckstein F (1991) Kinetic characterization of ribonuclease-resistant 2'-modified hammerhead ribozymes Science 253, 314-317

Podlisny, MB, Citron, M, Amarante, P, Sherrington, R, Xia, W, Zhang, J, Diehl, T, Levesque, G, Fraser, P, Haass, C, Koo, EH, Seubert, P, St George-Hyslop, P, Teplow, DB, and Selkoe. DJ (1997) Presenilin proteins undergo heterogenous endoproteolysis between Thr291 and Ala299 and occur as stable N- and C-terminal fragments in normal and Alzheimer brain tissue Neurobiol Dis 3, 325-337 Rogaev El, Sherrington R, Rogaeva EA, Levesque G, Ikeda M, Liang Y, Chi H, Lin C, Holman K, Tsuda T, Mar L, Sorbi S, Nacmias B, Piacentini S, Amaducci L, Chumakov I, Cohen D, Lannfelt L, Fraser PE, Rommens JM, St George-Hyslop PH (1995) Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene Nature 376, 775-778

Rossi JJ (1993) Introductory remarks on the general application of antisense RNAs and ribozymes Methods 5, 1-5

Ruffner, DE, Stormo, GD, and Uhlenbeck, OC (1990) Sequence requirements of the hammerhead RNA self-cleavage reaction Biochemistry 29, 10695-10702

Sambrook et al (1989) Molecular Cloning A Laboratory Manual, 2^nd ed , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York

Scheuner D, Eckman C, Jensen M, Song X, Citron M, Suzuki N, Bird TD, Hardy J, Hutton M, Kukull W, Larson E, Levy-Lahad E, Viitanen M, Peskind E, Poorkaj P, Schellenberg G, Tanzi R, Wasco W, Lannfelt L, Selkoe D, Younkin S (1996) Secreted amyloid Beta-protein similar to that in the senile plaques of Alzheimer's disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer's disease Nature Med 2, 864-870

Sherrington R, Rogaev El, Liang Y, Rogaeva E Levesque G, Ikeda M, Chi H, Lin C, Li G, Holman K, Tsuda T, Mar L, Foncin J, Bruni AC, Montesi MP, Sorbi S, Rainero I, Pinessi L, Nee L, Chumakov I, Pollen D, Brookes Sanseau P, St George-Hyslop PH (1995) Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease Nature 375, 754-760

Symons RH (1992) Small catalytic RNAs Annu Rev Biochem 61, 641-671

Thinakaran, G, Borchelt, DR, Lee, MK, Slunt, HH, Spitzer, L, Kim, G, Ratovitzky, T, Davenport, F, Nordstedt, C, Seeger, M, Hardy, J, Levey, Al, Gandy, SE, Jenkins, N Copeland, NG, Price, DL, and Sisodia, SS (1996) Endoproteolysis of presenilin 1 and accumulation of processed derivates in vivo Neuron 17, 181-190 Thomson JB, Tuschl T, Eckstein F (1993) Activity of hammerhead ribozymes containing non- nucleotidic linkers Nucleic Acids Res 21, 5600-5603

Vito P, Wolozin B, Ganjei JK, Iwasaki K, Lacana E, and D'Adamio L (1996) Requirement ofthe familial Alzheimer's disease gene PS2 for apoptosis J Biol Chem 271, 31025-31028

Weintraub HM (1990) Antisense RNA and DNA Scientific American, 262, 34-40

Wolozin B, Iwasaki K, Vito P, Ganjei JK, Lacana E, Sunderland T, Zhao B, Kusiak JW, Wasco W, D'Adamio L (1996) Participation of presenilin 2 in apoptosis enhanced basal activity conferred by an Alzheimer mutation Science 274, 1710-1713

Wu HN, Lee JY, Huang HW, Huang YS, Hsueh TG (1993) Mutagenesis analysis of a hepatitis delta virus genomic ribozyme Nucleic Acids Res 21, 4193-4199

Yamada O, Yu M, Yee JK, Kraus G, Looney D, Wong-Staal F (1994) Intracellular immunization of human T cells with a haiφin ribozyme against human immunodeficiency virus type 1 Gene Ther 1, 38-45

Yu M, Ojwang J, Yamada O, Hampel Rapapport J, Looney D, Wong-Staal F (1993) A hairpin ribozyme inhibits expression of diverse strains of human immunodeficiency virus type 1 Proc Natl Acad Sci USA 90, 6340-6344 [published erratum appears in Proc Natl Acad Sci USA (1993) 90, 8303]

Yuan Y, Altman S (1994) Selection of guide sequences that direct efficient cleavage of mRNA by human ribonuclease P Science 263, 1269-1273

Zuker M (1989) Computer prediction of RNA structure Methods Enzymol 180, 262-288

Claims

claims

1 Substance capable of inhibiting presenilin 2 expression in neurodegenerative diseases

2 Substance capable of inhibiting presenilin 2 expression in Alzheimer's disease

3 Substance capable of inhibiting presenilin 2 expression in familiar Alzheimer's disease

4 Substance according to any one of the claims 1 to 3 consisting of an anti-sense oligonucleotide

5 A ribozyme capable of cleaving presenilin 2-specific mRNA

6 A ribozyme according to claim 5, wherein the ribozyme comprises a catalytical region (a) and at least one hybridization region (b) with the hybridization region (b) essentially being complementary to a region ofthe mRNA that is transcribed from the presenilin 2 gene

7 A ribozyme according to claim 5 or 6, wherein the hybridization region (b) consists of two domains flanking the catalytic region (a) and is essentially complementary to the target nucleic region so as to be capable of binding all mRNAs that are transcribed from the presenilin 2 gene

8 Ribozyme according to any one of claims 5 to 7, wherein the catalytical region (a) and the hybridization region (b) are represented by the following general formula'

(b) (a) (b)

5' [N_3-2o] [CUGANGARNo,₃₀SGAAA] [N_3-20] 3', wherein N is G, C, A or U, R is a purine, and S is a pyrimidine, and wherein the central region No-₃o of sequence (a) can be replaced by a linker which is different from nucleic acid

9 Ribozyme according to any one of claims 5 to 8, wherein the ribozyme contains the following nucleotide sequence (5 'to 3')

CUGAUGAXXXXYYYYZZZZGAAAC wherein

CUGAUGA and GAAAC are conserved nucleotide sequences,

X is any nucleotide selected from A, G, C and U which is complementary to Z, so that G is paired with C and A is paired with U or C is paired with G and U is paired with A or C is paired with G and U is paired with A,

Y is any nucleotide selected from A, G, C and U,

Z is any nucleotide selected from G, C and U which is complementary to X, so that G is paired with C and A is paired with U or C is paired with G and U is paired with A or C is paired with G and U is paired with A

10. A ribozyme according to any one of claims 5 to 9, wherein the ribozyme is a hammerhead-, hairpin- or axehead-ribozyme.

11. Ribozyme according to any one of claims 5 to 10, wherein the ribozyme cleaves downstream ofthe 3' end ofthe GUU232 site of presenilin 2-specific RNA.

12. Ribozyme according to any one of claims 5 to 10, wherein the ribozyme cleaves downstream ofthe 3' end ofthe GUC308 site of presenilin 2-specific RNA.

13. Ribozyme according to any one of claims 5 to 10, wherein the ribozyme cleaves downstream ofthe 3' end ofthe GUC1 173 site of presenilin 2-specific RNA.

14. Ribozyme according to any one of claims 5 to 13, wherein the ribozyme is a fusion-ribozyme comprising a presenilin 2-specific ribozyme and an autocatalytical hammerhead-ribozyme fused with its 5' end to the 3' end ofthe presenilin 2-specific ribozyme.

15. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof UUCUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGCG

16. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAG

17. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof UUGGCUGAUGAGGCCGUGAGGCCGAAACAC

18. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAA

19. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof UGGUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUCG

20. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof GUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGU

21. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof UUUUCUGAUGAGGCCGUUAGGCCGAAACACGU

22. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof: GAAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGG

23. Ribozyme according to any one of claims 5 to 14, wherein said ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof: GAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUG

24. Ribozyme according to any one of claims 5 to 23, wherein the autocatalytical hammerhead- ribozyme comprises the following nucleotide sequence (5' to 3') or a bioequivalent thereof: GAUCCGUCGACGGACUCGAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGA UC

25. Ribozyme having the sequence UUCUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGCG or

CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAG or

UUGGCUGAUGAGGCCGUGAGGCCGAAACAC or

CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAA or

UGGUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUCG or

GUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGU or

UUUUCUGAUGAGGCCGUUAGGCCGAAACACGU or

GAAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGG or

GAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUG or

GAUCCGUCGACGGACUCGAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGA UC or

UUCUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGCGGAUCCGUCGACGGAC UCGAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAGGAUCCGUCGACGGACUCGA GUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

UUGGCUGAUGAGGCCGUGAGGCCGAAACACGAUCCGUCGACGGACUCGAGUCC GUCCUGAUGAGUCCGUGAGGACGAAACGGAUC or

CUUUGGCUGAUGAGGCCGUGAGGCCGAAACACAAGAUCCGUCGACGGACUCGA GUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUC or

UGGUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUCGGAUCCGUCGACGGAC UCGAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

GUUUUUCUGAUGAGGCCGUUAGGCCGAAACACGUGAUCCGUCGACGGACUCGA

GUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

UUUUCUGAUGAGGCCGUUAGGCCGAAACACGUGAUCCGUCGACGGACUCGAGU CCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

GAAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGGGAUCCGUCGACGGACU CGAGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUCor

GAUCCCGCUGAUGAGGCCGUUAGGCCGAAACCUUGGAUCCGUCGACGGACUCG AGUCCGUCCUGAUGAGUCCGUGAGGACGAAACGGAUC.

26. A recombinant DNA molecule coding for any one ofthe ribozymes of claim 5 to 25

27 A recombinant cDNA molecule coding for any one ofthe ribozymes of claim 5 to 25

28 A recombinant vector comprising the cDNA corresponding to any one of the ribozymes of claim 5 to 25.

29. A recombinant vector comprising the cDNA corresponding to any one of the ribozymes of claim 5 to 23 fused to the cDN A sequence corresponding to the ribozyme of claim 24

30. A host cell comprising the recombinant vector of claim 28 or 29

31. Pharmaceutical composition comprising a substance or a ribozyme or a DNA molecule or a recombinant vector according to any one of claims 1 to 29 and a pharmaceutically acceptable carrier therefor.

32. Use of a substance or a ribozyme or a DNA molecule or a recombinant vector according to any one of claims 1 to 29 in the manufacture of a medicament for the treatment of neurodegenerative diseases.

33. Use of a substance or a ribozyme or a DNA molecule or a recombinant vector according to any one of claims 1 to 29 in the manufacture of a medicament for the treatment of Alzheimer's disease.

34. Use of a substance or a ribozyme or a DNA molecule or a vector according to any one of claims 1 to 29 in the manufacture of a medicament for the treatment of familiar Alzheimer's disease.

35. Process for the production of a ribozyme according to any one of claims 5 to 25, characterized that a DNA molecule according to any one ofthe claims 26 to 29 is expressed in a host.

36. Process for the production of a ribozyme according to any one of claims 5 to 25, characterized that a DNA molecule according to any one ofthe claims 26 to 29 is synthesized in an automatic synthesizer.