WO1997043404A2

WO1997043404A2 - Ribozyme variants with improved catalytic activity under low magnesium conditions

Info

Publication number: WO1997043404A2
Application number: PCT/US1997/008101
Authority: WO
Inventors: Martin Zillman
Original assignee: Hybridon, Inc.
Priority date: 1996-05-13
Filing date: 1997-05-13
Publication date: 1997-11-20
Also published as: AU3005697A; WO1997043404A3

Abstract

Disclosed are ribozyme variants and structures making up the catalytic portions of ribozyme variants having enhanced catalytic activity under no turnover conditions in the presence of less than or equal to 10 millimolar concentrations of magnesium. Also disclosed are plasmids encoding such variants, and methods of controlling the expression of a target RNA molecule and of site-specifically cleaving a single-stranded, RNA-containing substrate molecule using such variants.

Description

RIBOZYME VARIANTS WITH IMPROVED CATALYTIC ACTIVITY UNDER LOW MAGNESIUM CONDITIONS

FIELD OF THE INVENTION

This invention relates to the control of gene ^■"""" expression through the~ degradation of mRNA. This invention also relates to nucleotidic molecules with endonucleolytic activity useful in the site- specific cleavage of RNA under physiological conditions.

BACKGROUND OF THE INVENTION

Ribozymes having the hammerhead catalytic core originally described by Forster and Symons (Forster et al . (1987) Cell 49:211-220) have been used for several years to modulate gene expression by reducing target messenger RNA levels (for review, see Stull et al. (1995) Pharm, Res. 12;465- 483) . These molecules require divalent cation binding for catalysis. As pharmaceuticals, ribozymes have suffered from several shortcomings: RNA is inherently less stable than DNA; endogenous ribozymes administered to a subject may be subjected to nucleolytic attack before reaching the target cell; and the activity of hammerhead ribozymes is greatly diminished under the low concentrations of free magnesium ion (about 0.1 mM to 5 mM) present physiologically (Romani et al. (1992) Arch. Biochim. Biophys. 298:1-12) .

A number of groups have addressed the first and second points, primarily through chemical modification of the ribozyme core and flanking sequences. Modifications have included the inclusion of deoxyribonucleotides (Takashi et al. (1993) Nuc. Acids Res. 21:2605-2611), phosphorothioate internucleotide linkages (Takashi et al. (1993) Nuc. Acids Res. 21:2605-2611), 2'-0-allyl- and 2 ' -O- methylribonucleotides (Paolella et al . (1992) EMBO J. 11:1913-1919; and Beibelman et al . (1995) J. Biol. Chem. 270:25702-25708), and 2 ' -amino- and 2'- fluororibonucleotides (Heidenreich et al . (1994) J. Biol. Chem. 269:2131-2138) .

Other modifications of reducing the length of the stem-loop II structure of the hammerhead ribozyme have been made in an effort to design a more stable molecule without reducing its catalytic activity. For example, Goodchild et al .

(Arch. Biochem. Biophys. (1991) 284:386-391) replaced stem II and loop II with shorter nucleotide sequences. Tuschl et al . {Proc. Natl. Acad. Sci. (USA)

(1993) 90:6991-6994) prepared hammerhead ribozymes with the stem II shortened to two base pairs, closed by a four base-pair loop. McCall et al.

( Proc. Natl. Acad. Sci. (USA) 89:5710-5714) replaced the stem-loop with a few nucleotides that cannot form Watson-Crick base pairs between themselves, and/ or substituted the stem-loop II and flanking arms with DNA, without reducing activity. WO 96/00232 (Gene Shears) disclose ribozymes with stems optimized for cleavage in the presence of at least 10 mM magnesium under turnover conditions and having at least two base pairs in stem-loop II. Modifications in ribozyme structure have also included the substitution or replacement of various stem-loop II portions of the molecule with non-nucleotidic molecules. For example, Benseler et al. (J. Am. Chem. Soc. (1993) 115:8483-8484) disclose hammerhead-like molecules in which two of the base pairs of stem II, and all four of the nucleotides of loop II have been replaced with non-nucleoside linkers based on hexaethylene glycol, propanediol, bis (triethylene glycol) phosphate, tris (propanediol)bisphosphate, or bis (propanediol) phosphate. Ma et al. (Biochem.

( 1993 ) 32 : 1751-1758 ; Nucleic Acids Res. ( 1993 ) 21 : 2585-

2589) replaced the six nucleotide loop of the TAR ribozyme hairpin with non-nucleotidic, ethylene glycol-related linkers. Thomson et al. (Nucleic Acids Res. (1993) 21:5600-5603) replaced loop II with linear, non-nucleotidic linkers of 13, 17, and 19 atoms in length.

However, while increasing the stability of ribozymes, these modifications have also generally reduced catalytic efficiency in 10 mM to 20 mM magnesium, and would be expected to further reduce cleavage under physiological conditions.

Thus, what is still needed are molecules with improved endonucleolytic activity and nuclease resistance under physiological conditions including less than 10 millimolar concentrations of magnesium.

SUMMARY OF THE INVENTION

It is known that hammerhead ribozymes with ^"""" short flanking regions (i.e., having 5 to 10 bases each) do not cleave target RNA particularly efficiently or at fast rate in the presence of 1 mM magnesium, the approximate concentration of free magnesium in the cell. However, it has been discovered that destabilization of the stem-loop II of a ribozyme, for example, by shortening it, improves the rate of chemical cleavage in 1 mM magnesium. This discovery has been exploited to develop the present invention, which includes ribozyme variants that have improved or "enhanced" catalytic activity under low magnesium conditions. These molecules are useful as RNA-specific restriction endonucleases, and as such, in combination with RNA ligases, allow for the preparation of recombinant RNA molecules.

In one aspect, the present invention provides a "ribozyme variant" or ribozyme-like RNA- containing molecules having enhanced endonucleolytic activity under no "turnover conditions" in the presence of less than 11 mM magnesium. This ribozyme variant has a structure similar to a hammerhead ribozyme, but in contrast, it has a shortened region called the "stem-loop II" made up of from one to six 3' to 5' covalently linked nucleotides. The ribozyme variant of the invention includes a stem-loop II (or helix II) having a 3' terminus and a 5 ' terminus and comprising a stem region and a loop region. The loop region of the helix II is covalently linked to the stem region at its 3 ' and 5 ' termini and comprises a plurality of 3 ' to 5 ' covalently-linked nucleotides. As used herein, the terms "stem-loop II" and "helix II" refer to the double-stranded, coiled, helical structure in hammerhead ribozymes having at one end a single-stranded loop, as described by Haseloff et al. (Nature (1988) 334:585-591) . The stem region also has a 3 ' terminus and 5 ' terminus and includes one to six covalently linked nucleotides. In one embodiment, the stem-loop II contains one nucleotide. In another embodiment, the stem-loop II has the nucleotide sequence 5'- CGUUAG-3 ' or 5 ' -GCGUUAGC-3 ' . Another embodiment has a loop portion comprising 3 or 4 nucleotides. In another embodiment, the stem-loop II contains two nucleotides which are self hybridizing. In yet another embodiment, the stem loop is made up of six nucleotides, two of which are self- hybridizing. In another embodiment the stem-loop II contains four nucleotides, two of which are self hybridizing. In one specific embodiment, the stem loop has the nucleotide sequence 5 ' -CGUG-3 ' .

As used herein, the term "self-hybridizing" refers to nucleotides in the stem region of the stem-loop II which are complementary to each other, and which form normal Watson-Crick base pairs. This stem region has two complementary nucleotidic strands which include at least one nucleotide on one stand and one nucleotide on the other strand which base pair together.

The ribozyme variant further includes first and second catalytic core regions, each comprising a plurality of 3 ' to 5 ' covalently-linked nucleotides, and each having a 3 ' terminus and a 5' terminus. The 3¹ terminus of the first catalytic core region is covalently linked to the 5' terminus of the stem region, and the 5' terminus of the second catalytic core region is covalently linked to the 3 ' terminus of the stem region. The first core region has the nucleotide sequence 5 ' -CUGANGAG-3 ' , wherein the N is G, C, A, or U, and the second core region has the nucleotide sequence 5 ' -CGAAA-3 ' . The 3' terminal G of the first core region and the 5 ' terminal C of the second core region are self-hybridizing.

To the 5 ' terminus of the first nucleotidic core region is covalently linked a first flanking region at its 3¹ terminus, and to the 3' terminus of a second nucleotidic core region is covalently linked the 5 ' terminus of the second flanking region. These first and second flanking regions each include a plurality of 3 ' to 5 ' covalently- linked nucleotides, and each has a 3' terminus and 5' terminus. At least a portion of the first flanking region is complementary to a first target region of a substrate RNA molecule, and at least a portion of the second flanking region is complementary to a second target region of the substrate RNA molecule. In some preferred embodiments, the first and/or the second flanking region contains at least 9 nucleotides. In another embodiment, the first and second flanking region each contain at least 20 nucleotides. In yet another embodiment, there are from about 10 to about 1,000 nucleotides in each flanking region. In another embodiment, there are from about 20 to about 100 bases in each flanking region.

In some embodiments, the ribozyme variant of the invention synthetically produced. Such a synthetically produced variant comprises, in one embodiment, at least one 2 ' -O-alkylated nucleotide. In this and other embodiments the synthetic ribozyme variant comprises an internucleotide linkage selected from the group consisting of an alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphate triester, phosphoramidate, carbamate, carbonate, acetamidate, and carboxymethyl ester internucleotide linkage.

In some embodiments, the ribozyme variant has from about 10 to 300 fold increase in catalytic activity relative to a wild type hammerhead ribozyme.

In another aspect, the invention provides a method of controlling the expression of a target RNA in the presence of less than 11 mM magnesium under no-turnover conditions. For purposes of this invention, "no turnover" refers to one molecule of ribozyme cleaving five or less substrate molecules per hour under standard conditions, (e.g., 200 mM substrate RNA, 2 nM ribozyme, 100 mM KCl, 50 mM Tris-HCl, pH 8.0, and 1 mM MgCl₂ at 37°C) . Usually, the conditions for no turnover will be met for helices I and III lengths of greater than or equal to nine, and preferably greater ten or more nucleotides.

In this method, a ribozyme variant of the invention is provided and used to contact the RNA. By "provided" is meant to supply commercially or otherwise, make available, or prepare. The target RNA is contacted with the ribozyme variant in the presence of less than 11 millimolar concentration of magnesium. As used herein, the terms "target RNA" or "substrate RNA" refers to an oligoribonucleotide composed of 3 ' to 5' covalently-linked ribonucleotides to which the complementary flanking regions of the ribozyme variant hybridizes and which the ribozyme variant cleaves, thereby controlling the expression of the target RNA e.g., its ability to be translated into protein, is controlled.

For purposes of the invention, the term "complementary" refers to the ability of the flanking region to hybridize with a specific sequence of nucleotides in the normal Watson-Crick base-pairing fashion.

In some embodiments, the target RNA is contacted with the variant under physiological conditions. In other embodiments, the target RNA is contacted with the variant in the presence of from about 0.1 mM to about 5 mM magnesium. In preferred embodiments, the target RNA is contacted with the variant in the presence of about 1 mM magnesium.

In some embodiments, the target RNA is in a cell, and the contacting step comprises the step of administering the ribozyme variant to the cell such that the variant contacts the substrate RNA. In particular embodiments, the ribozyme variant is administered to the cell by microinjection. In another embodiment, the target RNA is in a cell, and the contacting step comprises the step of administering a nucleotidic vector comprising DNA encoding the ribozyme variant to the cell, such that the variant is transcribed from the DNA and allowed to contact the target RNA. In some embodiments, the vector is a plasmid which is transfected into the cell. In other embodiments, the vector is a plasmid which is microinjected into the cell.

Another aspect of the invention is a method of site-specifically cleaving a single-stranded, RNA-containing substrate molecule in the presence of less than 11 millimolar concentrations of magnesium and under no turnover conditions . 'In this method, a ribozyme variant of the invention is provided and used to contact the RNA-containing substrate molecule with the ribozyme variant in the presence of from about 0.5 mM to 10 mM magnesium such that the first flanking region of the ribozyme variant hybridizes to the first target region of the substrate molecule, and the second flanking region of the ribozyme variant hybridizes to the second target region of the substrate molecule.

In another aspect, the invention provides a stem-loop II-catalytic core structure of a ribozyme variant, the variant having enhanced catalytic activity under no turnover conditions in the presence of less than or equal to 10 millimolar concentrations of magnesium. The structure comprises a stem-loop II region having a 3 ' terminus and a 5 ' terminus and comprises from one to six 3' to 5 ' covalently-linked nucleotides, flanked by first and second core regions. Each flanking region comprises 3' to 5 ' covalently- linked nucleotides, and each has a 3' terminus and a 5' terminus, the first core region having the nucleotide sequence 5 ' -CUGANGAG-3 ' , wherein N is G, A, U, or C, and the second core region having the nucleotide sequence 5 ' -CGAAA-3 ' . The 3 ' terminus of the first core region is covalently linked to the 5 ' terminus of the stem-loop region, and the 5 ' terminus of the second core region being covalently linked to the 3 ' terminus of the stem-loop II region, the first and second core regions forming a catalytic core.

In other embodiments, the structure further comprises first and second flanking regions, each comprising a plurality of 3 ' to 5 ' covalently- linked nucleotides, and each flanking region having a 3 ' terminus and a 5 ' terminus . At least a portion of the first flanking region is complementary to a first target region of a substrate RNA molecule, and at least a portion of the second flanking region is complementary to a second target region of the substrate RNA molecule. The 3' terminus of the first flanking region is covalently linked to the 5 ' terminus of the first core region, and the 5' terminus of the second flanking region is covalently linked to the 3 ' terminus of the second core region. In some embodiments, the flanking regions each include less than 10 nucleotides.

In some embodiments, the structure is synthetic. As used herein, the term "synthetic oligonucleotide" includes artificially synthesized (i.e., not made by a DNA or RNA polymerase in a cell) polymers of ribonucleotide and/or non- nucleotidic linker molecules connected together or linked by at least one 5 ' to 3 ' internucleotide linkage. In some embodiments, the synthetic structure or structure plus flanking regions (i.e., ribozyme variant) includes at least one non-phosphodiester internucleotide linkage selected from the group consisting of an alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphate triester, phosphoramidate, carbamate, carbonate, acetamidate, and carboxymethyl ester internucleotide linkage. Some embodiments include one 2 ' -O-alkylated ribonucleotide.

Another aspect of the invention provides a method of selecting for a ribozyme variant having enhanced catalytic activity under no turnover conditions. In this method a selection round is performed wherein the selection round comprises the steps of: (a) contacting an RNA-containing substrate molecule with a ribozyme variant in the presence of a concentration of magnesium from about 10 millimolar to about 10 micromolar and at a temperature of from about -5°C to about 25°C, wherein a first flanking region of the ribozyme variant hybridizes to a first target region of the RNA-containing substrate molecule, and a second flanking region of the ribozyme variant hybridizes to a second target region of the RNA-containing substrate molecule, the hybridized ribozyme variant cleaving the RNA-containing substrate; (b) identifying the ribozyme variant which has cleaved the RNA-containing substrate; and (c) isolating the ribozyme variant. The term "selection round", as used herein, refers to experimental steps designed to favor the selection of ribozymes of enhanced catalytic activity comprising steps (a) , (b) and (c) . In one embodiment, identification step (b) of the method of the invention is performed by electrophoresis.

In some embodiments of the method, contacting step (a) is performed at a temperature from about -5°C to about 15°C. In some embodiments, contacting step (a) is performed at from about -2°C to about 10°C. In more preferred embodiments, contacting step (a) is performed at a temperature from about -0°C to about 5°C. In another embodiment, contacting step (a) of the method of the invention is performed at about 0°C. In an additional embodiment, three or more selection rounds are performed. In the first selection round, the concentration of magnesium is from 10 millimolar to greater than 10 micromolar. In each successive selection round, the concentration of magnesium is decreased relative ^"""^■" to the magnesium concentration of a preceding selection round. In an additional embodiment, three selection rounds are performed. The magnesium concentration in the first selection round is about 1 millimolar, the magnesium concentration in the second selection round is about 100 micromolar, and the magnesium concentration in the third selection round is about 10 micromolar.

The invention also provides, in another embodiment, a plasmid encoding the ribozyme variants of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

The foregoing and other objects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which:

FIG. 1 is a diagrammatic representation of a generic hammerhead ribozyme hybridized to a substrate RNA;

FIG. 2A is a schematic representation of the ribozyme variants of the invention having a shortened stem-loop II region, where N is G, A, C, or U, " " indicates a covalent linkage, " • " indicates base pairing either by Watson-Crick or non-Watson-Crick, and "unit" is delineated by phosphodiester;

FIG. 2B is a schematic representation of some ribozyme variants of the invention having a stem- loop II region shortened to one nucleotide (N) or non-nucleotidic molecule (X) ;

FIG. 2C is a schematic representation of some ribozyme variants of the invention having a stem- loop II region shortened to two nucleotides (N) or non-nucleotidic molecules (X) ; FIG. 2D is a schematic representation of some ribozyme variants of the invention having a stem- loop II region shortened to three nucleotides (N) or non-nucleotidic molecules (X) ;

FIG. 2E is a schematic representation of some ribozyme variants of the invention having a stem- loop II region shortened to four nucleotides (N) or non-nucleotidic molecules (X) ;

FIG. 2F is a schematic representation of some ribozyme variants of the invention having a stem- loop II region shortened to five nucleotides (N) or non-nucleotidic molecules (X) ;

FIG. 2G is a schematic representation of some ribozyme variants of the invention having a stem- loop II region shortened to six nucleotides (N) or non-nucleotidic molecules (X) ;

FIG. 3A is a schematic representation of a wild type (RZMZ5) hammerhead ribozyme transcribed from the plasmid pUC19RZMZ5 and hybridized to S2, a substrate RNA, wherein helices I and III and stem-loop II are shown, some bases in the stem- loop II region which may be deleted in a ribozyme variant of the invention are indicated in the gray box, and wherein the point of cleavage is indicated by the arrow;

FIG. 3B is a schematic representation of a representative ribozyme variant of the invention (RZMZ9) transcribed from the plasmid pUC19RZMZ9 and hybridized to a substrate RNA, wherein the point of cleavage is indicated by the arrow;

FIG. 3C is a schematic representation of another representative ribozyme variant (RZMZ13) of the invention transcribed from the plasmid PUC19RZMZ13 and hybridized to a substrate RNA, wherein some bases in the stem-loop II region which may be deleted in a ribozyme variant of the invention are indicated in the gray box, and wherein the point of cleavage is indicated by the arrow;

FIG. 4A is a schematic representation of the sequence of the HCVLuc PCR target used in the construction of the plasmids from which HCVLuc (100+100) WT ribozyme and short loop (SL) long- flank ribozyme variant were transcribed;

FIG. 4B is a schematic representation of the PCR primer set #1 used in the construction of the plasmids from which HCVLuc (100+100)WT and SL long-flank ribozymes were transcribed, and wherein HCVLuc (100+100) WT contains the same ribozyme core sequence as RZMZ5, and HCVLuc (100+100) SL contains the same ribozyme variant core as RZMZ9 (see FIG. 3A) ; FIG. 4C is a schematic representation of the PCR primer set #2 used in the construction of the plasmids from which HCVLuc (100+100)WT and SL long-flank ribozymes were transcribed, and wherein HCVLuc (100+100) WT contains the same ribozyme core sequence as RZMZ5 and HCVLuc (100+100) SL contains the same ribozyme variant core as RZMZ9 (see FIG. 3A) ;

FIG. 5A is a graphic representation showing the cleavage activity of the wild type RZMZ5 and SL variant RZMZ9 ribozymes at 100 mM KCl and varying concentrations of magnesium;

FIG. 5B is a graphic representation showing the rate of cleavage by wild type RZMZ5 ribozyme and SL variant RZMZ9 ribozyme in 1 mM magnesium, 1 mM CaCl₂, and 100 mM KCl, in gross ribozyme excess;

FIG. 6 is a graphic representation showing the cleavage rate (k₂) as a function of the log of the magnesium concentration for ribozyme/variants measured in ribozyme/variant excess (100 nM) at 0°C, wherein the inset shows a plot of k₂ as a function of magnesium concentration.

FIG. 7A is a schematic representation of the SL ribozyme variant hybridized to a substrate RNA, wherein the arrow indicates the site of cleavage;

FIG. 7B is a schematic representation of the MRz ribozyme analog hybridized to a substrate RNA, wherein the arrow indicates the site of cleavage; FIG. 7C is a schematic representation of the LL ribozyme analog hybridized to a substrate RNA, wherein the arrow indicates the site of cleavage;

FIG. 8 is a graphic representation of the cleavage activity of MRz, LL, and SL stem-loop II variants in 1 mM magnesium at 0° C in variant excess under no turnover conditions using S2 ' as substrate;

FIG. 9A is a graphic representation showing the cleavage activity of the HCVLuc (100+100) WT and HCVLuc (100+100) SL variant ribozymes at 100 mM KCl and varying concentrations of magnesium;

FIG. 9B is a graphic representation showing the rate of cleavage by HCVLuc (100+100) WT ribozyme and HCVLuc (100+100) SL variant ribozyme in the presence of 1 mM magnesium, 100 mM KCl, and ribozyme excess, wherein the inset shows the same data except plotted as the natural logarithm of the fraction of substrate remaining;

FIG. 10A is a schematic representation of a synthetic wild type ribozyme with a three base pair helix II and short (5 and 6 nucleotide) flanking regions hybridized to a substrate RNA, wherein the arrow indicates the site of cleavage;

FIG. 10B is a schematic representation of the synthetic ML ribozyme variant with a two base pair helix II and short flanking regions hybridized to a substrate RNA, wherein the arrow indicates the site of cleavage; FIG. IOC is a schematic representation of the synthetic GC ribozyme variant with a one pair, no loop helix II and short flanking regions hybridized to a substrate RNA, wherein the arrow indicates the site of cleavage;

FIG. 11 is a graphic representation of the cleavage activity of synthetic wild type (RZMZ5 WT) , and synthetic ribozyme variants ML, SL, and GC in 1 mM magnesium at 37°C in substrate RNA excess under turnover conditions, wherein the activity of the WT ribozyme is superior to the short loop variants;

FIG. 12 is a schematic representation of the RZMZ9 SL ribozyme variant hybridized to S2S substrate RNA;

FIG. 13A is a graphic representation of the rate of cleavage of RNA substrate S2 by RZMZ5 wild type ribozyme and RZMZ9 ribozyme variant under turnover conditions;

FIG. 13B is a graphic representation of the rate of cleavage of RNA substrate S2S by RZMZ5 wild type ribozyme and RZMZ9 ribozyme variant under turnover conditions;

FIG. 13C is a graphic representation of the rate of cleavage of RNA substrate S2 by RZMZ5 wild type ribozyme and RZMZ9 ribozyme variant at 0°C under no turnover conditions; FIG. 13D is a graphic representation of the rate of cleavage of RNA substrate S2S by RZMZ5 wild type ribozyme and RZMZ9 ribozyme variant at 0°C;

FIG. 14A is a graphic representation of the rate of cleavage activity of RZMZ5 wild type ribozyme and RZMZ9 SL ribozyme variant in the presence of 1 mM magnesium under turnover conditions;

FIG. 14B is a graphic representation of the rate of cleavage activity of RZMZ5 wild type ribozyme and RZMZ9 SL ribozyme variant in the presence of 5 mM magnesium under turnover conditions; and

FIG. 14C is a graphic representation of the rate of cleavage activity of RZMZ5 wild type ribozyme and RZMZ9 SL ribozyme variant in the presence of 10 mM magnesium under turnover conditions;

FIG. 15A is a schematic representation of the structure of the ribozyme/substrate pair of the invention illustrating the difference in size following cleavage whereby the 3 ' portion of the ribozyme is separated from the large 5' product;

FIG. 15B is a representation of an autoradiograph of a native 5% polyacrylamide electrophoresis gel showing the migration of the substrate ("Subst") , the ribozyme ("Rz"), and the 5 ' product ("Prod") ; FIG. 16A is a graphic representation of the rate of cleavage activity of representative variant ribozymes as compared to wild type ("WT") and short loop ("SL") ribozyme variants of the invention; and

FIG. 16B is a graphic representation of the enrichment for variant ribozymes of enhanced ribozyme activity in successive selection rounds in the presence of 1 mM magnesium at 0°C.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. The issued U.S. patents, allowed applications, published foreign applications, and references cited herein are hereby incorporated by reference.

Ribozymes are RNA molecules with catalytic activities including the ability to cleave at specific phosphodiester linkages in RNA molecules to which they have hybridized, such as mRNAs, RNA- containing substrates, and ribozymes, themselves. These catalytic molecules may assume several physical structures, one of which is called a "hammerhead. " The hammerhead ribozyme, as described by Haseloff and Gerlach (Nature (1988) 334:585-591), and as depicted in FIG. 1, is composed of a double-stranded stem and loop structure of undefined sequence and length (stem- loop II), connecting two portions of a catalytic core having nine conserved ribonucleotides, and flanked by two regions complementary to the target RNA of undefined sequence and length. The flanking regions enable the ribozyme to bind to the target RNA specifically by forming double stranded stems or helices I and III. The nucleotide sequence of the ribozymal catalytic core region is believed to have to be largely conserved in order to maintain the ability of the ribozyme to cleave single-stranded RNA (Koisumi et al. (1991) Biochem. 30:5145-5150; Thomson et al. (1993) Nucleic Acids Res. 21:5600-5603) , although more recently it was determined that this cleavage can be accomplished with molecules containing, in their stem-loop or catalytic core regions, rigid molecules other than nucleotides or nucleotide analogs (HYZ-024) . The sequence of the conserved catalytic core in the generic ribozyme and the site of cleavage 3' to an unpaired residue N are shown in FIG. 1.

Cleavage by the ribozyme may occur in cis (i.e., cleavage of the same RNA molecule that contains the hammerhead motif) , or in trans (cleavage of an RNA substrate other than that containing the ribozyme) next to specific ribonucleotide triplet by a transesterification reaction from a 3 ' , 5 ' -phosphate diester to a 2 ' , 3 ' -cyclic phosphate diester. Catalysis requires the presence of a divalent metal (such as magnesium, manganese, calcium or zinc cation, for example) , which appears to bind to a region of the catalytic core of the ribozyme termed the "U-turn" (Scott et al. (1995) Cell 81:991-1002) . When the ribozyme is bound to its substrate RNA, its core is extensively hybridized thereto with the exception of the U-turn. Accordingly, for magnesium binding to occur, it is likely that the catalytic core must be partially melted.

The ribozyme analogs of the invention are structurally distinct from a consensus hammerhead ribozyme in that the stem-loop II has been shortened to from one to six nucleotides in a region known not to be conserved. Some representative ribozyme variants of the invention are shown in FIGS. 2A-2G. One particularly effective ribozyme variant has a stem-loop II with four nucleotides at least two of which are self- hybridizing. This stem-loop II may have the nucleotide sequence 5 ' -CGUG-3 ' , 5 ' -CGAG-3 ' , or 5 ' - CGCG-3 ' .

The catalytic core of the ribozyme variants of the invention include a first catalytic core region covalently attached to the 5 ' end of the stem-loop II towards the 5' end of the molecule, and a second catalytic core region covalently attached to the 3 ' end of the stem-loop II towards the 3' end of the molecule. The first core region has the nucleotide sequence 5 ' -UGANGAG-3 ' , where N=G, C, U, or A while the second core region has the sequence 5 ' -GAAA-3 ' . The 5' end of the first core region is covalently attached to the 3 ' end of the first flanking region making up helix I, while the 3 ' end of the second core region is covalently attached to the 5 ' end of the second flanking region making up helix III .

The flanking regions of the variant which make up helices I and II when bound to the substrate RNA each contain nucleotide sequences which are complementary to, and hybridizable with, target regions on the RNA substrate to be cle'aved. The target regions complementary to the flanking regions may be contiguous or separated by one or several nucleotides, depending on the position of the cleavage site. Flanking regions of synthetic ribozyme variants of the invention are composed of deoxyribonucleotides, analogs of ribonucleotides, analogs of deoxyribonucleotides, or a combination thereof, with the 5' end of one nucleotide or nucleotide analog and the 3 ' end of another nucleotide or nucleotide analog being covalently linked. These flanking regions are at least 10 nucleotides, and preferably are at least 20 nucleotides in length. Flanking regions of about 10 to 1000 nucleotides are useful, with flanking regions of 20 to 50 nucleotides being the most common.

The flanking regions and other nucleotidic regions of a synthetic ribozyme variant of the invention, i.e., a ribozyme prepared by biochemical means outside of a cell, may be modified in a number of ways for protection against nuclease digestion, without compromising the ability of the ribozyme variant to hybridize to substrate RNAs. For example, the nucleotides of the flanking regions and other portions of the ribozyme variants may contain at less than ten nucleotides and have least one or a combination of other than phosphodiester internucleotide linkages between the 5 ' end of one nucleotide and the 3 ' end of another nucleotide in which the 5 ' nucleotide phosphodiester linkage has been replaced with any number of chemical groups . Examples of such chemical groups include alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters . between the 5 ' end of one nucleotide and the 3 ' end of another nucleotide, in which the 3 ' phosphate has been replaced with any number of chemical groups. Examples of such chemical groups include alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate esters.

For example, US Patent No. 5,149,797 describes traditional chimeric oligonucleotides having a phosphorothioate core region interposed between methylphosphonate or phosphoramidate flanking regions. U.S. Patent Application Ser. No. (47508-559), filed on August 9, 1995 discloses "inverted" chimeric oligonucleotides comprising one or more nonionic oligonucleotide region (e.g. alkylphosphonate and/or phosphoramidate and/or phosphotriester internucleoside linkage) flanked by one or more region of oligonucleotide phosphorothioate. Various oligonucleotides with modified internucleotide linkages can be prepared according to known methods (see, e.g., Goodchild (1990) Bioconjugate Chem. 2:165-187 ; Agrawal et al. , (1988) Proc. Natl. Acad. Sci. (USA) 85:7079-7083; Uhlmann et al. (1990) Chem. Rev. 90:534-583; and Agrawal et al. (1992) Trends Biotechnol. 10:152-158.

The phosphorothioate linkages may be mixed Rp and Sp enantiomers, or they may be stereoregular or substantially stereoregular in either Rp or Sp form (see Iyer et al . (1995) Tetrahedron Asymmetry

6:1051-1054) . Oligonucleotides with phosphorothioate linkages can be prepared using methods well known in the field such as phosphoramidite (see, e.g., Agrawal et al. (1988) Proc. Natl. Acad. Sci. (USA) 85:7079-7083) . or by H- phosphonate (see, e.g., Froehler (1986) Tetrahedron Lett. 27:5575-5578) chemistry. The synthetic methods described in Bergot et al . (J. Chromatog. (1992) 559:35-42) can also be used.

Other modifications include those which are internal or at the end(s) of the flanking regions of the ribozyme analog and include additions to the molecule of the internucleoside phosphate linkages, such as cholesteryl or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the genome. Examples of such modified ribozyme variants include ribozyme variants with a modified base and/or sugar such as arabinose instead of ribose, or a 3', 5 ' -substituted oligonucleotide having a sugar which, at both its 3 ' and 5 ' positions is attached to a chemical group other than a hydroxyl group (at its 3 ' position) and other than a phosphate group (at its 5' position) .

Other examples of modifications to sugars include modifications to the 2 ' position of the ribose moiety which include but are not limited to 2 ' -O-substituted with an -O- lower alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an -O-aryl, or allyl group having 2-6 carbon atoms wherein such -O-alkyl, aryl or allyl group may be unsubstituted or may be substituted, (e.g., with halo, hydroxy, trifluoromethyl cyano, nitro acyl acyloxy, alkoxy, carboxy, carbalkoxyl, or amino groups), or with an amino, or halo group. None of these substitutions are intended to exclude the native 2 ' -hydroxyl group in the case of ribose or 2 ' -H- in the case of deoxyribose. PCT Publication No. WO 94/02498 discloses traditional hybrid oligonucleotides having regions of 2 ' -O-substituted ribonucleotides flanking a DNA core region. U.S. Patent Application Serial No. (47508-559) , filed August 9, 1995, discloses an "inverted" hybrid oligonucleotide which includes an oligonucleotide comprising a 2 ' -O-substituted (or 2' OH, unsubstituted) RNA region which is in between two oligodeoxyribonucleotide regions, a structure that "inverted relative to the "traditional" hybrid oligonucleotides.

Yet other modified ribozyme variants are capped with a nuclease resistance-conferring bulky substituent at their 3' and/or 5' end(s) , or have a substitution in one nonbridging oxygen per nucleotide. Such modifications can be at some or all of the internucleoside linkages, as well as at either or both ends of the ribozyme variant and/or in the interior of the molecule.

The preparation of these modified oligonucleotides is well known in the art (reviewed in Agrawal et al. (1992) Trends Biotechnol. 10:152-158) . For example, nucleotides can be covalently linked using art-recognized techniques such as phosphoramidate, H-phosphonate chemistry, or methylphosphoramidate chemistry (see, e.g., Uhlmann et al. (1990) Chem. Rev. 90:543-584; Agrawal et al . (1987) Tetrahedron. Lett. 28: (31) :3539-3542) ; Caruthers et al. (1987) Meth. Enzymol. 154:287-313; U.S. Patent 5,149,798) . Oligomeric phosphorothioate analogs can be prepared using methods well known in the field such as methoxyphosphoramidite (see , e.g. ,

Agrawal et al . (1988) Proc. Natl. Acad. Sci. (USA) 85:7079-7083) or H-phosphonate (see , e.g. , Froehler (1986) Tetrahedron Lett. 27:5575-5578) chemistry. The synthetic methods described in Bergot et al. (J. Chromatog. (1992) 559:35-42) can also be used.

Some non-limiting, representative ribozyme variants bound to the synthetic substrate S2 are shown in FIGS. 2A-2G, 3B, 3C, 7A, 10B, and 10D. The RZMZ9 and RZMZ13 ribozyme variants were transcribed from the plasmids pUCl9RZMZ9 and PUC19RZMZ13, respectively. The RZMZ13 ribozyme variant (FIG. 3C) contains a 2 base deletion from helix II and the RZMZ9 ribozyme variant (FIG. 3B) contains a 4 base deletion from helix II, as delineated by the grey box, but are otherwise identical in sequence to the wild type RZMZ5 ribozyme depicted in FIG. 3A. The ribozyme variants shown in FIGS. 10B and 10D, respectively ML and GC have shorter flanking regions (4 at 3' end and 7 at 5 ' end) .

By shortening stem-loop II, ribozyme variants of the invention RZMZ9 and RZMZ13 have been created whose activity in micromolar concentrations of magnesium approximates that of the wild type ribozyme at millimolar concentrations of magnesium (FIG. 6) . Assay of the cleavage activity of these variants show that the short loop (SL) stem-loop II variant RZMZ9 SL has high activity relative to its wild type ribozyme RZMZ WT, especially in the presence of low (10 mM or less) magnesium concentrations and minimal turnover conditions (FIGS. 5A and 5B) . Furthermore, ribozyme variants of the invention RZMZ9 and RZMZ13 were superior to their untruncated wild type ribozyme RZMZ counterpart under no turnover conditions (see, FIG. 6), as compared to conditions where turnover was allowed (see, e.g., FIG. 14A, B, and C) . Comparable levels of activity are seen for a particular ribozyme or variant in the RZMZ series independent of the ribozyme:substrate ratio, including conditions of gross ribozyme (or variant) excess usually used to measure the rate of a chemical step.

The variants of the present invention have a rate of substrate cleavage 10 to 1,000 times greater than that of the corresponding wild type hammerhead ribozyme under conditions which disallow turnover and in the presence of less than 10 mM magnesium with rates of cleavage of 100-500 being common. For example, in FIG. 9B, cleavage rates 200 to 300 times faster were observed.

The enhanced rate of catalysis is independent of the sequence of the flanking regions because ribozymes containing the same core, but different flanks (compare the sequences around the cleavage site, indicated by an arrow, in FIGS. 3A-3C and 3A) , behave similarly (FIGS. 5A, 5B, 9A, and 9B) . In FIGS. 9A and 9B the activity of ribozymes HCVLuc (100+100) WT and HCVLuc (100+100) SL having different (HCV) targets and longer (100 nucleotide) flanking regions were compared under no turnover conditions and 1 mM magnesium. Superior cleavage is still observed by the SL ribozyme variant. The first order rate constants for the short stem-loop II variants and wild-type long-flank ribozymes differ by a factor of 2 x 10³ to 3 x 10³ when measured in 1 mM MgCl₂ and physiological salt. Since the only difference between the two types of enzymes is length and hence T_m of stem-loop II, it is probable that partial melting of the catalytic core, facilitated by a weaker (shorter) stem-loop II is required for magnesium entry and catalysis. This is supported by the observation that the variant supports cleavage in micromolar concentrations of magnesium, whereas the wild-type enzyme requires greater than 10 millimolar concentrations for similar activity (see FIG. 6) .

The enhanced rate of cleavage exhibited by the short stem-loop II variant under no turnover and low magnesium conditions make it ideal for use in modulating gene expression in vivo using expression vectors to produce the ribozyme inside the cell. Other stem-loop II sequence variants that destabilize this structure (e.g., GC stem- loop II (SEQ ID NO:21) (FIG. 10D) (Amontov et al . (1996) J. Am. Chem. Soc. 118:1624-1628) may have similar effects. It is also possible that certain lengths of non-nucleotidic linker replacements will function as well in promoting cleavage in low magnesium under non-turnover conditions.

Thus, ribozyme variants of the invention fall into two classes to meet the condition of non- turnover defined above that dictates their utility. Class (1) ribozyme variants are designed to operate at physiological temperature (37°C) and salt conditions with long flanking sequences (greater than 9 base pairs on each side) . Class (2) synthetic ribozyme analogs are designed to operate at physiological temperature (37°C) and salt conditions with short, modified nucleic acid flanking sequences (10 or less base pairs on each side) capable of stronger interaction with substrate than that between the identical all RNA sequence.

Case (1) describes ribozymes presently used to modulate gene expression in vivo via expression from a nucleotidic vector (DeYoung et al. (1994) Biochem. 33:12127-12138; Crisell et al. (1993) Nuc. Acids Res. 21:5251-5255; Cantor et al . (1993) Proc. Nat. Acad. Sci. USA 90:10932-10936; Kobayashi et al. (1994) Cancer Res. 54:1271-1275) . The ribozyme variant HCVLuc SL (100+100) characterized in FIGS. 9A and 9B falls into this class. Here, the SL ribozyme has an unexpected advantage over its WT counterpart. Due to the extreme stability of the WT stem-loop II structure, even when present in DNA, plasmids bearing WT ribozymes are extremely prone to deletion when propagated in bacteria. By extension, this would also be expected to be the case during replication in any host. This sequence has also been shown to be an efficient transcription terminator in bacteria (Deshler et al. (1995) Gene 155:35-43), an additional disadvantage. Case (2) describes synthetic ribozymes presently used to modulate gene expression in vivo via external administration (see, e.g., Gu et al . (1995) Circ. Res. 77:14-20; Lyngstadaas et al . (1995) EMBO J. 14:5224-5229; Flory et al. (1996) Pharmacol. 93:754-758) . Based upon the data presented in FIGS. 5A, 5B, and 6, synthetic ribozymes having a truncated stem-loop II should have superior properties relative to their undeleted counterparts.

Several additional stem-loop II deleted or reduced ribozymes have been characterized here as well as by others that do not show superior cleavage in low magnesium under non-turnover conditions, (FIG. 8), most notably the ribozymes similar to LL (FIG. 7A) (Amontov et al . (1996) J. Am. Chem. Soc. 118:1624-1628) and MRz (FIG. 7B) (Hendry et al. (1995) Nuc. Acids Res. 23:3922-3927) .

The structure of a stem-loop providing optimal cleavage under marginal turnover conditions (50 mM Tris-HCl, pH 8.0, 10 mM magnesium chloride, a 10:1 ribozyme to substrate ratio, 10 base pair helix I, 10 base pair helix III, and incubation at 37°C) has been the subject of WO 96/00232) . A stem-loop II structure (as defined herein) containing 8 or 9 bases was found to be optimal. It was observed that stem-loop II sequences comparable to those contained in the SL ribozymes characterized herein gave rapid initial cleavage rates, but less cleavage overall. This is very similar to what is observed with the RZMZ (9 base pair helix I and 15 base pair helix III) series under nearly identical reaction conditions (FIG. 14A-14C) . However, WO 96/00232 does not describe testing of these ribozymes under physiological conditions of low magnesium ion concentration.

The invention also provides methods of selecting for a ribozyme variant having enhanced catalytic activity under no turnover conditions, the method comprising performing a selection round. A selection round comprises contacting an RNA-containing substrate molecule with a ribozyme variant in the presence of a concentration of magnesium from about 10 millimolar to about 10 micromolar and at a temperature of from about -5°C to about 25°C. A first flanking region of the ribozyme variant hybridizes to a first target region of the RNA-containing substrate molecule, and a second flanking region of the ribozyme variant hybridizes to a second target region of the RNA-containing substrate molecule. Cleavage of the RNA-containing substrate occurs when the variant hybridizes to the substrate. The ribozyme variant which has cleaved the RNA-containing substrate is then identified and isolated.

The contacting step of the method of the invention may be performed by mixing a ribozyme variant library, such as, but not limited to, the HCVLuc LS (100+30) library described herein, with an aliquot of a suitable RNA-containing substrate for a time sufficient to allow hybridization and cleavage. A noniimiting example of such a substrate is HCVLucΔ (100+100) described herein, for a time sufficient to allow hybridization and cleavage.

The temperature at which contacting step (a) may be performed ranges from about -5°C to about 15°C. Preferably, contacting step (a) is performed from about -2°C to about 10°C. More preferably, the contacting step is performed at a temperature from about -0°C to about 5°C. Most preferably, the contacting step is performed at about 0°C.

Two or more selection rounds may be performed, wherein in the first selection round, the concentration of magnesium is from 10 millimolar to greater than 10 micromolar, and wherein in each successive selection round, the concentration of magnesium is decreased relative to the magnesium concentration of a preceding selection round. For example, when the method includes three selection rounds, the magnesium concentration in the first selection round is 1 millimolar, the magnesium concentration in the second selection round is 100 micromolar, and the magnesium concentration in the third selection round is 10 micromolar. Identification step (b) of the method may be performed by any of the many methods available to one skilled in the art to distinguish molecules on the basis of their size or relative molecular weight. Such methods include, but are not limited to, methods well known in the art such as chromatographic methods including electrophoretic methods, gradient centrifugation, HPLC, etc.

FIG. 15A shows the identification of ribozyme variants having enhanced catalytic activity on the basis of the migrational difference between the precursor ribozyme/substrate pair and the ribozyme/3 ' -product pair upon cleavage and release of the 5 ' -portion of the substrate-ribozyme variant hybridized pair. Hence, according to the methods of this invention, the ribozyme/3 'product pair ("Rz/3' of FIG. 15B) is resolved by gel electrophoresis which separates precursors ("Rz/Subst" of FIG. 15B) from cleavage products on the basis of their molecular weight.

Selection for rapid cleavage in low magnesium may be accomplished by successive selective rounds of cleavage analysis using a randomized ribozyme variant library at progressively lower concentrations of magnesium at from -5°C to 25°C. As shown in FIG. 16, the catalytic activity of ribozymes tested at 37°C increases in successive selection rounds.

As described above, the ribozyme variants of the invention may be expressed in a cell containing the target RNA using various methods which import a DNA encoding the ribozyme into the cell. For example, ribozyme variants of the invention may be incorporated and expressed in cells as a part of a DNA or RNA transfer vector or plasmid, or a combination thereof, for the maintenance, replication and transcription of the ribozyme variant sequences of this invention. Nucleotide sequences encoding the ribozyme variants of this invention may be integrated into the genome of a eucaryotic or prokaryotic host cell for subsequent expression (see, e.g., Sambrook et al . (1989), Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press) .

Genomic integration may be facilitated by transfer vectors or plasmids which integrate into the host genome. Such vectors may include nucleotide sequences, for example, of viral or regulatory origin, which facilitate genomic integration. Methods for the insertion of nucleotide sequences into a host genome are described, for example, in Sambrook et al. (Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press (1989)) and in Hogan et al . ( Science (1989) 244:1275) .

Genomically integrated nucleic acid sequences encoding the ribozyme variants of the invention generally comprise a promoter operably linked to the nucleotide sequence encoding the ribozyme variant of this invention, and capable of expressing the ribozyme variant in a eucaryotic (such as animal or plant cells) or prokaryotic (such as bacteria) host cells. The ribozyme variants of the present invention may also be prepared by methods known in the art for the synthesis of RNA molecules (see, e.g., the recommended protocols of Promega, Madison, Wl, USA) . In particular, the ribozyme variants of the invention may be prepared from a corresponding DNA sequence (which on transcription yields a ribozyme variant, and which may be synthesized according to methods known in the art for the synthesis of DNA) , operably linked to an RNA polymerase promoter such as a promoter for T7 RNA polymerase or SP6 RNA polymerase. A DNA sequence corresponding to a ribozyme variant of the present invention may be ligated into a DNA transfer vector such as plasmid or bacteriophage DNA. Where the transfer vector contains an RNA polymerase promoter operably linked to DNA corresponding to a ribozyme variant, the ribozyme variant may be conveniently produced upon incubation with an RNA polymerase. Ribozyme variants may, therefore, be produced in vitro by incubation of RNA polymerase with an RNA polymerase promoter operably linked to DNA corresponding to a ribozyme variant, in the presence of ribonucleotides. In vivo, prokaryotic or eucaryotic cells (including mammalian and plant cells) may be transfected with an appropriate transfer vector containing genetic material corresponding to a ribozyme variant in accordance with the present invention, operably linked to an RNA polymerase polymer such that the ribozyme variant is transcribed in the host cell. Transfer vectors may be bacterial plasmids or viral RNA or DNA. Nucleotide sequences corresponding to ribozyme variants are generally placed under the control of strong promoters such as, for example, the lac, lambda, cytomegalovirus, SV40 late, SV40 early, or metallothionein promoters. Ribozyme variants may be directly transcribed in vivo from a transfer vector, or alternatively, may be transcribed as part of a larger RNA molecule. For example, DNA corresponding to ribozyme variant sequences may be ligated into the 3 ' end of a carrier gene after a translation stop signal. Larger RNA molecules may help to stabilize the ribozyme variant molecules against nuclease digestion within cells. Translation of the carrier gene gives rise to a protein whose presence can be directly assayed, for example, by enzymatic reaction. The carrier gene may, for example, encode an enzyme.

Ribozyme variants of the invention may be involved in gene therapy techniques, where, for example, cells from a human suffering from a disease such as HIV or some other viral or bacterial infection or disorder are removed from a patient, treated with the ribozyme variant to inactivate the infectious agent, and then returned to the patient to repopulate a target site with resistant cells. In the case of HIV, nucleotide sequences encoding ribozyme variants of this invention capable of inactivating the HIV virus may be integrated into the genome of lymphocytes or be present in the cells a transfer vector capable of expressing ribozyme variants of this invention. Such cells would be resistant to HIV infection and the progeny thereof would also confer such resistance. Ribozyme variants of the invention may be incorporated and expressed in cells as a part of a DNA or RNA transfer vector, or a combination thereof, for the maintenance, replication and transcription of the ribozyme variant sequences of this invention. Within the cell or cells of an organism, a transfer vector such as a bacterial plasmid or viral RNA or DNA, encoding one or more ribozyme variants may be transfected into cells (see, e.g., Llewellyn et al . (1987) J. Mol. Biol. 195:115-123) . Once inside the cells, the transfer vector may replicate and be transcribed by cellular polymerases to produce ribozyme variant RNAs which may have ribozyme variant sequences of this invention; the ribozyme variant RNAs produced may then inactivate a desired target RNA. Alternatively, a transfer vector containing one or more ribozyme variant sequences may be transfected into cells or introduced into cells by way of micromanipulation techniques such as microinjection, such that the transfer vector or a part thereof becomes integrated into the genome of the host cell. Transcription of the integrated genetic material gives rise to ribozyme variants, which act to inactivate a desired target RNA.

Transfer vectors expressing ribozyme variants of the invention may be capable of replication in a host cell for stable expression of ribozyme variant sequences. Alternatively, transfer vectors encoding ribozyme variant sequences of this invention may be incapable of replication in host cells, and thus may result in transient expression of ribozyme variant sequences . Methods for the production of DNA and RNA transfer vectors, such as plasmids and viral constructs are well known in the art and are described for example, by Sambrook et al. (Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press (1989)) . Transfer vectors generally comprise the nucleotide sequences encoding the ribozyme variant of the invention, operably linked to a promoter and other regulatory sequences required for expression and optionally replication in prokaryotic and/or eucaryotic cells. Suitable promoters and regulatory sequences for transfer vector maintenance and expression in plant, animal, bacterial, and other cell types are well known in the art (see, e.g., Hogan et al. (1989) Science 244:1275) .

The ribozyme variants of the present invention have extensive therapeutic and biological applications. For example, disease causing viruses in man and animals may be inactivated by administering to a subject infected with a virus, a ribozyme variant in accordance with the present invention adapted to hybridize to and cleave RNA transcripts of the virus. Such ribozyme variants may be delivered by parenteral and other means of administration. Alternatively, a subject infected with a disease causing virus may be administered a non-virulent virus such as vaccinia or adenovirus which has been genetically engineered to contain DNA corresponding to a ribozyme variant operably linked to an RNA promoter, such that the ribozyme variant is transcribed in the cells of the host animal, transfected with the engineered virus, to effect cleavage and/or inactivation of the target RNA transcript of the disease causing virus.

Methods for introduction of RNA and DNA sequences into cells, and the expression of the same in prokaryotic and eucaryotic cells are well known in the art for example as discussed by Cotten (1990) Tibtech 8:174-178 and Friedman (1989) Science 244:1275-1280) . The same widely known methods may be utilized in the present invention.

Ribozymes used to regulate the expression of RNA intracellularly may be administered to the cell via any method known, such as microinjection or liposome fusion from outside the cell, or may delivered to the cell via gene therapy methods, i.e., by a nucleic acid vector such as a plasmid containing DNA encoding the ribozyme.

Synthetic ribozyme variants of the invention may be synthesized by well known biochemical means. [The synthetic ribozyme variants can be prepared by the art-recognized methods such as phosphoramidate or H-phosphonate chemistry which can be carried out manually or by an automated synthesizer using standard H-phosphonate chemistry as described in U.S. Patent No. 5,149,789, or using standard phosphoramidite chemistry (see, e.g., Beaucage (Meth. Mol. Biol. (1993) 20:33-61);

Damha et al. (in Protocols for Oligonucleotides and Analogs; Synthesis and Properties (Agrawal, ed. ) (1993) Humana Press, Totowa, NJ, pp. 81-114) ; or Uhlmann et al . (Chem. Rev. (1990) 90:534-583)] and then added to the cell.

However, endogenously applied ribozymes are susceptible to nucleolytic cleavage outside the cell, and as such, are often designed as smaller molecules have fewer nucleotides linked by internucleotide linkages and/or other structures or modifications which are nuclease-resistant. Ribozymes expressed in the cell are viewed by the cell as native, and as such are not as susceptible to nucleolytic digestion as endogenously added ribozymes. Thus, the fact that the ribozyme variants of the invention consist of nucleotides linked by phosphodiester bonds and may have longer flanking regions is not as much of a concern. Long flanking regions ensure stable hybridization to the target RNA, however, such a structural characteristic results in low turnover and a correspondingly slow rate of catalysis. Another problem is that there is a low (about 1 mM) intracellular concentration of free magnesium, a condition which is not conducive for a fast rate of catalysis.

The ribozyme variant or the plasmid encoding the ribozyme variants of the invention may be in the form of a therapeutic composition or formulation useful for treating any conditions in which an mRNA is being over- or mal-expressed, or in which the RNA of a virus, bacterium, or other infecting organism is being expressed to the detriment of a cell, tissue, or organism. These variants or plasmids may be used as part of a pharmaceutical composition when combined with a physiologically and/or pharmaceutically acceptable carrier. The characteristics of the carrier will depend on the route of administration. Such a composition may contain, in addition to the synthetic oligonucleotide and carrier, diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.

The pharmaceutical composition of the invention may be in the form of a liposome in which a ribozyme variant or plasmid of the invention are combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers which are in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No. 4,501,728; U.S. Patent No. 4,837,028; and U.S. Patent No. 4,737,323. The pharmaceutical composition of the invention may further include other lipid carriers, such as Lipofectamine, or cyclodextrins and the like which enhance delivery of oligonucleotides into cells, or such as slow release polymers. As used herein, the term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, whether administered in combination, serially or simultaneously.

In practicing the method of treatment or use of the present invention, a therapeutically effective amount of a ribozyme variant or plasmid encoding a ribozyme variant of the invention is administered to a subject. Administration can be carried out in a variety of conventional ways, such as microinjection into the cell, tissue, or organ to be treated, or by transformation or transfection.

The amount of ribozyme variant or plasmid in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of pharmaceutical formulation with which to treat each individual patient. Initially, the attending physician will administer low doses of the formulation and observe the patient ' s response. Larger doses may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. It is contemplated that the various pharmaceutical compositions containing ribozyme variants used to practice the method of the present invention should contain about 1.0 ng to about 2.5 mg of synthetic oligonucleotide per kg body weight.

The duration of therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of ^""""" the disease being treated and the condition and potential idiosyncratic response of each individual patient. Ultimately the attending physician will decide on the appropriate duration of therapy using the pharmaceutical composition of the present invention.

The following examples illustrate the preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.

EXAMPLES

Synthesis of Oligonucleotides and Oligoribonucleotides

The ribozyme substrate RNA oligonucleotide, S2 (5'-AUCCUUAGUC*AGUGUGGAGAAUCCC-3 ' ; SEQ ID NO:l), where the site of ribozyme cleavage is indicated by an asterisk, was synthesized on a 1 μmol scale using a Applied Biosystems Inc. DNA synthesizer (Applied Biosystems, Inc. model 394 a division of Perkin-Elmer-Cetus, Foster City, CA) using standard β-cyanoethyl phosphoramidite chemistry and PAC protected RNA amidites (Glenn Research, Sterling, VA) . Oligonucleotide was cleaved from the support and base protecting groups were removed by treatment with 300 μl neat ethanolamine (Sigma Chemical Company, St. Louis, MO) at 65°C for 30 min. Oligonucleotide was removed form the support, the support was washed with 300 μl of water, and the supematants were combined and lyophilized. Sugar protecting groups were removed by treatment with 1 M tetrabutyl- ammonium fluoride in tetrahydrofuran (Sigma) at room temperature for 17 hours . Water was added to 50 ml and the deprotected RNA was desalted and recovered by Sep PAC (Waters Chromatography, a division of Millipore Corporation, Milford, MA) chromatography. After loading of the RNA, the Sep PAC cartridge was washed with 10 ml of water and RNA was eluted with 60% (vol:vol) aqueous methanol in 1 ml aliquots. One μl of each fractions was spotted onto a silica thin layer chromatography plate containing fluorescent dye (E.M. Separations, Gibbstown, NJ) . Spots from fractions containing RNA were located by UV shadowing. These fractions were pooled, lyophilized, and resuspended in gel loading dye (aqueous 90% formamide, 10 mM ethylenediamine-tetraacetic acid (EDTA) , and enough phenol red and xylene cyanol to see) or urea dye (saturated urea in 1/2X gel running buffer (see below) containing enough orange G (Sigma) and phenol red (Sigma) to see) for oligomers shorter than 20 nucleotides in length. RNA was gel resolved on 10% polyacrylamide:bisacrylamide (20:1) denaturing Tris-borate-EDTA gels, visualized by UV shadowing, excised and eluted into 0.5 M ammonium acetate (Sigma) overnight. RNA was recovered from the ammonium acetate by Sep PAC chromatography as above. RNA concentration was determined from absorbance at 260 nm and from the calculated extinction coefficient.

DNAs encoding ribozymes, T7BOT/RZMZ1 (having SEQ ID NO:2) and T7BOT/RZMZ9 (having SEQ ID NO:3) , as well the primers T7T0P (having SEQ ID NO:4) 5' Pstl PCR (having SEQ ID NO: 5), and RZMZl→RZMZ5 (having SEQ ID NO: 6) , shown below in Table 1, were synthesized on a 1 μmol scale using a Pharmacia Gene Assembler (Pharmacia Biotech, Piscataway, NJ) using β-cyanoethyl phosphoramidite chemistry and DNA amidites (Cruachem, Glasgow, Scotland) .

TABLE 1

Ribozyme SEQ ID or Primer Sequence (5 '—» 3') NO:

T7BOT/RZMZ1 AACTTTTAGTTTCGGCCTAACGGCCTCATCA GAGTGTGGAAAATCCCTATAGTGAGTCGTAT TACTGCA

T7BOT/RZMZ9 CACGGATCCTTAGTTTCGCTAACGCTCATC AGAGTGTGGAAAATCCCTATAGTGAGTCGT ATTACTGCA

T7TOP GTAATACGACTCACTATAGGG 4

5' Pstl PCR CCACTGCAGTAATACGACT 5

RZMZ1→RZMZ5 CACGGATCCTTAGTTTCGGCCTA 6

DNAs were deprotected in 30% aqueous ammonia for 17 hours at 55°C. The ammonia supernatant was removed into a fresh tube and the support was washed with 500 μl of water. Both supematants were lyophilized and the DNAs were gel purified as above using a 10% (T7BOT/RZMZ 1 and 9) or a 15% (T7TOP) polyacrylamide denaturing. Visualization after electrophoresis, extraction, recovery, and quantitation were done as above.

DNA primers for the construction of HCVLuc WT (100+100), HCVLuc SL (100+100), and HCVLuc (100+100) RNA (see below) were synthesized and purified as described above. These include the primers listed in Table 2 below: TABLE 2

SEQ ID primer sequence (5 ' -» 3 ' ) NO:

A. outside primer:

Pstl Sense #2 CCACTGCAGGAATTGCCAGGACGAC 7 BamHl Coding #2 CACGGATCCGGATAGAATGGCGCC 9

B. ribozyme encoding primers:

WT Sense GGCCTTTCGCTGATGAGGCCGTTAGGCCGAAACCCAACACTACTCG 10

WT Coding AGTGTTGGGTTTCGGCCTAACGGCCTCATCAGGCGAAAGGCCTTGT 11 o

SL Sense GGCCTTTCGCTGATGAGCGTTAGCGAAACCCAACACTACTCG 12

SL Coding AGTGTTGGGTTTCGCTAACGCTCATCAGGCGAAAGGCCTTGT 13

TABLE 2 (CON'T)

SEQ ID primer sequence (5' —» 3 ' ) NO:

C. HCVLuc LS (Loop Series) (100 + 100 ) DNA primers:

BamHl T7 TAATACGACTCACTATAGGGATCCGGATAGAATGGCG 14 ribozyme encoding

LS Sense CTCATCAGGCGAAAGGCC 15 ribozyme encoding

LS Coding GGCCTTTCGCCTGATGAG(N)^CGAAACCCAACAC 16

Pstl Sense #3 CCACTGCAGCTGCTAGCCGAGTAGTGT 8 ut

D. DNA HCVLucΔ (100 + 100) substrate RNA primers:

HCVΔ Sense GCCTGGAGATTTGGGCGTAGTGTTGGGTCGC 17

HCVΔ Coding GCGACCCAACACTACGCCCAAATCTCCAGGC 18

These oligonucleotides were synthesized and purified as above.

Preparation of Synthetic Ribozyme Variants

Synthetic ribozymes and ribozyme variants are synthesized on a 1 μmol scale using a DNA synthesizer (Model 394, Applied Biosystems, Inc., a division of Perkin-Elmer-Cetus, Foster City, CA) and the automated solid-support phosphoramidite method with commercial 2'-0-silyl nucleoside phosphoramidites (Usman et al. (1987) J. Amer. Chem. Soc. 109:7845-7854) . Products are cleaved from the support and deblocked as described above for the preparation of synthetic substrate in Example 1 above.

3. Cloning of Synthetic DNAs into pUC19

A double-stranded insert for cloning was prepared from synthetic oligonucleotides by treatment with Klenow fragment of E. coli DNA polymerase I (5 U/μl) . 10 μl each of 10X Klenow buffer (New England Biolabs, Inc., Beverly, MA), 10 μM T7BOT/RZMZ 1 or 9 and 10 μM T7T0P were mixed in a 500 μl microcentrifuge tube and heated to 95°C. The mixture was then cooled to 25°C over a half hour period and 10 μl of a 10 mM mixture of all four dNTPs (Pharmacia Biotech) , 55 μl of water, and 5 μl of Klenow fragment were added. The reaction was allowed to proceed for one hour at 37°C and then sequentially extracted with an equal volume of buffered phenol/CHCl₃ (1:1) an equal volume of CHCl₃/isoamyl alcohol (25:1), and then precipitated by the addition of 2 volumes of ethanol. The DNA was recovered by centrifugation dried under vacuum, and resuspended in 20 μl of water.

One microgram of the plasmid pUC19 (Messing (1983) Meth. Enzymol. 101:20-78) was digested with 5 units each of the restriction enzymes Pstl and Hindi in IX reaction buffer 3 supplemented with bovine serum albumin (both supplied by New England Biolabs, Inc.) in a 20 μl reaction at 37°C. 4 μl of 6X ethidium dye (30% v/v glycerol, 0.05% w/v bromphenol blue, xylene cyanol, and 0.25 mg/ml ethidium bromide) were added and the mixture was electrophoresed on an 0.8% agarose in TAE buffer 1 mM EDTA, and 20 mM acetic acid, and 40 mM Tris-OH, pH 8.3)) . Linearized plasmid was located by UV transillumination and excised. DNA was recovered from the gel block using a homemade spin filter that was prepared by piercing the bottom and cap of a 500 μl microcentrifuge tube with a 22 gauge needle. A small amount of either glass wool or aquarium filter medium was placed into the tube and stuffed into the bottom to cover the hole. The unit was placed into a 1.5 ml microcentrifuge tube with cap removed and the gel block was placed into the smaller tube and its lid was closed. The assembly was centrifuged for 5 minutes in a microfuge and approximately 50 μl of fluid that fluoresced intensely collected in the 1.5 ml microcentrifuge tube. This material was used as the recipient of the inserts prepared above. The plasmids pUC19RZMZl and pUC19RZMZ9 were constructed in a ligation reaction containing 2 μl of 10X T4 DNA ligase buffer (New England Biolabs, Inc.), 1 μl of prepared vector (see above), 5 μl of prepared insert (see above), 12 μl H₂0, and 0.1 μl of T4 DNA ligase (400 U/μl, New England Biolabs) ) . The ligation was allowed to proceed at 16°C overnight and 5 μl of the ligation reaction were transformed into competent E. coli using the procedure of Chung (Proc. Nat. Acad. Sci. USA (1989) 86:2172-2175) . Transformants were screened for the presence of insert by restriction digestion with PvuII and the identity of the insert was verified by sequencing.

The plasmid pUC19RZMZ5 was constructed from pUC19RZMZl by the cloning of a DNA fragment produced by polymerase chain reaction (PCR) (Saiki et al. (1985) Science 230:1350-1354) . Amplification was done in a 100 μl reaction containing 1 μM each of 5' Pstl PCR and RZMZ1→RZMZ5, IX Taq DNA polymerase buffer (Promega Corp., Madison, Wl), 2 mM MgCl₂, 200 μM mixed dNTPs, and 31 μmol PUC19RZMZ1. This mixture was heated to 95°C and 0.5 μl of Taq DNA polymerase (Promega Corp.) was added. The reaction was overlayed with mineral oil and amplified using a thermocycler (Model TRI, Hybaid Limited, Teddington, Middlesex, England) and 20 cycles of (92°C for 30 seconds, 40°C for 30 seconds, 72°C for 15 seconds) followed by 5 min at 72°C. The thermocycler was placed into a 4°C room for this amplification. DNA was purified from the amplification reaction using buffered phenol/CHCl₃, CHCl₃/isoamyl alcohol (25:1), and ethanol precipitation as described above. The DNA was then digested with 20 U of BamHl and Pstl restriction enzymes in a 20 μl reaction at 37°C overnight and purified as in the previous step. The digested product was resuspended in 20 ml of water. BamHl- and Pstl-restricted pUC19 DNA was prepared through gel purification and extraction as described above. Insert and vector were ligated and introduced into bacteria as for pUC19RZMZl and pUC19RZMZ9. The identity of the pUC19RZMZ5 plasmid was verified by sequencing.

Construction of HCVLuc WT (100+100) and HCVLuc SL (100+100) Ribozyme Encoding Plasmids

Plasmids expressing hammerhead ribozymes with long flanking sequences, roughly 100 bases on each side of the hammerhead core, capable of cleaving a hepatitis C virus-luciferase fusion RNA were constructed using a variation of recombinant PCR.

Construction required 2 separate rounds of PCR reactions, the first of which required the plasmid pcHCVLucneo. Briefly, to construct this plasmid, HCV sequences 52-337 were subcloned by PCR from plasmid pH03-65 (Kato et al. (1990) Proc.

Natl. Acad. Sci. (U.S.A.) 87:9524) (Hoffman-LaRoche) . The 5' PCR primer was a T7 primer (5'- TAATACGACTCACTATAGGG-3 ' ; SEQ ID NO: 19) which is upstream of the HCV region in pH03-65. The 3' PCR primer was a 53mer containing about 30 bases complementary to luciferase including a Kasl site found near 5' end, and 18 bases of HCV (5--AATGGCG CCGGGCCTTTCTTTATGTTTTTGGCGTCCGTGCTCATGGTGCACGG-3 ' ; SEQ ID NO:20) . The PCR product was subcloned into pCRII (Invitrogen, San Diego, CA) . The correct sequence was confirmed before the product was cloned into pGEMluc (Promega Corp.) . This fused HCV sequences to luciferase, substituting the first 9 bases of HCV for the first 6 bases of luciferase to make pGEMHCVLuc . HCVLuc sequences were subcloned into pcDNAIneo (Invitrogen) to produce pcHCVLucneo.

The first round of PCR to generate the ribozyme consisted of two reaction: amplification occurred between either a primer encoding the ribozyme or its complement and primers that defined the outermost limits of the final ribozyme (see FIG. 4A-4C) . The last round of PCR joined the half molecules formed in the previous PCR reactions to give the final ribozyme encoding insert ready for cloning into a phage polymerase promoter containing vector. PCR reactions were performed in a 500 μl microfuge tube containing 10 μl of 10X Vent buffer, 10 μl of each primer in primer set #1, 1 μl of 10 mM dNTP stock, and 68 μl of distilled water. To this were added 1 μl o

(10 fmol=10 copies or about 10 ng of plasmid) of target. Another identical PCR reaction was set up, except that it contained 10 μl of each primer in primer set #2 (FIG. 4C) . Both PCR reactions were heated to 95°C and 0.5 μl of Taq:Vent (10:1) were added. Taq DNA polymerase (5 U/μl) was purchased from Promega Corp. and Vent DNA polymerase (2 U/μl) was purchased from New England Biolabs. The reactions were mixed and overlayed with mineral oil. Amplification occurred during 20 cycles of 95°C for 5 sec, 55°C for 30 sec, and 75°C for 30 sec followed by one min at 75°C. At the end of the PCR cycle, the reactions were drawn out from under the mineral oil, placed into separate tubes and extracted with equilibrated ^""^*" phenol:chloroform. The phases were separated by centrifugation for 5 min in a microfuge and the aqueous phases were placed into fresh tubes . DNA was precipitated by the addition of 200 μl of ethanol, mixing, and incubation on ice for 30 min. DNA was recovered by centrifugation for 15 min in a microfuge. The supernatant was removed and the pellets were dried under vacuum. The pellets were dissolved in 20 μl of TE buffer and 4 μl of 6X DNA dye were added. Samples were loaded into an 0.8% agarose TAE gel in IX TAE buffer and electrophoresis was monitored using a hand-held short wave UV light.

When electrophoresis was finished, the gel was placed onto a UV transilluminator and the desired bands were carefully excised, removing as much of the gel outside of the band as possible. The agarose blocks were placed into labelled spin extraction units made as described above, and the assemblies were centrifuged for 5 min in a microfuge. Approximately 50 μl of fluid collected in the 1.5 ml centrifuge tube that fluoresce intensely under UV illumination.

The second round of PCR creates the final insert by taking advantage of the central overlap between the PCR products made in round one. Upon denaturation, a small portion of molecules anneal in a staggered fashion leaving long 5 ' overhangs that may be filled in by polymerase. This population will carries both of the outside primer binding sites and amplify rapidly using these primers to give the desired product.

Amplification occurred in a 100 μl PCR reaction containing 10 μl of 10X Vent buffer, 10 μl of each of the outside primers in primer sets #1 (FIG. 4B) and #2 (FIG. 4C) , 1 μl of 10 mM dNTPs, 68 μl of distilled water, and 0.5 ml (about 1/100 of sample) of each gel purified product from round 1 of PCR. The PCR reaction was heated to 95°C, and 0.5 μl of Taq:Vent (10:1) mix were added, the reaction was mixed and overlayed with mineral oil. Amplification was conducted as above. Upon completion of PCR, the reaction was removed from under the oil, extracted sequentially with an equal volume of buffered phenol/chloroform (1:1 v/v), an equal volume of chloroform/isoamyl alcohol (24:1 v/v), and precipitated with two volumes of ethanol. After 30 min on ice, the product was recovered by centrifugation in a microfuge for 15 min. The pellet was resuspended in 10 μl of TE buffer and 1 μl of PCR product was analyzed on an 0.8% agarose TAE gel by electrophoresis next to appropriate DNA standards . Since the product was of the anticipated length, it was digested with Pstl and BamHl restriction enzymes for cloning into similarly digested and gel purified pBluescript KS+ (Stratagene, La Jolla, CA) . 5 μl of the PCR product were digested in a 20 μl reaction containing IX BamHl restriction enzyme buffer supplemented with IX BSA (both supplied by New England Biolabs) with 20 U each of BamHl and Pstl restriction enzymes overnight at 37°C. Digested DNA was recovered from the restriction digestion by the addition of 30 μl of TE buffer and sequential extraction with 50 μl of buffered phenol/chloroform (1:1 v/v) and then 50 μl of chloroform/isoamyl alcohol (24:1 v/v) . DNA was precipitated with 100 μl of ethanol and collect the DNA by centrifugation as above. The resultant pellet was resuspended in 16 μl of distilled water. To this were added 2 μl of 10X T4 DNA ligase buffer, 1 μl of gel purified, double digested vector, and 0.1 μl of 400000 U/ml T4 DNA ligase. This was incubated overnight at 16°C and 5 μl of this ligation mix were used to transform competent E. coli SURE. Recombinants were screened by small-scale plasmid isolation, restriction digestion, and gel analysis as described above. Plasmids bearing the desired inserts were verified by sequence analysis.

Construction of HCVLuc (100+100) Substrate RNA-Encodinq Plasmid

Plasmid encoding HCVLuc substrate RNA was constructed as above with the following exceptions. Only the first round of PCR was conducted and only with the outside primers in each primer set. This resulted in the amplification of a region of the original HCVLuc plasmid delineated by the outside primers. This DNA insert was cloned in a manner similar to that described above for the product of the second PCR round.

Construction of HCVLuc LS (100+30) Library from HCV SL (100+100) bv PCR

HCVLuc LS (100+30) was constructed from HCV SL (100+100) using the outside primers, Pstl Sense #3 (SEQ ID NO:--) and BamHl T7 (SEQ ID NO:--), and the ribozyme encoding primers, LS Sense (SEQ ID NO:--) and LS coding (SEQ ID NO:—) as described above.

Construction of PCR of HCVLucΔ (100+100) Substrate for Selection from HCV Luc (100+100) Substrate

HCVLucΔ (100+100) was constructed from HCVLuc (100+100) by recombinant PCR using the primer sets [BamHl Coding #2 (SEQ ID NO:9) and HCVΔ Sense (SEQ ID NO:17)], and [Pstl Sense #2 (SEQ ID NO:7) and HCVΔ Coding (SEQ ID NO:18)] for the first round of PCR. This round of PCR provided the target for the next round of PCR using the outside primers BamHl Coding #2 (SEQ ID NO: 9) and Pstl Sense #2 (SEQ ID NO:7) . The product was digested with BamHl and Pstl and cloned into similarly digested pBluescript SK- (Stratagene) as described in detail above. Substrate RNA transcribed from this plasmid contained only ten bases of complementarity with the short arm of HCVLuc LS (100+30) and the 5' cleavage product could be readily dissociated by the addition of urea to 50% saturation and EDTA to 10 mM (see below) .

Transcription and Purification of RZMZ5. RZMZ9. HCVLuc WT (100+100) . and HCVLuc SL (100+100) Ribozymes

Plasmids were prepared using the Qia-Spin kit (Qiagen Inc., Chatsworth, CA) following the manufacturer's protocol. The plasmid was quantitated by measurement of OD₂₆₀ and assuming that a 1 mg/ml solution would have an OD₂₆₀ of 20. 50 μg of plasmid were digested in a 200 μl reaction with 100 units of BamHl (for RZMZ series and HCVLuc (100+100) RNA) or Hindlll (for HCVLuc WT or SL (100+100)) at 37°C for 16 hours. The linearized plasmid was purified by buffered phenol/CHC1₃ and CHCl₃/isoamyl alcohol (25:1) extraction, and precipitated with ethanol as described above. The DNA was resuspended in 50 μl of water to give a 1 μg/μl stock of linearized plasmid.

RNA was transcribed from the linearized RZMZ series plasmids in a 20 μl reaction using the MEGAshortscript T7 kit available from Ambion (Ambion, Inc., Austin, TX) following the manufacturer's instructions up to the removal of template DNA with deoxyribonuclease . RNA was then purified by adding 80 μl of urea dye blue (175 mM NaCl, 5 mM EDTA, 0.5% (w/v) SDS, 7 M urea, and 5 mM Tris-HCl, pH=7.4, and 0.05% (w/v) methylene blue), extracting with buffered phenol/CHCl₃, extracting with CHCl₃/isoamyl alcohol (25:1), and precipitating with ethanol as described above. The pellet was resuspended in 20 μl of formamide dye in preparation for gel purification.

Ribozymes in the HCV series were transcribed in a 20 μl volume using the MEGAscript T7 kit from Ambion following the manufacturer's instructions up to the removal of template DNA with deoxyribonuclease. The reaction was terminated by the addition of 10 μl of 400 mM EDTA, 30 μl of water, and 40 μl of 9 M sodium acetate. After 30 min on ice, the precipitated RNA was recovered by centrifugation in a microcentrifuge for 15 min and dried briefly under vacuum. The pellet was resuspended in 20 μl of formamide dye in preparation for gel purification. RNA was prepared from l/5^th of a 100 μl PCR reaction of HCVLuc LS (100+30) by transcription and work-up as described above.

RNA was gel purified using an 0.25 mm thick, denaturing polyacrylamide gel (10% polyacrylamide for RZMZ series and 5% polyacrylamide for the HCVLuc series) . RNA was visualized by UV shadow excised and eluted out of the gel slice into 200 μl of buffer X (500 mM ammonium acetate, 5 mM EDTA, and 0.5% sodium dodecyl sulfate) for 30 minutes with agitation at room temperature. This solution was removed and retained on ice while RNA was further eluted from the gel slice by the addition of another 300 μl of buffer X followed by incubation for 30 minutes. The solution was removed from the gel slice and combined with the previous extract. 10 μg of rabbit muscle glycogen were added as carrier and the RNA was precipitated by the addition of 2 volumes of ethanol. The RNA was resuspended in 50 μl of water and quantitated by absorption at 260 nm using calculated extinction coefficients .

9. Radiolabelling of Substrate RNA

1 pmol of S2, S2 ' , or S2S RNA was phosphorylated with 40 μCi of γ-³²P ATP (Amersham Corp., Arlington Heights, IL) in a 10 μl reaction containing IX polynucleotide kinase buffer (New England Biolabs, Inc.), 20 U of RNasin (Promega Corp.), and 10 U of polynucleotide kinase at 37 °C for 1 hour. The reaction was stopped by the addition of 10 μl of formamide loading dye for subsequent gel purification (see below) .

_α_³² _p γj^rpp labelled HCVLuc (100₊100) RNA substrate was transcribed in a 10 μl reaction containing 1 μl of T7 RNA polymerase buffer (supplied by New England Biolabs), 0.5 μl of a 10 mM mixed rNTP stock (made by dilution and mixing of 100 mM stocks available from Pharmacia Biotech), 5 μl of α-³²P UTP (Amersham Corp), 0.5 μl of 40 U/μl RNasin (Promega Biotech) , 2 μl of linearized 1 μg/μl plasmid stock, and 1 μl of 50 U/μl T7 RNA polymerase (New England Biolabs) . This reaction was incubated at 37 °C for 1 hour, at which time it was terminated by the addition of 10 μl of formamide loading dye for subsequent gel purification (see below) .

Radiolabelled RNA was gel purified as above for the unlabelled ribozyme RNAs with the exception that visualization was by brief autoradiography. A 10% polyacrylamide denaturing gel was used for S2, a 10% polyacrylamide denaturing gel was used for S2 ' and S2S, and a 5% polyacrylamide denaturing gel was used for HCVLuc (100+100) RNA. The RNA pellet was resuspended in 20 μl of water.

10. Measurement of Kinetic Parameters

Kinetic reactions for the RZMZ series contained 1 μM ribozyme variant, 1 nM substrate, 100 mM KCl, 50 mM Tris-HCl, pH 8.0, and magnesium chloride and calcium chloride as indicated and were incubated at 37°C for the length of time indicated in the figure legends, unless indicated otherwise (see FIGS. 5A, 5B, 6, and 8) . Ribozyme and substrate RNAs were quickly annealed in the absence of divalent cation by heating to 95 °C for 1 minute and rapidly chilling to room temperature. The reaction was initiated by the addition of magnesium and calcium. 2.5 μl aliquots were drawn at the indicated time points and the reaction was stopped by the addition of 7.5 μl of urea dye (see above) and chilling to 0 °C. The amount of substrate cleavage was assayed by electrophoresis of the samples on an 0.8 mm thick, 20% polyacrylamide denaturing gel, detection of the radiolabelled RNA species by autoradiography, excision, and scintillation counting. The data obtained from this experiment are shown in FIGS. 5A and 5B. The relationship of the two ribozymes, RZMZ5, the prototype ribozyme, and RZMZ9, the short-loop, low magnesium variant, is shown in FIGS. 3A and 3B.

Kinetic reactions for the HCVLuc series contained 50 nM ribozyme, 2.5 nM substrate, 100 mM KCl, 50 mM Tris-HCl, pH 8.0, and magnesium chloride as indicated. These reactions were incubated at 37°C for the length of time indicated in the figure legends . Ribozyme and substrate RNAs were annealed by heating to 95°C in 125 mM KCl and 62.5 mM Tris-HCl, pH 8.0 and cooling to 37°C over the course of 30 min. Reactions were then initiated by the addition of 5X magnesium chloride stock. At the indicated times, 10 μl of reaction were withdrawn and stopped in 90 μl of a solution containing 1 mg of tRNA carrier, 10 mM EDTA, and saturated in urea. At the completion of the experiment, samples were heated to 95°C for 5 minutes and then precipitated by the addition of 2 volumes of precipitation mix (66 mM sodium acetate and 1 mM magnesium chloride in ethanol) . RNA was recovered by centrifugation and dried as described above. The pellets were resuspended in 20 μl of formamide loading dye. RNA was analyzed by electrophoresis on a 10% polyacrylamide denaturing gel, followed by autoradiography, and scintillation counting as described above. The data obtained from this experiment are shown 'in FIGS. 9A and 9B.

For those experiments where cleavage rates are reported, rates were determined by plotting the natural logarithm of the fraction uncleaved versus time for experiments done in gross ribozyme excess and fitting the data to a line. The slope of this line was taken to be the rate of the chemical cleavage step, k₂.

11. In Vitro Selection of Ribozymes Cleaving in Low Magnesium

The HCVLuc LS (100+30) library described in Example 6 above was screened for ribozymes capable of cleavage in progressively lower concentrations of magnesium by native gel electrophoresis, taking advantage of a mobility difference between the ribozyme/substrate pair and the ribozyme variant/3 ' product pair brought about by the release of the 5' product upon cleavage. The 5' product, which is approximately 100 bases in length, contains only ten bases of complementarity with the ribozyme. In contrast, the 3' product contains in excess of 100 bases of complementarity, making it possible to selectively release the 5 ' product and leave the 3 ' product hybridized to the ribozyme. Rounds of selection were done in the following way. Approximately 10 pmoles of ribozyme (HCVLuc LS (100+30) and substrate (HCVLucΔ (100+100) were mixed in a volume of 4 μl in each of three 500 μl microcentrifuge tubes. To this were added 2 μl each of 250 mM Tris-HCl, pH=8.0 and 500 mM KCl. The sample was then brought to 95°C for 2 min and cooled to 37°C over 30 min to anneal the RNAs. At the end of this time, one of the three tubes (-Mg⁺⁺) received 2 μl of water, 1 μl of 200 mM EDTA, and 10 μl of urea loading dye (see above) . This sample was stored on ice. The next of the three tubes (+Mg⁺⁺) received 2 μl of 100 mM MgCl₂ and was incubated at 0°C and at 37°C to allow cleavage for at least 5 min prior to termination with EDTA and addition of loading dye and storage on ice as above. The remaining tube (Expt) received 2 μl of 5X MgCl₂ stock to give the desired final magnesium. This tube was incubated at 37°C for 1 min prior to termination of cleavage with EDTA and the addition of loading dye and storage on ice as above. The samples were loaded onto an 0.8 mm thick, 5% polyacrylamide native gel run in TAE buffer (40 mM Tris base, 20 mM acetic acid, and 1 mM Na₂EDTA) . The gel was electrophoresed at 6 V/cm at room temperature until the orange G dye was at the bottom. The gel was stained with ethidium bromide and placed on a UV transilluminator to detect the RNAs. The appropriate band, was excised using +Mg⁺⁺ and -Mg⁺⁺ lanes as guides, and the RNA was eluted from the gel slice by two successive extractions at room temperature with Buffer X (500 mM ammonium acetate, 5 mM EDTA, and 0.5% sodium dodecyl sulfate (200 μl) and then 300 μl) for 1 hr each. The two eluates were pooled, 10 μg of glycogen carrier were added, and the RNA was precipitated by the addition of 2 volumes of ethanol. After centrifugation and brief drying under vacuum, the RNA was resuspended in 100 μl of a solution containing 10 mM EDTA in saturated aqueous urea and transferred to a 500 μl microcentrifuge tube. This solution was heated to 95°C for 5 minutes to denature the extremely stable ribozyme/product hybrid. At the end of this time, 3 μl of 3 M sodium acetate solution were added and the RNA was precipitated with 2 volumes of ethanol . The dried RNA pellet was reverse transcribed and the coding DNA amplified by PCR in a coupled reaction. The RNA was resuspended in 2 μl of 50 μM Pstl Sense #3 primer (SEQ ID NO:8) and 10 ml of water and overlayed with mineral oil. This solution was heated to 95°C and cooled rapidly to 65°C. A pre¬ mixed cocktail consisting of 4 μl of 5X Superscript II RT buffer (GIBCO BRL) , 2 μl 0.1 M DTT, 1 μl of 10 mM dNTPs, 0.5 μl of 40 U/μl RNasin (Promega), and 0.5 μl of Superscript II reverse transcriptase (Gibco BRL) was added and the reaction was incubated at 65°C for 5 min prior to termination by incubation at 95°C for an additional 5 min. At the end of this time, 18 μl of 10X Vent buffer (100 mM KCl, 100 mM (NH₄)₂S0₄, 20 mM MgS0₄, 1% Triton X-100, 200 mM Tris-S0₄, pH 8.8), 20 μl of 600 mM tetramethyl-ammonium chloride, 1 μl of 10 mM dNTPs, 10 μl of Pstl Sense #3 (SEQ ID NO:8), 20 μl of BamHl T7 (SEQ ID NO:14), and 108 μl of water were added. The reaction was then heated to 95°C, 1 μl of 2.5 U/μl Taq DNA polymerase (Promega) was added, and 100 μl were removed into a fresh tube and overlayed with mineral oil. PCR was conducted as above. The reactions were then withdrawn from under the mineral oil and pooled, extracted sequentially with an equal volume of phenol/CHCl₃, and then an equal volume of CHCl₃/isoamyl alcohol, and then precipitated with 2 volumes of ethanol as above. The DNA pellet was resuspended in 20 μl of water, and 5 μl were transcribed as detailed above to yield the next round RNA. 12. Measurement of Ribozvme Activity In Vivo

The PCR generated inserts used to produce the plasmids HCVLuc WT (100+100), HCVLuc SL (100+100), and HCVLuc (100+100) substrate RNA were ligated into pGEM/U6/5'6 (the kind of gift of Dr. Gary R. Kunkel) digested with the restriction enzyme Xhol and gel purified as described above. The orientation of the insert was verified by sequencing using the Sequenase 2.0 kit (United States Biochemicals) , following the manufacturer's directions. Plasmid was purified from the desired transformants using the Qia-Spin kit (Qiagen Inc.) following the manufacturer's protocol. The plasmid was quantitated by measurement of OD₂₆₀ and assuming that a 1 mg/ml solution would have an OD of 20. Plasmid stock solutions were prepared by dilution with water to 1 mg/ml.

HepG2 cells permanently transformed with pcHCVLucneo (see above) were grown in a 24-we11 culture dish in MEM medium (Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum (FBS- Gibco-BRL, Gaithersburg, MA) until almost confluent. Plasmid solutions were mixed with Optimem medium (Gibco-BRL) to a final concentration of 1 μg/ml . Serial dilutions were then performed with Optimem medium to give a range of transformation efficiencies. Lipofectin (Gibco-BRL) was added to a final concentration of 10 μg/ml. Media was aspirated from cells, the cells were washed once with Optimem medium and about 200 μl of Optimem/lipofectin/plasmid mixture was added to each well containing cells . Cells were incubate 6 hours at 37°C and media was removed by aspiration. 500 μl of MEM medium and 10% FBS were added and the cells were incubated overnight. Cells were assayed for decreased luciferase protein activity by aspiration of culture medium, washing once with 1 ml of phosphate buffered saline (PBS-Gibco-BRL) , and lysis in luciferase lysis buffer (prepared from 10X stock-Analytical Luminescense Laboratory, Ann Arbor, MI) , following the manufacturer's protocol. Relative Luminescent Units (RLUs) were measured using an EG & G Instruments Luminat 96 model luminometer (EG & G Instruments, Princeton, NJ) . Ribozyme activity was scored versus a sense and antisense RNA control as a decrease in luminescence.

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention, and are covered by the following claims.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Zillmann, Martin

(ii) TITLE OF INVENTION: RIBOZYME VARIANTS WITH IMPROVED CATALYTIC ACTIVITY UNDER LOW MAGNESIUM CONDITIONS

(iii) NUMBER OF SEQUENCES: 21

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: HALE AND DOOR LLP

(B) STREET: 60 State Street

(C) CITY: Boston

(D) STATE: MA

(E) COUNTRY: USA

(F) ZIP: 02109

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.30

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: US

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/647,577

(B) FILING DATE: 21-MAY-1996

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Kerner, Ann-Louise

(B) REGISTRATION NUMBER: 33,523

(C) REFERENCE/DOCKET NUMBER: HYZ-052CPPCT

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 617-526-6000

(B) TELEFAX: 617-526-5000

(2) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: both

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: RNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1 :

AUCCUUAGUC AGUGUGGAGA AUCCC 25

(2) INFORMATION FOR SEQ ID NO:2 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 69 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: both

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2 :

AACTTTTAGT TTCGGCCTAA CGGCCTCATC AGAGTGTGGA AAATCCCTAT AGTGAGTCGT 60

ATTACTGCA 69

(2) INFORMATION FOR SEQ ID NO:3 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 69 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: both

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3 :

CACGGATCCT TAGTTTCGCT AACGCTCATC AGAGTGTGGA AAATCCCTAT AGTGAGTCGT 60

ATTACTGCA 69 (2) INFORMATION FOR SEQ ID NO:4 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4 :

GTAATACGAC TCACTATAGG G 21

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5 :

CCACTGCAGT AATACGACT 19

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6

CACGGATCCT TAGTTTCGGC CTA 23

(2) INFORMATION FOR SEQ ID NO:7 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7 :

CCACTGCAGG AATTGCCAGG ACGAC 25

(2) INFORMATION FOR SEQ ID NO:8 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8

CCACTGCAGC TGCTAGCCGA GTAGTGT 27

(2) INFORMATION FOR SEQ ID NO:9 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9 :

CACGGATCCG GATAGAATGG CGCC 24

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 46 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

GGCCTTTCGC TGATGAGGCC GTTAGGCCGA AACCCAACAC TACTCG 46

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 46 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

AGTGTTGGGT TTCGGCCTAA CGGCCTCATC AGGCGAAAGG CCTTGT 46

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 42 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12 :

GGCCTTTCGC TGATGAGCGT TAGCGAAACC CAACACTACT CG 42

(2) INFORMATION FOR SEQ ID NO:13 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 42 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

AGTGTTGGGT TTCGCTAACG CTCATCAGGC GAAAGGCCTT GT 42

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 37 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

TAATACGACT CACTATAGGG ATCCGGATAG AATGGCG 37

(2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

CTCATCAGGC GAAAGGCC 18

(2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

GGCCTTTCGC CTGATGAGNN NNCGAAACCC AACAC 35

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: GCCTGGAGAT TTGGGCGTAG TGTTGGGTCG C 31 (2) INFORMATION FOR SEQ ID NO: 18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

GCGACCCAAC ACTACGCCCA AATCTCCAGG C 31

(2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

TAATACGACT CACTATAGGG 20

(2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 53 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

AATGGCGCCG GGCCTTTCTT TATGTTTTTG GCGTCCGTGC TCATGGTGCA CGG 53

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: RNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

CACACUCUGA UGAGCGCGAA ACUAAA 26

Claims

What is claimed is :

1. A ribozyme variant having enhanced catalytic activity under no turnover conditions in the presence of less than or equal to 10 millimolar concentrations of magnesium, the variant comprising:

(a) a stem-loop II region having a 3' terminus and a 5 ' terminus and comprising from one to six 3 ' to 5 ' covalently-linked nucleotides;

(b) first and second core regions, each comprising 3 ' to 5 ' covalently-linked nucleotides, and each having a 3' terminus and a 5' terminus, the first core region having the nucleotide sequence 5 ' -CUGANGAG- 3 ' , wherein N is G, A, U, or C, and the second core region having the nucleotide sequence 5 ' -CGAAA-3 ' , the 3 ' terminus of the first core region being covalently linked to the 5 ' terminus of the stem-loop region, and the 5 ' terminus of the second core region being covalently linked to the 3 ' terminus of the stem-loop II region, the first and second core regions forming a catalytic core; the catalytic core being flanked by (c) first and second flanking regions, each comprising at least nine 3 ' to 5 ' covalently- linked nucleotides, and each having a 3' terminus and a 5 ' terminus, at least a portion of the first flanking region being complementary to a first target region of a substrate RNA molecule, and at least a portion of the second flanking region being complementary to a second target region of the substrate RNA molecule, the 3' terminus of the first flanking region being covalently linked to the 5 ' terminus of the first core region, and the 5 ' terminus of the second flanking region being covalently linked to the 3 ' terminus of the second core region.

2. The ribozyme variant of claim 1, having enhanced catalytic activity under no turnover conditions in the presence of magnesium concentrations from 10 μM to 10 mM.

3. The ribozyme variant of claim 1 wherein the stem-loop II comprises one nucleotide.

4. The ribozyme variant of claim 1 wherein the stem-loop II comprises two self-hybridizing nucleotides.

5. The ribozyme variant of claim 4 wherein the stem-loop II consists essentially of six nucleotides, at least two of which are self- hybridizing.

6. The ribozyme variant of claim 5 wherein the stem-loop II consists of the nucleotide sequence 5 ' -GCGUUAGC-3 ' .

7. The ribozyme variant of claim 5 wherein the stem-loop II has the nucleotide sequence 5'- CGUUAG-3 ' .

8. The ribozyme variant of claim 1 wherein the loop portion of the stem-loop II comprises 3 or 4 nucleotides.

9. The ribozyme variant of claim 1 wherein each flanking region comprises at least 20 nucleotides.

10. The ribozyme variant of claim 1 wherein the flanking regions each comprises from about 10 to 10000 nucleotides.

11. The ribozyme variant of claim 9 wherein the stem-loop II has six nucleotides, two of which are self-hybridizing.

12. The ribozyme variant of claim 1 which is synthetically produced.

13. A ribozyme variant of claim 12 having at least one 2 ' -O-alkylated nucleotide.

14. The ribozyme variant of claim 12 comprising an internucleotide linkage selected from the group consisting of an alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphate triester, phosphoramidate, carbamate, carbonate, acetamidate, and carboxymethyl ester internucleotide linkage.

15. The ribozyme variant of claim 13 comprising an internucleotide linkage selected from the group consisting of an alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphate triester, phosphoramidate, carbamate, carbonate, acetamidate, and carboxymethyl ester internucleotide linkage.

16. The ribozyme variant of claim 1 having from about 10 to 300 fold increase in catalytic activity relative to a wild type hammerhead ribozyme.

17. A plasmid encoding the ribozyme variant of claim 1.

18. A plasmid encoding the ribozyme variant of claim 6.

19. A plasmid encoding the ribozyme variant of claim 7.

20. A method of controlling the expression of a target RNA molecule in the presence of less than 11 millimolar concentrations of magnesium under no turnover conditions, comprising the steps of:

(a) providing a ribozyme variant comprising: (i) a stem-loop II region having a 3' terminus and a 5 ' terminus and comprising from one to six 3 ' to 5 ' covalently-linked nucleotides;

(ii) first and second core regions, each comprising 3' to 5 ' covalently-linked nucleotides, and each having a 3' terminus and a 5' terminus, the first core region having the nucleotide sequence 5 ' -CUGANGAG-3 ' , wherein N is G, C, A, or U, and the second core region having the nucleotide sequence, 5'- CGAAA-3 ' , the 3 ' terminus of the first core region being covalently linked to the 5' terminus of the stem-loop region, and the 5 ' terminus of the second core region being covalently linked to the 3 ' terminus of the stem-loop II region, the first and second core regions forming a catalytic core; the catalytic core being flanked by

(iii) first and second flanking regions, each comprising at least nine 3' to 5 ' covalently-linked nucleotides, and each having a 3 ' terminus and a 5 ' terminus, at least a portion of the first flanking region being complementary to a first target region of a substrate RNA molecule, and at least a portion of the second flanking region being complementary to a second target region of the substrate RNA molecule, the 3' terminus of the first flanking region being covalently linked to the 5 ' terminus of the first core region, and the 5 ' terminus of the second flanking region being covalently linked to the 3 ' terminus of the second core region;

(b) contacting a target RNA molecule with the ribozyme variant in the presence of less than 11 millimolar concentrations of magnesium, such that the first flanking region hybridizes to the first target region of the RNA molecule and the second flanking region hybridizes to the second target region of the RNA molecule,

the ribozyme variant cleaving the RNA molecule and thereby controlling expression of the RNA.

21. The method of claim 20 wherein the target RNA is contacted with the ribozyme variant under physiological conditions.

22. The method of claim 20 wherein the target RNA is contacted with the ribozyme variant in the presence of from about 0.1 mM to about 5 mM magnesium.

23. The method of claim 22 wherein the target RNA is contacted with the ribozyme variant in the presence of about 1 mM magnesium.

24. The method of claim 22 wherein the target RNA is in a cell, and the contacting step comprises the step of administering the ribozyme variant to the cell such that the variant contacts the substrate RNA.

25. The method of claim 24 wherein the ribozyme variant is administered to the cell by microinjection.

26. The method of claim 22 wherein the target RNA is in a cell, and the contacting step comprises the step of administering a nucleotidic vector comprising DNA encoding the ribozyme variant to the cell, such that the variant is transcribed from the DNA and allowed to contact the target RNA.

27. The method of claim 26 wherein the vector is a plasmid which is transfected into the cell.

28. The method of claim 26 wherein the vector is a plasmid which is microinjected into the cell.

29. A method of site-specifically cleaving a single-stranded, RNA-containing substrate molecule in the presence of less than 11 millimolar concentrations of magnesium, comprising the steps of:

(ii) first and second core regions, each comprising 3 ' to 5 ' covalently-linked nucleotides, and each having a 3" terminus and a 5' terminus, the first core region having the nucleotide sequence 5 ' -CUGANGAG-3 ' , wherein N is G, C, A, or U, and the second core region having the nucleotide sequence, 5'-

CGAAA-3 ' , the 3 ' terminus of the first core region being covalently linked to the 5 ' terminus of the stem-loop region, and the 5 ' terminus of the second core region being covalently linked to the 3 ' terminus of the stem-loop II region, the first and second core regions forming a catalytic core; the catalytic core being flanked by

(iii) first and second flanking regions, each comprising at least nine 3' to 5' covalently-linked nucleotides, and each having a 3 ' terminus and a 5 ' terminus, at least a portion of the first flanking region being complementary to a first target region of a substrate RNA molecule, and at least a portion of the second flanking region being complementary to a second target region of the substrate RNA molecule, the 3 ' terminus of the first flanking region being covalently linked to the 5 ' terminus of the first core region, and the 5 ' terminus of the second flanking region being covalently linked to the 3 ' terminus of the second core region;

(b) contacting the RNA-containing substrate molecule with the ribozyme variant in the presence of from about 0.5 mM to 10 mM magnesium such that the first flanking region of the ribozyme variant hybridizes to the first target region of the substrate molecule, and the second flanking region of the ribozyme variant hybridizes to the second target region of the substrate molecule,

the ribozyme variant cleaving the RNA in the molecule.

30. A stem-loop II-catalytic core structure of a ribozyme variant, the variant having enhanced catalytic activity under no turnover conditions in the presence of less than or equal to 10 millimolar concentrations of magnesium, the structure comprising:

(a) a stem-loop II region having a 3' terminus and a 5 ' terminus and comprising from one to six 3 ' to 5 ' covalently-linked nucleotides; flanked by

(b) first and second core regions, each comprising 3 ' to 5 ' covalently-linked nucleotides, and each having a 3' terminus and a 5' terminus, the first core region having the nucleotide sequence 5 ' -CUGANGAG- 3', wherein N is G, A, U, or C, and the second core region having the nucleotide sequence 5 ' -CGAAA-3 ' , the 3' terminus of the first core region being covalently linked to the 5' terminus of the stem-loop region, and the 5 ' terminus of the second core region being covalently linked to the 3 ' terminus of the stem-loop II region, the first and second core regions forming a catalytic core.

31. The structure of claim 30 which is synthetic.

32. The structure of claim 31 further comprising first and second flanking regions, each flanking region comprising a plurality of 3 ' to 5 ' covalently-linked nucleotides, and each flanking region having a 3' terminus and a 5' terminus, at least a portion of the first flanking region being complementary to a first target region of a substrate RNA molecule, and at least a portion of the second flanking region being complementary to a second target region of the substrate RNA molecule, the 3 ' terminus of the first flanking region being covalently linked to the 5 ' terminus of the first core region, and the 5' terminus of the second flanking region being covalently linked to the 3 ' terminus of the second core region.

33. The structure of claim 32 wherein the flanking regions each include less than 10 nucleotides.

34. The structure of claim 31 comprising at least one non-phosphodiester internucleotide linkage selected from the group consisting of an alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphate triester, phosphoramidate, carbamate, carbonate, acetamidate, and carboxymethyl ester internucleotide linkage.

35. The structure of claim 32 comprising at least one non-phosphodiester internucleotide linkage selected from the group consisting of an alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphate triester, phosphoramidate, carbamate, carbonate, acetamidate, and carboxymethyl ester internucleotide linkage.

36. The structure of claim 31 comprising at least one 2 ' -O-alkylated ribonucleotide.

37. The structure of claim 32 comprising at least one 2 ' -O-alkylated ribonucleotide.

38. The ribozyme variant of claim 4, wherein the stem-loop II consists essentially of four nucleotides, at least two of which are self- hybridizing.

39. The ribozyme variant of claim 38, wherein the stem-loop II has a nucleotide sequence selected from the group consisting of 5 ' -CGUG-3 ' , 5 ' -CGAG-

3 ' , and 5 ' -CGCG-3 ' .

40. The ribozyme variant of claim 38, wherein the first core region has the nucleotide sequence

5 '-CUGAUGAG-3 ' .

41. A method of selecting for a ribozyme variant having enhanced catalytic activity under no turnover conditions, the method comprising performing a selection round, the selection round comprising the steps of:

(a) contacting an RNA-containing substrate molecule with a ribozyme variant in the presence of a concentration of magnesium from about 10 millimolar to about 10 micromolar and at a temperature of from about -5°C to about 25°C, wherein a first flanking region of the ribozyme variant hybridizes to a first target region of the RNA-containing substrate molecule, and a second flanking region of the ribozyme variant hybridizes to a second target region of the RNA-containing substrate molecule, the hybridized ribozyme variant cleaving the RNA-containing substrate;

(b) identifying the ribozyme variant which has cleaved the RNA-containing substrate; and

(c) isolating the ribozyme variant.

42. The method of claim 41 wherein contacting step (a) is performed at about 0°C.

43. The method of claim 41 wherein the ribozyme variant is identified by electrophoresis.

44. The method of claim 41, wherein two or more selection rounds are performed, wherein in the first selection round, the concentration of magnesium is from 10 millimolar to greater than 10 micromolar, and wherein in each successive selection round, the concentration of magnesium is decreased relative to the magnesium concentration of a preceding selection round.

45. The method of claim 44, wherein three selection rounds are performed, the magnesium concentration in a first selection round is 1 millimolar; the magnesium concentration in a second selection round is 100 micromolar; and the magnesium concentration in a third selection round is 10 micromolar.

46. A plasmid encoding the ribozyme variant of claim 39.

47. A plasmid encoding the ribozyme variant of claim 40.