WO1999051749A2 - Recombinant potyvirus construct and use thereof - Google Patents

Recombinant potyvirus construct and use thereof Download PDF

Info

Publication number
WO1999051749A2
WO1999051749A2 PCT/IL1999/000184 IL9900184W WO9951749A2 WO 1999051749 A2 WO1999051749 A2 WO 1999051749A2 IL 9900184 W IL9900184 W IL 9900184W WO 9951749 A2 WO9951749 A2 WO 9951749A2
Authority
WO
WIPO (PCT)
Prior art keywords
plants
recombinant
potyvirus
construct
zymv
Prior art date
Application number
PCT/IL1999/000184
Other languages
French (fr)
Other versions
WO1999051749A3 (en
Inventor
Amit Gal-On
Original Assignee
State Of Israel/Ministry Of Agriculture
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by State Of Israel/Ministry Of Agriculture filed Critical State Of Israel/Ministry Of Agriculture
Priority to EP99912037A priority Critical patent/EP1068330A2/en
Priority to JP2000542461A priority patent/JP2002536956A/en
Priority to CA002327445A priority patent/CA2327445A1/en
Priority to AU30525/99A priority patent/AU3052599A/en
Publication of WO1999051749A2 publication Critical patent/WO1999051749A2/en
Publication of WO1999051749A3 publication Critical patent/WO1999051749A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/60—Isolated nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8203—Virus mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/503—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses
    • C12N9/506—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses derived from RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/34011—Potyviridae
    • C12N2770/34022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention generally relates to a recombinant potyvirus infectious nucleic acid construct useful for providing protection against viral infection in plants and to a recombinant virus harboring said construct. More specifically, the present invention relates to a recombinant potyvirus infectious construct containing an HC - Pro gene whose sequence coding for the conserved FRNK box contains a substitution.
  • the Arginin (Arg) is substituted with Isoleucine (He).
  • the present invention further relates to a method for the production of a mild strain of potyvirus utilizing the above mentioned construct and to a method for protecting plants from viral infection and for transient expression of foreign nucleic acid (genes) in plants, using said construct.
  • the present invention relates to a method for cross protection of curcurbits against ZYMV infection.
  • the Curcurbitaceae is a broad botanical family comprising several economically important species cultivated worldwide, such as cucumber, squash, cantaloupe, zucchini pumpkin, melon and watermelon. Curcurbit production throughout the world is impaired by several aphid transmitted viruses, the most prevalent being the two potyviruses ZYMV (Zucchini Yellow Mosaic Virus) and WMV-2 (Watermelon Mosaic Virus 2) and CMV (cucumber Mosaic Virus). ZYMV infected plants show symptoms such as vein clearing followed by a yellow mosaic on the infected systemic leaf and may show stunting and distortion. In mild cases of infection the quantity and quality of the yield are damaged and in severe infections there might be a total loss of the yield, causing significant economical losses. Control measures include phytosanitation, the use of colored plastic mulches for attracting virus bearing aphids and creating a hydrophobic barrier around the plant such as oil sprays. These provide temporary protection and are a limited protection during a massive infection.
  • the phenomenon of cross protection which is the use of a mild strain of a virus to protect against the damage by infection with severe strains of the same virus, provides a good method for controlling virus diseases.
  • cross protection In curcurbits, cross protection, specifically against ZYMV, is an attractive control option. Cross protection is highly effective under severe disease pressure. The severity of the disease conferred by the ZYMV on curcurbits and the latter' s relatively short crop cycle (8 - 16 weeks) make cross protection a preferred control option for curcurbits.
  • This strain is designated ZYMV-WK and is poorly transmitted by aphids, causes only mild leaf mottling and does not induce fruit malformation in curcurbits. Plants are inoculated at an early stage with the mild strain (ZYMV-WK), usually by mechanical inoculation.
  • Potyviruses have a genome consisting of a positive - sense single stranded RNA possessing a covalently linked 5' - terminal viral protein (Vpg) and a 3' terminal poly (A) tail.
  • the viral RNA is expressed as a single polyprotein, which is subsequently processed by three virus encoded proteases, producing eight to ten genes, which are a conserved region throughout the potyvirus genome.
  • the potyviruses are transmitted from plant to plant by aphids in a non persistent manner, and this process is dependent on the presence of two virus encoded proteins, the coat protein (CP) and the helper component proteinase HC-Pro.
  • the HC-Pro is a multifunctional protein involved in aphid transmission, polyprotein processing, virus replication, symptom expression and in virus movement in the plant (Maia I. G., Haenni A., and Bernardi F., (1996) Journal of General Virology 77:1335-1341).
  • Zucchini yellow mosaic virus is a member of the potyvirus group which causes devastating epidemics in commercial curcurbits world wide.
  • This infectious construct is therefore a unique potyvirus construct which is highly superior for plant cross protection and for transient expression of foreign nucleic acid in plants. It has an improved ability of protection against infection by the severe strain of ZYMV, over any of the existing protection methods, is significantly safer and more environment friendly than the naturally occurring viruses, does not cause the development of symptoms in a variety of curcurbits, and is stable (no revertant virus has been found after several passages through plants).
  • the present invention relates to a recombinant potyvirus infectious nucleic acid, preferably cDNA or RNA, construct useful for plant cross protection, comprising a full length clone characterized in that its HC- Pro gene conserved FRNK box sequence contains a substitution, preferably a substitution of Arg.
  • the construct further contains a substitution which effectively abolishes aphid transmissibility, such as a substitution of the Ala residue at position 10 in the conserved DAG triplet in the N terminal region of the CP or substitution of Thr at position 309 in the HC - pro in ZYMV.
  • the recombinant construct of the present invention may be useful for plant cross protection (especially against severe strains of ZYMV) and for the transient expression of foreign nucleic acid in plants wherein the full length clone has, in any position, a sequence of DNA or RNA inserted into it or wherein any viral genes are removed from the full length clone (defective RNA).
  • the full length clone may be of any potyvirus, preferably of ZYMV.
  • the present invention also relates to a method for providing protection against viral infection in plants comprising inoculating plants, by mechanical inoculation or by bombardment, with the recombinant potyvirus infectious construct.
  • the present invention also relates to a method for introducing foreign nucleic acid into plants according comprising infecting a plant with a full length clone or co-infecting a plant with a full length clone, from which any viral genes are removed, together with a full length clone or virus harboring a full length clone.
  • the present invention also relates to a method for the production of a mild strain of potyvirus comprising inoculating plants with the recombinant potyvirus infectious construct as defined in any of the preceding claims and collecting the resulting progeny, and to a virus produced in this method.
  • the present invention further relates to compositions for plant inoculation or for transient expression of foriegn nucleic acid in plants containing, as an active ingredient, the recombinant construct or a virus containing the recombinant construct.
  • the present invention relates to a recombinant potyvirus infectious nucleic acid construct useful for plant cross protection and for the transient expression of foreign nucleic acid in plants.
  • the present invention further relates to compositions for plant inoculation or for transient expression of foriegn nucleic acid in plants containing, as an active ingredient, the recombinant construct or a virus containing the recombinant construct.
  • the construct of the present invention comprises a full length potyvirus clone containing a substitution in the conserved FRNK box sequence in the HC - pro gene, preferably, Arg (in the FRNK box) is substituted with an amino acid having a bulky side chain or an amino acid from the hydrophobic group such as He.
  • This substitution in the FRNK box dramatically effects the severity of symptom development without effecting the accumulation of the virus in the plant.
  • the construct of the present invention also contains a substitution which effectively abolishes aphid transmissibility , such as the substitution of the Ala residue to Thr at position 10 in the conserved DAG (Asp-Ala-Gly) triplet in the N terminal region of the CP or substitution of Thr by Ala at position 309 in the HC - pro of ZYMV.
  • a substitution which effectively abolishes aphid transmissibility such as the substitution of the Ala residue to Thr at position 10 in the conserved DAG (Asp-Ala-Gly) triplet in the N terminal region of the CP or substitution of Thr by Ala at position 309 in the HC - pro of ZYMV.
  • Full length infectious clones of a severe strain of ZYMV were constructed and put under the control of a phage promoter, such as the T7 RNA polymerase promoter (Gal On A., Antignus Y., Rosner A., and Raccah B.
  • bacterial promoters or a promoter effective in planta such as the cauliflower mosaic virus (CaMV) 35S promoter (Gal On A., Meiri E., Huet H., Hua W.J., Raccah B. and Gaba V. (1995) Journal of General Virology 76:3223-3227).
  • CaMV cauliflower mosaic virus
  • the FRNK box is implicated, for the first time, as being of importance in symptom development, surprisingly without effecting the accumulation of the virus in the plant. Due to the highly conserved sequence of the FRNK box within the HC -Pro gene of the potyviruses, any substitution in the FRNK box of a potyvirus would have an effect on symptom development, not only the substitution of Arg in position 180 with He, in ZYMV, demonstrated in the work described here.
  • BCMV Bean Common Mosaic Virus
  • BYMV Bean YeUow Mosaic Virus
  • BtMV Beet mosaic
  • MWMV Mooroccan watermelon mosaic
  • OYDV Onion yellow dwarf
  • PRSV Paperaya ringspot
  • PStV Piert stripe
  • PepMoV Pepper mottle
  • PVMV pepper veinal mottle
  • CGVBV Cowpea green vein banding
  • GEV ground eyespot
  • ISMV Iris severe mosaic
  • JGMV Johnsongrass mosaic
  • LYSV Longeek yeUow stripe
  • LMV Lettuce mosaic
  • MDMV Mainze dwarf mosaic
  • PPV Plum box
  • PVA Potato A
  • PW Potato V
  • PVY PVY
  • SbMV Soybean mosaic
  • SCMV Sudgarcane mosaic
  • SPFMV Sudgarcane mosaic
  • YMV Yam mosaic
  • ZYFV Zucchini yellow fleck
  • infectious clone may be an RNA transcript or a cDNA construct, though the use of infectious transcripts is the less efficient process in vitro.
  • a method for providing protection against viral infection in plants comprises inoculating plants with the recombinant potyvirus infectious construct, for example, by mechanical inoculation or by bombardment.
  • compositions containing, as an active ingredient, the construct of the present invention may be used for superior plant cross protection, especially against infection by the severe strain of ZYMV and for transient expression of foreign nucleic acid in plants.
  • the composition used for the introduction of the construct into plants, for infecting them by bombardment is an aqueous composition comprising, in aproximately equal volumes, the construct, a salt, such as calcium nitrate and particles such as tungsten, gold.
  • the composition used for the introduction of the construct into plants by mechanical inoculation comprises infected plant tissue.
  • the construct of the present invention may be further used as a vehicle for the transient expression of foreign nucleic acid, namely genes, in a plant.
  • the construct according to the present invention is highly infective, does not induce symptoms in the infected plants and is not transmitted by aphids.
  • compositions containing as an active ingredient, this clone provides an efficient, safe and environment friendly method for transient expression of foreign nucleic acid into the infected plants. Further applications of this construct may, therefore, be the expression of foreign sequences or genes within a defective RNA molecule of potyviruses.
  • Defective RNAs are viral
  • RNA genomes which are missing some of the viral genes but which, together with a complete helper virus (the full length parental virus), can facilitate the expression of the sequences they contain.
  • Defective RNAs are derived from the helper virus genome, but still require the presence of a complete helper virus for replication in the plant cell.
  • the construct of the present invention may have viral genes removed from the full length clone and may then serve to support the expression of foreign genes via potyviruses defective RNA by co-infection of a plant with a full length clone, from which any viral genes are removed, together with a full length clone or virus harboring a full length clone.
  • a method for introducing foreign nucleic acid into plants according to the present invention comprises infecting a plant with a full length clone into which any sequence of DNA or RNA is inserted or co-infecting a plant with a full length clone, from which any viral genes are removed, together with a full length clone or virus harboring a full length clone.
  • a method for the production of a mild strain of potyvirus comprises inoculating plants with the recombinant potyvirus infectious construct and collecting the resulting progeny.
  • Figure 1 is a schematic drawing of four constructs of ZYMV infectious cDNA
  • Figure 1 is a schematic drawing of four constructs of ZYMV infectious cDNA
  • Example 1 - full length clone (FLC) of ZYMV Construction of the mutants in the full length clone (FLC) of ZYMV The constructs which represent the HC - Pro sequences (Huet H., Gal On A., Meiri E., Lecoq H.
  • Antignus Y. Raccah B., Gal - On A. and Cohen S. (1989) Phytoparasitica
  • Leaf discs of squash and cucumber ZYTVTV-infected plants were taken 7 - 10 d.p.i. and the homogenized tissue were subjected to ELISA as described by Antignus et al (1989).
  • the engineered virus containing the Arg 180 replacement by He was designated ZYMV-AGl.
  • This new strain did not cause the development of symptoms in cucumber (three different varieties), melon and watermelon.
  • the virus did accumulate to levels as high as that of the wild type ZYMV-JV. It was assumed, therefore, that the second amino acid difference ( Asp at position 148) is dispensable for altering the symptoms from mild to severe.
  • a new restriction site of Eco47Hl was introduced at position 550 nt (from the 5' of the HC- Pro gene) and the DAG motif in the CP was replaced by DTG respectively (figure 1).
  • ZYMV-AGl n ⁇ ld strain
  • Melon ⁇ Cucumis melo L. cv. Ofir seedlings were planted and were infected with ZYMV-WK and the recombinant virus ZYMV-AGl. The viruses were sprayed onto the melon seedlings prior to planting. The seedlings were then planted together with untreated (control) seedlings. Half of the plants at three weeks were challenged mechanically with the wild type virus (ZYMV-JV) and half were unchallenged for testing natural infection.
  • ZYMV-JV wild type virus
  • Plants were inoculated by bombardment with the ZYMV - AGl containing the GFP reporter gene or Bar gene.
  • a, b and c are three separate experiments, a and b were in the greenhouse and c was done in a small plot in the field, c is a sum of two experiments where the protected plants (AGl) were exposed to field inoculation.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The present invention relates to a recombinant potyvirus infectious nucleic acid, preferably cDNA or RNA, construct useful for plant cross protection, comprising a full length clone characterized in that its HC-Pro gene conserved FRNK box sequence contains a substitution, preferably a substitution of Arg. Preferably, the construct further contains a substitution which effectively abolishes aphid transmissibility. The present invention further relates to a method for the production of a mild strain of potyvirus utilizing the above mentioned construct and to a method for protecting plants from viral infection and for transient expression of foreign nucleic acid (genes) in plants, using said construct. Preferably, the present invention relates to a method for cross protection of curcurbits against ZYMV infection. The present invention also relates to a method for providing protection against viral infection in plants comprising inoculating plants, by mechanical inoculation or by bombardment, with the recombinant potyvirus infectious construct.

Description

RECOMBINANT POTYVIRUS CONSTRUCT AND USE THEREOF
Field of the Invention
The present invention generally relates to a recombinant potyvirus infectious nucleic acid construct useful for providing protection against viral infection in plants and to a recombinant virus harboring said construct. More specifically, the present invention relates to a recombinant potyvirus infectious construct containing an HC - Pro gene whose sequence coding for the conserved FRNK box contains a substitution. Preferably, the Arginin (Arg) is substituted with Isoleucine (He).
The present invention further relates to a method for the production of a mild strain of potyvirus utilizing the above mentioned construct and to a method for protecting plants from viral infection and for transient expression of foreign nucleic acid (genes) in plants, using said construct. Preferably, the present invention relates to a method for cross protection of curcurbits against ZYMV infection.
Background of the Invention
The Curcurbitaceae is a broad botanical family comprising several economically important species cultivated worldwide, such as cucumber, squash, cantaloupe, zucchini pumpkin, melon and watermelon. Curcurbit production throughout the world is impaired by several aphid transmitted viruses, the most prevalent being the two potyviruses ZYMV (Zucchini Yellow Mosaic Virus) and WMV-2 (Watermelon Mosaic Virus 2) and CMV (cucumber Mosaic Virus). ZYMV infected plants show symptoms such as vein clearing followed by a yellow mosaic on the infected systemic leaf and may show stunting and distortion. In mild cases of infection the quantity and quality of the yield are damaged and in severe infections there might be a total loss of the yield, causing significant economical losses. Control measures include phytosanitation, the use of colored plastic mulches for attracting virus bearing aphids and creating a hydrophobic barrier around the plant such as oil sprays. These provide temporary protection and are a limited protection during a massive infection.
Development of virus resistant cultivars either by classical breeding or by introducing viral derived nucleic acid sequences into the plant genome through genetic engineering of plants, is also employed for the protection of plants against virus infection. Squash hybrid transgenic inbred lines exhibiting resistance to ZYMV were produced (Tricoli D.M., Carney K.J., Russell
McMaster P.F., Groff D.W., Hadden K.C., Himmel P.T., Hubbard J. P.,
Boeshore M.L. and Quemada H.D. (1995) Biotechnology vol. 13;1458) but these are limited to one cultivar only.
The phenomenon of cross protection, which is the use of a mild strain of a virus to protect against the damage by infection with severe strains of the same virus, provides a good method for controlling virus diseases.
In curcurbits, cross protection, specifically against ZYMV, is an attractive control option. Cross protection is highly effective under severe disease pressure. The severity of the disease conferred by the ZYMV on curcurbits and the latter' s relatively short crop cycle (8 - 16 weeks) make cross protection a preferred control option for curcurbits.
The currently used mild strain of ZYMV for cross protection of curcurbits, was obtained by Lecoq (Lecoq H., Lemaire JM., Wipf-Scheible C, (1991) Plant
Dis. 75:208-211). This strain is designated ZYMV-WK and is poorly transmitted by aphids, causes only mild leaf mottling and does not induce fruit malformation in curcurbits. Plants are inoculated at an early stage with the mild strain (ZYMV-WK), usually by mechanical inoculation.
No full length infectious clone of this mild virus exists.
Potyviruses have a genome consisting of a positive - sense single stranded RNA possessing a covalently linked 5' - terminal viral protein (Vpg) and a 3' terminal poly (A) tail. The viral RNA is expressed as a single polyprotein, which is subsequently processed by three virus encoded proteases, producing eight to ten genes, which are a conserved region throughout the potyvirus genome. The potyviruses are transmitted from plant to plant by aphids in a non persistent manner, and this process is dependent on the presence of two virus encoded proteins, the coat protein (CP) and the helper component proteinase HC-Pro. The HC-Pro is a multifunctional protein involved in aphid transmission, polyprotein processing, virus replication, symptom expression and in virus movement in the plant (Maia I. G., Haenni A., and Bernardi F., (1996) Journal of General Virology 77:1335-1341).
Zucchini yellow mosaic virus (ZYMV) is a member of the potyvirus group which causes devastating epidemics in commercial curcurbits world wide. A full length clone of ZYMV, from which infectious transcripts were produced, was constructed (Gal On A., Antignus Y., Rosner A., and Raccah B. (1991) Journal of General Virology 72:2639-2643).
It was found that a substitution of the Alanin (Ala) residue to Threonin (Thr) at position 10 in the conserved DAG (Aspartate - Alanin - Glycine; Asp-Ala-Gly) triplet in the N terminal region of the CP effectively abolished aphid transmissibility of ZYMV (Gal On A., Antignus Y., Rosner A., and Raccah B. (1992) Journal of General Virology 73:2183-2187). Also substitution of Thr by Ala at position 309 in the HC-Pro gene of the infectious clone of ZYMV effected aphid transmissibility without changing virus accumulation and symptom development (Huet H., Gal On A., Meiri E., Lecoq H. and Raccah B.(1994) Journal of General Virology 75:1407-1414), though less effectively than the substitution in the DAG triplet in the CP of the ZYMV. It has surprisingly been found that an amino acid substitution in the conserved FRNK box of the potyvirus HC-pro gene allows for the construction of an infectious potyvirus construct, which, when introduced to plants, induces little or no symptom development, and which does not effect the accumulation of the virus in the plant. This infectious construct is therefore a unique potyvirus construct which is highly superior for plant cross protection and for transient expression of foreign nucleic acid in plants. It has an improved ability of protection against infection by the severe strain of ZYMV, over any of the existing protection methods, is significantly safer and more environment friendly than the naturally occurring viruses, does not cause the development of symptoms in a variety of curcurbits, and is stable (no revertant virus has been found after several passages through plants).
Summary of the Invention
The present invention relates to a recombinant potyvirus infectious nucleic acid, preferably cDNA or RNA, construct useful for plant cross protection, comprising a full length clone characterized in that its HC- Pro gene conserved FRNK box sequence contains a substitution, preferably a substitution of Arg. Preferably, the construct further contains a substitution which effectively abolishes aphid transmissibility, such as a substitution of the Ala residue at position 10 in the conserved DAG triplet in the N terminal region of the CP or substitution of Thr at position 309 in the HC - pro in ZYMV. The recombinant construct of the present invention may be useful for plant cross protection (especially against severe strains of ZYMV) and for the transient expression of foreign nucleic acid in plants wherein the full length clone has, in any position, a sequence of DNA or RNA inserted into it or wherein any viral genes are removed from the full length clone (defective RNA). The full length clone may be of any potyvirus, preferably of ZYMV. The present invention also relates to a method for providing protection against viral infection in plants comprising inoculating plants, by mechanical inoculation or by bombardment, with the recombinant potyvirus infectious construct.
The present invention also relates to a method for introducing foreign nucleic acid into plants according comprising infecting a plant with a full length clone or co-infecting a plant with a full length clone, from which any viral genes are removed, together with a full length clone or virus harboring a full length clone.
The present invention also relates to a method for the production of a mild strain of potyvirus comprising inoculating plants with the recombinant potyvirus infectious construct as defined in any of the preceding claims and collecting the resulting progeny, and to a virus produced in this method.
The present invention further relates to compositions for plant inoculation or for transient expression of foriegn nucleic acid in plants containing, as an active ingredient, the recombinant construct or a virus containing the recombinant construct.
Detailed Description of the Invention
The present invention relates to a recombinant potyvirus infectious nucleic acid construct useful for plant cross protection and for the transient expression of foreign nucleic acid in plants. The present invention further relates to compositions for plant inoculation or for transient expression of foriegn nucleic acid in plants containing, as an active ingredient, the recombinant construct or a virus containing the recombinant construct.
The construct of the present invention comprises a full length potyvirus clone containing a substitution in the conserved FRNK box sequence in the HC - pro gene, preferably, Arg (in the FRNK box) is substituted with an amino acid having a bulky side chain or an amino acid from the hydrophobic group such as He. This substitution in the FRNK box dramatically effects the severity of symptom development without effecting the accumulation of the virus in the plant. Preferably, the construct of the present invention also contains a substitution which effectively abolishes aphid transmissibility , such as the substitution of the Ala residue to Thr at position 10 in the conserved DAG (Asp-Ala-Gly) triplet in the N terminal region of the CP or substitution of Thr by Ala at position 309 in the HC - pro of ZYMV. Full length infectious clones of a severe strain of ZYMV were constructed and put under the control of a phage promoter, such as the T7 RNA polymerase promoter (Gal On A., Antignus Y., Rosner A., and Raccah B. (1991) Journal of General Virology 72:2639-2643), bacterial promoters or a promoter effective in planta, such as the cauliflower mosaic virus (CaMV) 35S promoter (Gal On A., Meiri E., Huet H., Hua W.J., Raccah B. and Gaba V. (1995) Journal of General Virology 76:3223-3227).
In the work presented here, the FRNK box is implicated, for the first time, as being of importance in symptom development, surprisingly without effecting the accumulation of the virus in the plant. Due to the highly conserved sequence of the FRNK box within the HC -Pro gene of the potyviruses, any substitution in the FRNK box of a potyvirus would have an effect on symptom development, not only the substitution of Arg in position 180 with He, in ZYMV, demonstrated in the work described here.
Based on the highly conserved genome, organization and gene function of the potyviruses, it may be concluded that the conserved FRNK box in the HC - pro gene has the same function in aU potyviruses (perhaps as a receptor). Therefore, the substitution in the FRNK box in any of the potyviruses would have a similar effect on symptom development. Members of the potyviruses that are economically important are, for example, BCMV (Bean Common Mosaic Virus), BYMV (Bean YeUow Mosaic Virus), BtMV (Beet mosaic), MWMV (Moroccan watermelon mosaic), OYDV (Onion yellow dwarf), PRSV (Papaya ringspot), PStV (Peanut stripe), PepMoV (Pepper mottle), PVMV (pepper veinal mottle), CGVBV (Cowpea green vein banding), GEV (ground eyespot), ISMV (Iris severe mosaic), JGMV (Johnsongrass mosaic), LYSV (Leek yeUow stripe), LMV (Lettuce mosaic), MDMV (Maize dwarf mosaic), PPV (Plum box), PVA (Potato A), PW (Potato V), PVY (Potato Y), SbMV (Soybean mosaic), SCMV (Sugarcane mosaic), SPFMV (Sweet potato feathery mottle), TEV (Tobacco etch), TVMV (Tobacco vein mottling), TBV (Tulip breaking), TuMV (Turnip mosaic), WMV-2 (Watermelon Mosaic Virus 2) ,
YMV (Yam mosaic), ZYFV (Zucchini yellow fleck).
The infectious clone may be an RNA transcript or a cDNA construct, though the use of infectious transcripts is the less efficient process in vitro.
A method for providing protection against viral infection in plants, according to the present invention comprises inoculating plants with the recombinant potyvirus infectious construct, for example, by mechanical inoculation or by bombardment.
Compositions containing, as an active ingredient, the construct of the present invention may be used for superior plant cross protection, especially against infection by the severe strain of ZYMV and for transient expression of foreign nucleic acid in plants. The composition used for the introduction of the construct into plants, for infecting them by bombardment is an aqueous composition comprising, in aproximately equal volumes, the construct, a salt, such as calcium nitrate and particles such as tungsten, gold. The composition used for the introduction of the construct into plants by mechanical inoculation comprises infected plant tissue.
The construct of the present invention may be further used as a vehicle for the transient expression of foreign nucleic acid, namely genes, in a plant. The construct according to the present invention is highly infective, does not induce symptoms in the infected plants and is not transmitted by aphids.
Use of compositions, containing as an active ingredient, this clone provides an efficient, safe and environment friendly method for transient expression of foreign nucleic acid into the infected plants. Further applications of this construct may, therefore, be the expression of foreign sequences or genes within a defective RNA molecule of potyviruses. Defective RNAs are viral
RNA genomes which are missing some of the viral genes but which, together with a complete helper virus (the full length parental virus), can facilitate the expression of the sequences they contain. Defective RNAs are derived from the helper virus genome, but still require the presence of a complete helper virus for replication in the plant cell. The construct of the present invention may have viral genes removed from the full length clone and may then serve to support the expression of foreign genes via potyviruses defective RNA by co-infection of a plant with a full length clone, from which any viral genes are removed, together with a full length clone or virus harboring a full length clone.
A method for introducing foreign nucleic acid into plants according to the present invention comprises infecting a plant with a full length clone into which any sequence of DNA or RNA is inserted or co-infecting a plant with a full length clone, from which any viral genes are removed, together with a full length clone or virus harboring a full length clone.
A method for the production of a mild strain of potyvirus, according to the present invention comprises inoculating plants with the recombinant potyvirus infectious construct and collecting the resulting progeny.
The said invention wiH be further described and illustrated by the following experiments and figure. These experiments and figure do not intend to limit the scope of the invention but to demonstrate and clarify it only.
Brief Description of the Figure
Figure 1 is a schematic drawing of four constructs of ZYMV infectious cDNA
(a-d).
Detailed Description of the Figure
Figure 1 is a schematic drawing of four constructs of ZYMV infectious cDNA
(a-d). The open and striped bars indicate the ZYMV-NAT and ZYMV-WK sequences within the FLC respectively. The relevant restriction enzymes and the amino acid changes are present. On the right side the severity of the symptoms in squash is indicated, from very severe ( M i l l ) to mild (+). The sequence of the primer used for the mutagenesis is indicated. Example 1 - full length clone (FLC) of ZYMV Construction of the mutants in the full length clone (FLC) of ZYMV The constructs which represent the HC - Pro sequences (Huet H., Gal On A., Meiri E., Lecoq H. and Raccah B.(1994) Journal of General Virology 75:1407-1414) of the ZYMV - WK strain were placed under the T7 RNA promoter in the infectious FLC. In order to get higher rate of infection with those constructs the fragment BstXI/Agel from the FLC of 35SZYMVNOS cDNA (Gal On A., Antignus Y., Rosner A., and Raccah B. (1991) Journal of General Virology 72:2639-2643 and Gal On A., Meiri E., Huet H., Hua W.J., Raccah B. and Gaba V. (1995) Journal of General Virology 76:3223-3227), was replaced by the appropriate fragment from pZYHC (-) clone (Huet H., Gal On A., Meiri E., Lecoq H. and Raccah B.(1994) Journal of General Virology 75:1407-1414). Site directed mutagenesis was introduced on ssDNA template of the subclone pksM16B (Gal On A., Antignus Y., Rosner A., and Raccah B. (1991) Journal of General Virology 72:2639-2643), using the primer 5' ATGTTCATAAATAAGCGCTCTAG3 ' (amino acid He is underlined and the unique restriction site of Eco47HI is in bold). The clone pksM16B carrying the mutations was double digested by BamHI/BstEII and the obtained fragment (1.4kb) was introduced to the same sites in the 35SZYMVNOS cDNA (Gal On A., Meiri E., Huet H., Hua W.J., Raccah B. and Gaba V. (1995) Journal of General Virology 76:3223-3227).
Plants, mechanical or bombardment inoculation and symptom appearance of the ZYMV AG1
Greenhouse - grown zucchini squash (Curcurbita pepo. L. cv Ma'ayan), cucumber (Cucumis sativus L. cv. Bet Alpha; Shimshon; Delila), melon (Cucumis melo L. cv. Arava) and watermelon (Citrullus lanatus Schad cv. Malali) plants were used at the cotyledon stage. The inoculated plants were maintained in a growth chamber under continuous light at about 25°C. The plants were examined daily for visual symtom development. Bombardment inoculation were as previously described by Gal - On et al. (1995). Mechanical inoculation of plants infected by the recombinant virus were performed by sap inoculation (lOOmg/ml), applied to a cotyledon previously dusted with carborundum.
Cross protection experiments
Cross protection by the ZYMV-AGl strain was tested as described by Lecoq et al. (1991) Squash seedlings at the fully expanded cotyledon stage were bombarded with the 35S-AG1 at 0.1 μg/μl. A week later they were infected in the greenhouse by 5 - 7 aphids (Myzus persicae) per plant according to
Antignus Y., Raccah B., Gal - On A. and Cohen S. (1989) Phytoparasitica
17:287-289).
Determination of the mutation in the progeny virions
To ascertain the presence of the mutations in the viral RNA total mRNA from infected leaf tissue was extracted. The synthesis of the RT-PCR was performed as described by Huet et al. (1994).
ELISA assay for evaluation of ZYMV titer
Leaf discs of squash and cucumber ZYTVTV-infected plants were taken 7 - 10 d.p.i. and the homogenized tissue were subjected to ELISA as described by Antignus et al (1989).
Previously, sequence comparison has shown four amino acid changes in the 455 amino acid sequence of the HC - pro gene between the severe field strain (ZYMV - JV) and the mild field strain ZYMK - WK. The replacement of a fragment of the HC - Pro of ZYMV - WK containing two substitutions Aspartate (Asp) 148 and Arg 180 (BstXI/BstEπ fragment), reduced symptom expression of the virus in squash plants without effecting virus accumulation. To distinguish which of the two substitutions, Asp 148 or Arg 180, effect symptom development, Arg 180 was replaced by He within the FRNK box (figure 1, clone d) by site directed mutagensis.
The engineered virus containing the Arg 180 replacement by He, was designated ZYMV-AGl. This new strain did not cause the development of symptoms in cucumber (three different varieties), melon and watermelon. The virus did accumulate to levels as high as that of the wild type ZYMV-JV. It was assumed, therefore, that the second amino acid difference ( Asp at position 148) is dispensable for altering the symptoms from mild to severe. In order to verify the presence of the amino acid changes within the mild virus ZYMV - AGl, and to prevent aphid transmission, a new restriction site of Eco47Hl was introduced at position 550 nt (from the 5' of the HC- Pro gene) and the DAG motif in the CP was replaced by DTG respectively (figure 1). The new engineered virus (AGl) and a wild type severe strain (JV) accumulated to a similar level in systemically infected leaves of different curcurbit species (Table 1). Therefore, it may be concluded, that a point mutation changing amino acid Arg 180 to He, dramatically effects the severity of symtom development without effecting the movement and the replication of the ZYMV virus in the plant. The dramatic results confered by a point mutation in the potyvirus FRNK box, demonstrated in this work for the first time, could not have been inferred from the mere known sequence comparison which showed amino acid changes between the severe field strain and the mild field strain.
The stability of the amino acid substitution Arg 180 to He within ZYMV-AGl was tested by infecting hundreds of squash plants and dozens of cucumber plants (Table 2). The presence of the He 180 mutation in the HC - Pro was confirmed by sequencing (data not shown). Curcurbit plants inoculated with ZYMV-AGl mechanically or by particle bombardment with the ZYMV-AGl strain did show the mild symptom appearance even throughout the growing period of the plant (Table 2). The presence of the He 180 mutation within the virion genome was confirmed by sequencing or indirectly by digestion of the RT-PCR amplified fragment with the restriction enzyme Eco47HI (figure 1). Replication and movement of the engineered ZYMV-AGl strain remained high (as the wild type ZYMV), as seen from the accumulated level of the virus. These results suggest that no selective pressure is exerted to cause a reversion in the virus mutated genome.
The ability of the newly produced nύld strain (ZYMV-AGl) to protect against a challenge inoculation of the severe strain of ZYMV (JV), was studied in cross protection experiments. Most of the protected plants did show mild symptoms after a challenge with the severe strain (96% protection). Two plants out of 47 that were infected with the ZYMV-AGl strain and challenged a week later with the JV strain exhibited severe symptoms about one month post inoculation (Table 3).
The protection was studied in a small field experiment in which protected plants were exposed to field inoculation. Approximately 40% of the control non-protected plants became infected, while none of the protected plants showed severe symptoms. Therefore, no fruit damage was observed in the protected plants (Table 3). Previous studies showed that in a typical cross protection phenomenon, both the protective and the challenge virus strains are very closely related (Perring T.M., Farrar C. A., Blua M. J., Wang H.L. and Gonsalves D. (1995) Crop Protection 14 no. 7, 601 - 606). This is the first report where cross protection takes place between strains that have an identical sequence, including the coat protein sequence, that differ only in a single amino acid in a non structural protein (the HC - Pro).
2) Cross protection in melons
Melon {Cucumis melo L. cv. Ofir) seedlings were planted and were infected with ZYMV-WK and the recombinant virus ZYMV-AGl. The viruses were sprayed onto the melon seedlings prior to planting. The seedlings were then planted together with untreated (control) seedlings. Half of the plants at three weeks were challenged mechanically with the wild type virus (ZYMV-JV) and half were unchallenged for testing natural infection.
30 days after the begining of the experiment parameters such as the plant size and the extent of infection with the wild type virus, were studied. Plants infected with ZYMV-JV that were not treated by the weakened virus (WK) were small and showed clear infection symptoms. Plants treated with the recombinant virus (ZYMV - AGl) showed no symptoms of infection.
3) Expression of foreign genes through the ZYMV-AGl clone in plants For the expression of a foriegn gene in an infected plant, a Pst I site was inserted into the ZYMV-AGl between the Nib and CP genes. The GFP (green flurocent protein) reporter gene and the Bar gene, which confers resistance to the non selective herbicide bialaphos (commercially named BASTA), were ampHfied by PCR, using primers containing the Pst I restriction site, and were inserted in the Pstl site.
Plants were inoculated by bombardment with the ZYMV - AGl containing the GFP reporter gene or Bar gene.
Biochemical analysis showed the GFP and Bar gene to be highly and stably expressed. Even after several passages, no revertants of the recombinant mild virus were found and the reporter gene and Bar expression remained high and stable. Plants expressing the GFP were luminecent and plants expressing the Bar gene were found resistant to the herbicide bialaphos. Table 1. Comparison of virus accumulation between ZYMV-JV and ZYMV-AGl strains in cucurbits.
experiment no of tested YMV-JV# ZYMV-AG1Λ ZYMV-WK- no. plants: severe mild mild
JV, AGI, WK ELISA OD(405)
ls+ 11, 6, 6 0.9* (0.41)** 0.5 (0.19) 0.7 (0.18)
2s 2, 9, 8 1 (0.4) 0.7 (0.48) -
3s 3, 10, 4 0.3 (0.08) 0.9 (0.27) 1.33 (0.13)
4s 9, 9, 9 0.51 (0.4) 0.46 (0.21) 0.59 (0.3)
5s 9, 9, - 0.56 (0.07) 0.7 (0.09) -
6s 9, 8, - 0.82 (0.09) 0.95 (0.09) -
7c 6, 7, - 0.7 (0.07) 0.81 (0.2) -
# Severe strain of ZYMV which found in Israel in the Jordan Valley (JV). Λ The engineered virus of ZYMV.
~ ZYMV weak strain described by Lecoq et al. (1991).
* Average of O.D (405) detected by ELISA from 11 plants. ** Standard deviation (in brackets).
+ s and c are squash and cucumber test plants, respectively. Table 2. The stability of the ZYMV-AGl virus in the plants
number of tested plants plant species bombardment * visual # molecular with 35SAGl symptoms analysis of Ilu- 180 mild I severe mutation
squash 402 398 0 10 cucumber 105 103 0 5 melon 30 30 0 3
Total 537Λ 531+ 0 18
*Visual symptoms were observed and detected by ELISA about one and half month post inoculation.
# The presence of the Ilu Mutation was confirmed by digestion of the RT-PCR by Ecc47III restriction enzyme.
Λ Total of bombarded plants.
+ Total of infected plants
Table 3. Cross protection in squash with the mild strain ZYM -AGl (induction) against the severe strain ZYMV-JV (challenge) in the greenhouse experiments.
Number of tested plants experiment induction #challenge symptoms "fruit damage number* ZYMV-AGl ZYMV -JV mild 1 severe
a) 47 47 45 2 1 a) 14 - 15 0 a) - 5 5 5 b) 15 15 14 0 0 b) 5 - 5 0 b) - 5 5 5
c) 43 field inocul. 43 0 c) - 6 6 6 c)18 healthy - field inocul. 7 7
* a, b and c are three separate experiments, a and b were in the greenhouse and c was done in a small plot in the field, c is a sum of two experiments where the protected plants (AGl) were exposed to field inoculation.
~ No. of plants showed fruit damage.
# Inoculation by aphids.

Claims

1) A recombinant potyvirus infectious nucleic acid construct useful for plant cross protection, comprising a full length clone characterized in that its HC- Pro gene conserved FRNK box sequence contains a substitution.
2) A recombinant construct according to claim 1 wherein the nucleic acid is cDNA or an RNA transcript.
3) A recombinant construct according to claim 1 wherein the substitution in the conserved FRNK box is a substitution of Arg.
4) A recombinant construct according to claim 3 wherein Arg is substituted with an amino acid of the hydrophobic group or having a bulky side chain.
5) A recombinant construct according to claim 4 wherein Arg is substituted with He.
6) A recombinant construct according to claim 1 further containing a substitution which effectively abolishes aphid transmissibility.
7) A recombinant potyvirus infectious nucleic acid construct according to claim 5 and 6 wherein the potyvirus is ZYMV.
8) A recombinant construct according to claim 6 and 7 wherein the substitution which effectively abolishes aphid transmissibility is a substitution of the Ala residue at position 10 in the conserved DAG triplet in the N terminal region of the CP or substitution of Thr at position 309 in the HC - pro in ZYMV. 9) A recombinant construct according to claim 8 wherein the construct is ZYMV-AGl.
10) A recombinant construct according to claim 9, useful for plant cross protection wherein the cross protection is against severe strains of ZYMV.
11) A recombinant construct according to claims 1-10 further useful for the transient expression of foreign nucleic acid in plants wherein the full length clone has, in any position, a sequence of DNA or RNA inserted into it or wherein any viral genes are removed from the full length clone.
12) A recombinant potyvirus infectious nucleic acid construct according to claims 1-6 and claim 11 wherein the potyvirus is selected from BCMV, BYMV, BtMV, MWMV, OYDV, PRSV, PStV, PepMoV, PVMV, CGVBV, GEV, ISMV, JGMV, LYSV, LMV, MDMV, PPV, PVA, PW , PVY, SCMV, SPFMV, TEV, TVMV, TBV, TuMV, WMV-2 , YMV and ZYFV.
13) A method for providing protection against viral infection in plants comprising inoculating plants with the recombinant potyvirus infectious construct as defined in any of the preceding claims.
14) A method according to claim 13 wherein inoculating plants is done by mechanical inoculation or by bombardment.
15) A method for introducing foreign nucleic acid into plants comprising infecting a plant with a fuH length clone as defined in claim 11 or co-infecting a plant with a full length clone as defined in claim 1, from which any viral genes are removed, together with a full length clone or virus harboring a full length clone. 16) A method for the production of a mild strain of potyvirus comprising inoculating plants with the recombinant potyvirus infectious construct as defined in any of the preceding claims and collecting the resulting progeny.
17) A virus containing the recombinant construct as defined by claim 1 and as produced according to claim 16.
18) Produce inoculated with the recombinant construct as defined in the preceding claims and in the method according to claim 12.
19) Produce according to claim 18 wherein the produce are curcurbits.
20) Compositions for plant inoculation or for transient expression of foriegn nucleic acid in plants containing, as an active ingredient, the recombinant construct according to claim 1-12 or a virus containing the recombinant construct according to claim 17.
PCT/IL1999/000184 1998-04-07 1999-03-30 Recombinant potyvirus construct and use thereof WO1999051749A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP99912037A EP1068330A2 (en) 1998-04-07 1999-03-30 Recombinant potyvirus construct and use thereof
JP2000542461A JP2002536956A (en) 1998-04-07 1999-03-30 Recombinant potyvirus constructs and uses thereof
CA002327445A CA2327445A1 (en) 1998-04-07 1999-03-30 Recombinant potyvirus construct and use thereof
AU30525/99A AU3052599A (en) 1998-04-07 1999-03-30 Recombinant potyvirus construct and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IL12399498 1998-04-07
IL123994 1998-04-07

Publications (2)

Publication Number Publication Date
WO1999051749A2 true WO1999051749A2 (en) 1999-10-14
WO1999051749A3 WO1999051749A3 (en) 1999-12-09

Family

ID=11071404

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL1999/000184 WO1999051749A2 (en) 1998-04-07 1999-03-30 Recombinant potyvirus construct and use thereof

Country Status (7)

Country Link
EP (1) EP1068330A2 (en)
JP (1) JP2002536956A (en)
CN (1) CN1303433A (en)
AU (1) AU3052599A (en)
CA (1) CA2327445A1 (en)
TR (1) TR200002909T2 (en)
WO (1) WO1999051749A2 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001034823A2 (en) * 1999-11-12 2001-05-17 University Of South Carolina Method for enhancing resistance in plants
JP2002238574A (en) * 2001-02-16 2002-08-27 Japan International Research Center For Agricultural Services Whole length genomic rna of papaya deformed leaf mosaic virus
EP1364035A1 (en) * 2001-01-24 2003-11-26 Virogene Ltd. Vectors capable of imparting herbicide resistance and viral cross protection and methods
EP1425395A2 (en) * 2000-11-28 2004-06-09 Virogene Ltd. Systems and methods for delivering interferon to a subject
CN102796739A (en) * 2012-08-16 2012-11-28 北京农业生物技术研究中心 Application of TuMV-CP gene fragment-mediated RNAi carrier in cultivation of anti-TuMV transgenic plant
US8372964B2 (en) * 2007-12-26 2013-02-12 Seoul Women's University Industry—University Cooperation Foundation Highly infectious nucleic acid molecules from pepper mottle virus and plant viral vector derived from the same
CN108823174A (en) * 2018-06-28 2018-11-16 山东农业大学 The development and its application of papaya ringspot virus watermelon strain attenuated vaccine
US10351874B2 (en) 2011-04-20 2019-07-16 Syngenta Participations Ag Cucurbita plant resistant to potyvirus
CN111118216A (en) * 2020-01-18 2020-05-08 广西壮族自治区农业科学院 PCR primer group and kit for detecting sweet pepper vein mottle virus and application of PCR primer group and kit

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102277376B (en) * 2010-06-10 2013-09-25 叶锡东 Gene transfer vector providing crop broad-spectrum virus resistance and containing pawpaw ringspot virus helper component protease gene and application thereof
CN102379305B (en) * 2011-09-28 2013-11-20 中国农业大学 Novel applications of corn ferredoxin
CN104531756A (en) * 2014-10-15 2015-04-22 湖南省烟草公司长沙市公司 Method for providing tobacco with potato Y virus resistance and VIGS carrier
CN107964551A (en) * 2017-12-07 2018-04-27 山东农业大学 The structure of watermelon mosaic virus infectious clone expression vector and application
CN116675751B (en) * 2023-06-08 2024-01-26 山东农业大学 Application of SWEET1g protein and encoding gene thereof in resisting potato viruses

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995012669A1 (en) * 1993-11-01 1995-05-11 The Texas A & M University System Expression of foreign genes using a replicating polyprotein producing virus vector

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995012669A1 (en) * 1993-11-01 1995-05-11 The Texas A & M University System Expression of foreign genes using a replicating polyprotein producing virus vector

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
BLANC, S., ET AL.: "A specific interaction between coat protein and helper component correlates with aphid transmission of a potyvirus" VIROLOGY, vol. 231, 1997, pages 141-147, XP002118205 *
FUCHS, M., ET AL.: "Management of virus diseases by classical and engineered protection" MOLECULAR PLANT PATHOLOGY ON-LINE ÄHTTP://WWW.BSPP.ORG.UK/MPPOL/] 1997/0116FUCHS, [Online] 1997, pages 1-19, XP002118200 Retrieved from the Internet: <URL:http://www.bspp.org.uk./mppol/1997/01 16fuchs/> [retrieved on 1999-10-08] *
GAL-ON, A., ET AL.: "A zucchini yellow mosaic virus coat protein gene mutation restores aphid transmissibility but has no effect on amplification" JOURNAL OF GENERAL VIROLOGY, vol. 73, 1992, pages 2183-2187, XP002118198 cited in the application *
GAL-ON, A., ET AL.: "Particle bombardment drastically increases the infectivity of cloned DNA of zucchini yellow mosaic potyvirus" JOURNAL OF GENERAL VIROLOGY, vol. 76, 1995, pages 3223-3227, XP002118207 *
GRANIER, F., ET AL.: "Mutations in zucchini yellow mosaic virus helper component protein associated with loss of aphid transmissibility" JOURNAL OF GENERAL VIROLOGY, vol. 74, 1993, pages 2737-2742, XP002118202 -& GRANIER, F., ET AL.: "Helper component - zucchini yellow mosaic virus (strain E15-PAT)" PIR ACCESSION NO:JQ2396, 30 September 1993 (1993-09-30), XP002118203 *
HUET, H., ET AL: "Mutations in the helper component protease gene of zucchini yellow mosaic virus affect its ability to mediate aphid transmissibility" JOURNAL OF GENERAL VIROLOGY, vol. 75, 1994, pages 1407-1414, XP002118196 cited in the application -& HUET, H., ET AL.: "Zucchini yellow mosaic virus (ZYMV) HC-PRO gene" EMBL ACCESSION NO: X77756, 25 April 1994 (1994-04-25), XP002118197 *
LECOQ, H., ET AL.: "Characterization of a zucchini yellow mosaic virus isolate with a deficient helper component" PHYTOPATHOLOGY, vol. 81, 1991, pages 1087-1091, XP002118204 *
LECOQ, H., ET AL.: "Control of zucchini yellow mosaic virus in squash by cross protection" PLANT DISEASE, vol. 75, 1991, pages 208-211, XP002118201 *
LIVNEH, ORNA., ET AL.: "Plants transformed with the first (nonstructural) three cistrons of potato virus Y are resistant to potato virus infection" TRANSGENICS (1995), 1(5), 565-71, XP002118206 *
MAIA, I.G., ET AL.: "Potyviral HC-PRO: a multifunctional protein" JOURNAL OF GENERAL VIROLOGY, vol. 77, 1996, pages 1335-1341, XP002118199 *
PENG, Y.-H., ET AL.: "Mutations in the HC-Pro gene of zucchini yellow mosaic potyvirus: effects on aphid transmission and binding to purified virions" JOURNAL OF GENERAL VIROLOGY, vol. 79, April 1998 (1998-04), pages 897-904, XP002118215 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001034823A3 (en) * 1999-11-12 2001-11-29 Univ South Carolina Method for enhancing resistance in plants
US6806400B1 (en) 1999-11-12 2004-10-19 University Of South Carolina Method for enhancing pathogen resistance in plants
WO2001034823A2 (en) * 1999-11-12 2001-05-17 University Of South Carolina Method for enhancing resistance in plants
EP1425395A2 (en) * 2000-11-28 2004-06-09 Virogene Ltd. Systems and methods for delivering interferon to a subject
EP1425395A4 (en) * 2000-11-28 2006-03-01 Virogene Ltd Systems and methods for delivering interferon to a subject
EP1364035A1 (en) * 2001-01-24 2003-11-26 Virogene Ltd. Vectors capable of imparting herbicide resistance and viral cross protection and methods
EP1364035A4 (en) * 2001-01-24 2005-05-04 Virogene Ltd Vectors capable of imparting herbicide resistance and viral cross protection and methods
JP2002238574A (en) * 2001-02-16 2002-08-27 Japan International Research Center For Agricultural Services Whole length genomic rna of papaya deformed leaf mosaic virus
US8372964B2 (en) * 2007-12-26 2013-02-12 Seoul Women's University Industry—University Cooperation Foundation Highly infectious nucleic acid molecules from pepper mottle virus and plant viral vector derived from the same
US10351874B2 (en) 2011-04-20 2019-07-16 Syngenta Participations Ag Cucurbita plant resistant to potyvirus
US10717987B2 (en) 2011-04-20 2020-07-21 Syngenta Participations Ag Cucurbita plant resistant to potyvirus
US11186846B2 (en) 2011-04-20 2021-11-30 Syngenta Participations Ag Cucurbita plant resistant to potyvirus
CN102796739B (en) * 2012-08-16 2014-02-19 北京农业生物技术研究中心 Application of TuMV-CP gene fragment-mediated RNAi carrier in cultivation of anti-TuMV transgenic plant
CN102796739A (en) * 2012-08-16 2012-11-28 北京农业生物技术研究中心 Application of TuMV-CP gene fragment-mediated RNAi carrier in cultivation of anti-TuMV transgenic plant
CN108823174A (en) * 2018-06-28 2018-11-16 山东农业大学 The development and its application of papaya ringspot virus watermelon strain attenuated vaccine
CN111118216A (en) * 2020-01-18 2020-05-08 广西壮族自治区农业科学院 PCR primer group and kit for detecting sweet pepper vein mottle virus and application of PCR primer group and kit
CN111118216B (en) * 2020-01-18 2022-09-20 广西壮族自治区农业科学院 PCR primer group and kit for detecting sweet pepper vein mottle virus and application of PCR primer group and kit

Also Published As

Publication number Publication date
CA2327445A1 (en) 1999-10-14
JP2002536956A (en) 2002-11-05
WO1999051749A3 (en) 1999-12-09
EP1068330A2 (en) 2001-01-17
CN1303433A (en) 2001-07-11
TR200002909T2 (en) 2001-02-21
AU3052599A (en) 1999-10-25

Similar Documents

Publication Publication Date Title
Weber et al. Two amino acid substitutions in the tomato mosaic virus 30-kilodalton movement protein confer the ability to overcome the Tm-2 (2) resistance gene in the tomato
DE69535563T2 (en) TRANSGENIC PLANTS EXPRESSING DNA CONSTRUCTS CONTAINING SEVERAL VIRUS RESISTANT GENES
SCHOLTHOF et al. Tomato bushy stunt virus spread is regulated by two nested genes that function in cell-to-cell movement and host-dependent systemic invasion
Gal-On A point mutation in the FRNK motif of the potyvirus helper component-protease gene alters symptom expression in cucurbits and elicits protection against the severe homologous virus
JPH0851986A (en) Method of producing virus resisting plant
EP1068330A2 (en) Recombinant potyvirus construct and use thereof
JPH08506489A (en) Plants resistant to PLRV infection
EP0513054B1 (en) Virus/herbicide resistance genes process for producing same and their use
CN1119422C (en) Virus resistant plants
EP0938574B1 (en) Method for inducing viral resistance into a plant
US20020059660A1 (en) Transgenic plants expressing DNA constructs containing a plurality of genes to impart virus resistance
US5792937A (en) Plants resistant to infection by PVX
JP2008283978A (en) Papaya ringspot virus gene
AU3284599A (en) Disease resistant transgenic plants
MXPA00009836A (en) Recombinant potyvirus construct and use thereof
Yie et al. Rapid production and field testing of homozygous transgenic tobacco lines with virus resistance conferred by expression of satellite RNA and coat protein of cucumber mosaic virus
Gokalp et al. Properties of a previously undescribed nepovirus from South-East Anatolia
Monti et al. Transgenic tomatoes expressing a cucumber mosaic virus satellite RNA: Field testing and analysis of satellite RNA spread
TW202405179A (en) Construct for rendering papaya plant resistant to papaya ringspot virus, method for generating mild papaya ringspot virus, mild papaya ringspot virus, vaccine for mild papaya ringspot virus and method for rendering papaya plant resistant to papaya ringspot virus including a whole genome coding region fragment of the papaya ringspot virus TG5
US5428144A (en) Maize dwarf mosaic virus cDNA
US20050257287A1 (en) Vectors capable of imparting herbicide resistance and viral cross protection and methods
Sudarsono et al. Transgenic Barley and Flue-Cured Tobacco with Resistance
Li Turnip crinkle virus (TCV) and its subviral RNAs
Hammond et al. Resistance to Bean Yellow Mosaic Virus (BYMV) and Other Po ses in Transgenic Plants Expressing BYMV Antisense RNA, Coat Protein, or Chimeric Coat Proteins
Rajakaruna Characterization of a Brassica-infecting comovirus from Ohio

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99806606.0

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2327445

Country of ref document: CA

Ref document number: 2327445

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1999912037

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 30525/99

Country of ref document: AU

Ref document number: PA/a/2000/009836

Country of ref document: MX

Ref document number: 2000/02909

Country of ref document: TR

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 09647952

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1999912037

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1999912037

Country of ref document: EP