WO1999061064A1

WO1999061064A1 - Mammalian genes encoding 3'-5' exonuclease

Info

Publication number: WO1999061064A1
Application number: PCT/US1999/010578
Authority: WO
Inventors: Fred W. Perrino
Original assignee: Wake Forest University
Priority date: 1998-05-22
Filing date: 1999-05-14
Publication date: 1999-12-02
Also published as: WO1999061064A8; AU4077399A

Abstract

Genes encoding 3'-5' exonucleases have been isolated and identified. A human exonuclease independent of DNA polymerase is produced in host cells from recombinant vectors. Methods of use include inhibition of exonuclease activity to increase incorporation of nucleotide analogs into DNA in rapidly dividing cells.

Description

MAMMALIAN GENES ENCODING 3'-5' EXONUCLEASE BACKGROUND OF THE INVENTION

There are a growing number of antmeoplastic and antiviral agents such as the nucleoside analogs and dideoxy nucleosides that act as anti-metabolites by inhibiting nucleic acid polymerization, or elongation Some resistance or ineffectiveness of these agents may be due to an exonuclease activity that removes the analog from the nucleic acid molecule and permits the analog to be replaced with the correct nucleoside

As an example of such a therapy for treatment of acute myeloblastic leukemia (AML) includes administration of 1-β-D-arabmofuranosylcytosιne (araC), an analog of dCTP and potent inhibitor of DNA replication For a review, see Gilman, et al (Eds ), The Pharmacological Basis of Therapeutics, Eighth Edition, Pergamon Press, New York (1990). pp 1230-1232 Despite the well established therapeutic value of araC, the precise mechanism by which cell death is induced is unclear. One possibility is that inhibition of DNA synthesis without concomitant suppression of RNA and protein synthesis leads to "unbalanced growth" resulting in increased cell volume and ultimately cell death. In araC treatment, it has been observed that a large number of AML patients are initially refractory to the drug or later develop resistance to araC resulting in failure of therapy in the long term It is believed that araC resistance aπses in part from the relative activities of metabolic enzymes that participate in conversion of araC to araCTP and ultimately to an inactive araUMP. Other factors which may influence araC efficacy include (l) the ability of cells to transport araC, (n) deoxycytidme kinase deficiency, (in) increased CTP synthase activity which gives πse to increased intracellular dCTP that may inhibit araC activity, (iv) cytidme deammase activity, and/or (v) coordinated polymerase/exonuclease activities Changes in araC structure and/or intracellular concentration relative to analogous compounds may alter affinity of DNA polymerases for araC, thereby resulting in decreased incorporation of the analog into replicating DNA and decreased efficacy of araC chemotherapy regimens

Thus there exists a need in the art to identify metabolic factors which modulate the ability of chemotherapeutic agents to effect cell killing Isolation of polypeptides, and their underlying polynucleotide sequences that modulate araC activity would permit the design and identification of therapeutics that regulate the biological activity of the polypeptides and increase efficiency of chemotherapeutic agent at lower doses Treatment regimens including lower doses of a chemotherapeutic agent may be more easily tolerated in patients, reduce unpleasant side effects, and increase overall efficiency of the treatment program.

SUMMARY OF THE INVENTION The present invention addresses certain shortcomings in the fields of anti-cancer and anti-viral therapies by providing isolated 3'-5' exonucleases that are not linked to any polymerase activity, and that are shown herein to be involved in decreasing the effectiveness of certain therapeutic compounds. For example, agents such as nucleoside analogs and chain- terminating dideoxynucleotides, which are used as therapeutic agents against proliferating cells, are removed from a cellular or viral genome by the disclosed exonucleases during treatment, allowing the cell or virus to continue to proliferate. In light of the present disclosure, these isolated exonucleases may be inhibited or even eliminated from a cell containing an anti-proliferative therapeutic agent in order to increase the effectiveness of such an agent. Disclosed herein are isolated nucleic acid molecules of from about 708 to about 1238 nucleotides in length that include a gene, or the full length complement of a gene, that gene encodes a polypeptide, or protein, that includes the amino acid sequence of those sequences designated herein as SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:31 or SEQ ID NO:33, and conservative variants of these polypeptides. Conservative variants of a polypeptide typically contain an alternative amino acid at one or more sites within the protein. Substitutions preferably are conservative, that is, one amino acid is replaced with one of similar size and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine, glutamine, or glutamate; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Conservative variants may also include small deletions or insertions of amino acids, so long as the protein maintains its enzymatic activity.

For example, insertional variants may include fusion proteins such as those used to allow rapid purification of the polypeptide and also may include hybrid proteins containing sequences from other proteins and polypeptides which are homologues of the polypeptide. For example, an insertional variant may include portions of the amino acid sequence of the polypeptide from one species, together with portions of the homologous polypeptide from another species. Other insertional variants may include those in which additional amino acids are introduced within the coding sequence of the polypeptide. These typically are smaller insertions than the fusion proteins described above and are introduced, for example, to disrupt a protease cleavage site, or to aid in chromatographic purification of the polypeptide.

In certain embodiments, the polypeptides or proteins disclosed herein are encoded by the nucleic acid sequences designated herein as SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:30, SEQ ID NO:32, or the complement, or full length complement of any of these. As used herein the term "complement" is used to define a second strand of nucleic acid that will hybridize to a first nucleic acid sequence to form a double stranded molecule under highly stringent conditions. Highly stringent conditions are those that allow hybridization between two nucleic acid sequences with a high degree of homology, but precludes hybridization of random sequences. For example, hybridization at low temperature and/or high ionic strength is termed low stringency and hybridization at high temperature and/or low ionic strength is termed high stringency. In a general sense, a low stringency hybridization may include conditions of 0.15 M to 0.9 M NaCl at a temperature range of 20°C to 50°C. High stringency may generally include conditions of 0.02 M to 0.15 M NaCl at a temperature range of 50°C to 70°C. Preferred nucleic acid segments as disclosed herein are those that hybridize to the nucleic acid sequences designated herein as SEQ ID NOS:l, 3, 30, and 32 under conditions including hybridization at 50°C in lx SSC, and washing at 65°C in O.lx SSC. As known in the art, lxSSC is a solution containing about 8.76 grams/liter NaCl and about 4.41 grams/liter sodium citrate. The temperature and ionic strength of a desired stringency are understood to be applicable to particular probe lengths, to the length and base content of the sequences and to the presence of formamide, tetramethylammonium chloride or other solvents in the hybridization mixture. It is also understood that these ranges are mentioned by way of example only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to positive and negative controls. To hybridize is understood to mean the forming of a double stranded molecule or a molecule with substantial double stranded nature. Equations have been derived to relate duplex formation to the major variables of temperature, salt concentration, nucleic acid strand length and composition, and formamide concentration. Eg: 1. Tm = 81.5 - 16.6(log[Na⁺]) + 0.41 (%GC) - 600/N

(Tm = temperature for duplex to half denature; N = chain length

2. Tm = 81.5 - 16.6(log[Na⁺] + 0.41(%GC) - 0.63(% formamide) - 600 N

One can thus predict whether complementary strands will exist in double-stranded or single-stranded form under a given set of conditions, and can determine high stringency conditions based on knowledge of the nucleotide sequences.

It is understood in the art that a nucleic acid sequence will hybridize with a complementary nucleic acid sequence under high stringency conditions even though some mismatches may be present. Such closely matched, but not perfectly complementary sequences are also encompassed by the present invention. For example, differences may occur through genetic code degeneracy, or by naturally occurring or man made mutations and such mismatched sequences would still be encompassed by the present disclosure. A complement may also be described, therefore, as a fragment of DNA (nucleic acid segment) or a synthesized single stranded oligomer that may contain small mismatches or gaps when hybridized to its complement, but that is able to hybridize to the complementary DNA under high stringency conditions. The full length complement is understood to indicate that the two molecules hybridize along the fall length of the gene or complementary region. For example the full length complement of a gene would be a complementary molecule that is complementary along the entire gene rather than complementary to only a small portion of the gene. It is also understood that a nucleic acid strand that includes the full length complement of a gene may also contain extraneous nucleotides flanking the complementary region, or linked to either end of the complementary region and such strands would still be defined as the full length complement of the gene. The nucleic acid molecules disclosed herein are, in certain embodiments, operatively linked to a promoter, and may be operatively linked to a heterologous promoter, and may be linked to any appropriate promoter known in the art that is appropriate for the particular application. For example, certain promoters may be chosen for expression in a particular type of cell, or for high expression, or even for inducible expression of the gene of interest. The selection of such promoters is well known and routine in the art, and a comprehensive list of all available promoters is available from various sources to those in the art. A gene as disclosed herein may also be linked to various markers known in the art to monitor transformation efficiency or to otherwise detect the presence of the gene. Such markers are also routine and known in the art.

The nucleic acids of the present disclosure may also be contained in a vector. A vector used in the practice of the invention may be a plasmid, a viral vector, and also may be an expression vector that directs expression of the disclosed genes in an appropriate host cell. Vectors as described herein may be compatible with certain host cells such as bacterial cells, yeast, plant, animal, or even mammalian cells. Certain aspects of the disclosure may also include vectors contained in host cells.

In certain embodiments, the present disclosure encompasses compositions containing purified or partially purified proteins or polypeptides. Such partially purified polypeptides having a 3 '-5' exonuclease activity, and including those having or including the amino acid sequences designated herein as SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:31 or SEQ ID NO:33, or a conservative variant of any thereof. A polypeptide as disclosed herein may be a naturally occurring protein that is isolated from a cell, such as a mammalian cell or even a mouse or human cell, using chromatographic or other techniques as disclosed herein or known in the art. Such techniques generally include isolation of a particular fraction of a cell culture, such as the aqueous fraction, for example, and a protein precipitation in the presence of an ammonium salt, such as ammonium sulfate.

Polypeptides as disclosed herein may also be recombinant proteins or polypeptides expressed from a manmade vector or isolated gene. Such recombinant proteins may also be isolated from a cell culture as described for the naturally occurring proteins, but are often "overexpressed" at a higher level than normal.

As such, a method for producing a polypeptide having 3'-5- exonuclease activity is also disclosed herein. Such a method may include obtaining a nucleic acid molecule including a gene encoding a polypeptide including the sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:31, or SEQ ID NO:33, or a conservative variant of any thereof, operatively linked to a promoter sequence; transferring the nucleic acid molecule into a host cell; and growing the host cell under condition effective to express the gene. In certain embodiments, the method may further include isolating the polypeptide from a host cell or from the medium of its growth. It is also understood that in certain embodiments a recombinantly produced protein may be used in the intracellular compartment where it is expressed, in a candidate screening assay for example, and such methods would not require isolation of the protein product. Proteins and polypeptides of the invention may be produced in any appropriate cell, including but not limited to bacterial cells, and eukaryotic cells such as mammalian cells.

The present disclosure also encompasses antibodies specifically immunoreactive with a polypeptide that includes the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:31 or SEQ ID NO:33. Antibodies may be polyclonal or monoclonal antibodies, although monoclonal antibodies are preferred for certain embodiments, and may also include anti- idiotype antibodies specifically immunoreactive with the disclosed antibodies.

An aspect of the present disclosure is a method of identifying an effector of a 3'-5' exonuclease activity. This method includes obtaining a candidate substance; contacting a 3'-5' exonuclease polypeptide composition with a substrate in the presence and absence of the candidate substance; and detecting 3'-5' exonuclease activity in the presence and absence of the candidate substance; wherein a change in activity of the exonuclease in the presence of the candidate substance is indicative of an effector of 3'-5' exonuclease activity. Also encompassed herein are effectors of 3'-5' exonuclease activity identified by this method, and pharmaceutical compositions including such an effector. An effector of exonuclease activity may be an activator or an inhibitor of the enzymatic activity, or even of the expression of the protein in a cell.

A method of identifying an inhibitor of 3'-5' exonuclease activity may include obtaining a candidate substance; growing a cell culture in the presence of a nucleoside analog that is incorporated into a nucleic acid molecule and inhibits polymerization of the molecule when incorporated therein, wherein the cells express a 3'-5- exonuclease activity; contacting the cell culture with the candidate substance; growing an identical cell culture that is not contacted with the candidate substance; and comparing the cell growth in the presence and absence of the candidate substance; wherein a decrease in cell growth in the presence of the candidate substance is indicative of an inhibitor of 3'-5' exonuclease activity.

This screening assay may include obtaining a candidate substance, which can come from any source. For example, it is proposed that compounds isolated from natural sources such as fungal extracts, plant extracts, bacterial extracts, higher eukaryotic cell extracts, or even extracts from animal sources, or marine, forest or soil samples, may be assayed for the presence of potentially useful pharmaceutical agents. In addition, man made substances which would include, but are not limited to, nucleic acid analogs or other compounds designed de novo based on the predicted protein structure of the exonuclease enzyme, may also be screened for possible use as pharmaceutical agents. It is also understood that antibodies and other isolated or purified, but naturally occurring compounds, could be screened by this process. The active compounds may include fragments or parts of naturally- occurring compounds or may be only found as active combinations of known compounds which are otherwise inactive.

The present disclosure also includes methods of inhibiting the replication of a nucleic acid molecule in a cell that expresses a 3'-5' exonuclease activity comprising contacting said cell with a nucleic acid polymerization inhibitor such as a nucleoside analog or a dideoxy nucleotide, and further contacting the cell with an inhibitor of the 3'-5' exonuclease activity. This method may preferably be practiced in any type of cell, including, but not limited to, a mammalian cell, a human cell, or even a human cancer cell. The method is particularly advantageous when applied to a proliferating tumor or cancer cell, or a virally infected cell, such as a mammalian cell infected with a virus, and including T-cells and monocyte/macrophage. Viruses would include, but not be limited to, retroviruses including HIV, herpes simplex viruses (1 and 2), Epstein-Barr viruses, varicella-zoster viruses, influenza viruses, Lassa fever, infectious hepatitis, dengue fever, measles, respirator}' syncytial viruses, vaccinia viruses, and cytomegaloviruses, for example. As a part of this method, one may include any dideoxynucleotide, such as ddATP, ddGTP, ddCTP, ddUTP, ddTTP or even ddlTP, and may also include nucleoside analogs, and compounds that are converted to nucleoside analogs in the cell. Such drugs would include cytarabine, fluorouracil, mercaptopurine, thioguanine, acyclovir, didanosine, ganciclovir sodium, idoxuridine, ribavirin, trifluridine, zalcitabine, azacitidine, and zidovudine, for example.

Also disclosed are methods of identifying a compound as a specific binding partner of the exonuclease polypeptide. In a preferred method, the specific binding partner modulates activity of the exonuclease polypeptide. In a most preferred embodiment, the methods of the invention identify compounds that inhibit biological activity of the exonuclease polypeptide. It is contemplated that compounds that interact with active site amino acids, such as amino acids 2 through 17, 111 through 125, or 181 through 196 of SEQ ID NO:2, or amino acids 8 through 24, 114 through 128, or 184 through 199 of SEQ LD NO:4 may be particularly useful.

The invention also provides methods to identify an inhibitor compound of an exonuclease biological activity comprising the steps of a) contacting the exonuclease polypeptide encoded by a polynucleotide of the invention with a substrate in the presence and absence of a test compound; b) comparing biological activity of the exonuclease polypeptide in the presence and absence of the test compound; and c) identifying the test compound as an inhibitor compound when biological activity of the exonuclease polypeptide is decreased in the presence of the test compound. Also provided are inhibitors identified by the method and pharmaceutical compositions comprising an inhibitor identified by the method of the invention.

The invention further provides methods for increasing incorporation of a nucleotide analog into replicating DNA in a cell comprising the steps of, a) contacting the cell with a nucleotide analog, and b) contacting the cell with an inhibitor of an exonuclease polypeptide activity encoded by a polynucleotide as disclosed herein. In a preferred method, the exonuclease is selected from the group consisting of TREXlh, TREX2h, TREXlm, or TREX2m . The inhibitor may be a substrate analog, an antibody, an antisense molecule, or inhibitor of either gene expression or enzymatic activity. An inhibitor may be included in a pharmaceutical composition including a nucleotide analog such as araC, or chain terminating nucleotide such as a dideoxy nucleotide, or it may be administered separately.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides polypeptides and underlying polynucleotides for a novel exonuclease family of proteins exemplified by human and mouse 3'-5' exonucleases, termed by the inventor TREXlh, TREX2h, TREXlm and TREX2m, renamed from the designation of Exolh, Exo2h, Exolm and Exo2m as used in previous applications. The invention includes both naturally occurring and non-naturally occurring exonuclease polynucleotides and polypeptide products thereof. Naturally occurring exonuclease products include distinct gene and polypeptide species within the exonuclease family. These species include those that are expressed within cells of the same animal as well as corresponding species homologs expressed in cells of other animals. Within each exonuclease species, the invention further provides splice variants encoded by the same polynucleotide but which arise from distinct mRNA transcripts. Non-naturally occurring exonuclease products include variants of the naturally occurring products such as analogs and exonuclease products altered through covalent modifications. The exonuclease family is distinguished from previously known exonuclease families in that these enzymes are the only known 3'-5' exonucleases that are not associated with polymerase activity.

In a preferred embodiment, the invention provides polynucleotides encoding human exonucleases comprising the sequences set forth in SEQ LD NOs: 1 and 3. The invention also embraces polynucleotides encoding the amino acid sequences set out in SEQ ID NOs: 2 and 4. A presently preferred polypeptide of the invention comprises the amino acid sequences set out in SEQ ID NO: 2 or 4.

The present invention provides novel purified and isolated polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands, including splice variants thereof) encoding the human exonucleases. DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. "Synthesized," as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides. "Wholly" synthesized DNA sequences are, therefore, produced entirely by chemical means, and "partially" synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means. A preferred DNA sequence encoding a human TREXlh (Exo 1) polypeptide is set out in SEQ LD NO: 1, a preferred DNA sequence encoding a human TREX2h (Exo2h) polypeptide is set out in SEQ ID NO: 3, a preferred DNA sequence encoding a murine TREXlm polypeptide is set out in SEQ ID NO: 30, and a preferred DNA sequence encoding a murine TREX2m polypeptide is set out in SEQ D NO: 32. The worker of skill in the art will readily appreciate that the preferred DNAs of the invention comprise a double stranded molecule, for example, the molecule having the sequence set forth in SEQ ID NO: 1 along with the complementary molecule (the "non-coding strand" or "complement") having a sequence deducible from the sequence of SEQ ID NO: 1 according to Watson-Crick base pairing rules for DNA. Also preferred are polynucleotides encoding the polypeptides of SEQ LD NOs: 2 and 4, respectively. The invention further embraces species, preferably mammalian, homologs of the human exonuclease DNAs.

The invention also embraces polynucleotide sequences encoding exonuclease species that exhibit greater than 45% identity to the polynucleotide set out in SEQ ID NO: 1 and hybridize under highly stringent conditions to the non-coding strand, or complement, of the polynucleotides in SEQ LD NO: 1. Identity herein is determined using GAP program alignment (GCG software) with parameters of (i) gap weight 50, (ii) length weight 3, (iii) average match 10.0, and (iv) average mismatch 0.0. The worker of ordinary skill will realize that other methods for determining identity can easily be applied under conditions/parameters similar to those described herein. DNA sequences encoding exonuclease polypeptides that would hybridize thereto but for the redundancy of the genetic code are contemplated by the invention. Exemplary highly stringent hybridization conditions are as follows: hybridization at 50°C in lx SSC, and washing at 65°C in O.lx SSC. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described Ausebel, et al. (Eds.), Protocols in Molecular Biology, John Wiley& Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook, et al, (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (1989), pp. 9.47 to 9.51.

Autonomously replicating recombinant expression constructions such as plasmid and viral DNA vectors incorporating exonuclease-encoding sequences are also provided. Expression constructs wherein exonuclease-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. The genes can be expressed in any number of different recombinant DNA expression systems to generate large amounts of the polypeptide product, which can then be purified and used to vaccinate animals to generate antisera with which further studies may be conducted, or to screen candidate substances for inhibitors or effectors of exonuclease activity.

Examples of expression systems known to the skilled practitioner in the art include bacteria such as E. coli, yeast such as Pichia pastoris, baculovirus, and mammalian expression systems such as in COS or CHO cells. A complete gene can be expressed or, alternatively, fragments of the gene encoding portions of polypeptide can be produced.

The gene or gene fragment encoding a polypeptide may be inserted into an expression vector by standard subcloning techniques. An E. coli expression vector may be used which produces the recombinant polypeptide as a fusion protein, allowing rapid affinity purification of the protein. Examples of such fusion protein expression systems are the giutathione S- transferase system (Pharmacia, Piscataway, NJ), the maltose binding protein system (NEB, Beverley, MA), the FLAG system (LBI, New Haven, CT), and the 6xHis system (Qiagen, Chatsworth, CA).

Some of these systems produce recombinant polypeptides bearing only a small number of additional amino acids, which are unlikely to affect the antigenic ability of the recombinant polypeptide. For example, both the FLAG system and the 6xHis system add only short sequences, both of which are known to be poorly antigenic and which do not adversely affect folding of the polypeptide to its native conformation. Other fusion systems are designed to produce fusions wherein the fusion partner is easily excised from the desired polypeptide. In one embodiment, the fusion partner is linked to the recombinant polypeptide by a peptide sequence containing a specific recognition sequence for a protease. Examples of suitable sequences are those recognized by the Tobacco Etch Virus protease (Life Technologies, Gaithersburg, MD) or Factor Xa (New England Biolabs, Beverley, MA).

The expression system used may also be one driven by the baculovirus polyhedron promoter. The gene encoding the polypeptide may be manipulated by standard techniques in order to facilitate cloning into the baculovirus vector. One baculovirus vector is the pBlueBac vector (Invitrogen, Sorrento, CA). The vector carrying the gene for the polypeptide is transfected into Spodoptera frugiperda (Sf9) cells by standard protocols, and the cells are cultured and processed to produce the recombinant antigen. See Summers et al, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station; U.S. Patent No. 4,215,051 (incorporated by reference).

Major antigenic determinants of the polypeptide may be identified by an empirical approach in which portions of the gene encoding the polypeptide are expressed in a recombinant host, and the resulting proteins tested for their ability to elicit an immune response. For example, PCR may be used to prepare a range of peptides lacking successively longer fragments of the C-terminus of the protein. The immunoprotective activity of each of these peptides then identifies those fragments or domains of the polypeptide which are essential for this activity. Further studies in which only a small number of amino acids are removed at each iteration then allows the location of the antigenic determinants of the polypeptide. A method that may be used for the preparation of the polypeptides as disclosed herein is the use of peptide mimetics. Mimetics are peptide-containing molecules which mimic elements of protein secondary structure. See, for example, Johnson et al, "Peptide Turn Mimetics" in BIOTECHNOLOGY AND PHARMACY, Pezzuto et al, Eds., Chapman and Hall, New York (1993). The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and antigen. A peptide mimetic is expected to permit molecular interactions similar to the natural molecule.

The nucleic acid sequences disclosed herein may be expressed as encoded peptides or proteins. The engineering of DNA segment(s) for expression in a prokaryotic or eukaryotic system may be performed by techniques generally known to those of skill in recombinant expression. It is believed that virtually any expression system may be employed in the expression of the claimed nucleic acid sequences.

Both cDNA and genomic sequences are suitable for eukaryotic expression, as the host cell will generally process the genomic transcripts to yield functional mRNA for translation into protein. In addition, it is possible to use partial sequences for generation of antibodies against discrete portions of a gene product, even when the entire sequence of that gene product remains unknown. Computer programs are available to aid in the selection of regions which have potential immunologic significance. For example, software capable of carrying out this analysis is readily available commercially, for example Mac Vector (LBI, New Haven, CT). The software typically uses standard algorithms such as the Kyte/Doolittle or Hopp/Woods methods for locating hydrophilic sequences which are characteristically found on the surface of proteins and are, therefore, likely to act as antigenic determinants.

As used herein, the terms "engineered" and "recombinant" cells are intended to refer to a cell into which an exogenous DNA segment or gene, such as a cDNA or gene has been introduced through the hand of man. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced exogenous DNA segment or gene. Recombinant cells include those having an introduced cDNA or genomic gene, and also include genes positioned adjacent to a heterologous promoter not naturally associated with the particular introduced gene.

To express a recombinant encoded protein or peptide, whether mutant or wild-type, in accordance with the present invention one would prepare an expression vector that comprises one of the claimed isolated nucleic acids under the control of, or operatively linked to, one or more promoters. To bring a coding sequence "under the control of a promoter, or to "operatively link to a promoter," one positions the 5¹ end of the transcription initiation site of the transcriptional reading frame generally between about 1 and about 50 nucleotides "downstream" (i.e., 3') of the chosen promoter. The "upstream" promoter stimulates transcription of the DNA and promotes expression of the encoded recombinant protein. This is the meaning of "recombinant expression" in this context.

Many standard techniques are available to construct expression vectors containing the appropriate nucleic acids and transcriptional/translational control sequences in order to achieve protein or peptide expression in a variety of host-expression systems. Cell types available for expression include, but are not limited to, bacteria, such as E. coli and B. subtilis transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors.

Certain examples of prokaryotic hosts are E. coli strain RRl, E. coli LΕ392, E. coli B, E. coli X 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No. 273325); bacilli such as Bacillus subtilis; and other enterobacteriaceae such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

In general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli is often transformed using pBR322, a plasmid derived from an E. coli species. pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR plasmid, or other microbial plasmid or phage must also contain, or be modified to contain, promoters which may be used by the microbial organism for expression of its own proteins. In addition, phage vectors containing replicon and control sequences that are compatible with the host microorganism may be used as fransforming vectors in connection with these hosts. For example, the phage lambda GEM™- 11 may be utilized in making a recombinant phage vector which may be used to transform host cells, such as E. coli LE392.

Further useful vectors include pLN vectors and pGEX vectors, for use in generating giutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage. Other suitable fusion proteins are those with β-galactosidase, ubiquitin, or the like. Promoters that are most commonly used in recombinant DNA construction include the

-lactamase (penicillinase), lactose and tryptophan (tip) promoter systems. While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling those of skill in the art to ligate them functionally with plasmid vectors.

For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used.

This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-

1. The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoting sequences in yeast vectors include the promoters for 3- phosphoglycerate kinase or other glycolytic enzymes such as enolase, glyceraldehyde-3- phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6- phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.

Other suitable promoters, which have the additional advantage of transcription controlled by growth conditions, include the promoter region for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, glyceraldehyde- 3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.

In addition to micro-organisms, cultures of cells derived from multicellular organisms may also be used as hosts. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture. Examples of useful mammalian host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines. In addition, a host cell strain may be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the encoded protein.

Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cells lines or host systems may be chosen to ensure the correct modification and processing of the foreign protein expressed. Expression vectors for use in mammalian cells ordinarily include an origin of replication (as necessary), a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences. The origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.

The promoters may be derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Further, it is also possible, and may be desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.

A number of viral based expression systems may be utilized, for example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication. Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hind UI site toward the Bgl I site located in the viral origin of replication.

In cases where an adenovirus is used as an expression vector, the coding sequences may be ligated to an adenovirus transcription/ translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing proteins in infected hosts.

Specific initiation signals may also be required for efficient translation of the claimed isolated nucleic acid coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may additionally need to be provided. One of ordinary skill in the art would readily be capable of deteirnining this and providing the necessary signals. It is well known that the initiation codon must be in-frame (or in-phase) with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons may be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements or transcription terminators. In eukaryotic expression, one will also typically desire to incorporate into the transcriptional unit an appropriate polyadenylation site (e.g., 5'-AATAAA-3') if one was not contained within the original cloned segment. Typically, the poly A addition site is placed about 30 to 2000 nucleotides "downstream" of the teimination site of the protein at a position prior to transcription termination. For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express constructs encoding proteins may be engineered. Rather than using expression vectors that contain viral origins of replication, host cells may be transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn may be cloned and expanded into cell lines. A number of selection systems may be used, including but not limited to, the herpes simplex virus thymidine kinase, hypoxanfhine-guanine phosphoribosyltransferase, and adenine phosphoribosyltransferase genes, in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance may be used as the basis of selection for dhfr, that confers resistance to mefhotrexate; gpt, that confers resistance to mycophenolic acid; neo, that confers resistance to the aminoglycoside G-418; and hygro, that confers resistance to hygromycin.

It is contemplated that the isolated nucleic acids of the invention may be "overexpressed", i.e., expressed in increased levels relative to its natural expression, or even relative to the expression of other proteins in the recombinant host cell. Such overexpression may be assessed by a variety of methods, including radio-labeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or Western blotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein or peptide in comparison to the level in natural human cells is indicative of overexpression, as is a relative abundance of the specific protein in relation to the other proteins produced by the host cell and, e.g., visible on a gel.

According to an aspect of the invention, therefore, host cells are provided that include prokaryotic and eukaryotic cells, either stably or transiently transformed with DNA sequences of the invention in a manner that permits expression of exonuclease polypeptides of the invention. Host cells are a valuable source of immunogen for development of antibodies specifically immunoreactive with exonuclease polypeptides of the invention. Host cells are also conspicuously useful in methods for large scale production of exonuclease polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffmity purification.

Knowledge of exonuclease DNA sequences allows for modification of ceils to modulate expression of endogenous exonuclease polypeptides of the invention. Cells can be modified (e.g., by homologous recombination) to provide increased exonuclease expression by replacing, in whole or in part, the naturally occurring exonuclease promoter with all or part of a heterologous promoter so that the cells express, for example, TREX lh at higher levels. The heterologous promoter is inserted in such a manner that it is operatively-linked to exonuclease encoding sequences. See, for example, PCT International Publication No. WO 94/12650, PCT International Publication No. WO 92/20808, and PCT International Publication No. 91/09955 (all incorporated herein by reference). The invention also contemplates that, in addition to heterologous promoter DNA, amplifiable marker DNA (e.g., ada, dhfr. and the multifunctional CAD gene that encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase) and/or intron DNA may be inserted along with the heterologous promoter DNA. If linked to the exonuclease-coding sequence, amplification of the marker DNA by standard selection methods results in co-amplification of the exonuclease coding sequences in the cells.

The DNA sequence information provided by the present invention also makes possible the development through, e.g. homologous recombination or "knock-out" strategies [Capecchi, Science 244:1288-1292 (1989)], of animals that fail to express functional exonucleases of the invention or that express variants thereof. Such animals are useful as models for studying the in vivo activities of, for example, TREXlh, TREX2h, TREX2m, and modulators thereof.

The invention also provides purified and isolated mammalian exonuclease polypeptides. Presently preferred are a human TREXlh polypeptide comprising the amino acid sequence set out in SEQ ID NO:2, a human TREX2h polypeptide comprising the amino acid sequence set out in SEQ ID NO:4, a murine TREXlm polypeptide comprising the amino acid sequence set out in SEQ ED NO:31, and a murine TREX2m polypeptide comprising the amino acid sequence set out in SEQ ID NO:33. Exonuclease polypeptides of the invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. Exonuclease products of the invention may be full length polypeptides, biologically active fragments, or variants thereof that retain specific exonuclease biological or immunological activity. Variants may comprise exonuclease polypeptide analogs wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more non-specified amino acids are added: (1) without loss of one or more of the biological activities or immunological characteristics specific for exonuclease polypeptides of the invention; or (2) with specific disablement of a particular biological activity of an exonuclease of the invention. Preferred fragments of the invention represent catalytic regions of polypeptides of the invention and include polypeptides comprising amino acid residues 2 through 17, 111 through 125, and 171 through 185 as set out in SEQ ID NO 2 for TREXlh and polypeptides comprising amino acid residues 8 through 24, 114 through 128, and 174 through 187 as set out in SEQ ID NO: 4, and the analogous residues in SEQ ID NOS:31 and 33.

Variant polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding the exonucleases. Conservative substitutions are recognized in the art to classify amino acids according to their related physical properties as defined in Table I (from WO 97/09433 published March 13, 1997 (PCT/GB96/02197, filed 9/6/96, page 10). Alternatively, conservative amino acids can be grouped as defined in Lehninger, [Biochemistry, Second Edition-, Worth Publishers, Inc. NY,:NY (1975), pp.71-77] as set out in Table II. Both Tables I and II define amino acid residues by one letter abbreviations understood in the art.

Table I Conservative Substitutions I

SIDE CHAIN CHARACTERISTIC AMINO ACIDS

Aliphatic - Non-Polar GAP

ILV

Polar - Uncharged CSTM

NQ

Polar - Charged DE

KR

Aromatic HFWY

Other NQDE

Table II

Conservative Substitutions II

SIDE CHAIN CHARACTERISTIC AMINO ACID

Non-polar (hydrophobic)

A. Aliphatic ALIVP

B. Aromatic FW

C. Sulfur containing M

D. Borderline G

Uncharged - polar

A. Hydroxyl STY

B. Amides NQ

C. Sulfhydryl C

D. Borderline G

Positively charged (Basic) KRH

Negatively charged (Acidic) DE Variant products of the invention include mature exonuclease products, i.e., exonuclease products wherein leader or signal sequences are removed, having additional amino terminal residues. Exonuclease products having an additional methionine residue at position -1, for example, Met^" '-TREX1, are contemplated, as are exonuclease products having additional methionine and lysine residues at positions -2 and -1, for example, Mef^{^}-Lys^" ^]-TREXl. Variants of these types are particularly useful for recombinant protein production in bacterial cell types.

The invention also embraces exonuclease variants having additional amino acid residues that result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide such as a glutathione-S-transferase (GST) fusion product provide the desired polypeptide having an additional glycine residue at position -1 as a result of cleavage of the GST component from the desired polypeptide. Variants that result from expression in other vector systems are also contemplated. Also comprehended by the present invention are antibodies (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) and other binding proteins specific for exonuclease products of the invention or fragments thereof. The term "specific for" indicates that the variable regions of the antibodies of the invention recognize and bind exonuclease polypeptides of the invention exclusively (i.e., able to distinguish TREXlh, TREX2h, TREXlm, or TREX2m polypeptides from the family of exonuclease polypeptides despite sequence identity, homology, or similarity found in the family of polypeptides), but may also interact with other proteins (for example, S. aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable region of the antibodies, and in particular, in the constant region of the molecule. Screening assays to determine binding specificity of an antibody of the invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (eds), Antibodies, A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor, NY (1988), Chapter 6. Antibodies that recognize and bind fragments of the exonuclease polypeptides of the invention are also contemplated, provided that the antibodies are first and foremost specific for, as defined above, exonuclease polypeptides. As with antibodies that are specific for full length exonuclease polypeptides, antibodies of the invention that recognize exonuclease fragments are those that can distinguish, for example TREXlh, TREX2h, TREXlm, or TREX2m polypeptides from the family of exonuclease polypeptides despite inherent sequence identity, homology, or similarity found in the family of proteins.

Specific binding polypeptides, and in particular antibodies, for exonuclease polypeptides of the invention can be identified, synthesized, or generated using isolated or recombinant exonuclease products, exonuclease variants, or cells expressing such products. Specific binding sequences can be useful for purifying exonuclease products and detection or quantification of exonuclease products in fluid and tissue samples using known immunological procedures. Binding proteins are also manifestly useful in modulating (i.e., blocking, inhibiting or stimulating) biological activities of exonucleases, especially those activities involved in site specific DNA binding. Anti-idiotypic antibodies specific for anti-TREXlh, anti-TREX2h, anti-TREXlm, and anti-TREX2m antibodies are also contemplated.

The DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of the exonucleases of the invention. DNA and amino acid sequence information for the exonucleases also permits identification of binding partner compounds with which an exonuclease polypeptide or polynucleotide will interact. Agents that modulate (i.e., increase, decrease, or block) exonuclease activity or expression may be identified by incubating a putative modulator with an exonuclease polypeptide or polynucleotide and determining the effect of the putative modulator on exonuclease activity or expression. The selectivity of a compound that modulates the activity of the exonuclease can be evaluated by comparing its binding activity on, for example TREXlh, TREX2h, TREXlm, or TREX2m to its activity on other exonuclease enzymes. Cell based methods, such as di-hybrid assays to identify DNAs encoding binding compounds and split hybrid assays to identify inhibitors of exonuclease polypeptide interaction with a known binding polypeptide, as well as in vitro methods, including assays wherein an exonuclease polypeptide, exonuclease-encoding polynucleotide, or a binding partner are immobilized, and solution assays are contemplated by the invention.

Selective modulators may include, for example, antibodies and other proteins or peptides that specifically bind to an exonuclease polypeptide or an exonuclease-encoding nucleic acid, oligonucleotides that specifically bind to a exonuclease polypeptide or an exonuclease gene sequence, and other non-peptide compounds (e.g., isolated or synthetic organic and inorganic molecules) that specifically react with an exonuclease polypeptide or underlying nucleic acid. Mutant exonuclease polypeptides that affect the enzymatic activity or cellular localization of the wild-type exonuclease polypeptides are also contemplated by the invention. Mutant exonuclease polypeptides that result in dominant-negative phenotypes when introduced into a host cell are further contemplated. Presently preferred targets for the development of selective modulators include, for example: (i) regions of the exonuclease polypeptide that contact other proteins and/or localize the exonuclease polypeptide within a cell and (ii) regions of the exonuclease polypeptide that bind specific DNA sequences. Still other selective modulators include those that recognize specific exonuclease encoding and regulatory polynucleotide sequences.

The scientific value of the information contributed through the disclosures of DNA and amino acid sequences of the present invention is manifest. As one series of examples, knowledge of the sequence of cDNA encoding TREXlh, TREX2h, TREXlm, or TREX2m makes possible through use of Southern hybridization or polymerase chain reaction (PCR) the identification of genomic DNA sequences encoding the polypeptide and expression control regulatory sequences such as promoters, operators, enhancers, repressors, and the like. DNA/DNA hybridization procedures carried out with DNA sequences of the invention under moderately to highly stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of exonucleases of the invention; allelic variants are known in the art to include structurally related proteins sharing one or more of the biochemical and/or immunological properties specific to, for example, TREXlh, TREX2h, TREXlm, or TREX2m.

Similarly, non-human species genes encoding proteins homologous to exonucleases of the invention can also be identified by Southern and/or PCR analysis. As an alternative, complementation studies can be useful for identifying other human exonuclease products, as well as non-human proteins and DNAs encoding the proteins, that share one or more biological properties of an exonuclease of the invention.

Polynucleotides of the invention are also useful in hybridization assays to detect the capacity of cells to express exonucleases. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in an exonuclease locus that underlies a disease state or states. Also made available by the invention are anti-sense polynucleotides that recognize and hybridize to polynucleotides encoding polypeptides of the invention. Full length and fragment anti-sense polynucleotides are provided. The worker of ordinary skill will appreciate that fragment anti-sense molecules of the invention include (i) those which specifically recognize and hybridize to exonuclease-encoding polynucleotides (as determined by sequence comparison of polynucleotides encoding an exonuclease of the invention to polynucleotides encoding other known molecules) as well as (ii) those which recognize and hybridize to polynucleotides encoding other members of the exonuclease family of proteins. Antisense polynucleotides that hybridize to multiple polynucleotides encoding other members of the exonuclease family of proteins are also identifiable through sequence comparison to identify characteristic, or signature, sequences for the family of molecules. Anti-sense polynucleotides are particularly relevant to regulating expression of an exonuclease of the invention by those cells expressing exonuclease mRNA.

The antisense technology embraces gene therapy techniques to modulate exonuclease expression in vivo. Delivery sequences that modulate expression activity of an exonuclease in target cells is effected in vivo or ex vivo by use of vectors, and more particularly viral vectors (e.g., adenovirus, adeno-associated virus, or a retrovirus), or ex vivo by use of physical DNA transfer methods (e.g., liposomes or chemical treatments). For reviews of gene therapy technology see Friedmann, Science, 244: 1275-1281 (1989); Verma, Scientific American: 68-84 (1990); and Miller, Nature, 357: 455-460 (1992). It is contemplated that in particular human disease states or therapeutic treatments, preventing the expression of, or inhibiting the activity of an exonuclease of the invention will be useful. Antisense nucleic acids (preferably 10 to 20 base pair oligonucleotides) capable of specifically binding to exonuclease expression control sequences or exonuclease RNA are introduced into cells (e.g., by a viral vector or colloidal dispersion system such as a liposome). Phosphothioate and methylphosphate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention. The antisense oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5' ends.

The invention further contemplates methods to modulate exonuclease expression through use of ribozymes. For a review, see Gibson and Shillitoe, Mol. Biotech. 7:125-137 (1997). Ribozyme technology can be utilized to inhibit translation of exonuclease mRNA in a sequence specific manner through (i) the hybridization of a complementary polynucleotide to a target mRNA and (ii) cleavage of the hybridized mRNA through nuclease activity inherent to the complementary strand. Ribozymes can be specifically designed or identified by empirical methods. Delivery of ribozymes to target cells can be accomplished using techniques well known and routinely practiced in the art, including for example, through use of targeting liposomes or viral vectors.

The invention further embraces methods to modulate transcription of an exonuclease of the invention through use of oligonucleotide-directed triplet helix formation. For a review, see Lavrovsky, et al., Biochem. Mot Med 62:11-22 (1997). Triplet helix formation is accomplished using sequence specific oligonucleotides that hybridize to double stranded DNA in the major groove as defined in the Watson-Crick model. Hybridization of a sequence-specific oligonucleotide can thereafter modulate activity of DNA-binding proteins, including, for example, transcription factors and polymerases. Preferred target sequences for hybridization include promoter and enhancer regions to permit transcriptional regulation of exonuclease expression. Oligonucleotides that are capable of triplet helix formation are also useful for site-specific covalent modification of target DNA sequences. Oligonucleotides capable of modifying specific polynucleotide sequences are coupled to various DNA damaging agents as described in Lavrovsky, et al. [supra].

Example 1

Determining Exonuclease Participation in DNA Incorporation of AraC

In view of the fact that many patients undergoing araC treatment are refractory to the drug or subsequently develop a drug resistance, it was proposed that, in these patients, araC may be incorporated into DNA at a decreased rate. One possibility is that the analog structure of araC may be recognized by proofreading exonuclease components of the polymerase which act to remove the analog and permit incorporation of dCTP.

HL-60 cells were incubated with 6-mercaptopurine (6-MP) to allow intracellular levels of thioinosine monophosphate (TEMP) to accumulate. TEMP has previously been shown to inhibit exonuclease activity specifically associated with DNA polymerase δ [Lee, et al. Biochemistry 19:215-219 (1980)]. Cytoplasmic 6-MP is converted to an active nucleotide metabolite TIMP by the action of hypoxanthine phosphoribosyltransferase (HPRT). Pharmacokinetic analysis of 6-MP metabolites indicated that pretreatment of HL-60 cells with 50 or 100 μM 6-MP resulted in accumulation of intracellular levels of TIMP -with peak concentration achieved at approximately twelve hours. Intracellular accumulation of TIMP was determined by HPLC [Zimm, et al., Cancer Res. 45:4156-4161 (1985)]. Upon addition of araC, the amount of araC incorporated into DNA increased and total DNA synthesis decreased in cells pretreated with 6-MP relative to untreated cells. At peak intracellular levels of TIMP, araC incorporation into DNA relative to total DNA synthesis was 20-fold greater in the 6-MP treated cells. The increased incorporation of araC into DNA resulted in an increase in cell killing as determined by growth curves and clonogenic assays of treated cells. The increased incorporation of araC into the DNA was not the result of increased accumulation of araC in the 6-MP treated cells. Cells were treated with 6-MP for varying times for up to twelve hours followed by incubation with araCTP. At time points up to twelve hours, cells were treated with araC and harvested one hour after addition of araC. The nucleotides were then separated using HPLC, and intracellular araCTP was quantified. Results indicated that araCTP levels varied less than two-fold during the time course of the study, which was unlikely to account for the observed 20-fold increase in araC incorporation into DNA.

In order to assess the effect of intracellular TIMP that contributed to increased araC incorporation, exonuclease activity was partially purified from myeloblastic leukemia cells and in vitro enzyme inhibition studies were carried out with TIMP. The majority of the cellular exonuclease activity was found in a band migrating on SDS-PAGE with a predicted molecular weight of 30 kDa.

Results indicated that TIMP inhibited the 30 kDa exonuclease with a K, of 17 μM, which strongly suggested that exonuclease inhibition occurred in vivo. Resistance to araC treatment by some AML cells may therefore arise as a result of exonuclease repair of araC-terminated DNA. Inhibition of the exonuclease activity in cells should, therefore, increase araC in DNA and increase cell killing. It is possible, however, that cell death may be attributable in part to 6-MP treatment alone.

Inhibition studies were also carried out with the purified 30 kD exonuclease and either TIMP or dGMP. The exonuclease was incubated in the presence of varying concentrations of dGMP or TIMP and results indicated TIMP was a more potent inhibitor that dGMP. The K, values for TIMP and dGMP were calculated to be 17 μM and 56 μM, respectively. Because the intracellular level of TEMP in murine leukemia cells treated for twelve hours with 6-MP has been shown to rise to approximately 180 μM, it is likely that the exonuclease activity is greatly abolished in those cells, thereby allowing the increase in araC incorporation into DNA. Useful methods in the practice of this example include the following:

DNA pol δ may be purified from human myeloblasts using the methods of Syvaoja et al. (Proc. Natl. Acad. Sci., USA 87:6664-6668, 1990) through step 5. The specific activity of the DNA pol δ preparation is preferably about 3,500 units/mg. A unit of DNA pol δ catalyzes the incorporation of 1 nmol of total nucleotide per hour at 37°C using 100 μM poly(dAdT) as template and reaction conditions as described by Lewis et al. (Biochemistry 33:14620-14624, 1994). The 30 kDa exonuclease may be purified from human myeloblasts and from calf thymus using a modification of the published procedure (Perrino et al. J. Biol. Chem. 269:16357-16363, 1994). The CM-Sepharose column may be eliminated, and the ssDNA-cellulose column used prior to chromatography using a monoS FPLC column. The peak fractions from the monoS column are pooled, and ammonium sulfate added (Cρ25% saturation). The exonuclease sample is loaded onto a phenyl-Superose FPLC column previously equilibrated in buffer A (50 mM Tris, pH 8.2, 1 mM DTT, 1 mM EDTA, 10% glycerol) containing 25% ammonium sulfate. The column is washed with buffer A and eluted with a decreasing linear gradient of buffer A containing 25-0% ammonium sulfate into tubes containing α-lactalbumin (Cf=0.2 mg/ml). Dilutions of fractions are assayed for exonuclease activity, and the peak fractions are pooled, dialyzed against buffer A, and stored in aliquots at -80°C.

For primer extension, a 17 base oligonucleotide primer may be labeled with 32p _a the 5' position and hybridized to a 35mer DNA template at a 1 :1 molar ratio (Perrino and Mekosh, J. Biol. Chem. 267:23043-23051, 1992. Reaction mixtures may be prepared containing 40 mM HEPES, pH 6.5, 1 mM MgCl2, 10 mM KC1, 2 mM DTT, 0.03% Triton X-

100, 2% glycerol, 80 μg/mL BSA, and 170 nM 17mer-primed DNA template. For the 3'-5' exonuclease, a 20mer or a 21mer primer may be labeled with 32p and hybridized to the

35mer DNA template. Reaction mixtures are prepared as described for the primer extension assays except a 10 nM template:primer and 0.0017 units of DNA pol δ. Reaction products are processed as described by Perrino and Loeb,( J. Biol. Chem:264, 2898-2905, 1989) and analyzed by electrophoresis through 15% polyacrylamide sequencing gels. Gels are fixed in 10% methanol 10% acetic acid, vacuum-dried, and exposed to Kodak XAR-5 film and quantified using an AMBIS radioanalytic imaging system.

To measure the 3'-5' exonuclease activity, a 23mer is labeled with 32p _at the 5' position and used in reactions as ssDNA. Reaction mixtures (10 μl) are prepared containing 20 mM Tris-HCI, pH 7.5, 10 mM MgCk), 2 mM DTT, 100 μg/mL BSA, 100 nM 23mer, and 1 μl of the appropriate enzyme dilution. Incubation is 20 minutes at 37°C, and reactions are stopped by addition of 30 μl 95% ethanol. Samples are dried, resuspended in 5 μl 95% formamide, and analyzed by electrophoresis through 15% polyacrylamide sequencing gels. Radiolabeled bands are visualized and quantified by phosphorimagery (Molecular Dynamics). One unit of exonuclease is the amount of enzyme needed to degrade 1 pmol of 3' tennini in 1 min at 37°C.

The phenyl-Superose purified exonuclease is incubated with AMP-resin (Sigma product # A-3019) in buffer B (20 mM Tris, 7.5, 2 mM DTT, 0.5 mM EDTA, 10% glycerol) containing 10 mM MgCl2 for 30 minutes at 4°C. The resin is allowed to settle to the bottom of the tube, and unbound protein in the buffer above the resin is removed. The resin is washed three times with 0.5 ml of buffer B containing 10 mM MgCl2, and bound proteins are eluted with sequential washes using 0.5 ml buffer B containing 0.5, 1.0, and 2.0 M NaCl and no MgCl2- The collected samples are assayed for 3'-5' exonuclease activity. The 3'-5' exonuclease activity may be detected in situ after SDS-PAGE using modified published procedures (Blank et al, Anal. Biochem. 120:267-275, 1982; Spanos and Hubscher, Methods in Enzymology. 91 :263-727, 1983). Initially, the 30 kDa protein is identified after electrophoresis in a 12% SDS polyacrylamide gel containing a 3' P labeled DNA. To prepare the DNA 25 pmol of 20mer is hybridized to 50 pmol of a KS+ phagemid ssDNA (Stratagene), and the 20mer is elongated with 32p_αdATP using Klenow exo- . The 3' 32p labeled DNA is added to the 12% acrylamide gel solution prior to casting the slab gel. After electrophoresis of samples, the SDS is extracted with 20 mM Tris, pH 7.5, 2 mM DTT, and the enzymes are renatured in 20 mM Tris, pH 7.5, 2 mM DTT, 0.4 mg/ml BSA, and 10% glycerol. To assay for 3'-5' exonuclease, MgCl2 (Cf=10mM) is added, and the gel is incubated at 37°C. The gel is dried and exposed to film. To detect the products of the 3'-5' exonuclease in situ a modified published procedure may used (Longley and Mosbaugh, Biochemistry 30:2655-266423, 1991). In this gel assay a

32

5' P-labeled 20mer is hybridized to the phagemid template. After electrophoresis, the SDS is extracted, proteins are renatured in situ, and the gel lanes are sliced vertically. Gel slices are incubated at 37°C for 1 hr in exonuclease reaction buffer, and the gel slices are polymerized horizontally on top of a 15% urea-polyacrylamide DNA sequencing gel. After electrophoresis the sequencing gel is dried and exposed to film.

Logarithmically growing cultures of HL-60 cells are incubated with 6-MP for varying times. The cultures are divided into two groups. The first group is treated with 1 μM H- araC for 1 hour to measure araC in DNA. The second group is treated with 3H-thymidine and 1 μM unlabeled araC for 1 hour to measure total DNA synthesis. Cells are pelleted, washed with PBS, and 3H-araC or 3H-thymidine in acid insoluble material is determined by scintillation counting. To measure araCTP in HL-60 cells, 6-MP treated samples are incubated with 1 μM 3H-araC. Cells are pelleted and washed with PBS. The acid soluble nucleotides are collected and separated by HPLC (Partisil 10 SAX, Whatman). The fraction containing 3HaraCTP is quantified by scintillation counting.

Example 2 Isolation of Human Myeloblastic Leukemia and Bovine Thymus Exonucleases

In order to identify the 30 kDa protein exhibiting the predominant exonuclease activity in human myeloblastic leukemia and bovine thymus cells, protein purification was carried out essentially as described in Perrino, et al, J Biol. Chem. 269:16357-16363 (1994). For protein purification from bovine thymus, an additional step using phenyl SUPEROSE was employed.

In order to detect exonuclease activity in the cell extract, a biochemical assay was developed using DNA polymerase α and an oligonucleotide template primer with an araC analog at the 3' terminus. In this assay, incorporation of radiolabeled nucleotides into the araC-template primer by the polymerase first requires that the araC analog be removed by a 3'- 5' exonuclease. A 30 kDa enzyme was found in both cell types that possessed 3'-5' exonuclease activity. The 3'-5' exonuclease activity suggests that this enzyme plays a role in DNA repair. The apparent rate of araC removal by the exonuclease was approximately the same rate as the rate of deoxynucleotide monophosphate removal. Furthermore, the apparent rate of 3' terminal excision was approximately the same whether the template primer was hybridized to a complementary strand or not, indicating that the enzyme possessed both single and double stranded 3'- 5' exonuclease activity. No 5'- 3' exonuclease was detected, nor was the exonuclease activity found to be associated with polymerase activity.

The AML exonuclease and other previously identified enzymes share similar characteristics, but significant differences distinguish the AML activity. For example, the 30 kD AML enzyme resembles DNaselll and DNaseVII in that all three degrade single or double stranded DNA in a 3'- 5' direction only and require a divalent cation for activity. Substrate specificity indicates, however, that the AML enzyme is distinct in that it does not degrade 3'-phosphoryl-terminated DNA like DNaselll and DNaseVII. In addition, the products of DNaselll digestion are both 5' mononucleotides and dinucleotides, while the products of AML exonuclease and DNaseVII activity are exclusively 5 'mononucleotides.

Example 3 Cloning of the Human TREXlh Gene In order to identify a cDNA encoding the TREXlh polypeptide, the following procedure was carried out. The purified bovine exonuclease was digested with trypsin and resulting proteolytic fragments were separated by HPLC. The amino acid sequences of four internal peptides (SEQ ID NOs: 5, 6, 7, and 8) were determined by Edman degradation and provided 53 amino acids of the primary sequence of the enzyme.

Ala-Phe- Asp- Ala- Asp-Leu- Asn-Leu-Ile- Arg SEQ ID NO : 5

Tyr-Ala-Leu-Glu-Leu-Ser-Ala-Pro-Gln-Gly-Pro-Ser-Pro-Thr-Ala-Pro-Val

SEQ ID NO:6 Ala-Leu-Glu-Pro-Thr-Gly-Ser-Ser-Ser-Glu-His-Gly-Pro-Arg SEQ ID NO:7 Xaa-Tyr-Asp-Leu-Gly-Xaa-Val-Tyr-Xaa SEQ ID NO:8 Degenerate oligonucleotides were prepared based on the amino acid sequence of two of the four peptides and used in polymerase chain reaction (PCR) as described below. The primer sequences are:

TAGCATGAATTCTA(T/C)GCN(T/C)TNGA(A/G)GG SEQ ED NO:9

GCATCAGGATCCTCNGC(G/A)TC(G/A)AANGC SEQ ID NO: 10

TCAGCAGAATTCGCI(T/C)TIGA(A G)GGI(T/C)TI(T/A)(G/C)IGCICCICA(A/G)GG

SEQ ID NO: 11 GGTGTTGGATCCIC(T/G)IATIA(A/G)(A/G)TTIAGIA(A/G)(A/G)TCIGC(G/A)TC SEQ ID NO: 12

PCR was carried out as follows: The 100 μl reaction included 10 mM Tris-HCI, pH 9.0, 0. 1% Triton X-100, 2.5 mM MgCl₂, 0.5 mM dNTPs, 5 μg bovine cDNA, 1 μM each primer, and 2.5 units Taq polymerase. Amplification was carried out with five cycles of 95°C for one minute, 37°C for one minute, a two minute ramp to 74°C for one minute, and then thirty cycles of 95°C for one minute, 55°C for one minute, and 74°C for one minute. The bovine cDNA was prepared from total RNA isolated from thymus tissue using cesium chloride equilibrium density centrifugation. mRNA was isolated from total RNA using an oligo(dT) column, and cDNA was prepared using a synthesis kit (Gibco/BRL) according to manufacturer's suggested protocol.

PCR resulted in amplification of a 201 base pair fragment, which was cloned and sequenced. Sequence analysis indicated that the PCR product encoded twelve amino acids in the two peptides from which the PCR primers were designed, thereby providing the primary amino acid sequence for a contiguous 67 amino acid fragment of the bovine exonuclease. The DNA and protein sequences of the bovine enzyme were used as query sequences in the Expressed Sequence Tag (EST) database available through Genbank. Two human cDNA clones, #704410 (identified by 5' EST AA279657, SEQ ID NO:13, and 3* EST AA279658, SEQ ID NO:14) and #131083 (identified by 5' EST R23917, SEQ ID NO.: 15, and 3' EST R23918, SEQ ID NO: 16) were identified in the database. These sequences did not include complete open reading frames as evidenced by the lack, in both, of an initiating methionine codon. The sequences for the two human clones were then used as query sequences to search the EST database a second time and a mouse clone, #671838 (identified by 5" EST AA242227, SEQ ID NO: 17, and a second clone, identified by 5' EST AA896411, SEQ ID NO: 18) encoding a complete open reading frame was identified. Finally, the database was searched a third time using the mouse clone and a third human clone, #306966 (identified by 3' EST N91973, SEQ ED NO: 19, and 5' EST W24304, SEQ ID NO:20) was identified, and which included a complete open reading frame.

The resulting open reading frame encoding a polypeptide designated TREXlh is set out in SEQ ID NO: 1. The amino acid sequence of the polypeptide is set out in SEQ ID NO: 2. Analysis of the amino acid sequence for TREXlh indicated sequence identity within the predicted exonuclease domain. While exonuclease domains have been identified in enzymes isolated from species as divergent as viruses to eukaryotes, TREXlh is the first cloned mammalian exonuclease that is independent from DNA polymerase activity.

Example 4 Expression of TREXlh The EST encoding human TREXlh was obtained from Genome Systems (St Louis,

MO) and sequenced. The complete open reading frame was subcloned into parental vector pCMV5B as follows:

Two oligomer primers were synthesized (SEQ ID NOs: 21 and 22) for use in PCR to amplify the coding region of the TREXlh EST: ACTCATACGTCGACAGGAGGTAAAAAAAAATGCAGACCCTCATCT

SEQ ID NO: 21 GTAAAACGACGGCCAGT SEQ ID NO: 22

The 5' primer (SEQ ID NO: 21) included an Xhol restriction site, a ribosome binding site, and 16 nucleotides complementary to the 5' end of the TREX lh gene. The 3' primer (SEQ ID NO: 22) included 17 nucleotides complementary to the plasmid vector. PCR was performed under the following conditions: 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for one minute. The amplification product was digested with Xhol and Hindlll and ligated into vector pOXO4 [Parsonage, et αl J. Biol. Chem. 268:3161-3167 (1993)] previously digested with the same enzymes to give an expression plasmid designated as pTREXlh T7. The pTREXlh/T7 plasmid was electroporated into BL21/DE3 cells, which were grown at 23°C to a density of OD₅₉₅ 0.3. lsopropylthiogalactopyranoside (EPTG) was added to induce overexpression and incubation of the cells was continued overnight. Protein extracts were prepared from the cells and enzyme activity assayed using a ³²P- labeled 23 nucleotide oligomer.

Results indicated that the exonuclease activity in cells transfected with TREXlh coding sequences was 30 fold higher than in control cells transfected only with the parental vector, which indicated that the EST encoded an exonuclease.

Example 5

Identification of Polynucleotide Encoding Additional TREXlh-Like Polypeptides

Having determined the cDNA encoding human TREXlh, the full length sequence was used as the query sequence in a subsequent search of the available databases. TREX2h and TREX2m A COSMID (Genbank # AF002998, SEQ ID NO: 23) comprising a 45 kb human genomic sequence in which a region related to that encoding TREXlh was identified by searching the Genbank database using the cDNA for TREXlh as query. The region with homology to the TREXlh-encoding sequence was designated TREX2h. Interestingly, the TREX2h genomic sequence did not include any intron sequences. The polynucleotide and amino acid sequences for TREX2h are set out in SEQ ID NO: 3 and 4, respectively. Sequence analysis of the TREX2h open reading frame indicated greater than 55% identity with the polynucleotide encoding TREXlh.

The open reading frame identified in AF002998 and related to TREXlh was then used to search the EST database. Results of the search indicated that no human EST contained the sequence. The apparent lack of an EST corresponding to this sequence raises questions about the level of expression of this gene in human cells. The search did identify, however, a mouse sequence, # 480859 (identified by 5' EST AA060540, SEQ ID NO:24), and a second clone, #804515, (identified by 5' EST AA474437, SEQ ID NO:25), which encoded a complete open reading frame that was designated as TREX2m. The genomic sequence identified above permits design and synthesis of PCR primers that are used to amplify the human sequence from readily available genomic sources. The primer pair set out in SEQ ID NOs: 26 and 27 is used in amplification reactions as described above for TREXlh.

GCGTCAAGCTTGGGAACATCACCATGTCCGAGGCACCCCGG SEQ LD NO:26

GTCGCGGATCCTGGCCCTGGTGCTCAGGCCTCCAGGCTGGG

SEQ ID NO: 27

The resulting amplification product is inserted into an expression vector and introduced into host cells as described above or by use of any of the number of techniques well known and routinely practiced in the art.

The mouse TREX2m sequence was subcloned as described above for TREXlh using the 5' primer set out in SEQ ID NO: 28 and the 3' primer used to amplify TREXlh (SEQ ID NO: 22).

AGTGATACAGTCGACAGGAGGTAAAAAAAAATGTCTGAGCCACCCCG

SEQ ID NO: 28

Template DNA was the mouse EST 480859. PCR was carried out as described for TREXlh and the resulting amplification product was subcloned as for TREXlh. The resulting expression plasmid was designated pTREX2m T7 and expression of the encoded gene was carried out as described for TREXlh. Protein extract from the electroporated cells included 30 fold greater exonuclease activity than protein from control cells having only the parental vector.

TREX3h

A polynucleotide encoding a third exonuclease species designated TREX3h was also identified in a human EST during database searches. The coding region for TREX3h was found to exhibit approximately 41 % identity to the open reading frame for TREXlh and approximately 39% identity with the coding region for TREX2h. An EST encoding a portion of the TREXlh gene has previously been reported to encode an exonuclease [Koonin, Crr. Biol. 7:R604-R606 (1997)]. The coding region for the protein is amplified by PCR using the 5' primer below in combination with the 3' primer used to amplify TREXlh (SEQ ID NO:

22).

ACTCATACGTCGACAGGAGGTAAAAAAAAATGGTCTCAGCGGATG

SEQ TD NO: 29

Amplification is carried out as described above and the PCR product is subcloned as described to give plasmid pTREX3h/T7. Bacterial expression is carried out as for expression of TREXlh and TREX2m, above.

Example 6 Expression in Mammalian Cells

The TREXlh, TREX2m, and TREX3h encoding sequences are digested from the bacterial expression plasmids described above using Xhol and Hindlll and cloned into the mammalian expression vector pCMV5b previously digested with the same enzymes. The resulting expression constructs are designated pTREXlh/CMV, pTREX2m/CMV and pTREX3h/CMV. The individual plasmids are transfected into COS cells, which are grown for two days following transfection. Protein extracts are prepared and exonuclease activity is measured using the ³²P-labeled 23 nucleotide oligomer as described above.

In a second method of expression in a mammalian cell, the TREXlh and TREX2h genes have been cloned into mammalian expression vectors in the forward and reverse directions to generate stable cell lines that over and underexpress the TREXlh gene products. The TREXlh and TREX2h sequences were cloned into the pTRE plasmid (Clontech) for expression, and the TREXlh gene was cloned into this plasmid in the reverse orientation to express the TREXlh antisense mRNA. In a preliminary step, cell lines were generated from HeLa and HL-60 cells that contain the stably integrated pTET-OFF plasmid (Clontech). These cells incorporate the Clontech Tet-off system establishing cell lines that express the tetRVPlό fusion protein. The tetR protein binds at the tetO operator in the absence of tetracycline. The tetR protein has been fused to the C-terminal 127 amino acids of the mammalian cell transcription activator protein VP16 (Herpes Simplex Virus). Thus, in the absence of tetracycline the tetRVPlό protein binds the TRE and induces transcription of downstream genes, while in the presence of tetracycline the tetRVPlό protein does not associate with the TRE. The pTET-OFF plasmid also contains a neomycin resistance gene to allow the selection of stable clones with G418. Colonies were picked, transiently transfected with the pTRE-LUC plasmid (Clontech) and tested for induction levels. The pTRE-LUC plasmid contains the luciferase gene downstream of the Tet Responsive elements in the pTRE plasmid. Cells with low background and high induction levels of expression were chosen for transfection with the TREXlh and TREX2h genes. The TREXlh and TREXlm genes were then cloned into the pTRE plasmid downstream from the TRE (Tet responsive element). The TREX containing plasmids, as well as the empty pTRE vector, were cotransfected with the pTK-HYG plasmid (Clontech) into the HeLa and HL-60 tetRVPlό expressing cell lines. Stable cell lines were selected using the hygromycin resistance marker located on the pTK- HYG plasmid. Cell lines with varying expression levels of the TREXlh and TREX2h genes were selected for subsequent studies. Expression levels were measured using exonuclease assays and RT-PCR. The Ecdysone System (Invitrogen) uses the steroid hormone ecdysone analog, ponasterone A, to activate the TREX genes by way of a heterodimeπc nuclear receptor. A cell line is generated that has stably integrated the pVgRXR plasmid (Invitrogen) containing the RXR (retrnoid X receptor) and VgEcR receptor (a modified form of the ecdysone receptor to which the VP16 transactivation domain has been fused) These two products form a heterodimer that binds to the ecdysone response element (ERE) in the presence of the synthetic analog ponasterone A Cells (HeLa and HL-60) were transfected with the pVgRXR plasmid and stable clones were selected usmg the zeocm resistance marker located on the pVgRXR plasmid. Colonies were picked, transiently transfected with the pIND-GFP plasmid (Invitrogen) and tested for induction levels The pIND-GFP plasmid contams the green fluorescence protein (GFP) gene downstream of the Tet Responsive elements m the pTRE plasmid Cell lines shown to have low background and high induction levels of expression were then transfected with the pIND plasmid (Invitrogen) empty vector as well as pIND vectors contammg the TREXlh or TREX2h genes located downstream of the ecdysone response element Stable clones were selected usmg the neomycin resistance marker located in the pIND vector Cell lines with varying expression levels of the TREX genes were selected for subsequent studies Expression levels were measured usmg exonuclease assays and RT- PCR.

Example 7 Screening Candidate Substances as Effectors of Exonuclease Activity

The TREXlh and TREX2h proteins have been cloned mto prokaryotic expression vectors and expressed in bacteria. The proteins have been purified using standard chromatography procedures. A screening assay has been designed to identify compounds that inhibit the exonuclease activity of the TREX exonucleases. A radiolabeled or fluorescently labeled DNA oligomer is incubated with the purified recombinant enzyme in the absence or presence of the test compound. Activity of the enzyme is detected by examination of the length of the oligomer products by DNA sequencing gel analysis or by loss of the fluorescently labeled nucleotide from the oligomer. Compounds that demonstrate inhibitory activity toward the TREX exonucleases are tested for chemotherapeutic potential.

The TREXlh expressing cells are used to identify specific drugs that increase the chemosensitivity of cells to a variety of chemotherapeutic nucleotide analogs. Cell lines containing the mammalian expression plasmids, with and without the TREX genes, are incubated with a currently available nucleoside analog. Cells lines expressing the TREX genes are expected to survive higher drug concentrations than nonexpressing cell lines. A screening assay has been designed to identify compounds that increase the sensitivity of the TREX expressing cell lines to the first drug. Cells that are not expressing the TREX proteins are not expected to be sensitive to this TREX-specific compound. A 96 well plate contains TREX-expressing cells contacted with the drug and cytotoxicity is measured by rhodamine assay. Cytotoxicity is then measured for cells contacted with the drug (X) plus a candidate substance, compound (Y). Compounds (Y) that increase cytotoxicity for TREX expressing cells are tested for chemotherapeutic potential.

While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the appended claims should be placed on the invention.

Claims

CLAIMS:

1. An isolated nucleic acid molecule of from about 708 to about 1238 nucleotides in length comprising a gene or the full length complement of a gene, wherein the gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:31 or SEQ ID NO:33, or a conservative variant of any thereof.

2. The nucleic acid molecule of claim 1, wherein the encoded polypeptide comprises the amino acid sequence of SEQ ID NO:2 or a conservative variant thereof.

3. The nucleic acid molecule of claim 1, wherein the encoded polypeptide comprises the amino acid sequence of SEQ ID NO:4 or a conservative variant thereof.

4. The nucleic acid molecule of claim 1, wherein the encoded polypeptide comprises the amino acid sequence of SEQ ID NO:31 or a conservative variant thereof.

5. The nucleic acid molecule of claim 1, wherein the encoded polypeptide comprises the amino acid sequence of SEQ ID NO:33 or a conservative variant thereof.

6. The nucleic acid composition of claim 1, wherein the gene comprises the nucleic acid sequence of SEQ ID NO:l or its full length complement.

7. The nucleic acid composition of claim 1, wherein the gene comprises the nucleic acid sequence of SEQ ID NO:3 or its full length complement.

8. The nucleic acid composition of claim 1, wherein the gene comprises the nucleic acid sequence of SEQ ID NO:30 or its full length complement.

9. The nucleic acid composition of claim 1, wherein the gene comprises the nucleic acid sequence of SEQ ID NO:32 or its full length complement.

10. The nucleic acid composition of claim 1 wherein the gene hybridizes to a nucleic acid segment having the sequence of SEQ ED NO: 1, SEQ ID NO:3, SEQ ID NO:30, or SEQ ID NO:32 under conditions including hybridization at 50┬░C in lx SSC, and washing at 65┬░C in O.lx SSC.

11. The nucleic acid composition of claim 1 , wherein said gene is operatively linked to a promoter.

12. The nucleic acid composition of claim 1, wherein said gene is operatively linked to a heterologous promoter.

13. The nucleic acid composition of claim 1, wherein said gene is linked to a marker gene.

14. The nucleic acid composition of claim 1, wherein said gene is contained in a vector.

15. The nucleic acid composition of claim 14, wherein said vector is an expression vector.

16. The nucleic acid composition of claim 14, wherein said vector is a viral vector.

17. The nucleic acid composition of claim 14, wherein said vector is a plasmid.

18. A host cell that contains the nucleic acid composition of claim 14.

19. The host cell of claim 18, wherein said host cell is a bacterial cell.

20. The host cell of claim 18, wherein said host cell is a mammalian cell.

21. A composition comprising a purified polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:31 or SEQ ID NO:33, or a conservative variant of any thereof, wherein the composition has a 3'-5' exonuclease activity.

22. The composition of claim 21, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:2, or a conservative variant thereof.

23. The composition of claim 21, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:4, or a conservative variant thereof.

24. The composition of claim 21, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:31, or a conservative variant thereof.

25. The composition of claim 21, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:33, or a conservative variant thereof.

26. The composition of claim 21, wherein said polypeptide is isolated from a mammalian cell.

27. The composition of claim 21, wherein said polypeptide is a recombinant protein.

28. The composition of claim 21, wherein said conservative variant is a naturally occurring variant.

29. A method for producing a polypeptide having 3'-5- exonuclease activity comprising the steps of:

a) obtaining a nucleic acid molecule including a gene encoding a polypeptide comprising the sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:31, or SEQ ID NO:33, or a conservative variant of any thereof, operatively linked to a promoter sequence;

b) transferring said nucleic acid molecule into a host cell; and

c) growing said host cell under condition effective to express said gene.

30. The method of claim 29, further comprising isolating said polypeptide from said host cell or from the medium of its growth.

31. The method of claim 29, wherein said cell is a bacterial cell.

32. The method of claim 29, wherein said cell is a mammalian cell.

33. An antibody specifically immunoreactive with a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:31 or SEQ ID NO:33.

34. The antibody according to claim 33 further defined as a polyclonal antibody.

35. The antibody according to claim 33 further defined as a monoclonal antibody.

36. An anti-idiotype antibody specifically immunoreactive with the antibody according to claim 33.

37. A method of identifying an effector of a 3'-5' exonuclease activity comprising the steps of:

a) obtaining a candidate substance;

b) contacting a 3'-5' exonuclease polypeptide composition with a substrate in the presence and absence of said candidate substance; and

c) detecting 3'-5' exonuclease activity in the presence and absence of said candidate substance;

wherein a change in activity of the exonuclease in the presence of the candidate substance is indicative of an effector of 3'-5' exonuclease activity.

38. The method of claim 37, wherein the 3'-5' exonuclease polypeptide comprises the amino acid sequence of SEQ ED NO:2, SEQ ID NO:4, SEQ ID NO:31 or SEQ ED NO:33, or a conservative variant of any thereof.

39. An effector of 3'-5' exonuclease activity identified by the method of claim 37.

40. A pharmaceutical composition comprising the effector of claim 39.

41. The method of claim 39, wherein the 3'-5' exonuclease polypeptide is expressed from a recombinant vector in a cell and isolated from the culture of said cell.

42. The method of claim 40, wherein said cell is a bacterial cell.

43. A method of identifying an inhibitor of 3'-5' exonuclease activity comprising the steps of:

a) obtaining a candidate substance;

b) growing a cell culture in the presence of a nucleoside analog that is incorporated into a nucleic acid molecule and inhibits polymerization of said molecule when incorporated therein, wherein the cells express a 3 '-5- exonuclease activity;

c) contacting said cell culture with said candidate substance;

d) growing an identical cell culture that is not contacted with said candidate substance; and

e) comparing the cell growth in the presence and absence of said candidate substance;

wherein a decrease in cell growth in the presence of the candidate substance is indicative of an inhibitor of 3'-5' exonuclease activity.

44. A method of inhibiting the replication of a nucleic acid molecule in a cell that expresses a 3'-5' exonuclease activity comprising contacting said cell with a nucleoside analog, and further contacting said cell with an inhibitor of said 3'-5' exonuclease activity.

45. The method of claim 44, wherein said cell is a mammalian cell.

46. The method of claim 45, wherein said cell is a human cell.

47. The method of claim 44, wherein said cell is a human cancer cell.

48. The method of claim 44, wherein said nucleic acid molecule is a viral nucleic acid molecule.