WO1999045948A1 - Reagents for detection and treatment of kaposi's sarcoma - Google Patents

Reagents for detection and treatment of kaposi's sarcoma Download PDF

Info

Publication number
WO1999045948A1
WO1999045948A1 PCT/US1999/005464 US9905464W WO9945948A1 WO 1999045948 A1 WO1999045948 A1 WO 1999045948A1 US 9905464 W US9905464 W US 9905464W WO 9945948 A1 WO9945948 A1 WO 9945948A1
Authority
WO
WIPO (PCT)
Prior art keywords
hhv
glycoprotein
antibody
complex
human
Prior art date
Application number
PCT/US1999/005464
Other languages
French (fr)
Inventor
J. Charles Whitbeck
Roselyn J. Eisenberg
Gary H. Cohen
Original Assignee
The Trustees Of The University Of Pennsylvania
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of The University Of Pennsylvania filed Critical The Trustees Of The University Of Pennsylvania
Priority to AU31848/99A priority Critical patent/AU3184899A/en
Publication of WO1999045948A1 publication Critical patent/WO1999045948A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
    • C07K16/085—Herpetoviridae, e.g. pseudorabies virus, Epstein-Barr virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
    • C12N2710/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16411—Rhadinovirus, e.g. human herpesvirus 8
    • C12N2710/16422—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the field of the invention is diagnosis and treatment of Kaposi's sarcoma.
  • Herpesviruses are ubiquitous viruses which are the causative agents of numerous diseases in both humans and animals. These viruses are enveloped double stranded icosahedral DNA containing viruses, which envelope is acquired by budding of the nucleocapsid through the inner nuclear membrane.
  • Members of the he ⁇ esvirus family which are important human pathogens include herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella zoster virus (VZV), Epstein Ban * virus (EBV), cytomegalovirus (CMV), and human herpesviruses type 6, type 7 and type 8 (HHV-6, HHV-7 and HHV-8).
  • Human herpes virus 8 (HHV-8) has been implicated in AIDs associated
  • KS Kaposi's sarcoma
  • HAV Human Immunodeficiency Virus
  • the invention includes an isolated nucleic acid encoding an HHV-8 glycoprotein H polypeptide.
  • the nucleic acid shares at least about 40% homology with SEQ ID NO.T.
  • the nucleic acid has the sequence of SEQ ID NO:l.
  • the invention also includes a vector comprising an isolated nucleic acid encoding an HHV-8 glycoprotein H polypeptide.
  • the vector is the plasmid pCW320.
  • the invention includes a recombinant cell comprising an isolated nucleic acid encoding an HHV-8 glycoprotein H polypeptide.
  • the invention further includes an isolated nucleic acid encoding an HHV-8 glycoprotein L polypeptide.
  • the nucleic acid shares at least about 40% homology with
  • the nucleic acid has the sequence of SEQ ID NO:3.
  • the vector is the plasmid pCW315. Also included is a recombinant cell comprising an isolated nucleic acid encoding an HHV-8 glycoprotein L polypeptide.
  • the invention additionally includes a substantially pure preparation of an HHV-8 glycoprotein H polypeptide.
  • the substantially pure preparation of the HHV-8 glycoprotein H polypeptide shares at least about 40% homology with SEQ ID NO:2.
  • the substantially pure preparation of the HHV-8 glycoprotein H polypeptide has the sequence of SEQ ID NO:2.
  • the invention further includes a cell comprising a substantially pure preparation of an HHV-8 glycoprotein H polypeptide.
  • the invention includes a substantially pure preparation of an HHN-8 glycoprotein L polypeptide.
  • L polypeptide shares at least about 40% homology with SEQ ID ⁇ O:4.
  • the substantially pure preparation of the HHV-8 glycoprotein L polypeptide has the sequence of SEQ ID NO:4.
  • the invention also includes a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex.
  • the glycoprotein H in the complex is truncated.
  • the truncated glycoprotein H comprises a signal sequence and an ectodomain.
  • glycoprotein H is truncated after amino acid 704.
  • the glycoprotein L is substantially full length.
  • the amino acid sequence of the glycoprotein H shares at least about 40% homology with SEQ ID NO:2 and the amino acid sequence of the glycoprotein L shares at least about 40% homology with SEQ ID NO:4.
  • amino acid sequence of the glycoprotein H is amino acids 1-704 of SEQ ID NO:2 and the amino acid sequence of the glycoprotein L is SEQ ID NO:4.
  • the cell is selected from the group consisting of a prokaryotic cell and a eukaryotic cell.
  • the eukaryotic cell is selected from the group consisting of a yeast cell, an insect cell and a mammalian cell. Yet more preferably, the cell is a murine cell.
  • the cell is KS gH/L-9.
  • the invention includes an isolated nucleic acid encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex.
  • the invention includes a pharmaceutical composition comprising an isolated nucleic acid encoding a soluble HHV-8 glycoprotein H- glycoprotein L complex.
  • composition comprising a soluble HHV-8 glycoprotein H-glycoprotein L complex.
  • invention additionally includes a vaccine comprising an isolated nucleic acid encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex.
  • the invention further includes a vaccine comprising a soluble HHV-8 glycoprotein H-glycoprotein L complex.
  • an antibody which specifically binds an HHV-8 glycoprotein H polypeptide.
  • the antibody is selected from the group consisting of a polyclonal, a monoclonal and a synthetic antibody.
  • the antibody is a monoclonal antibody.
  • the antibody is 6F12AB1.
  • the invention also includes a hybridoma cell line which produces an antibody which specifically binds an HHV-8 glycoprotein H polypeptide.
  • the invention includes an antibody which specifically binds an HHV-8 glycoprotein L polypeptide.
  • the antibody is selected from the group consisting of a polyclonal, a monoclonal and a synthetic antibody.
  • the antibody is a monoclonal antibody.
  • hybridoma cell line which produces an antibody which specifically binds an HHV-8 glycoprotein L polypeptide.
  • a vaccine comprising a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
  • the invention further includes a vaccine comprising at least one polynucleotide encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
  • the invention also provides a method of preventing an HHV-8 infection in a human.
  • the method comprises administering to the human a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
  • a method of preventing an HHV-8 infection in a human comprises administering to the human at least one polynucleotide encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
  • a method of treating an HHV-8 infection in a human comprises administering to the human a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
  • the invention further includes a method of treating an HHV-8 infection in a human.
  • the method comprises administering to the human at least one polynucleotide encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
  • the invention includes a method of diagnosing an HHV-8 infection in a human.
  • the method comprises contacting a biological sample obtained from the human with an antibody which specifically binds to a protein selected from the group consisting of HHV-8 glycoprotein H, HHV-8 glycoprotein L, and HHV-8 glycoprotein H-glycoprotein L complex, wherein when the antibody specifically binds to a composition in the biological sample, the human has the HHV-8 infection.
  • the invention includes a method of diagnosing an HHV-8 infection in a human, the method comprising contacting a biological sample obtained from the human with a protein selected from the group consisting of HHV-8 glycoprotein H, HHV-8 glycoprotein L, and HHV-8 glycoprotein H-glycoprotein L complex, and determining whether the protein specifically binds to an antibody in the biological sample, wherein specific binding of the protein to an antibody in the biological sample is an indication that the human has an HHV-8 infection.
  • the protein has a detectable label attached thereto and specific binding of the protein to an antibody in the biological sample is assessed by assessing the association of the label with the antibody.
  • the method comprises contacting a biological sample obtained from the human with an isolated nucleic acid selected from the group consisting of an HHV-8 glycoprotein H polynucleotide and an HHV-8 glycoprotein L polynucleotide, and determining whether the isolated nucleic acid binds to a nucleic acid in the biological sample, wherein binding of the isolated nucleic acid to nucleic acid in the biological sample, is an indication that the human has an HHV-8 infection.
  • an isolated nucleic acid selected from the group consisting of an HHV-8 glycoprotein H polynucleotide and an HHV-8 glycoprotein L polynucleotide
  • the invention additionally includes a method of diagnosing an HHV-8 infection in a human.
  • the method comprises contacting a biological sample obtained from the human with a substantially pure preparation of an HHV-8 gH polypeptide, or an HHV-8 gL polypeptide and determining whether the polypeptide binds to an antibody in the biological sample, wherein binding of the polypeptide to an antibody in the biological sample is an indication that the human has an HHV-8 infection.
  • the invention includes a method of diagnosing an HHV-8 infection in a human, the method comprising contacting a biological sample obtained from the human with a substantially pure preparation of an HHV-8 gH-gL complex and determining whether the complex binds to an antibody in the biological sample, wherein binding of the complex to an antibody in the biological sample is an indication that the human has an HHV-8 infection.
  • Figure 1 is the nucleotide sequence of HHV-8 gH open reading frame (SEQ ID NO:l).
  • Figure 2 is the predicted amino acid sequence of HHV-8 gH (SEQ ID NO:2).
  • Figure 3 is the nucleotide sequence of HHV-8 gL ORF (SEQ ID NO:3).
  • Figure 4 is the predicted amino acid sequence of HHV-8 gL (SEQ ID NO:4).
  • Figure 5 depicts construction of plasmid pCW320.
  • Truncated HHV-8 gH ORF was PCR amplifed, adding 6 his-codons and a termination codon using a 3' primer.
  • the PCR product was digested with BamHl and cloned into BamHl-digestcd pcDNA3.1/Hygro(+).
  • Figure 6 depicts construction of plasmid pCW315.
  • HHV-8gL ORF was PCR amplified using a 5' PCR primer having the sequence GGATCCTAGAGGAGACATG CAG GGT CTA GCC TTC TTG and a 3' primer, the reverse complement of which had the sequence TAT AGA AGA CGC GCA GCC AGT CAT CAC CAC CAT CAC CAT TAGGATCC. where BamHl sites are underlined.
  • the PCR product was digested with BamHl and cloned into R /wHI-digested pcDNA3.1/ ⁇ ygro(+).
  • Figure 7A is an image of a series of gels depicting crude nickel-agarose purification of KS gH/gL.
  • Figure 7B is an image of a series of gels depicting the fact that expression of KS gH/gL is enhanced by the addition of sodium butyrate.
  • the invention relates to the discovery of two HHV-8 glycoproteins, gH and gL, which are useful for the development of diagnostic, therapeutic and prophylactic reagents for diagnosis, treatment, and prevention of KS in humans.
  • the invention includes an isolated DNA comprising DNA encoding an HHV-8 gH protein. While the preferred DNA encoding HHV-8 gH protein is SEQ ID NO: 1 , the invention should not be construed to be limited to this sequence. Rather, the isolated DNA of the invention encoding HHV-8 gH should be construed to be any
  • the DNA encoding HHV-8 gH of the invention shares about 40% homology with SEQ ID NO: 1. More preferably, the DNA shares about 50%, even more preferably, the DNA shares about 60%), yet more preferably, the DNA shares about 70%, more preferably 80%, even more preferably 90%), yet more preferably 95% and even more preferably the DNA shares about 99-100% homology with SEQ ID NO:l.
  • the invention further includes an isolated DNA comprising DNA encoding an HHV-8 gL protein. While the preferred DNA encoding HHV-8 gL protein is SEQ ID NO:3, the invention should not be construed to be limited to this sequence.
  • the isolated DNA of the invention encoding HHV-8 gL should be construed to be any DNA encoding HHV-8 gL or any mutant, variant, or homolog thereof, having the biological activity of HHV-8 gL as described herein.
  • the DNA encoding HHV-8 gL of the invention shares about 40% homology with SEQ ID NO:3. More preferably, the DNA shares about 50%, even more preferably, the DNA shares about 60%, yet more preferably, the DNA shares about 70%>, more preferably 80%, even more preferably 90%>, yet more preferably 95% and even more preferably the DNA shares about 99-100% homology with SEQ ID NO:3.
  • the invention also includes a substantially pure preparation of an isolated polypeptide comprising an HHV-8 gH polypeptide. While the preferred HHV-
  • the invention should not be construed to be limited to this sequence. Rather, the HHV-8 gH polypeptide of the invention should be construed to be any HHV-8 gH polypeptide, or any mutant, variant, or homolog thereof, having the biological activity of HHV-8 gH as described herein.
  • the amino acid sequence of the HHV-8 gH of the invention shares about 35% homology with SEQ ID NO:2.
  • the DNA shares about 50%), even more preferably, the DNA shares about 60%, yet more preferably, the DNA shares about 70%), more preferably 80%, even more preferably 90%), yet more preferably 95%> and even more preferably the DNA shares about 99-100%) homology with SEQ ID NO:2.
  • the invention also includes a substantially pure preparation of an isolated polypeptide comprising an HHV-8 gL polypeptide. While the preferred HHV- 8 gL polypeptide has the sequence of SEQ ID NO:4, the invention should not be construed to be limited to this sequence. Rather, the HHV-8 gL polypeptide of the invention should be construed to be any HHV-8 gL polypeptide, or any mutant, variant, or homolog thereof, having the biological activity of HHV-8 gL as described herein. Preferably, the amino acid sequence of the HHV-8 gL of the invention shares about 35% homology with SEQ ID NO:4.
  • the DNA shares about 50%, even more preferably, the DNA shares about 60%, yet more preferably, the DNA shares about 70%, more preferably 80%, even more preferably 90%), yet more preferably 95%) and even more preferably the DNA shares about 99-100%) homology with SEQ ID NO:4.
  • the invention further includes an HHV-8 gH/gL complex, which complex is preferably a soluble complex which is secreted from the cell.
  • the gH/gL complex is a soluble complex, it comprises a truncated gH molecule, designated herein as gHt, which is complexed to a substantially full length gL molecule.
  • the complex is referred to herein as a gHt-gL complex.
  • This complex may be obtained in large quantities using recombinant DNA methodology as described herein, for use as a vaccine for protection of humans against HHV-8 infection, or for eliminating or diminishing the frequency of reactivation of the virus from the latent state thus, reducing the severity of HHV-8 infection in humans.
  • the complex is also useful as a diagnostic reagent for assessing the presence or absence of a HHV-8 infection in a human. Such an assessment is made by obtaining a sample, such as serum, from the individual and reacting it with the complex in a standard immunoassay, such as radioimmunoassay or enzyme linked immunoadsorbent assay (ELISA).
  • a standard immunoassay such as radioimmunoassay or enzyme linked immunoadsorbent assay (ELISA).
  • HHV-8 gH and gL may also be used to diagnose the presence of HHV-8 in a human patient. Either of these two proteins may be used to
  • these proteins may be used in a diagnostic assay as set forth herein.
  • the proteins may have a detectable label attached thereto to facilitate detection of the antibody.
  • Diagnosis of an HHV-8 infection in a human patient may also be accomplished using nucleic acid which specifically binds to nucleic acid comprising one or both strands of the gH or gL genes in HHV-8.
  • nucleic acid diagnostic assays are well know in the art, and may comprise polymerase chain reactions or simple hybridization assays which can be performed on samples comprising a tissue, a cell or nucleic acid obtained from the patient.
  • the gH-gL complex of the invention comprises a truncated gH molecule which is complexed to a substantially full length gL molecule. It has been discovered in the present invention that it may be necessary that the gH portion of the gHt-gL complex be truncated in order that the complex is secreted from the cell in soluble form. Truncated forms of gH include those containing amino acid residues selected from regions of the protein which bind to gL. At a minimum, the truncated form of gH useful in the complex of the invention comprises a signal sequence and an ectodomain. In particular, gH which is truncated after amino acid number 704 is especially useful for formation of the gHt-gL complex of the invention.
  • HHV-8 gH Based upon the amino acid sequence provided in SEQ ID NO:2, it is predicted that HHV-8 gH has a cleavable signal sequence which comprises about amino acid residues 1-21 of the protein. It is further predicted that HHV-8 gH is anchored to the cell membrane (or the virus envelope when referring to virions) via a series of hydrophobic amino acid residues near the carboxy-terminus, at about amino acid residues 805-723. It is therefore further predicted that the ectodomain of HHV-8 gH comprises about amino acids 22-704.
  • truncated forms of gH are generated using conventional recombinant DNA technology, as described herein and in, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and in Ausubel et al. (1994, Current
  • a plasmid comprising a truncated form of gH is cotransfected into a cell with substantially full length HHV-8 gL.
  • the synthesis and/or secretion, or absence thereof, of a soluble gHt- gL complex from the cell is assessed using any of the assays presented herein.
  • the invention should be construed to include any and all forms of HHV-8 gH which form a soluble complex with substantially full length gL, which complex has the biological activity defined herein.
  • signal sequence is meant a polynucleotide sequence which encodes a peptide that directs the path a polypeptide takes within a cell, i.e., it directs the cellular processing of a polypeptide in a cell, including, but not limited to, eventual secretion of a polypeptide from a cell.
  • a signal sequence is a sequence of amino acids which are typically, but not exclusively, found at the amino terminus of a polypeptide which targets the synthesis of the polypeptide to the endoplasmic reticulum. In some instances, the signal peptide is proteolytically removed form the polypeptide and is thus absent from the mature protein.
  • a polypeptide having an "ectodomain” is one wherein a portion of the polypeptide is positioned within a cellular membrane and a portion of the polypeptide is located on the outside of a cell. Typically, the polypeptide spans the cell membrane of a cell.
  • ectodomain of a polypeptide is meant that portion of a polypeptide which is located on the outside of a cell, wherein another portion of the polypeptide spans or is otherwise located within the cell membrane.
  • amino acids in proteins encoded by herpesviruses are numbered from the first methionine in the protein.
  • the complex also includes a substantially full length gL molecule which may comprise all of the amino acids of gL, or may also be mutated to comprise less than all of the amino acids of gL.
  • a stable gHt-gL complex can be formed.
  • the invention should be construed to include all forms of stable substantially pure HHV-8 gHt-gL complexes which comprise any number of gH residues complexed with any number of gL residues.
  • the invention should not be construed to be limited to any particular specific length of either gH or gL. Rather, the invention should be construed to encompass any length of a truncated gH which binds to any length of gL to form a complex which has gHt-gL biological activity as defined herein.
  • the invention should also be construed to include any form of a substantially pure gHt-gL complex having substantial homology to the HHV-8 gHt-gL complex disclosed herein.
  • a gHt-gL complex which is substantially homologous is about 40% homologous, more preferably, about 50%), even more preferably, about 60%>, yet more preferably, about 70% homologous, even more preferably, about 80% homologous and more preferably, about 90%) homologous, and most preferably, about 99% homologous to the specific gHt-gL complex disclosed herein and defined in part by SEQ ID NOS :2 and 4.
  • HHV-8 gHt-gL complex To generate an HHV-8 gHt-gL complex, following the teaching provided herein, it is well within the skill of those in the art to take a plasmid encoding truncated gH and full length gL from other strains of HHV-8 and introduce it into a population of cells such that the cells produce the complex. It is also well within the
  • HHV-8 DNA obtained from various strains of HHV-8, which DNA encodes gH and gL
  • the invention relates to the discovery that two HHV-8 specific glycoproteins, gH and gL, may be produced as a complex. When administered to an animal, the complex may serve to elicit an immune response in the animal and perhaps protect the animal against infection by HHV-8.
  • the invention should be construed to include a pharmaceutical composition, which may be useful as a subunit vaccine comprising a recombinant or synthetic HHV-8 gH-gL complex, which vaccine is useful not only as a prophylactic therapeutic agent for protection of an animal against a HHV-8 infection, but is also useful as a therapeutic agent for treatment of an ongoing HHV-8 infection in an animal, particularly a human.
  • the invention should also be construed to include gHt-gL complexes which are generated in baculovirus infected cells as described herein, or which are generated by other means, such as by expression in mammalian cells also as described herein, or by expression in a yeast expression system. gHt-gL complexes which are generated by synthetic methods are also included in the invention.
  • the invention should be construed to include a recombinant cell comprising an isolated nucleic acid encoding HHV-8 gH and a recombinant cell comprising an isolated nucleic acid encoding HHV-8 gL.
  • Cells which express and therefore comprise HHV-8 gH and/or HHV-8 gL are also contemplated in the invention.
  • the invention includes a recombinant cell comprising one or more isolated nucleic acids encoding a soluble gHt-gL complex, and a cell comprising the complex expressed thereby.
  • the cell may be a prokaryotic cell, which may be used for the generation of DNA encoding the desired polypeptides, or the cell may be eukaryotic cell, such as, for example, a yeast cell, an insect cell or a mammalian cell.
  • a recombinant mammal cell comprising polynucleotides which encode a soluble HHV-8 gHt-gL complex.
  • the cell is a murine cell and more preferably, the cell is KS gH/L-9.
  • a pharmaceutical composition which may be useful as a subunit vaccine comprising an isolated nucleic acid, preferably, an isolated DNA, encoding a gHt-gL complex.
  • an isolated nucleic acid preferably, an isolated DNA, encoding a gHt-gL complex.
  • a nucleic acid preferably, a DNA molecule
  • To generate a DNA encoding gHt-gL the desired gHt and gL coding sequences are ligated together in either of two configurations.
  • a plasmid is generated having the following elements: a promoter/regulatory sequence for expression of gHt which is positioned upstream of a desired gHt encoding sequence and a promoter/regulatory sequence for expression of gL which is positioned upstream of a desired gL coding sequence.
  • the plasmid therefore encodes gHt and gL on the same molecule wherein expression of each of gHt and gL is under the control of an individual promoter/regulatory sequence, preferably the same promoter/regulatory sequence. Both gHt and gL are expressed individually from this plasmid in a cell and form complex therein which is secreted from the cells as described herein.
  • a plasmid may be generated which has the following elements: a single promoter/regulatory sequence which is positioned upstream of a desired gHt encoding and a desired gL encoding sequence, the gHt and gL encoding sequences being separated by a DNA sequence encoding a cleavage site for a protease.
  • the gHt and gL encoding sequences may be positioned in the plasmid in either orientation which respect to each other, such that either one of them is adjacent or juxtaposed to the promoter/regulatory sequence.
  • DNA encoding the protease cleavage site which is positioned between the gHt and gL coding sequences may be any DNA known to encode a length of amino acids which are cleaved by any
  • gHt-gL which is expressed by this plasmid is initially expressed in a cell as a single length of protein comprising gHt and gL fused together via a protease cleavage site. Subsequent cleavage of the fused protein by a protease generates individual molecules of gHt and gL which form a complex which is secreted from the cell as described herein.
  • the isolated DNA encoding the gHt-gL complex of the invention is not limited to a plasmid based DNA, but rather may include any form of DNA which encodes gHt-gL as described herein in the case of a plasmid DNA.
  • the isolated DNA of the invention may include a viral vector, a non-viral vector, or a plasmid DNA.
  • the promoter/regulatory sequence which is used to drive expression of gHt-gL in either type of configuration may be any constitutive promoter which drives expression of these proteins in cells.
  • Such promoters therefore include, but are not limited to, the cytomegalovirus immediate early promoter/regulatory sequence, the SV40 early promoter/enhancer sequence, the Rous sarcoma virus promoter/enhancer and any other suitable promoter which is available in the art for constitutive expression of high levels of proteins in cells.
  • Tissue specific and inducible promoter/regulatory sequences are also contemplated as part of the invention.
  • gHt-gL When the isolated DNA of the invention is used to generate large quantities of gHt-gL complex, cells are transfected with the DNA using ordinary transfection methodology or any other available transfection methodology, gHt-gL is expressed and is recovered from the cells as described herein.
  • a DNA based vaccine is prepared following the disclosure described in Wang et al. (1993, Proc. Natl. Acad. Sci. USA 90:4156-4160).
  • the vaccine comprises DNA encoding a gHt and a substantially full length gL expressed under the control of any of the promoters disclosed herein.
  • Antibodies are raised against the expressed protein by intramuscular injection of DNA into the hind limb of six to eight week old mice.
  • the anesthetic bupivacaine 50 ⁇ l of a 0.5% solution is used to improve immunogenicity of the
  • the animals are immunized first with bupivacaine and then are immunized the following day with 50 ⁇ g of plasmid DNA encoding gHt-gL. At about four weeks, animals are test bled to measure the level of anti-gHt-gL antibody and are re-injected with bupivacaine and DNA on successive days. On day 45, or thereabouts, serum is collected from the animals and is tested to determine whether antibodies contained therein neutralize virus in a virus neutralization assay.
  • DNA based vaccine to human subjects, the amounts of DNA, the route of injection and the adjuvants to be used may vary from that just described. However, these variations will be readily apparent to the skilled artisan working in the field of DNA based vaccines.
  • the invention should therefore be construed to include any form of a gHt-gL complex or DNA encoding a gHt-gL complex, which is homologous to the HHV-8 gHt-gL complex or it's DNA disclosed herein and which has or encodes gHt- gL complex having the biological activity as defined herein.
  • a gHt-gL complex for use as a vaccine or other therapeutic, the examples given in the experimental details section may be followed.
  • a substantially pure preparation of a gHt-gL complex is obtained by immunoaffinity chromatography of supernatants obtained from cells which express and secrete gHt-gL complex using antibodies generated as described herein, or any other antibody which specifically binds gH, gL or the combination of the two.
  • the supernatant is passed over an affinity column comprising anti-gHt-gL complex antibody, the column is washed with buffer and adsorbed proteins are eluted from the column in fractions using an elution buffer, such as 50 mM glycine buffer (pH 2.5) containing 0.5 M NaCl and 0.1%) Triton X-100.
  • Fractions so eluted are neutralized with a high pH buffer, for example, Tris-HCl, pH 9.0 and are then analyzed for the presence of gHt and gL by gel electrophoresis or other protein detection technology. Fractions containing the proteins are pooled and are concentrated using a commercially available concentrator, for example, a Centricon-10 concentrator.
  • a high pH buffer for example, Tris-HCl, pH 9.0
  • Fractions containing the proteins are pooled and are concentrated using a commercially available concentrator, for example, a Centricon-10 concentrator.
  • the invention should be construed to include modifications of gHt or gL which in their modified form are capable of forming a complex having the biological activity of the gHt-gL complex disclosed herein.
  • conservative amino acid substitutions may be made in either or both of gHt or gL which alter the primary sequence of the proteins without significantly affecting the ability of these proteins to bind together and retain the biological activity of the gHt-gL complex.
  • Conservative amino acid substitutions typically include substitutions within the following groups, but are not limited to these groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine. Also included are proteins and peptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation, to optimize solubility properties, or to alter post- translational modification of the protein or peptide. The proteins and peptides of the invention are not limited to products of any of the specific exemplary processes listed herein.
  • biological activity of gHt-gL is meant a gHt-gL complex which when inoculated into an animal elicits an antibody which when the antibody is a virus neutralizing antibody, the infectivity of a HHV-8 in a virus neutralization assay is diminished.
  • the antibody need not necessarily be a virus neutralizing antibody.
  • Antibodies raised in an animal against the gH-gL complex may be useful according to the methods of the invention for diagnosis of HHV-8 infection in a human without necessarily neutralizing HHV-8 in a virus neutralizing assay.
  • a virus neutralization assay involves incubation with a known titer of infectious virus of serial dilutions of serum obtained from an animal administered the gH-gL complex for a period of time. Following the incubation period, the amount of infectious virus remaining is quantitated, usually by plaque assay.
  • virus neutralizing effective amount means an amount of antigen which elicits an immune response when administered to an animal
  • a virus neutralizing immune response is also one which affords protection to the animal from lethal challenge with wild type virus. Protection against lethal challenge with wild type virus is typically assessed by first immunizing a series of animals with the subject antigen to generate serum capable of neutralizing virus infectivity in a standard virus neutralization assay. The animals are then inoculated with a serial dilutions of wild type virus, which dilutions contain sufficient virus to kill non-immunized animals. The death rate of the animals is quantitated and is compared to the level of the virus neutralizing immune response in each of the animals.
  • virus neutralizing antibody is meant a reduction in the infectivity of a virus in the presence of the antibody compared with the infectivity of the virus in the absence of the antibody.
  • an antibody is a virus neutralizing antibody when the infectivity of the virus is reduced by about 50%> in the presence of the antibody at a dilution of the serum containing the antibody which is greater than 1 :20. The higher the dilution of serum which neutralizes a constant amount of virus by 50%, the greater the estimate of the activity of the antibody contained within the serum.
  • the term "protect an animal against disease” is used herein to mean a reduction in the level of disease caused by a wild type virus in an animal inoculated with a gHt-gL complex compared with the level of disease caused by a wild type virus in an animal which as not been inoculated with a gHt-gL complex.
  • the subunit vaccine of the invention may be formulated to be suspended in a pharmaceutically acceptable composition suitable for use in animals and in particular, in humans. Such formulations include the use of adjuvants such as muramyl dipeptide derivatives (MDP) or analogs which are described in U.S. Patent Nos. 4,082,735; 4,082,736; 4,101,536; 4,185,089; 4,235,771; and, 4,406,890.
  • MDP muramyl dipeptide derivatives
  • - 18 - adjuvants which are useful include alum (Pierce Chemical Co.), lipid A, trehalose dimycolate and dimethyldioctadecylammonium bromide (DDA), Freund's adjuvant, and IL-12.
  • Other components may include a polyoxypropylene-polyoxyethylene block polymer (Pluronic®), a non-ionic surfactant, and a metabolizable oil such as squalene (U.S. Patent No. 4,606,918).
  • the subunit vaccine of the invention may be encapsulated into liposomes for administration to the animal. See for example, U.S. Patent Nos. 4,053,585, 4,261,975 and 4,406,890.
  • the subunit vaccine of the invention is administered to a human by any suitable route of administration, for example, subcutaneously, intramuscularly, orally, intravenously, intradermally, intranasally or intravaginally.
  • the complex is first suspended in a pharmaceutically acceptable carrier which is suitable for the chosen route of administration and which will be readily apparent to those skilled in the art of vaccine preparation and administration.
  • the dose of vaccine to be used may vary dependent upon any number of factors including the age of the individual and the route of administration.
  • the subunit vaccine is administered in a range of 1 ⁇ g to 50 mg of protein per dose. Approximately 1-10 doses are administered to the individual at intervals ranging from once per day to once per week to once every few years.
  • the vaccine of the invention is useful for prevention of HHV-8 disease in a human.
  • the vaccine is also useful as a therapeutic agent for treatment of HHV-8 infection in order to boost the immune response in the animal.
  • the invention contemplates both prophylactic and therapeutic uses for the vaccine of the invention.
  • the HHV-8 gHt-gL complex of the invention or individually, gH or gL, or DNA encoding the same, may be used directly as diagnostic reagents for detection of HHV-8 infection in a human.
  • a biological sample preferably, but not exclusively, a serum sample, is obtained from the human. The sample is contacted with the protein, wherein
  • binding of the protein to an antibody in the sample is an indication that the human has an HHV-8 infection. Binding of the protein to an antibody may be detected using any ordinary protein detection techniques, such as immunodetection, biochemical detection, and the like. Such techniques, and examples of detectable labels when used in the method, are described, for example in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), in Ausubel et al. (1994, Current Protocols in Molecular Biology, John Wiley & Sons, New York), and in Harlow et al. (1988, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York). When DNA is used, which DNA has sequences corresponding to HHV-
  • the DNA is used as a probe or primer to detect the presence of HHV-8 DNA in a biological sample in a human. Detection of DNA in such a sample is also well known in the art and is described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1994, Current Protocols in Molecular
  • the biological sample which is obtained from the human may be serum, or any tissue suspected of having antibody directed against HHV-8, or other HHV-8 protein or DNA.
  • the diagnostic method of the invention should not be construed to be limited to any particular biological sample obtained from the patient.
  • antibodies raised against the gH-gL complex of the invention are useful as a diagnostic tools for detection of the presence of HHV-8 in a human using any ordinary diagnostic assay.
  • antibodies directed against either of HHV-8 gH or HHV-8 gL are also useful as diagnostic reagents for the detection of HHV-8 infection, and/or detection of KS in a human patient.
  • diagnostic procedures are well known in the art and include the detection of either or both of HHV-8 gH or gL in a sample obtained from a human suspected of having an HHV-8 infection and/or KS. Samples which can be obtained include biological fluids and tissue samples. Diagnostic assays include, but are not limited to, Western blot assays,
  • anti-gH-gL antibodies which are produced in animals may themselves serve as therapeutic compounds for treatment of HHV-8 infection, particularly in severely immunocompromised individuals, such as those infected with human immunodeficiency virus or those receiving transplants.
  • Anti-gH and anti-gL antibodies, which are used separately, or in combination with each other, and antibodies specifically directed against the gH-gL complex are contemplated as being useful in the invention.
  • the invention should therefore be construed to include antibodies, including, but not limited to, anti-gHt-gL antibodies as described herein, and anti-gHt-gL antibodies which may be modified such that they are phage displayed and/or humanized using technology available in the art.
  • the invention should also be construed to include an isolated DNA which encodes a gHt-gL antibody, or a portion or fragment of such antibody.
  • the antibody of the invention is a monoclonal antibody
  • the nucleic acid encoding the antibody may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. in Immunol. 12(3 ,4): 125- 168) and the references cited therein.
  • the antibody of the invention may be "humanized" using the technology described in Wright et al., ⁇ supra) and in the references cited therein.
  • a cDNA library is first obtained from mRNA which is isolated from cells, e.g., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g., the desired antibody.
  • cDNA copies of the mRNA are produced using reverse transcriptase.
  • cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting
  • bacteriophage DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes.
  • bacteriophage DNA library comprising DNA specifying immunoglobulin genes.
  • the procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY).
  • Bacteriophage which encode the desired antibody may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g., the antigen against which the antibody is directed.
  • the bacteriophage which express a specific antibody are incubated in the presence of a cell which expresses the corresponding antigen, the bacteriophage will bind to the cell.
  • Bacteriophage which do not express the antibody will not bind to the cell.
  • panning techniques are well known in the art and are described for example, in Wright et al., (supra).
  • a cDNA library is generated from mRNA obtained from a population of antibody-producing cells.
  • the mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same.
  • Amplified cDNA is cloned into Ml 3 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin.
  • this procedure immortalizes DNA encoding human immunoglobulin rather than cells which express human immunoglobulin.
  • the invention thus includes an isolated DNA encoding a gHt-gL antibody or a portion of the antibody of the invention.
  • DNA is extracted from antibody expressing phage obtained according to the methods of the invention. Such extraction techniques are well known in the art and are described, for example, in Sambrook et al. (supra).
  • the anti-gHt-gL complex antibody of the invention may be conventionally administered to a human, parenterally, by injection, for example, subcutaneously, intravenously, intramuscularly, and the like. Additional formulations which are suitable for other modes of administration include suppositories, intranasal aerosols and, in some cases, oral formulations.
  • the antibody may be administered in any of the described formulations either daily, several times daily, weekly, bi-weekly or monthly or several times a year in a dosage which will be apparent to the skilled artisan and will depend on the type of disease being treated. Preferably, the dosage will range from about 1 nanogram of antibody to several milligrams of antibody to even up to about 100 milligrams of antibody per dose.
  • the subunit vaccine of the invention, the DNA vaccine of the invention and the antibody of the invention may be used to prevent or treat HHV-8 infections in a human in cases where the human is not yet infected, in cases where the human is infected and treatment is initiated in order to prevent more severe infection, such as, for example, in cases where the human is at risk for developing severe HHV-8 infection and immunosuppressed individuals at risk for developing severe HHV-8 infection, such as is the case in patients having acquired immunodeficiency syndrome and in transplant patients and those requiring chemotherapy.
  • Compounds which are useful in any of the methods described herein may be formulated and administered to a mammal for treatment or prevention of an HHV-8 infection as now described.
  • the invention encompasses the preparation and use of pharmaceutical compositions comprising a compound useful for prevention or treatment of an HHV-8 infection as an active ingredient.
  • a pharmaceutical composition may consist of the active ingredient alone, in a form suitable for administration to a subject, or the pharmaceutical composition may comprise the active ingredient and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or some combination of these.
  • the active ingredient may be present in the pharmaceutical
  • the term "pharmaceutically acceptable carrier” means a chemical composition with which the active ingredient may be combined and which, following the combination, can be used to administer the active ingredient to a subject.
  • physiologically acceptable ester or salt means an ester or salt form of the active ingredient which is compatible with any other ingredients of the pharmaceutical composition, which is not deleterious to the subject to which the composition is to be administered.
  • compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology.
  • preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.
  • compositions are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts.
  • compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation.
  • Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs, birds including commercially relevant birds such as chickens, ducks, geese, and
  • compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, ophthalmic, or another route of administration.
  • Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses.
  • a "unit dose" is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
  • compositions of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1% and
  • a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.
  • additional agents include anti-emetics and scavengers such as cyanide and cyanate scavengers.
  • Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.
  • a formulation of a pharmaceutical composition of the invention suitable for oral administration may be prepared, packaged, or sold in the form of a discrete
  • - 25 - solid dose unit including, but not limited to, a tablet, a hard or soft capsule, a cachet, a troche, or a lozenge, each containing a predetermined amount of the active ingredient.
  • Other formulations suitable for oral administration include, but are not limited to, a powdered or granular formulation, an aqueous or oily suspension, an aqueous or oily solution, or an emulsion.
  • an "oily" liquid is one which comprises a carbon- containing liquid molecule and which exhibits a less polar character than water.
  • a tablet comprising the active ingredient may, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients.
  • Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free-flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface active agent, and a dispersing agent.
  • Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture.
  • compositions used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, binding agents, and lubricating agents.
  • Known dispersing agents include, but are not limited to, potato starch and sodium starch glycollate.
  • Known surface active agents include, but are not limited to, sodium lauryl sulphate.
  • Known diluents include, but are not limited to, calcium carbonate, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate.
  • Known granulating and disintegrating agents include, but are not limited to, corn starch and alginic acid.
  • binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and hydroxypropyl methylcellulose.
  • Known lubricating agents include, but are not limited to, magnesium stearate, stearic acid, silica, and talc.
  • Tablets may be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby
  • a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets.
  • tablets may be coated using methods described in U.S. Patents numbers 4,256,108; 4,160,452; and 4,265,874 to form osmotically-controlled release tablets.
  • Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide pharmaceutically elegant and palatable preparation.
  • Hard capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such hard capsules comprise the active ingredient, and may further comprise additional ingredients including, for example, an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.
  • an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.
  • Soft gelatin capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin.
  • Such soft capsules comprise the active ingredient, which may be mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.
  • Liquid formulations of a pharmaceutical composition of the invention which are suitable for oral administration may be prepared, packaged, and sold either in liquid form or in the form of a dry product intended for reconstitution with water or another suitable vehicle prior to use.
  • Liquid suspensions may be prepared using conventional methods to achieve suspension of the active ingredient in an aqueous or oily vehicle.
  • Aqueous vehicles include, for example, water and isotonic saline.
  • Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
  • Liquid suspensions may further comprise one or more additional ingredients including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents.
  • Oily suspensions may further comprise a thickening
  • suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose.
  • Known dispersing or wetting agents include, but are not limited to, naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with a fatty acid, with a long chain aliphatic alcohol, with a partial ester derived from a fatty acid and a hexitol, or with a partial ester derived from a fatty acid and a hexitol anhydride (e.g. polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively).
  • Known emulsifying agents include, but are not limited to, lecithin and acacia.
  • Known preservatives include, but are not limited to, methyl, ethyl, or n-propyl-para- hydroxybenzoates, ascorbic acid, and sorbic acid.
  • Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin.
  • Known thickening agents for oily suspensions include, for example, beeswax, hard paraffin, and cetyl alcohol.
  • Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, the primary difference being that the active ingredient is dissolved, rather than suspended in the solvent.
  • Liquid solutions of the pharmaceutical composition of the invention may comprise each of the components described with regard to liquid suspensions, it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent.
  • Aqueous solvents include, for example, water and isotonic saline.
  • Oily solvents include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
  • Powdered and granular formulations of a pharmaceutical preparation of the invention may be prepared using known methods. Such formulations may be administered directly to a subject, used, for example, to form tablets, to fill capsules, or to prepare an aqueous or oily suspension or solution by addition of an aqueous or oily
  • Each of these formulations may further comprise one or more of dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, may also be included in these formulations.
  • a pharmaceutical composition of the invention may also be prepared, packaged, or sold in the form of oil-in- water emulsion or a water-in-oil emulsion.
  • the oily phase may be a vegetable oil such as olive or arachis oil, a mineral oil such as liquid paraffin, or a combination of these.
  • compositions may further comprise one or more emulsifying agents such as naturally occurring gums such as gum acacia or gum tragacanth, naturally-occurring phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate.
  • emulsions may also contain additional ingredients including, for example, sweetening or flavoring agents.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for rectal administration.
  • a composition may be in the form of, for example, a suppository, a retention enema preparation, and a solution for rectal or colonic irrigation.
  • Suppository formulations may be made by combining the active ingredient with a non-irritating pharmaceutically acceptable excipient which is solid at ordinary room temperature (i.e. about 20 °C) and which is liquid at the rectal temperature of the subject (i.e. about 37 °C in a healthy human).
  • Suitable pharmaceutically acceptable excipients include, but are not limited to, cocoa butter, polyethylene glycols, and various glycerides.
  • Suppository formulations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.
  • Retention enema preparations or solutions for rectal or colonic irrigation may be made by combining the active ingredient with a pharmaceutically acceptable
  • enema preparations may be administered using, and may be packaged within, a delivery device adapted to the rectal anatomy of the subject. Enema preparations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for vaginal administration. Such a composition may be in the form of, for example, a suppository, an impregnated or coated vaginally-insertable material such as a tampon, a douche preparation, or a solution for vaginal irrigation.
  • Methods for impregnating or coating a material with a chemical composition include, but are not limited to methods of depositing or binding a chemical composition onto a surface, methods of inco ⁇ orating a chemical composition into the structure of a material during the synthesis of the material (i.e. such as with a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material, with or without subsequent drying.
  • Douche preparations or solutions for vaginal irrigation may be made by combining the active ingredient with a pharmaceutically acceptable liquid carrier.
  • douche preparations may be administered using, and may be packaged within, a delivery device adapted to the vaginal anatomy of the subject.
  • Douche preparations may further comprise various additional ingredients including, but not limited to, antioxidants, antibiotics, antifungal agents, and preservatives.
  • parenteral administration of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue.
  • Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like.
  • parenteral administration is contemplated to include, but is not limited to, subcutaneous, intraperitoneal, intramuscular, intrastemal injection, and kidney dialytic infusion techniques.
  • Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents.
  • the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
  • a suitable vehicle e.g. sterile pyrogen-free water
  • compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution.
  • This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein.
  • Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1 ,3-butane diol, for example.
  • Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.
  • Other parentally- administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems.
  • - 31 - may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
  • Formulations suitable for topical administration include, but are not limited to, liquid or semi-liquid preparations such as liniments, lotions, oil-in-water or water-in-oil emulsions such as creams, ointments or pastes, and solutions or suspensions.
  • Topically-administrable formulations may, for example, comprise from about 1%) to about 10% (w/w) active ingredient, although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent.
  • Formulations for topical administration may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity.
  • a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers, and preferably from about 1 to about 6 nanometers.
  • Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent/powder-dispensing container such as a device comprising the active ingredient dissolved or suspended in a low- boiling propellant in a sealed container.
  • such powders comprise particles wherein at least 98%> of the particles by weight have a diameter greater than 0.5 nanometers and at least 95%) of the particles by number have a diameter less than 7 nanometers. More preferably, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90%) of the particles by number have a diameter less than 6 nanometers.
  • Dry powder compositions preferably include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.
  • Low boiling propellants generally include liquid propellants having a boiling point of below 65 °F at atmospheric pressure. Generally the propellant may
  • the propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (preferably having a particle size of the same order as particles comprising the active ingredient).
  • compositions of the invention formulated for pulmonary delivery may also provide the active ingredient in the form of droplets of a solution or suspension.
  • Such formulations may be prepared, packaged, or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, comprising the active ingredient, and may conveniently be administered using any nebulization or atomization device.
  • Such formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, or a preservative such as methylhydroxybenzoate.
  • the droplets provided by this route of administration preferably have an average diameter in the range from about 0.1 to about 200 nanometers.
  • formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of a pharmaceutical composition of the invention.
  • Another formulation suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle from about 0.2 to 500 micrometers. Such a formulation is administered in the manner in which snuff is taken i.e. by rapid inhalation through the nasal passage from a container of the powder held close to the nares.
  • Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1 %> (w/w) and as much as 100% (w/w) of the active ingredient, and may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration.
  • a formulation suitable for buccal administration may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance comprising an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein.
  • formulations suitable for buccal administration may comprise a powder or an aerosolized or atomized solution or suspension comprising the active ingredient.
  • Such powdered, aerosolized, or aerosolized formulations, when dispersed preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for ophthalmic administration.
  • Such formulations may, for example, be in the form of eye drops including, for example, a 0.1-1.0%) (w/w) solution or suspension of the active ingredient in an aqueous or oily liquid carrier.
  • Such drops may further comprise buffering agents, salts, or one or more other of the additional ingredients described herein.
  • Other ophthalmalmically- administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form or in a liposomal preparation.
  • additional ingredients include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials.
  • excipients surface active agents
  • dispersing agents inert diluents
  • granulating and disintegrating agents binding agents
  • lubricating agents such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; e
  • dosages of the compound of the invention which may be administered to an animal, preferably a human, range in amount from 1 ⁇ g to about 100 g per killogram of body weight of the animal. While the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration. Preferably, the dosage of the compound will vary from about 1 mg to about 10 g per killogram of body weight of the animal. More preferably, the dosage will vary from about 10 mg to about 1 g per killogram of body weight of the animal.
  • the compound may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even lees frequently, such as once every several months or even once a year or less.
  • the frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc.
  • the invention also includes a kit comprising the composition of the invention and an instructional material which describes adventitially administering the composition to a cell or a tissue of a mammal.
  • this kit comprises a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to the mammal.
  • an element means one element or more than one element.
  • adjacent is used to refer to nucleotide sequences which are directly attached to one another, having no intervening nucleotides.
  • the pentanucleotide 5'-AAAAA-3' is adjacent the trinucleotide 5'-TTT-3' when the two are connected thus: 5'-AAAAATTT-3' or 5'-TTTAAAAA-3', but not when the two are connected thus: 5'-AAAAACTTT-3'.
  • amino acids are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:
  • antibody refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen.
  • Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules.
  • the antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab) 2 , as well as single chain antibodies and humanized antibodies (Harlow et al., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
  • synthetic antibody an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein.
  • the term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
  • a "coding region" of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.
  • mRNA-coding region of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotide residues of the non-coding strand of the gene which are homologous with or complementary to, respectively, an mRNA molecule which is produced by transcription of the gene. It is understood that, owing to mRNA processing which occurs in certain instances in eukaryotic cells, the mRNA- coding region of a gene may comprise a single region or a plurality of regions separated from one another in the gene as it occurs in the genome. Where the mRNA- coding region of a gene comprises separate regions in a genome, “mRNA-coding region” refers both individually and collectively to each of these regions.
  • a "coding region" of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anticodon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon.
  • the coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g. amino acid residues in a protein export signal sequence).
  • “Complementary” as used herein refers to the broad concept of subunit sequence complementarity between two nucleic acids, e.g., two DNA molecules.
  • nucleic acids When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position.
  • two nucleic acids are complementary to each other when a substantial number (at least 50%) of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T and G:C nucleotide pairs).
  • Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
  • a gene encodes a protein if transcription and translation of mRNA corresponding
  • both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings
  • the non-coding strand used as the template for transcription of a gene or cDNA
  • encoding the protein or other product of that gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • a first region of an oligonucleotide "flanks" a second region of the oligonucleotide if the two regions are adjacent one another or if the two regions are separated by no more than about 1000 nucleotide residues, and preferably no more than about 100 nucleotide residues.
  • homologous refers to the subunit sequence similarity between two polymeric molecules, e.g. , between two nucleic acid molecules, e.g. , two
  • DNA molecules or two RNA molecules, or between two polypeptide molecules are homologous at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions, e. g. , if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90%) homology.
  • the DNA sequences 3'ATTGCC 5' and 3'TAAGCC 5' share 50% homology.
  • homology is used synonymously with “identity.”
  • identity The percentage identity of two polynucleotide or two polypeptide molecules may be compared with one another using any one of several available algorithms, the most common of which being the BLAST program.
  • an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the invention for its designated use.
  • the instructional material of the kit of the invention may, for example, be affixed to a container which contains the composition or be shipped together with a container which contains the composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the composition be used cooperatively by the recipient.
  • isolated nucleic acid refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs.
  • nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell.
  • the term therefore includes, for example, a recombinant DNA which is inco ⁇ orated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g, as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
  • A refers to adenosine
  • C refers to cytidine
  • G refers to guanosine
  • T refers to thymidine
  • U refers to uridine.
  • a single-stranded or double-stranded nucleic acid moiety comprises the two polynucleotides arranged within the nucleic acid moiety in such a manner that at least one of the two polynucleotides is able to exert a physiological effect by which it is
  • a promoter operably linked to the coding region of a gene is able to promote transcription of the coding region.
  • a "polynucleotide” means a single strand or parallel and anti-parallel strands of a nucleic acid.
  • a polynucleotide may be either a single-stranded or a double-stranded nucleic acid.
  • nucleic acid typically refers to large polynucleotides.
  • oligonucleotide typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T.”
  • the left-hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5'-direction.
  • the direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction.
  • the DNA strand having the same sequence as an mRNA is referred to as the "coding strand”; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as “upstream sequences”; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences.”
  • a "portion" of a polynucleotide means at least at least about twenty sequential nucleotide residues of the polynucleotide. It is understood that a portion of a polynucleotide may include every nucleotide residue of the polynucleotide.
  • Primer refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA polymerase.
  • a primer is typically single-stranded, but
  • Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications.
  • a primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions.
  • Primers can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
  • Probe refers to a polynucleotide that is capable of specifically hybridizing to a designated sequence of another polynucleotide.
  • a probe specifically hybridizes to a target complementary polynucleotide, but need not reflect the exact complementary sequence of the template. In such a case, specific hybridization of the probe to the target depends on the stringency of the hybridization conditions.
  • Probes can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
  • Recombinant polynucleotide refers to a polynucleotide having sequences that are not naturally joined together. An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell.
  • a recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.
  • a non-coding function e.g., promoter, origin of replication, ribosome-binding site, etc.
  • a host cell that comprises a recombinant polynucleotide is referred to as a "recombinant host cell.”
  • a gene which is expressed in a recombinant host cell wherein the gene comprises a recombinant polynucleotide produces a "recombinant polypeptide.”
  • a “recombinant polypeptide” is one which is produced upon expression of a recombinant polynucleotide.
  • Polypeptide refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants,
  • Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer.
  • the term "protein” typically refers to large polypeptides.
  • the term "peptide” typically refers to short polypeptides. Conventional notation is used herein to portray polypeptide sequences: the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus.
  • promoter/regulatory sequence means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulator sequence.
  • this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
  • the promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
  • substantially full length HHV-8 gL is meant a HHV-8 gL molecule which comprises a sufficient number of amino acids so that the substantially full length gL is capable of binding to gHt, forming a complex therewith, which complex has biological activity as defined herein.
  • a substantially full length gL molecule does not necessarily contain all of the amino acids which comprise HHV-8 gL, (although according to the invention, it may) but rather, the molecule comprises a substantial portion of the molecule sufficient for binding to gHt and forming a biologically active complex therewith.
  • substantially pure as it refers to gH, gL or a gH-gL complex, is meant a composition which has been separated from the components which naturally accompany it in the cell or medium in which it resides.
  • a composition is substantially pure when at least 10%>, more preferably at least 20%, more preferably at least 50%, more preferably at least 60%), more preferably at least 75%>, more preferably at least 90%>, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a
  • - 43 - sample is the compound of interest. Purity can be measured by any appropriate method, e.g., in the case of polypeptides by column chromatography, gel electrophoresis or HPLC analysis.
  • a compound, e.g., a protein, is also substantially purified when it is essentially free of naturally associated components or when it is separated from the native contaminants which accompany it in its natural state.
  • treating an HHV-8 infection means reducing the frequency with which a symptom of the HHV-8 infection is experienced by a patient.
  • truncated as used herein as it refers to gH, is meant a molecule of gH which contains less than the complete number of amino acids found in a wild type protein. Particularly, the term truncated is used to mean a gH molecule which is not membrane anchored, i.e., which comprises a deletion or other mutation which facilitates secretion of gH from the cell. Mutations in the gH molecule which give rise to different lengths of gH may comprise insertion, deletion or point mutations. An insertion mutation is one where additional base pairs are inserted into a DNA molecule. A deletion mutation is one where base pairs have been removed from a
  • a point mutation is one where a single base pair alteration has been made in a DNA molecule.
  • Each of these mutations is designed such that creation of any one of them in a DNA molecule effects an alteration in the nature of any polypeptide expressed by that DNA, which alteration results in a gH molecule capable of binding to gL to form a complex having biological activity as defined herein, and which gH-gL complex is secreted from a cell in which it is expressed.
  • vacuna is meant a composition which when inoculated into a mammal has the effect of stimulating a cellular immune response comprising a T cell response or a B cell response.
  • the T cell response may be a cytotoxic T cell response directed against macromolecules associated with the composition, or an agent associated with the composition.
  • a B cell response results in the production of antibody which binds to
  • the vaccine may serve to elicit an immune response in the mammal which serves to protect the mammal against a disease.
  • vaccine is also meant a composition, a protein complex or a DNA encoding a protein complex which may serve to protect an animal against a he ⁇ esvirus disease.
  • immunizing a human against HHV-8 is meant administering to the human a composition, a protein complex, a DNA encoding a protein complex, an antibody or a DNA encoding an antibody, which elicits an immune response in the human which immune response provides protection to the human against a disease caused by HHV-8.
  • a “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
  • vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
  • the term “vector” includes an autonomously replicating plasmid or a virus.
  • the term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like.
  • examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
  • “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis- acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
  • Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses that inco ⁇ orate the recombinant polynucleotide.
  • Example 1 Generation and Characterization of Baculovirus-Expressed HHV-8 gH/gL
  • the gH and gL open reading frames were each amplified using PCR and were subcloned into a baculovirus transfer vector.
  • gH only the predicted ectodomain was amplified to permit secretion of the protein.
  • a 6-His tag was appended to the C-terminus of gH to facilitate purification of the protein using nickel chromatography.
  • the resulting plasmid constructs were cotransfected with baculovirus DNA into insect cells.
  • Recombinant viruses were plaque purified and the presence of the desired inserts was confirmed by PCR.
  • Synthetic peptides mimicking gH residues 690-704 and gL residues 153-167 were coupled to Keyhole Limpet Hemocyanin (KLH) and were used separately to immunize rabbits.
  • KLH Keyhole Limpet Hemocyanin
  • infected cell lysates were analyzed by Western blotting using the antisera raised against the synthetic peptides. Bands of the expected size for each of the proteins were readily detected.
  • Insect cells were co-infected with the baculovirus recombinants expressing gH and gL.
  • Culture medium and infected cells were harvested separately and were analyzed by Western blotting to detect gH and gL. Both proteins were readily detected in the culture medium (following purification and concentration by nickel chromatography) as well as in infected cells.
  • gL lacked a 6- His tag and yet co-purified with gH from the infected culture medium, gL was associated with gH during the purification procedure. In the absence of antibodies which recognize the native proteins, the fact that a secreted complex was obtained suggests that the recombinant gH and gL were correctly folded and processed.
  • HSV-1 gD class I membrane protein
  • HHV-8 gH ORF GenBank Database Entry Accession # U75698
  • two PCR primers were synthesized in order to amplify and modify the gH ectodomain coding region for cloning and expression in a recombinant baculovirus.
  • the first primer 5'-GCGGGATCCTACAACGGCGACGACAATAA -3' (SEQ ID NO:5), hybridized to the non-coding strand of the gH ORF immediately beyond the region coding for the predicted signal sequence and inco ⁇ orated a BamHl restriction enzyme cleavage site (bold letters).
  • the second primer 5'-GCGGGATCCTACAACGGCGACGACAATAA -3'
  • the resulting construct was also designed to code for 6 histidine residues at the carboxy-terminus of the truncated protein (the codons for these additional residues were added by inco ⁇ oration into the second PCR primer shown above) to allow for its purification using nickel agarose chromatography.
  • the PCR-amplified product was then digested with BamHl and cloned into pVT-Bac which had also been digested with BamHl.
  • the resulting plasmid construct pCW287
  • Baculovirus DNA Baculogold, Pharmingen
  • Sf9 cells growing in monolayer culture.
  • the culture supernatant containing recombinant progeny virus
  • Grace's insect cell medium containing 1% agarose.
  • Recombinant virus plaques were picked, amplified and infected cell cultures were screened for the expression of gH by SDS-PAGE and immunoblot analysis using R156 antiserum.
  • Virus clones expressing gH were plaque-purified three times and protein expression from individual virus clones was verified at each stage by SDS-PAGE and immunoblot analysis.
  • the plaque-purified baculovirus recombinant selected for further study was named
  • bac-HHV-8 gH(704t) The protein produced by bac-HHV-8 gH(704t) is referred to as herein "HHV-8 gH(704t)". These designations indicate that the recombinant form of HHV-8 gH is truncated after amino acid 704 of the predicted gH protein.
  • the first primer 5'-GCCGGATCCTCATGCATACGTCGCCTTACCATGTTG-3' (SEQ ID NO:7), hybridized to the non-coding strand of the gL ORF immediately beyond the region coding for the predicted signal sequence and inco ⁇ orated a BamHl restriction enzyme cleavage site (bold letters).
  • the second primer 5'-GCCGGATCCTCATGCATACGTCGCCTTACCATGTTG-3' (SEQ ID NO:7)
  • the resulting plasmid construct pCW290
  • Baculovirus DNA Baculogold, Pharmingen
  • Sf9 cells growing in monolayer culture.
  • the culture supernatant containing recombinant progeny virus
  • Grace's insect cell medium containing 1% agarose.
  • Recombinant virus plaques were picked, amplified and infected cell cultures were screened for the expression of gL by SDS-PAGE and immunoblot analysis using R159 antiserum.
  • Virus clones expressing gL were plaque-purified three times and protein expression from individual virus clones was verified at each stage by SDS-PAGE and immunoblot analysis.
  • the plaque-purified baculovirus recombinant selected for further study was named
  • bac-HHV-8 gL The protein produced by bac-HHV-8 gL is referred to herein as " HHV-8 gL”.
  • Monospecific rabbit antisera against HHV-8 gH were generated by immunizing two animals with KLH coupled to a 15 amino-acid peptide representing a portion of the HHV-8 gH ectodomain.
  • the sequence of this peptide is as follows: TVVEIRGMYRRRAAS (SEQ ID NO:9).
  • the resulting antisera, labeled R156 and R157, were shown to specifically recognize the peptide used for immunization by dot blot and ELISA.
  • monospecific rabbit antisera directed against HHV-8 gL were generated by immunizing two animals with KLH coupled to a 15 amino-acid peptide representing a portion of the gL protein.
  • HHV-8 gH open reading frame which encodes the signal sequence and the predicted ectodomain of HHV-8 gH were amplified by PCR using the 5' primer:
  • CGCGGATCCTAATGGTGATGGTGGTGATGACTGGCTGCGCGTCTTCTATA (SEQ ID NO:6).
  • the predicted transmembrane and cytoplasmic domains of gH were omitted to facilitate secretion of the truncated gH protein.
  • the downstream PCR primer was designed to add six histidine codons and a termination codon to the truncated gH open reading frame. This modification was made to facilitate purification of gH using nickel chromatography.
  • the PCR product was then subcloned into the mammalian cell expression plasmid, pcDNA3.1/Hygro(+) (Invitrogen, Carlsbad, CA) under the transcriptional control of the human cytomegalovirus immediate early promoter.
  • This plasmid also comprises the hygromycin resistance gene for selection of stably transformed cells.
  • the resulting plasmid construct was named pCW320 ( Figure 5).
  • the entire HHV-8 gL open reading frame was amplified by PCR using the 5' primer CGCGGTACCATGGGGATCTTTGCGCTATTTG (SEQ ID NO:12) and the 3' primer GCCGAATTCATTTTCCCTTTTGACCTGCGTGCGCTCT (SEQ ID NO: 8) and was subcloned into the mammalian cell expression plasmid, pcDNA3.1(+) (Invitrogen, Carlsbad, CA), also under the transcriptional control of the human cytomegalovirus immediate early promoter.
  • This plasmid also comprises the neomycin resistance gene for selection of stably transformed cells using the drug G418.
  • This plasmid construct was named pCW315 ( Figure 6).
  • Plasmids pCW315 and pCW 320 were co-transfected into murine Ltk- cells using the lipid transfection reagent, FuGene 6 (Boehringer Mannheim Biochemicals, Indianapolis, IN) according to the manufacturer's instructions.
  • - 50 - Transfected cells were initially cultured in DMEM, 5%> fetal bovine serum (FBS) in the absence of selecting drugs. After 48 hours, the cells were grown in the continuous presence of both G418 (400 ⁇ g/ml) and hygromycin (200 ⁇ g/ml). After two weeks of drug selection, the remaining viable cells were cloned by limiting dilution. Multiple drug-resistant clones were obtained and each was screened for HHV-8 gHt and gL expression. One cell line, designated "KS gH/L-9" was selected for further study based on the high level of gHt/gL expression as well as the relatively rapid growth of these cells in culture ( Figure 7A and 7B).
  • FBS fetal bovine serum
  • the medium was then replaced with DMEM, 2% FBS without drugs, and the cells were incubated at 37°C for 72 hours.
  • the growth medium was harvested and replaced with fresh medium. Following an additional 72 hour incubation, the growth medium was again harvested and the cells were discarded.
  • the medium from both harvests was pooled, dialyzed against PBS and incubated with 0.2 ml of nickel agarose resin (Qiagen, Chatsworth, CA) at 4°C for 16 hours on a rotary shaker.
  • the nickel-agarose resin was collected and washed with PBS and then with 10 mM imidazole in 20 mM sodium phosphate (pH 7.5), 500 mM NaCl. Bound protein was then eluted from the resin using 500 mM imidazole in 20 mM sodium phosphate (pH 7.5), 500 mM NaCl.
  • Example 3 Development of a murine hybridoma cell line which produces monoclonal antibody directed against an HHV-8 gH peptide As described herein, it has been possible to generate rabbit antisera which specifically binds to synthetic peptides which mimic portions of the predicted HHV-8 gH and gL polypeptides (two of these antisera were used in the experiments described above).
  • a murine hybridoma cell line called "6F12AB1" that produces a monoclonal antibody recognizing a peptide mimicking HHV-8 gH residues 690-704 has been generated. This cell line was constructed using ordinary antibody technology, and it is therefore a simple matter for one skilled in the art to generate other hybridomas which produce anti-HHV-8 gH and anti-HHV-8 gL antibodies.
  • the monoclonal antibody produced by the cell line 6F12AB1 has been successfully used to detect recombinant HHV-8 gH on Western blots.
  • KS gH/L-9 a stably transformed mammalian cell line which expresses both a truncated form of HHV-8 gH and the full-length HHV-8 gL.
  • HHV-8 gH/gL complex produced in KS gH/L-9 cells using either nickel-agarose or the 6F 12 AB1 monoclonal antibody.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention includes a substantially pure preparation of a human herpesvirus type (8) glycoprotein H and a human herpesvirus glycoprotein L polypeptide and an isolated nucleic acid encoding the same. Also inlcuded is a substantially pure preparation of a human herpesvirus type (8) glycoprotein H-glycoprotein L complex and at least one isolated nucleic acid molecule encoding the same. Methods of use of the compositions of the invention are also included.

Description

TITLE OF THE INVENTION
REAGENTS FOR DETECTION AND TREATMENT OF KAPOSI'S SARCOMA
FIELD OF THE INVENTION The field of the invention is diagnosis and treatment of Kaposi's sarcoma.
BACKGROUND OF THE INVENTION Herpesviruses are ubiquitous viruses which are the causative agents of numerous diseases in both humans and animals. These viruses are enveloped double stranded icosahedral DNA containing viruses, which envelope is acquired by budding of the nucleocapsid through the inner nuclear membrane. Members of the heφesvirus family which are important human pathogens include herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella zoster virus (VZV), Epstein Ban* virus (EBV), cytomegalovirus (CMV), and human herpesviruses type 6, type 7 and type 8 (HHV-6, HHV-7 and HHV-8). Human herpes virus 8 (HHV-8) has been implicated in AIDs associated
Kaposi's sarcoma (KS), classic KS and KS in Human Immunodeficiency Virus (HIV)- negative homosexual men. In addition, studies suggest that HHV-8 may be associated with other human neoplasms.
Currently, there are no effective diagnostic, therapeutic or prophylactic reagents for diagnosis, treatment or prevention of KS. The present invention provides such reagents and methods of their use.
- 1 - SUMMARY OF THE INVENTION The invention includes an isolated nucleic acid encoding an HHV-8 glycoprotein H polypeptide.
In one aspect, the nucleic acid shares at least about 40% homology with SEQ ID NO.T.
In a preferred embodiment, the nucleic acid has the sequence of SEQ ID NO:l.
The invention also includes a vector comprising an isolated nucleic acid encoding an HHV-8 glycoprotein H polypeptide. In a preferred embodiment, the vector is the plasmid pCW320.
In addition, the invention includes a recombinant cell comprising an isolated nucleic acid encoding an HHV-8 glycoprotein H polypeptide.
The invention further includes an isolated nucleic acid encoding an HHV-8 glycoprotein L polypeptide. In one aspect, the nucleic acid shares at least about 40% homology with
SEQ ID NO:3.
In a preferred embodiment, the nucleic acid has the sequence of SEQ ID NO:3.
Also included is a vector comprising an isolated nucleic acid encoding an HHV-8 glycoprotein L polypeptide.
In a preferred embodiment, the vector is the plasmid pCW315. Also included is a recombinant cell comprising an isolated nucleic acid encoding an HHV-8 glycoprotein L polypeptide.
The invention additionally includes a substantially pure preparation of an HHV-8 glycoprotein H polypeptide.
Preferably, the substantially pure preparation of the HHV-8 glycoprotein H polypeptide shares at least about 40% homology with SEQ ID NO:2.
More preferably, the substantially pure preparation of the HHV-8 glycoprotein H polypeptide has the sequence of SEQ ID NO:2.
- 2 - The invention further includes a cell comprising a substantially pure preparation of an HHV-8 glycoprotein H polypeptide.
In addition, the invention includes a substantially pure preparation of an HHN-8 glycoprotein L polypeptide. Preferably, the substantially pure preparation of the HHV-8 glycoprotein
L polypeptide shares at least about 40% homology with SEQ ID ΝO:4.
More preferably, the substantially pure preparation of the HHV-8 glycoprotein L polypeptide has the sequence of SEQ ID NO:4.
Also included is a cell comprising a substantially pure preparation of an HHV-8 glycoprotein L polypeptide.
The invention also includes a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex.
In one aspect, the glycoprotein H in the complex is truncated.
Preferably, the truncated glycoprotein H comprises a signal sequence and an ectodomain.
More preferably, the glycoprotein H is truncated after amino acid 704.
In another aspect, the glycoprotein L is substantially full length.
In a preferred embodiment, the amino acid sequence of the glycoprotein H shares at least about 40% homology with SEQ ID NO:2 and the amino acid sequence of the glycoprotein L shares at least about 40% homology with SEQ ID NO:4.
In another preferred embodiment, the amino acid sequence of the glycoprotein H is amino acids 1-704 of SEQ ID NO:2 and the amino acid sequence of the glycoprotein L is SEQ ID NO:4.
Also included is a cell comprising a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex.
Preferably, the cell is selected from the group consisting of a prokaryotic cell and a eukaryotic cell.
More preferably, the eukaryotic cell is selected from the group consisting of a yeast cell, an insect cell and a mammalian cell. Yet more preferably, the cell is a murine cell.
More preferably, the cell is KS gH/L-9.
Further included in the invention is an isolated nucleic acid encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex. In addition, the invention includes a pharmaceutical composition comprising an isolated nucleic acid encoding a soluble HHV-8 glycoprotein H- glycoprotein L complex.
Also included is a pharmaceutical composition comprising a soluble HHV-8 glycoprotein H-glycoprotein L complex. The invention additionally includes a vaccine comprising an isolated nucleic acid encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex.
The invention further includes a vaccine comprising a soluble HHV-8 glycoprotein H-glycoprotein L complex.
Also included is an antibody which specifically binds an HHV-8 glycoprotein H polypeptide.
In one aspect, the antibody is selected from the group consisting of a polyclonal, a monoclonal and a synthetic antibody.
In a preferred embodiment, the antibody is a monoclonal antibody.
In another preferred embodiment, the antibody is 6F12AB1. The invention also includes a hybridoma cell line which produces an antibody which specifically binds an HHV-8 glycoprotein H polypeptide.
In addition, the invention includes an antibody which specifically binds an HHV-8 glycoprotein L polypeptide.
In one aspect, the antibody is selected from the group consisting of a polyclonal, a monoclonal and a synthetic antibody.
In a preferred embodiment, the antibody is a monoclonal antibody.
Also included is a hybridoma cell line which produces an antibody which specifically binds an HHV-8 glycoprotein L polypeptide. Additionally, there is included in the invention a vaccine comprising a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
The invention further includes a vaccine comprising at least one polynucleotide encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
The invention also provides a method of preventing an HHV-8 infection in a human. The method comprises administering to the human a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
There is also provided a method of preventing an HHV-8 infection in a human. This method comprises administering to the human at least one polynucleotide encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier. In addition there is provided a method of treating an HHV-8 infection in a human. The method comprises administering to the human a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
The invention further includes a method of treating an HHV-8 infection in a human. The method comprises administering to the human at least one polynucleotide encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
In addition, the invention includes a method of diagnosing an HHV-8 infection in a human. The method comprises contacting a biological sample obtained from the human with an antibody which specifically binds to a protein selected from the group consisting of HHV-8 glycoprotein H, HHV-8 glycoprotein L, and HHV-8 glycoprotein H-glycoprotein L complex, wherein when the antibody specifically binds to a composition in the biological sample, the human has the HHV-8 infection.
5 - Further, the invention includes a method of diagnosing an HHV-8 infection in a human, the method comprising contacting a biological sample obtained from the human with a protein selected from the group consisting of HHV-8 glycoprotein H, HHV-8 glycoprotein L, and HHV-8 glycoprotein H-glycoprotein L complex, and determining whether the protein specifically binds to an antibody in the biological sample, wherein specific binding of the protein to an antibody in the biological sample is an indication that the human has an HHV-8 infection.
In one aspect, the protein has a detectable label attached thereto and specific binding of the protein to an antibody in the biological sample is assessed by assessing the association of the label with the antibody.
Also included is a method of diagnosing an HHV-8 infection in a human. The method comprises contacting a biological sample obtained from the human with an isolated nucleic acid selected from the group consisting of an HHV-8 glycoprotein H polynucleotide and an HHV-8 glycoprotein L polynucleotide, and determining whether the isolated nucleic acid binds to a nucleic acid in the biological sample, wherein binding of the isolated nucleic acid to nucleic acid in the biological sample, is an indication that the human has an HHV-8 infection.
The invention additionally includes a method of diagnosing an HHV-8 infection in a human. The method comprises contacting a biological sample obtained from the human with a substantially pure preparation of an HHV-8 gH polypeptide, or an HHV-8 gL polypeptide and determining whether the polypeptide binds to an antibody in the biological sample, wherein binding of the polypeptide to an antibody in the biological sample is an indication that the human has an HHV-8 infection.
In addition, the invention includes a method of diagnosing an HHV-8 infection in a human, the method comprising contacting a biological sample obtained from the human with a substantially pure preparation of an HHV-8 gH-gL complex and determining whether the complex binds to an antibody in the biological sample, wherein binding of the complex to an antibody in the biological sample is an indication that the human has an HHV-8 infection.
- 6 - BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1, comprising Figures 1 A and IB, is the nucleotide sequence of HHV-8 gH open reading frame (SEQ ID NO:l).
Figure 2 is the predicted amino acid sequence of HHV-8 gH (SEQ ID NO:2).
Figure 3 is the nucleotide sequence of HHV-8 gL ORF (SEQ ID NO:3).
Figure 4 is the predicted amino acid sequence of HHV-8 gL (SEQ ID NO:4).
Figure 5 depicts construction of plasmid pCW320. Truncated HHV-8 gH ORF was PCR amplifed, adding 6 his-codons and a termination codon using a 3' primer. The 5' PCR primer had the sequence GGATCCTAGAGGAG ACATG CAG GGT CTA GCC TTC TTG (bold = initiation condon), and the reverse complement of the 3' primer had the sequence TAT AGA AGA CGC GCA GCC AGT CAT CAC CAC CAT CAC CAT TAGGATCC. where BamHl sites are underlined. The PCR product was digested with BamHl and cloned into BamHl-digestcd pcDNA3.1/Hygro(+).
Figure 6 depicts construction of plasmid pCW315. HHV-8gL ORF was PCR amplified using a 5' PCR primer having the sequence GGATCCTAGAGGAGACATG CAG GGT CTA GCC TTC TTG and a 3' primer, the reverse complement of which had the sequence TAT AGA AGA CGC GCA GCC AGT CAT CAC CAC CAT CAC CAT TAGGATCC. where BamHl sites are underlined. The PCR product was digested with BamHl and cloned into R /wHI-digested pcDNA3.1/Ηygro(+).
Figure 7A is an image of a series of gels depicting crude nickel-agarose purification of KS gH/gL.
Figure 7B is an image of a series of gels depicting the fact that expression of KS gH/gL is enhanced by the addition of sodium butyrate.
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to the discovery of two HHV-8 glycoproteins, gH and gL, which are useful for the development of diagnostic, therapeutic and prophylactic reagents for diagnosis, treatment, and prevention of KS in humans.
The DNA and predicted amino acid sequence of HHV-8 gH and gL are provided herein in Figures 1, 2, 3 and 4, as SEQ ID NOS: 1, 2, 3 and 4, respectively.
The invention includes an isolated DNA comprising DNA encoding an HHV-8 gH protein. While the preferred DNA encoding HHV-8 gH protein is SEQ ID NO: 1 , the invention should not be construed to be limited to this sequence. Rather, the isolated DNA of the invention encoding HHV-8 gH should be construed to be any
- 7 - DNA encoding HHV-8 gH or any mutant, variant, or homolog thereof, having the biological activity of HHV-8 gH as described herein. Preferably, the DNA encoding HHV-8 gH of the invention shares about 40% homology with SEQ ID NO: 1. More preferably, the DNA shares about 50%, even more preferably, the DNA shares about 60%), yet more preferably, the DNA shares about 70%, more preferably 80%, even more preferably 90%), yet more preferably 95% and even more preferably the DNA shares about 99-100% homology with SEQ ID NO:l.
The invention further includes an isolated DNA comprising DNA encoding an HHV-8 gL protein. While the preferred DNA encoding HHV-8 gL protein is SEQ ID NO:3, the invention should not be construed to be limited to this sequence.
Rather, the isolated DNA of the invention encoding HHV-8 gL should be construed to be any DNA encoding HHV-8 gL or any mutant, variant, or homolog thereof, having the biological activity of HHV-8 gL as described herein. Preferably, the DNA encoding HHV-8 gL of the invention shares about 40% homology with SEQ ID NO:3. More preferably, the DNA shares about 50%, even more preferably, the DNA shares about 60%, yet more preferably, the DNA shares about 70%>, more preferably 80%, even more preferably 90%>, yet more preferably 95% and even more preferably the DNA shares about 99-100% homology with SEQ ID NO:3.
The invention also includes a substantially pure preparation of an isolated polypeptide comprising an HHV-8 gH polypeptide. While the preferred HHV-
8 gH polypeptide has the sequence of SEQ ID NO:2, the invention should not be construed to be limited to this sequence. Rather, the HHV-8 gH polypeptide of the invention should be construed to be any HHV-8 gH polypeptide, or any mutant, variant, or homolog thereof, having the biological activity of HHV-8 gH as described herein. Preferably, the amino acid sequence of the HHV-8 gH of the invention shares about 35% homology with SEQ ID NO:2. More preferably, the DNA shares about 50%), even more preferably, the DNA shares about 60%, yet more preferably, the DNA shares about 70%), more preferably 80%, even more preferably 90%), yet more preferably 95%> and even more preferably the DNA shares about 99-100%) homology with SEQ ID NO:2.
The invention also includes a substantially pure preparation of an isolated polypeptide comprising an HHV-8 gL polypeptide. While the preferred HHV- 8 gL polypeptide has the sequence of SEQ ID NO:4, the invention should not be construed to be limited to this sequence. Rather, the HHV-8 gL polypeptide of the invention should be construed to be any HHV-8 gL polypeptide, or any mutant, variant, or homolog thereof, having the biological activity of HHV-8 gL as described herein. Preferably, the amino acid sequence of the HHV-8 gL of the invention shares about 35% homology with SEQ ID NO:4. More preferably, the DNA shares about 50%, even more preferably, the DNA shares about 60%, yet more preferably, the DNA shares about 70%, more preferably 80%, even more preferably 90%), yet more preferably 95%) and even more preferably the DNA shares about 99-100%) homology with SEQ ID NO:4. The invention further includes an HHV-8 gH/gL complex, which complex is preferably a soluble complex which is secreted from the cell. When the gH/gL complex is a soluble complex, it comprises a truncated gH molecule, designated herein as gHt, which is complexed to a substantially full length gL molecule. The complex is referred to herein as a gHt-gL complex. This complex may be obtained in large quantities using recombinant DNA methodology as described herein, for use as a vaccine for protection of humans against HHV-8 infection, or for eliminating or diminishing the frequency of reactivation of the virus from the latent state thus, reducing the severity of HHV-8 infection in humans. The complex is also useful as a diagnostic reagent for assessing the presence or absence of a HHV-8 infection in a human. Such an assessment is made by obtaining a sample, such as serum, from the individual and reacting it with the complex in a standard immunoassay, such as radioimmunoassay or enzyme linked immunoadsorbent assay (ELISA).
Individually, HHV-8 gH and gL may also be used to diagnose the presence of HHV-8 in a human patient. Either of these two proteins may be used to
- 9 - detect the presence of an anti-gH or anti-gL antibody in a sample, preferably a serum sample obtained from the patient. Thus, irrespective of whatever form HHV-8 gH or gL are used, these proteins may be used in a diagnostic assay as set forth herein. When used in a diagnostic assay, the proteins may have a detectable label attached thereto to facilitate detection of the antibody.
Diagnosis of an HHV-8 infection in a human patient may also be accomplished using nucleic acid which specifically binds to nucleic acid comprising one or both strands of the gH or gL genes in HHV-8. Such nucleic acid diagnostic assays are well know in the art, and may comprise polymerase chain reactions or simple hybridization assays which can be performed on samples comprising a tissue, a cell or nucleic acid obtained from the patient.
As noted above, the gH-gL complex of the invention comprises a truncated gH molecule which is complexed to a substantially full length gL molecule. It has been discovered in the present invention that it may be necessary that the gH portion of the gHt-gL complex be truncated in order that the complex is secreted from the cell in soluble form. Truncated forms of gH include those containing amino acid residues selected from regions of the protein which bind to gL. At a minimum, the truncated form of gH useful in the complex of the invention comprises a signal sequence and an ectodomain. In particular, gH which is truncated after amino acid number 704 is especially useful for formation of the gHt-gL complex of the invention.
Based upon the amino acid sequence provided in SEQ ID NO:2, it is predicted that HHV-8 gH has a cleavable signal sequence which comprises about amino acid residues 1-21 of the protein. It is further predicted that HHV-8 gH is anchored to the cell membrane (or the virus envelope when referring to virions) via a series of hydrophobic amino acid residues near the carboxy-terminus, at about amino acid residues 805-723. It is therefore further predicted that the ectodomain of HHV-8 gH comprises about amino acids 22-704.
It is a simple matter for one skilled in the art to follow the teaching provided herein to ascertain the minimum amount of HHV-8 gH which is required for
- 10 - binding to HHV-8 gL in order to form the soluble gHt-gL complex of the invention having the biological activity defined herein. Essentially, truncated forms of gH are generated using conventional recombinant DNA technology, as described herein and in, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and in Ausubel et al. (1994, Current
Protocols in Molecular Biology, John Wiley & Sons, New York). A plasmid comprising a truncated form of gH is cotransfected into a cell with substantially full length HHV-8 gL. The synthesis and/or secretion, or absence thereof, of a soluble gHt- gL complex from the cell is assessed using any of the assays presented herein. Thus, the invention should be construed to include any and all forms of HHV-8 gH which form a soluble complex with substantially full length gL, which complex has the biological activity defined herein.
By the term "signal sequence" is meant a polynucleotide sequence which encodes a peptide that directs the path a polypeptide takes within a cell, i.e., it directs the cellular processing of a polypeptide in a cell, including, but not limited to, eventual secretion of a polypeptide from a cell. A signal sequence is a sequence of amino acids which are typically, but not exclusively, found at the amino terminus of a polypeptide which targets the synthesis of the polypeptide to the endoplasmic reticulum. In some instances, the signal peptide is proteolytically removed form the polypeptide and is thus absent from the mature protein.
A polypeptide having an "ectodomain" is one wherein a portion of the polypeptide is positioned within a cellular membrane and a portion of the polypeptide is located on the outside of a cell. Typically, the polypeptide spans the cell membrane of a cell. Thus, by the term "ectodomain" of a polypeptide is meant that portion of a polypeptide which is located on the outside of a cell, wherein another portion of the polypeptide spans or is otherwise located within the cell membrane.
As is customary in the field of herpesvirology, amino acids in proteins encoded by herpesviruses are numbered from the first methionine in the protein.
11 - The complex also includes a substantially full length gL molecule which may comprise all of the amino acids of gL, or may also be mutated to comprise less than all of the amino acids of gL.
Referring to gH and gL molecules encoded by HHV-8, it has been discovered in the present invention that a stable gHt-gL complex can be formed. The invention should be construed to include all forms of stable substantially pure HHV-8 gHt-gL complexes which comprise any number of gH residues complexed with any number of gL residues. Thus, the invention should not be construed to be limited to any particular specific length of either gH or gL. Rather, the invention should be construed to encompass any length of a truncated gH which binds to any length of gL to form a complex which has gHt-gL biological activity as defined herein. The procedures which are used to generate plasmids expressing proteins of different lengths are well known in the art and the means for expressing gH and gL in a cell such that they form a biologically active complex are described in detail herein. Thus, it is well within the skill of those in the art to generate biologically active gHt-gL complexes, wherein the gHt-and gL each comprise an animo acid length which is different from the gHt and gL molecules disclosed in the experimental examples section herein.
The invention should also be construed to include any form of a substantially pure gHt-gL complex having substantial homology to the HHV-8 gHt-gL complex disclosed herein. Preferably, a gHt-gL complex which is substantially homologous is about 40% homologous, more preferably, about 50%), even more preferably, about 60%>, yet more preferably, about 70% homologous, even more preferably, about 80% homologous and more preferably, about 90%) homologous, and most preferably, about 99% homologous to the specific gHt-gL complex disclosed herein and defined in part by SEQ ID NOS :2 and 4.
To generate an HHV-8 gHt-gL complex, following the teaching provided herein, it is well within the skill of those in the art to take a plasmid encoding truncated gH and full length gL from other strains of HHV-8 and introduce it into a population of cells such that the cells produce the complex. It is also well within the
- 12 - skill of those in the art to take yet another plasmid encoding gH and gL (i.e., DNA obtained from various strains of HHV-8, which DNA encodes gH and gL) and generate cells which secrete soluble gHt-gL complex following the teaching contained herein and as set forth below. The invention relates to the discovery that two HHV-8 specific glycoproteins, gH and gL, may be produced as a complex. When administered to an animal, the complex may serve to elicit an immune response in the animal and perhaps protect the animal against infection by HHV-8. Thus, the invention should be construed to include a pharmaceutical composition, which may be useful as a subunit vaccine comprising a recombinant or synthetic HHV-8 gH-gL complex, which vaccine is useful not only as a prophylactic therapeutic agent for protection of an animal against a HHV-8 infection, but is also useful as a therapeutic agent for treatment of an ongoing HHV-8 infection in an animal, particularly a human.
The invention should also be construed to include gHt-gL complexes which are generated in baculovirus infected cells as described herein, or which are generated by other means, such as by expression in mammalian cells also as described herein, or by expression in a yeast expression system. gHt-gL complexes which are generated by synthetic methods are also included in the invention.
Thus, the invention should be construed to include a recombinant cell comprising an isolated nucleic acid encoding HHV-8 gH and a recombinant cell comprising an isolated nucleic acid encoding HHV-8 gL. Cells which express and therefore comprise HHV-8 gH and/or HHV-8 gL are also contemplated in the invention. In addition, the invention includes a recombinant cell comprising one or more isolated nucleic acids encoding a soluble gHt-gL complex, and a cell comprising the complex expressed thereby. The cell may be a prokaryotic cell, which may be used for the generation of DNA encoding the desired polypeptides, or the cell may be eukaryotic cell, such as, for example, a yeast cell, an insect cell or a mammalian cell.
13 In a preferred embodiment, there is provided a recombinant mammal cell comprising polynucleotides which encode a soluble HHV-8 gHt-gL complex. Preferably, the cell is a murine cell and more preferably, the cell is KS gH/L-9.
Also contemplated by the invention is a pharmaceutical composition which may be useful as a subunit vaccine comprising an isolated nucleic acid, preferably, an isolated DNA, encoding a gHt-gL complex. Such a nucleic acid, preferably, a DNA molecule, may be used directly as a vaccine as described herein, or it may be used to transfect cells in order to produce large quantities of gHt-gL for use as a subunit vaccine. To generate a DNA encoding gHt-gL, the desired gHt and gL coding sequences are ligated together in either of two configurations. In the first configuration, a plasmid is generated having the following elements: a promoter/regulatory sequence for expression of gHt which is positioned upstream of a desired gHt encoding sequence and a promoter/regulatory sequence for expression of gL which is positioned upstream of a desired gL coding sequence. The plasmid therefore encodes gHt and gL on the same molecule wherein expression of each of gHt and gL is under the control of an individual promoter/regulatory sequence, preferably the same promoter/regulatory sequence. Both gHt and gL are expressed individually from this plasmid in a cell and form complex therein which is secreted from the cells as described herein.
Alternatively, a plasmid may be generated which has the following elements: a single promoter/regulatory sequence which is positioned upstream of a desired gHt encoding and a desired gL encoding sequence, the gHt and gL encoding sequences being separated by a DNA sequence encoding a cleavage site for a protease. In this plasmid, the gHt and gL encoding sequences may be positioned in the plasmid in either orientation which respect to each other, such that either one of them is adjacent or juxtaposed to the promoter/regulatory sequence. DNA encoding the protease cleavage site which is positioned between the gHt and gL coding sequences may be any DNA known to encode a length of amino acids which are cleaved by any
- 14 - protease which is present in a majority of cells and which is particularly present in cells into which the DNA of the invention is introduced. gHt-gL which is expressed by this plasmid is initially expressed in a cell as a single length of protein comprising gHt and gL fused together via a protease cleavage site. Subsequent cleavage of the fused protein by a protease generates individual molecules of gHt and gL which form a complex which is secreted from the cell as described herein.
The isolated DNA encoding the gHt-gL complex of the invention is not limited to a plasmid based DNA, but rather may include any form of DNA which encodes gHt-gL as described herein in the case of a plasmid DNA. Thus, the isolated DNA of the invention may include a viral vector, a non-viral vector, or a plasmid DNA.
The promoter/regulatory sequence which is used to drive expression of gHt-gL in either type of configuration may be any constitutive promoter which drives expression of these proteins in cells. Such promoters therefore include, but are not limited to, the cytomegalovirus immediate early promoter/regulatory sequence, the SV40 early promoter/enhancer sequence, the Rous sarcoma virus promoter/enhancer and any other suitable promoter which is available in the art for constitutive expression of high levels of proteins in cells. Tissue specific and inducible promoter/regulatory sequences are also contemplated as part of the invention.
When the isolated DNA of the invention is used to generate large quantities of gHt-gL complex, cells are transfected with the DNA using ordinary transfection methodology or any other available transfection methodology, gHt-gL is expressed and is recovered from the cells as described herein.
When the isolated DNA is to be used as a vaccine, a DNA based vaccine is prepared following the disclosure described in Wang et al. (1993, Proc. Natl. Acad. Sci. USA 90:4156-4160). The vaccine comprises DNA encoding a gHt and a substantially full length gL expressed under the control of any of the promoters disclosed herein. Antibodies are raised against the expressed protein by intramuscular injection of DNA into the hind limb of six to eight week old mice. The anesthetic bupivacaine (50 μl of a 0.5% solution) is used to improve immunogenicity of the
- 15 - vaccine. The animals are immunized first with bupivacaine and then are immunized the following day with 50 μg of plasmid DNA encoding gHt-gL. At about four weeks, animals are test bled to measure the level of anti-gHt-gL antibody and are re-injected with bupivacaine and DNA on successive days. On day 45, or thereabouts, serum is collected from the animals and is tested to determine whether antibodies contained therein neutralize virus in a virus neutralization assay.
To adapt this DNA based vaccine to human subjects, the amounts of DNA, the route of injection and the adjuvants to be used may vary from that just described. However, these variations will be readily apparent to the skilled artisan working in the field of DNA based vaccines.
The invention should therefore be construed to include any form of a gHt-gL complex or DNA encoding a gHt-gL complex, which is homologous to the HHV-8 gHt-gL complex or it's DNA disclosed herein and which has or encodes gHt- gL complex having the biological activity as defined herein. To purify a gHt-gL complex for use as a vaccine or other therapeutic, the examples given in the experimental details section may be followed. Essentially, a substantially pure preparation of a gHt-gL complex is obtained by immunoaffinity chromatography of supernatants obtained from cells which express and secrete gHt-gL complex using antibodies generated as described herein, or any other antibody which specifically binds gH, gL or the combination of the two. To purify the gH-gL complex, the supernatant is passed over an affinity column comprising anti-gHt-gL complex antibody, the column is washed with buffer and adsorbed proteins are eluted from the column in fractions using an elution buffer, such as 50 mM glycine buffer (pH 2.5) containing 0.5 M NaCl and 0.1%) Triton X-100. Fractions so eluted are neutralized with a high pH buffer, for example, Tris-HCl, pH 9.0 and are then analyzed for the presence of gHt and gL by gel electrophoresis or other protein detection technology. Fractions containing the proteins are pooled and are concentrated using a commercially available concentrator, for example, a Centricon-10 concentrator.
16 The invention should be construed to include modifications of gHt or gL which in their modified form are capable of forming a complex having the biological activity of the gHt-gL complex disclosed herein. For example, conservative amino acid substitutions may be made in either or both of gHt or gL which alter the primary sequence of the proteins without significantly affecting the ability of these proteins to bind together and retain the biological activity of the gHt-gL complex. Conservative amino acid substitutions typically include substitutions within the following groups, but are not limited to these groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine. Also included are proteins and peptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation, to optimize solubility properties, or to alter post- translational modification of the protein or peptide. The proteins and peptides of the invention are not limited to products of any of the specific exemplary processes listed herein.
By "biological activity" of gHt-gL as used herein, is meant a gHt-gL complex which when inoculated into an animal elicits an antibody which when the antibody is a virus neutralizing antibody, the infectivity of a HHV-8 in a virus neutralization assay is diminished. The antibody need not necessarily be a virus neutralizing antibody.
Antibodies raised in an animal against the gH-gL complex may be useful according to the methods of the invention for diagnosis of HHV-8 infection in a human without necessarily neutralizing HHV-8 in a virus neutralizing assay.
Typically, a virus neutralization assay involves incubation with a known titer of infectious virus of serial dilutions of serum obtained from an animal administered the gH-gL complex for a period of time. Following the incubation period, the amount of infectious virus remaining is quantitated, usually by plaque assay.
The term "virus neutralizing effective amount" as used herein, means an amount of antigen which elicits an immune response when administered to an animal,
- 17 - which response is capable of neutralizing virus infectivity to a level which is less than 50%) of normal infectivity in a standard virus neutralization assay.
A virus neutralizing immune response is also one which affords protection to the animal from lethal challenge with wild type virus. Protection against lethal challenge with wild type virus is typically assessed by first immunizing a series of animals with the subject antigen to generate serum capable of neutralizing virus infectivity in a standard virus neutralization assay. The animals are then inoculated with a serial dilutions of wild type virus, which dilutions contain sufficient virus to kill non-immunized animals. The death rate of the animals is quantitated and is compared to the level of the virus neutralizing immune response in each of the animals.
Protection from lethal challenge has been effected when non-immunized animals die and immunized animals do not die as a result of infection with virus.
By the term "virus neutralizing antibody" as used herein, is meant a reduction in the infectivity of a virus in the presence of the antibody compared with the infectivity of the virus in the absence of the antibody. Typically, an antibody is a virus neutralizing antibody when the infectivity of the virus is reduced by about 50%> in the presence of the antibody at a dilution of the serum containing the antibody which is greater than 1 :20. The higher the dilution of serum which neutralizes a constant amount of virus by 50%, the greater the estimate of the activity of the antibody contained within the serum.
The term "protect an animal against disease" is used herein to mean a reduction in the level of disease caused by a wild type virus in an animal inoculated with a gHt-gL complex compared with the level of disease caused by a wild type virus in an animal which as not been inoculated with a gHt-gL complex. The subunit vaccine of the invention may be formulated to be suspended in a pharmaceutically acceptable composition suitable for use in animals and in particular, in humans. Such formulations include the use of adjuvants such as muramyl dipeptide derivatives (MDP) or analogs which are described in U.S. Patent Nos. 4,082,735; 4,082,736; 4,101,536; 4,185,089; 4,235,771; and, 4,406,890. Other
- 18 - adjuvants which are useful include alum (Pierce Chemical Co.), lipid A, trehalose dimycolate and dimethyldioctadecylammonium bromide (DDA), Freund's adjuvant, and IL-12. Other components may include a polyoxypropylene-polyoxyethylene block polymer (Pluronic®), a non-ionic surfactant, and a metabolizable oil such as squalene (U.S. Patent No. 4,606,918).
The subunit vaccine of the invention may be encapsulated into liposomes for administration to the animal. See for example, U.S. Patent Nos. 4,053,585, 4,261,975 and 4,406,890.
The subunit vaccine of the invention is administered to a human by any suitable route of administration, for example, subcutaneously, intramuscularly, orally, intravenously, intradermally, intranasally or intravaginally. The complex is first suspended in a pharmaceutically acceptable carrier which is suitable for the chosen route of administration and which will be readily apparent to those skilled in the art of vaccine preparation and administration. The dose of vaccine to be used may vary dependent upon any number of factors including the age of the individual and the route of administration. Typically, the subunit vaccine is administered in a range of 1 μg to 50 mg of protein per dose. Approximately 1-10 doses are administered to the individual at intervals ranging from once per day to once per week to once every few years. The vaccine of the invention is useful for prevention of HHV-8 disease in a human. However, the vaccine is also useful as a therapeutic agent for treatment of HHV-8 infection in order to boost the immune response in the animal. Thus the invention contemplates both prophylactic and therapeutic uses for the vaccine of the invention. The HHV-8 gHt-gL complex of the invention, or individually, gH or gL, or DNA encoding the same, may be used directly as diagnostic reagents for detection of HHV-8 infection in a human. Essentially, when gH, gL or gH/gL protein is used as a diagnostic reagent, a biological sample, preferably, but not exclusively, a serum sample, is obtained from the human. The sample is contacted with the protein, wherein
- 19 - the protein optionally has a detectable label attached thereto. Binding of the protein to an antibody in the sample is an indication that the human has an HHV-8 infection. Binding of the protein to an antibody may be detected using any ordinary protein detection techniques, such as immunodetection, biochemical detection, and the like. Such techniques, and examples of detectable labels when used in the method, are described, for example in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), in Ausubel et al. (1994, Current Protocols in Molecular Biology, John Wiley & Sons, New York), and in Harlow et al. (1988, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York). When DNA is used, which DNA has sequences corresponding to HHV-
8 gH, gL or a gH-gL complex, the DNA is used as a probe or primer to detect the presence of HHV-8 DNA in a biological sample in a human. Detection of DNA in such a sample is also well known in the art and is described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1994, Current Protocols in Molecular
Biology, John Wiley & Sons, New York).
The biological sample which is obtained from the human may be serum, or any tissue suspected of having antibody directed against HHV-8, or other HHV-8 protein or DNA. Thus, the diagnostic method of the invention should not be construed to be limited to any particular biological sample obtained from the patient.
Further, antibodies raised against the gH-gL complex of the invention are useful as a diagnostic tools for detection of the presence of HHV-8 in a human using any ordinary diagnostic assay. In addition, antibodies directed against either of HHV-8 gH or HHV-8 gL are also useful as diagnostic reagents for the detection of HHV-8 infection, and/or detection of KS in a human patient. Such diagnostic procedures are well known in the art and include the detection of either or both of HHV-8 gH or gL in a sample obtained from a human suspected of having an HHV-8 infection and/or KS. Samples which can be obtained include biological fluids and tissue samples. Diagnostic assays include, but are not limited to, Western blot assays,
- 20 - ELISA, radioimmune assays and the like, each of which is readily available in the art of diagnosing virus infections.
The anti-gH-gL antibodies which are produced in animals may themselves serve as therapeutic compounds for treatment of HHV-8 infection, particularly in severely immunocompromised individuals, such as those infected with human immunodeficiency virus or those receiving transplants. Anti-gH and anti-gL antibodies, which are used separately, or in combination with each other, and antibodies specifically directed against the gH-gL complex are contemplated as being useful in the invention. The invention should therefore be construed to include antibodies, including, but not limited to, anti-gHt-gL antibodies as described herein, and anti-gHt-gL antibodies which may be modified such that they are phage displayed and/or humanized using technology available in the art.
The generation of polyclonal and monoclonal antibodies is well known in the art and is described and referenced herein. Phage displayed and humanized antibodies are also well known in the art and are also described herein.
Given the advances in technology in cloning DNA encoding proteins comprising antibodies, the invention should also be construed to include an isolated DNA which encodes a gHt-gL antibody, or a portion or fragment of such antibody. When the antibody of the invention is a monoclonal antibody, the nucleic acid encoding the antibody may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. in Immunol. 12(3 ,4): 125- 168) and the references cited therein. Further, the antibody of the invention may be "humanized" using the technology described in Wright et al., {supra) and in the references cited therein. For example, to generate a phage antibody library, a cDNA library is first obtained from mRNA which is isolated from cells, e.g., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g., the desired antibody. cDNA copies of the mRNA are produced using reverse transcriptase. cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting
- 21 - DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes. The procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY).
Bacteriophage which encode the desired antibody, may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g., the antigen against which the antibody is directed. Thus, when bacteriophage which express a specific antibody are incubated in the presence of a cell which expresses the corresponding antigen, the bacteriophage will bind to the cell. Bacteriophage which do not express the antibody will not bind to the cell. Such panning techniques are well known in the art and are described for example, in Wright et al., (supra).
Processes such as those described above, have been developed for the production of human antibodies using Ml 3 bacteriophage display (Burton et al, 1994,
Adv. Immunol. 57:191-280). Essentially, a cDNA library is generated from mRNA obtained from a population of antibody-producing cells. The mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same. Amplified cDNA is cloned into Ml 3 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin. Thus, in contrast to conventional monoclonal antibody synthesis, this procedure immortalizes DNA encoding human immunoglobulin rather than cells which express human immunoglobulin. The invention thus includes an isolated DNA encoding a gHt-gL antibody or a portion of the antibody of the invention. To isolate DNA encoding an antibody, for example, DNA is extracted from antibody expressing phage obtained according to the methods of the invention. Such extraction techniques are well known in the art and are described, for example, in Sambrook et al. (supra).
- 22 - The anti-gHt-gL complex antibody of the invention may be conventionally administered to a human, parenterally, by injection, for example, subcutaneously, intravenously, intramuscularly, and the like. Additional formulations which are suitable for other modes of administration include suppositories, intranasal aerosols and, in some cases, oral formulations. The antibody may be administered in any of the described formulations either daily, several times daily, weekly, bi-weekly or monthly or several times a year in a dosage which will be apparent to the skilled artisan and will depend on the type of disease being treated. Preferably, the dosage will range from about 1 nanogram of antibody to several milligrams of antibody to even up to about 100 milligrams of antibody per dose.
It will be appreciated that the subunit vaccine of the invention, the DNA vaccine of the invention and the antibody of the invention may be used to prevent or treat HHV-8 infections in a human in cases where the human is not yet infected, in cases where the human is infected and treatment is initiated in order to prevent more severe infection, such as, for example, in cases where the human is at risk for developing severe HHV-8 infection and immunosuppressed individuals at risk for developing severe HHV-8 infection, such as is the case in patients having acquired immunodeficiency syndrome and in transplant patients and those requiring chemotherapy. Compounds which are useful in any of the methods described herein may be formulated and administered to a mammal for treatment or prevention of an HHV-8 infection as now described.
The invention encompasses the preparation and use of pharmaceutical compositions comprising a compound useful for prevention or treatment of an HHV-8 infection as an active ingredient. Such a pharmaceutical composition may consist of the active ingredient alone, in a form suitable for administration to a subject, or the pharmaceutical composition may comprise the active ingredient and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or some combination of these. The active ingredient may be present in the pharmaceutical
- 23 - composition in the form of a physiologically acceptable ester or salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art.
As used herein, the term "pharmaceutically acceptable carrier" means a chemical composition with which the active ingredient may be combined and which, following the combination, can be used to administer the active ingredient to a subject. As used herein, the term "physiologically acceptable" ester or salt means an ester or salt form of the active ingredient which is compatible with any other ingredients of the pharmaceutical composition, which is not deleterious to the subject to which the composition is to be administered.
The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.
Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts.
Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs, birds including commercially relevant birds such as chickens, ducks, geese, and
24 turkeys, fish including farm-raised fish and aquarium fish, and crustaceans such as farm-raised shellfish.
Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, ophthalmic, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.
A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses.
As used herein, a "unit dose" is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and
100%) (w/w) active ingredient.
In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents. Particularly contemplated additional agents include anti-emetics and scavengers such as cyanide and cyanate scavengers.
Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.
A formulation of a pharmaceutical composition of the invention suitable for oral administration may be prepared, packaged, or sold in the form of a discrete
- 25 - solid dose unit including, but not limited to, a tablet, a hard or soft capsule, a cachet, a troche, or a lozenge, each containing a predetermined amount of the active ingredient. Other formulations suitable for oral administration include, but are not limited to, a powdered or granular formulation, an aqueous or oily suspension, an aqueous or oily solution, or an emulsion.
As used herein, an "oily" liquid is one which comprises a carbon- containing liquid molecule and which exhibits a less polar character than water.
A tablet comprising the active ingredient may, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients. Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free-flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface active agent, and a dispersing agent. Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture. Pharmaceutically acceptable excipients used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, binding agents, and lubricating agents. Known dispersing agents include, but are not limited to, potato starch and sodium starch glycollate. Known surface active agents include, but are not limited to, sodium lauryl sulphate. Known diluents include, but are not limited to, calcium carbonate, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate. Known granulating and disintegrating agents include, but are not limited to, corn starch and alginic acid. Known binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and hydroxypropyl methylcellulose. Known lubricating agents include, but are not limited to, magnesium stearate, stearic acid, silica, and talc.
Tablets may be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby
- 26 - providing sustained release and absorption of the active ingredient. By way of example, a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets. Further by way of example, tablets may be coated using methods described in U.S. Patents numbers 4,256,108; 4,160,452; and 4,265,874 to form osmotically-controlled release tablets. Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide pharmaceutically elegant and palatable preparation.
Hard capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such hard capsules comprise the active ingredient, and may further comprise additional ingredients including, for example, an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.
Soft gelatin capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such soft capsules comprise the active ingredient, which may be mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.
Liquid formulations of a pharmaceutical composition of the invention which are suitable for oral administration may be prepared, packaged, and sold either in liquid form or in the form of a dry product intended for reconstitution with water or another suitable vehicle prior to use.
Liquid suspensions may be prepared using conventional methods to achieve suspension of the active ingredient in an aqueous or oily vehicle. Aqueous vehicles include, for example, water and isotonic saline. Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin. Liquid suspensions may further comprise one or more additional ingredients including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents. Oily suspensions may further comprise a thickening
- 27 - agent. Known suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose. Known dispersing or wetting agents include, but are not limited to, naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with a fatty acid, with a long chain aliphatic alcohol, with a partial ester derived from a fatty acid and a hexitol, or with a partial ester derived from a fatty acid and a hexitol anhydride (e.g. polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively). Known emulsifying agents include, but are not limited to, lecithin and acacia. Known preservatives include, but are not limited to, methyl, ethyl, or n-propyl-para- hydroxybenzoates, ascorbic acid, and sorbic acid. Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin. Known thickening agents for oily suspensions include, for example, beeswax, hard paraffin, and cetyl alcohol.
Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, the primary difference being that the active ingredient is dissolved, rather than suspended in the solvent. Liquid solutions of the pharmaceutical composition of the invention may comprise each of the components described with regard to liquid suspensions, it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent. Aqueous solvents include, for example, water and isotonic saline. Oily solvents include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
Powdered and granular formulations of a pharmaceutical preparation of the invention may be prepared using known methods. Such formulations may be administered directly to a subject, used, for example, to form tablets, to fill capsules, or to prepare an aqueous or oily suspension or solution by addition of an aqueous or oily
- 28 - vehicle thereto. Each of these formulations may further comprise one or more of dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, may also be included in these formulations. A pharmaceutical composition of the invention may also be prepared, packaged, or sold in the form of oil-in- water emulsion or a water-in-oil emulsion. The oily phase may be a vegetable oil such as olive or arachis oil, a mineral oil such as liquid paraffin, or a combination of these. Such compositions may further comprise one or more emulsifying agents such as naturally occurring gums such as gum acacia or gum tragacanth, naturally-occurring phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate. These emulsions may also contain additional ingredients including, for example, sweetening or flavoring agents.
A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for rectal administration. Such a composition may be in the form of, for example, a suppository, a retention enema preparation, and a solution for rectal or colonic irrigation. Suppository formulations may be made by combining the active ingredient with a non-irritating pharmaceutically acceptable excipient which is solid at ordinary room temperature (i.e. about 20 °C) and which is liquid at the rectal temperature of the subject (i.e. about 37 °C in a healthy human). Suitable pharmaceutically acceptable excipients include, but are not limited to, cocoa butter, polyethylene glycols, and various glycerides. Suppository formulations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.
Retention enema preparations or solutions for rectal or colonic irrigation may be made by combining the active ingredient with a pharmaceutically acceptable
- 29 - liquid carrier. As is well known in the art, enema preparations may be administered using, and may be packaged within, a delivery device adapted to the rectal anatomy of the subject. Enema preparations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives. A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for vaginal administration. Such a composition may be in the form of, for example, a suppository, an impregnated or coated vaginally-insertable material such as a tampon, a douche preparation, or a solution for vaginal irrigation. Methods for impregnating or coating a material with a chemical composition are known in the art, and include, but are not limited to methods of depositing or binding a chemical composition onto a surface, methods of incoφorating a chemical composition into the structure of a material during the synthesis of the material (i.e. such as with a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material, with or without subsequent drying.
Douche preparations or solutions for vaginal irrigation may be made by combining the active ingredient with a pharmaceutically acceptable liquid carrier. As is well known in the art, douche preparations may be administered using, and may be packaged within, a delivery device adapted to the vaginal anatomy of the subject.
Douche preparations may further comprise various additional ingredients including, but not limited to, antioxidants, antibiotics, antifungal agents, and preservatives.
As used herein, "parenteral administration" of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In
- 30 - particular, parenteral administration is contemplated to include, but is not limited to, subcutaneous, intraperitoneal, intramuscular, intrastemal injection, and kidney dialytic infusion techniques.
Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1 ,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally- administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation
- 31 - may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
Formulations suitable for topical administration include, but are not limited to, liquid or semi-liquid preparations such as liniments, lotions, oil-in-water or water-in-oil emulsions such as creams, ointments or pastes, and solutions or suspensions. Topically-administrable formulations may, for example, comprise from about 1%) to about 10% (w/w) active ingredient, although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent. Formulations for topical administration may further comprise one or more of the additional ingredients described herein.
A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers, and preferably from about 1 to about 6 nanometers. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent/powder-dispensing container such as a device comprising the active ingredient dissolved or suspended in a low- boiling propellant in a sealed container. Preferably, such powders comprise particles wherein at least 98%> of the particles by weight have a diameter greater than 0.5 nanometers and at least 95%) of the particles by number have a diameter less than 7 nanometers. More preferably, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90%) of the particles by number have a diameter less than 6 nanometers. Dry powder compositions preferably include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.
Low boiling propellants generally include liquid propellants having a boiling point of below 65 °F at atmospheric pressure. Generally the propellant may
- 32 - constitute 50 to 99.9%o (w/w) of the composition, and the active ingredient may constitute 0.1 to 20%> (w/w) of the composition. The propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (preferably having a particle size of the same order as particles comprising the active ingredient).
Pharmaceutical compositions of the invention formulated for pulmonary delivery may also provide the active ingredient in the form of droplets of a solution or suspension. Such formulations may be prepared, packaged, or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, comprising the active ingredient, and may conveniently be administered using any nebulization or atomization device. Such formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, or a preservative such as methylhydroxybenzoate. The droplets provided by this route of administration preferably have an average diameter in the range from about 0.1 to about 200 nanometers.
The formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of a pharmaceutical composition of the invention. Another formulation suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle from about 0.2 to 500 micrometers. Such a formulation is administered in the manner in which snuff is taken i.e. by rapid inhalation through the nasal passage from a container of the powder held close to the nares. Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1 %> (w/w) and as much as 100% (w/w) of the active ingredient, and may further comprise one or more of the additional ingredients described herein.
33 - A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance comprising an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may comprise a powder or an aerosolized or atomized solution or suspension comprising the active ingredient. Such powdered, aerosolized, or aerosolized formulations, when dispersed, preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further comprise one or more of the additional ingredients described herein.
A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for ophthalmic administration. Such formulations may, for example, be in the form of eye drops including, for example, a 0.1-1.0%) (w/w) solution or suspension of the active ingredient in an aqueous or oily liquid carrier. Such drops may further comprise buffering agents, salts, or one or more other of the additional ingredients described herein. Other ophthalmalmically- administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form or in a liposomal preparation. As used herein, "additional ingredients" include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Other "additional ingredients" which may be included in the pharmaceutical compositions of the invention are known in the art and
- 34 - described, for example in Genaro, ed., 1985, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, which is incoφorated herein by reference.
Typically dosages of the compound of the invention which may be administered to an animal, preferably a human, range in amount from 1 μg to about 100 g per killogram of body weight of the animal. While the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration. Preferably, the dosage of the compound will vary from about 1 mg to about 10 g per killogram of body weight of the animal. More preferably, the dosage will vary from about 10 mg to about 1 g per killogram of body weight of the animal.
The compound may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even lees frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc.
The invention also includes a kit comprising the composition of the invention and an instructional material which describes adventitially administering the composition to a cell or a tissue of a mammal. In another embodiment, this kit comprises a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to the mammal. Definitions As used herein, each of the following terms has the meaning associated with it in this section.
The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
- 35 - "Plurality" means at least two.
As used herein, "alleviating a symptom" means reducing the severity of the symptom.
The term "adjacent" is used to refer to nucleotide sequences which are directly attached to one another, having no intervening nucleotides. By way of example, the pentanucleotide 5'-AAAAA-3' is adjacent the trinucleotide 5'-TTT-3' when the two are connected thus: 5'-AAAAATTT-3' or 5'-TTTAAAAA-3', but not when the two are connected thus: 5'-AAAAACTTT-3'.
As used herein, amino acids are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:
Full Name Three-Letter Code One-Letter Code
Aspartic Acid Asp D
Glutamic Acid Glu E
Lysine Lys K
Arginine Arg R
Histidine His H
Tyrosine Tyr Y
Cysteine Cys C
Asparagine Asn N
Glutamine Gin Q
Serine Ser s
Threonine Thr T
Glycine Gly G
Alanine Ala A
Valine Val V
Leucine Leu L
Isoleucine He I
Figure imgf000038_0001
Methionine Met M
- 36 Proline Pro P
Phenylalanine Phe F
Figure imgf000039_0001
Tryptophan Tφ W
The term "antibody," as used herein, refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen.
Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies (Harlow et al., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
By the term "synthetic antibody" as used herein, is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
By the term "specifically binds," as used herein, is meant an antibody which recognizes and binds an HHV-8 gHt-gL complex, but does not substantially recognize or bind other molecules in a sample. A "coding region" of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.
37 An "mRNA-coding region" of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotide residues of the non-coding strand of the gene which are homologous with or complementary to, respectively, an mRNA molecule which is produced by transcription of the gene. It is understood that, owing to mRNA processing which occurs in certain instances in eukaryotic cells, the mRNA- coding region of a gene may comprise a single region or a plurality of regions separated from one another in the gene as it occurs in the genome. Where the mRNA- coding region of a gene comprises separate regions in a genome, "mRNA-coding region" refers both individually and collectively to each of these regions. A "coding region" of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anticodon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon. The coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g. amino acid residues in a protein export signal sequence).
"Complementary" as used herein refers to the broad concept of subunit sequence complementarity between two nucleic acids, e.g., two DNA molecules. When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position. Thus, two nucleic acids are complementary to each other when a substantial number (at least 50%) of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T and G:C nucleotide pairs).
"Encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding
- 38 - to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns. A first region of an oligonucleotide "flanks" a second region of the oligonucleotide if the two regions are adjacent one another or if the two regions are separated by no more than about 1000 nucleotide residues, and preferably no more than about 100 nucleotide residues.
"Homologous" as used herein, refers to the subunit sequence similarity between two polymeric molecules, e.g. , between two nucleic acid molecules, e.g. , two
DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions, e. g. , if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90%) homology. By way of example, the DNA sequences 3'ATTGCC 5' and 3'TAAGCC 5' share 50% homology.
As used herein, "homology" is used synonymously with "identity." The percentage identity of two polynucleotide or two polypeptide molecules may be compared with one another using any one of several available algorithms, the most common of which being the BLAST program.
- 39 - As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the invention for its designated use. The instructional material of the kit of the invention may, for example, be affixed to a container which contains the composition or be shipped together with a container which contains the composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the composition be used cooperatively by the recipient.
An "isolated nucleic acid" refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell. The term therefore includes, for example, a recombinant DNA which is incoφorated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g, as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytidine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.
By describing two polynucleotides as "operably linked" is meant that a single-stranded or double-stranded nucleic acid moiety comprises the two polynucleotides arranged within the nucleic acid moiety in such a manner that at least one of the two polynucleotides is able to exert a physiological effect by which it is
- 40 - characterized upon the other. By way of example, a promoter operably linked to the coding region of a gene is able to promote transcription of the coding region.
A "polynucleotide" means a single strand or parallel and anti-parallel strands of a nucleic acid. Thus, a polynucleotide may be either a single-stranded or a double-stranded nucleic acid.
The term'"nucleic acid" typically refers to large polynucleotides. The term "oligonucleotide" typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T."
Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5'-direction. The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the "coding strand"; sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as "upstream sequences"; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences."
A "portion" of a polynucleotide means at least at least about twenty sequential nucleotide residues of the polynucleotide. It is understood that a portion of a polynucleotide may include every nucleotide residue of the polynucleotide.
"Primer" refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA polymerase. A primer is typically single-stranded, but
- 41 - may be double-stranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications. A primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions. Primers can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
"Probe" refers to a polynucleotide that is capable of specifically hybridizing to a designated sequence of another polynucleotide. A probe specifically hybridizes to a target complementary polynucleotide, but need not reflect the exact complementary sequence of the template. In such a case, specific hybridization of the probe to the target depends on the stringency of the hybridization conditions. Probes can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties. "Recombinant polynucleotide" refers to a polynucleotide having sequences that are not naturally joined together. An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell.
A recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.
A host cell that comprises a recombinant polynucleotide is referred to as a "recombinant host cell." A gene which is expressed in a recombinant host cell wherein the gene comprises a recombinant polynucleotide, produces a "recombinant polypeptide." A "recombinant polypeptide" is one which is produced upon expression of a recombinant polynucleotide.
"Polypeptide" refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants,
- 42 - and synthetic non-naturally occurring analogs thereof. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. The term "protein" typically refers to large polypeptides. The term "peptide" typically refers to short polypeptides. Conventional notation is used herein to portray polypeptide sequences: the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus.
As used herein, the term "promoter/regulatory sequence" means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulator sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner. By the term "substantially full length HHV-8 gL" as used herein, is meant a HHV-8 gL molecule which comprises a sufficient number of amino acids so that the substantially full length gL is capable of binding to gHt, forming a complex therewith, which complex has biological activity as defined herein. Thus, a substantially full length gL molecule does not necessarily contain all of the amino acids which comprise HHV-8 gL, (although according to the invention, it may) but rather, the molecule comprises a substantial portion of the molecule sufficient for binding to gHt and forming a biologically active complex therewith.
By the term "substantially pure" as it refers to gH, gL or a gH-gL complex, is meant a composition which has been separated from the components which naturally accompany it in the cell or medium in which it resides. Typically, a composition is substantially pure when at least 10%>, more preferably at least 20%, more preferably at least 50%, more preferably at least 60%), more preferably at least 75%>, more preferably at least 90%>, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a
- 43 - sample is the compound of interest. Purity can be measured by any appropriate method, e.g., in the case of polypeptides by column chromatography, gel electrophoresis or HPLC analysis. A compound, e.g., a protein, is also substantially purified when it is essentially free of naturally associated components or when it is separated from the native contaminants which accompany it in its natural state.
As used herein, "treating an HHV-8 infection" means reducing the frequency with which a symptom of the HHV-8 infection is experienced by a patient.
By the term "truncated" as used herein as it refers to gH, is meant a molecule of gH which contains less than the complete number of amino acids found in a wild type protein. Particularly, the term truncated is used to mean a gH molecule which is not membrane anchored, i.e., which comprises a deletion or other mutation which facilitates secretion of gH from the cell. Mutations in the gH molecule which give rise to different lengths of gH may comprise insertion, deletion or point mutations. An insertion mutation is one where additional base pairs are inserted into a DNA molecule. A deletion mutation is one where base pairs have been removed from a
DNA molecule. A point mutation is one where a single base pair alteration has been made in a DNA molecule. Each of these mutations is designed such that creation of any one of them in a DNA molecule effects an alteration in the nature of any polypeptide expressed by that DNA, which alteration results in a gH molecule capable of binding to gL to form a complex having biological activity as defined herein, and which gH-gL complex is secreted from a cell in which it is expressed.
By the term "vaccine," as used herein, is meant a composition which when inoculated into a mammal has the effect of stimulating a cellular immune response comprising a T cell response or a B cell response. The T cell response may be a cytotoxic T cell response directed against macromolecules associated with the composition, or an agent associated with the composition. However, the induction of a T cell response comprising other types of T cells by the vaccine of the invention is also contemplated. A B cell response results in the production of antibody which binds to
44 - the composition. The vaccine may serve to elicit an immune response in the mammal which serves to protect the mammal against a disease.
By the term "vaccine" is also meant a composition, a protein complex or a DNA encoding a protein complex which may serve to protect an animal against a heφesvirus disease.
By the term "immunizing a human against HHV-8 " is meant administering to the human a composition, a protein complex, a DNA encoding a protein complex, an antibody or a DNA encoding an antibody, which elicits an immune response in the human which immune response provides protection to the human against a disease caused by HHV-8.
A "vector" is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
"Expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis- acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses that incoφorate the recombinant polynucleotide.
The invention is now described with reference to the following examples. These examples are provided for the pmpose of illustration only and the
- 45 - invention should in no way be construed as being limited to these examples but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Example 1. Generation and Characterization of Baculovirus-Expressed HHV-8 gH/gL To generate quantities HHV-8 gH and gL, the gH and gL open reading frames were each amplified using PCR and were subcloned into a baculovirus transfer vector. In the case of gH, only the predicted ectodomain was amplified to permit secretion of the protein. In addition, a 6-His tag was appended to the C-terminus of gH to facilitate purification of the protein using nickel chromatography. The resulting plasmid constructs were cotransfected with baculovirus DNA into insect cells.
Recombinant viruses were plaque purified and the presence of the desired inserts was confirmed by PCR.
Synthetic peptides mimicking gH residues 690-704 and gL residues 153-167 were coupled to Keyhole Limpet Hemocyanin (KLH) and were used separately to immunize rabbits. To determine whether gH and gL were synthesized by the individual baculovirus recombinants, infected cell lysates were analyzed by Western blotting using the antisera raised against the synthetic peptides. Bands of the expected size for each of the proteins were readily detected.
Insect cells were co-infected with the baculovirus recombinants expressing gH and gL. Culture medium and infected cells were harvested separately and were analyzed by Western blotting to detect gH and gL. Both proteins were readily detected in the culture medium (following purification and concentration by nickel chromatography) as well as in infected cells. Furthermore, since gL lacked a 6- His tag and yet co-purified with gH from the infected culture medium, gL was associated with gH during the purification procedure. In the absence of antibodies which recognize the native proteins, the fact that a secreted complex was obtained suggests that the recombinant gH and gL were correctly folded and processed.
The experiments establish that antisera raised against HHV-8 gH and gL synthetic peptides recognized the recombinant proteins produced in baculovirus
- 46 - infected cells. Co-expression of HHV-8 gH and gL in insect cells resulted in secretion of a gH-gL complex.
The precise protocols used in the experiments described in this Example were as follows. Construction of the baculovirus recombinant expressing HHV-8 gH(704t)
The general strategy employed in the construction of a baculovirus recombinant expressing a secreted form of a class I membrane protein (HSV-1 gD) has been described in detail elsewhere (Sisk et al., 1994, J. Virol. 68:766-775; Whitbeck. et al, 1997, J. Virol. 71 :6083-6093.). Briefly, based on the nucleotide sequence of the
HHV-8 gH ORF (GenBank Database Entry Accession # U75698), two PCR primers were synthesized in order to amplify and modify the gH ectodomain coding region for cloning and expression in a recombinant baculovirus. The first primer, 5'-GCGGGATCCTACAACGGCGACGACAATAA -3' (SEQ ID NO:5), hybridized to the non-coding strand of the gH ORF immediately beyond the region coding for the predicted signal sequence and incoφorated a BamHl restriction enzyme cleavage site (bold letters). The second primer,
5'-CGCGGATCCTAATGGTGATGGTGGTGATGACTGG-CTGCGCGTCTTCTAT A-3' (SEQ ID NO:6), hybridized to the coding strand of the cloned gH ORF immediately prior to the transmembrane region coding sequence and also incoφorated a BamHl restriction enzyme cleavage site (bold letters). The PCR-amplified DNA fragment encoded gH lacking its natural signal sequence so that when cloned into the pVT-Bac transfer vector, the melittin signal sequence, coded for by pVT-Bac, would replace the missing gH signal sequence. The resulting construct was also designed to code for 6 histidine residues at the carboxy-terminus of the truncated protein (the codons for these additional residues were added by incoφoration into the second PCR primer shown above) to allow for its purification using nickel agarose chromatography. The PCR-amplified product was then digested with BamHl and cloned into pVT-Bac which had also been digested with BamHl.
- 47 - Once cloned into pVT-Bac, the resulting plasmid construct, pCW287, was cotransfected with baculovirus DNA (Baculogold, Pharmingen) into Sf9 cells growing in monolayer culture. After 4 days, the culture supernatant (containing recombinant progeny virus) was replated onto Sf9 cell monolayers under Grace's insect cell medium containing 1% agarose. Recombinant virus plaques were picked, amplified and infected cell cultures were screened for the expression of gH by SDS-PAGE and immunoblot analysis using R156 antiserum. Virus clones expressing gH were plaque-purified three times and protein expression from individual virus clones was verified at each stage by SDS-PAGE and immunoblot analysis. The plaque-purified baculovirus recombinant selected for further study was named
"bac-HHV-8 gH(704t)". The protein produced by bac-HHV-8 gH(704t) is referred to as herein "HHV-8 gH(704t)". These designations indicate that the recombinant form of HHV-8 gH is truncated after amino acid 704 of the predicted gH protein.
Construction of the baculovirus recombinant expressing HHV-8 gL Based on the nucleotide sequence of the HHV-8 gL ORF (3), two PCR primers were synthesized in order to amplify and modify the gL ectodomain coding region for cloning and expression in a recombinant baculovirus. The first primer, 5'-GCCGGATCCTCATGCATACGTCGCCTTACCATGTTG-3' (SEQ ID NO:7), hybridized to the non-coding strand of the gL ORF immediately beyond the region coding for the predicted signal sequence and incoφorated a BamHl restriction enzyme cleavage site (bold letters). The second primer,
5'-GCCGAATTCATTTTCCCTTTTGACCTGCGTGCGCTCT- 3' (SEQ ID NO:8), hybridized to the coding strand of the cloned gL ORF at its 3 '-end and incoφorated a EcoRI restriction enzyme cleavage site (bold letters). The PCR-amplified DNA fragment encoded gL lacking its natural signal sequence so that when cloned into the pVT-Bac transfer vector, the melittin signal sequence, coded for by pVT-Bac, would replace the missing gL signal sequence. The resulting construct was not modified in any other way. The PCR-amplified product was then digested with BamHl and EcoRI and cloned into pVT-Bac which had also been digested with BamHl and EcoRI.
- 48 - Once cloned into pVT-Bac, the resulting plasmid construct, pCW290, was cotransfected with baculovirus DNA (Baculogold, Pharmingen) into Sf9 cells growing in monolayer culture. After 4 days, the culture supernatant (containing recombinant progeny virus) was replated onto Sf9 cell monolayers under Grace's insect cell medium containing 1% agarose. Recombinant virus plaques were picked, amplified and infected cell cultures were screened for the expression of gL by SDS-PAGE and immunoblot analysis using R159 antiserum. Virus clones expressing gL were plaque-purified three times and protein expression from individual virus clones was verified at each stage by SDS-PAGE and immunoblot analysis. The plaque-purified baculovirus recombinant selected for further study was named
"bac-HHV-8 gL". The protein produced by bac-HHV-8 gL is referred to herein as " HHV-8 gL".
Antibodies
Monospecific rabbit antisera against HHV-8 gH were generated by immunizing two animals with KLH coupled to a 15 amino-acid peptide representing a portion of the HHV-8 gH ectodomain. The sequence of this peptide is as follows: TVVEIRGMYRRRAAS (SEQ ID NO:9). The resulting antisera, labeled R156 and R157, were shown to specifically recognize the peptide used for immunization by dot blot and ELISA. Similarly, monospecific rabbit antisera directed against HHV-8 gL were generated by immunizing two animals with KLH coupled to a 15 amino-acid peptide representing a portion of the gL protein. The sequence of this peptide is as follows: AKSSSRRAHAGQKGK (SEQ ID NO: 10). The resulting antisera, labeled R158 and R159, were shown to specifically recognize the peptide used for immunization by dot blot and ELISA. Example 2. Generation and Characterization of Mammalian Cell -Expressed HHV-8 gH/gL
Expression of HHV-8 gH and gL in stably transformed mammalian cells was performed to generate sufficient quantities of protein for further characterization
49 and use in the methods of the invention. The procedures and results obtained were as follows:
The portion of the HHV-8 gH open reading frame which encodes the signal sequence and the predicted ectodomain of HHV-8 gH were amplified by PCR using the 5' primer:
GCGGGATCCTAGAGGAGACATGCAGGGTCTAGCCTTCTTG (SEQ ID NO:l 1), and the 3' primer
CGCGGATCCTAATGGTGATGGTGGTGATGACTGGCTGCGCGTCTTCTATA (SEQ ID NO:6). The predicted transmembrane and cytoplasmic domains of gH were omitted to facilitate secretion of the truncated gH protein. The downstream PCR primer was designed to add six histidine codons and a termination codon to the truncated gH open reading frame. This modification was made to facilitate purification of gH using nickel chromatography. The PCR product was then subcloned into the mammalian cell expression plasmid, pcDNA3.1/Hygro(+) (Invitrogen, Carlsbad, CA) under the transcriptional control of the human cytomegalovirus immediate early promoter. This plasmid also comprises the hygromycin resistance gene for selection of stably transformed cells. The resulting plasmid construct was named pCW320 (Figure 5).
The entire HHV-8 gL open reading frame was amplified by PCR using the 5' primer CGCGGTACCATGGGGATCTTTGCGCTATTTG (SEQ ID NO:12) and the 3' primer GCCGAATTCATTTTCCCTTTTGACCTGCGTGCGCTCT (SEQ ID NO: 8) and was subcloned into the mammalian cell expression plasmid, pcDNA3.1(+) (Invitrogen, Carlsbad, CA), also under the transcriptional control of the human cytomegalovirus immediate early promoter. This plasmid also comprises the neomycin resistance gene for selection of stably transformed cells using the drug G418. This plasmid construct was named pCW315 (Figure 6).
Plasmids pCW315 and pCW 320 were co-transfected into murine Ltk- cells using the lipid transfection reagent, FuGene 6 (Boehringer Mannheim Biochemicals, Indianapolis, IN) according to the manufacturer's instructions.
- 50 - Transfected cells were initially cultured in DMEM, 5%> fetal bovine serum (FBS) in the absence of selecting drugs. After 48 hours, the cells were grown in the continuous presence of both G418 (400 μg/ml) and hygromycin (200 μg/ml). After two weeks of drug selection, the remaining viable cells were cloned by limiting dilution. Multiple drug-resistant clones were obtained and each was screened for HHV-8 gHt and gL expression. One cell line, designated "KS gH/L-9" was selected for further study based on the high level of gHt/gL expression as well as the relatively rapid growth of these cells in culture (Figure 7A and 7B).
An experiment was performed to test the binding of the secreted HHV-8 gH and gL to nickel agarose. Since gHt (but not gL) had a 6-histidine tag attached thereto, it was expected to bind to nickel agarose. Co-purification of HHV-8 gL then should only occur if gL is associated with gH. To determine whether HHV-8 gL copurified with HHV-8 gHt, two 225 cm2 tissue culture flasks were seeded with KS gH/L-9 cells and grown in the presence of G418 and hygromycin until the cells reached confluence. The medium was then replaced with DMEM, 2% FBS without drugs, and the cells were incubated at 37°C for 72 hours. The growth medium was harvested and replaced with fresh medium. Following an additional 72 hour incubation, the growth medium was again harvested and the cells were discarded.
The medium from both harvests was pooled, dialyzed against PBS and incubated with 0.2 ml of nickel agarose resin (Qiagen, Chatsworth, CA) at 4°C for 16 hours on a rotary shaker. The nickel-agarose resin was collected and washed with PBS and then with 10 mM imidazole in 20 mM sodium phosphate (pH 7.5), 500 mM NaCl. Bound protein was then eluted from the resin using 500 mM imidazole in 20 mM sodium phosphate (pH 7.5), 500 mM NaCl. Column wash and elution fractions were analyzed by SDS-PAGE followed by Western blot for HHV-8 gHt and gL using rabbit antisera raised against peptides mimicking HHV-8 gH residues 690-704 (antiserum called "R156") and gL residues 153-167 (antiserum called "R159"). Both proteins were readily detected in the 500 mM imidazole fraction, but not in the column flow-through or wash fractions (Figure 7A). The observation that a secreted complex
- 51 - was obtained is evidence that recombinant gH and gL were correctly folded and processed.
An additional experiment was carried out to determine the effect of sodium butyrate on gHt/gL production from KS gH/L-9 cells. Identical cultures of KS gH/L-9 cells were prepared for protein production as described above. When the cells reached confluence, DMEM, 5% FBS was added to one flask while the same medium containing 5 mM sodium butyrate was added to the other. The growth medium from each flask was harvested after 72 hours. HHV-8 gHt and gL were enriched by nickel-agarose chromatography and analyzed by SDS-PAGE followed by Western blotting as before (Figure 7B). The results demonstrate that gHt/gL production was increased approximately two-fold by the addition of sodium butyrate to the growth medium.
Example 3. Development of a murine hybridoma cell line which produces monoclonal antibody directed against an HHV-8 gH peptide As described herein, it has been possible to generate rabbit antisera which specifically binds to synthetic peptides which mimic portions of the predicted HHV-8 gH and gL polypeptides (two of these antisera were used in the experiments described above). In the present Example, a murine hybridoma cell line called "6F12AB1" that produces a monoclonal antibody recognizing a peptide mimicking HHV-8 gH residues 690-704 has been generated. This cell line was constructed using ordinary antibody technology, and it is therefore a simple matter for one skilled in the art to generate other hybridomas which produce anti-HHV-8 gH and anti-HHV-8 gL antibodies.
The monoclonal antibody produced by the cell line 6F12AB1 has been successfully used to detect recombinant HHV-8 gH on Western blots.
The data presented in the present examples establish the successful production of a stably transformed mammalian cell line called "KS gH/L-9" which expresses both a truncated form of HHV-8 gH and the full-length HHV-8 gL. These proteins are secreted as a complex and can be purified by affinity chromatography
- 52 - using nickel-agarose. Protein production can be boosted approximately two-fold by treatment of the transformed cells with 5 mM sodium butyrate. In addition, a murine hybridoma cell line has been developed which produces a monoclonal antibody recognizing a peptide mimicking HHV-8 gH residues 690-704. It is therefore possible to obtain and purify larger amounts of the soluble
HHV-8 gH/gL complex produced in KS gH/L-9 cells using either nickel-agarose or the 6F 12 AB1 monoclonal antibody.
The disclosures of each and every patent, patent application, and publication cited herein are hereby incoφorated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
53 -

Claims

What is claimed is:
1. An isolated nucleic acid encoding an HHV-8 glycoprotein H polypeptide.
2. The isolated nucleic acid of claim 1, wherein said nucleic acid shares at least about 40% homology with SEQ ID NO: 1.
3. The isolated nucleic acid of claim 1, wherein said nucleic acid has the sequence of SEQ ID NO: 1.
4. A vector comprising the isolated nucleic acid of claim 1.
5. The vector of claim 4, wherein said vector is the plasmid pCW320.
6. A recombinant cell comprising the isolated nucleic acid of claim 1.
7. An isolated nucleic acid encoding an HHV-8 glycoprotein L polypeptide.
8. The isolated nucleic acid of claim 7, wherein said nucleic acid shares at least about 40% homology with SEQ ID NO:3.
9. The isolated nucleic acid of claim 7, wherein said nucleic acid has the sequence of SEQ ID NO:3.
10. A vector comprising the isolated nucleic acid of claim 7.
11. The vector of claim 10, wherein said vector is the plasmid pCW315.
12. A recombinant cell comprising the isolated nucleic acid of claim 7.
13. A substantially pure preparation of an HHV-8 glycoprotein H polypeptide.
14. The substantially pure preparation of the HHV-8 glycoprotein H polypeptide of claim 13, wherein said polypeptide shares at least about 40%) homology with SEQ ID NO:2.
15. The substantially pure preparation of the HHV-8 glycoprotein H polypeptide of claim 13, wherein said polypeptide has the sequence of SEQ ID NO:2.
16. A cell comprising the substantially pure preparation of an HHV-8 glycoprotein H polypeptide of claim 13.
- 54 -
17. A substantially pure preparation of an HHV-8 glycoprotein L polypeptide.
18. The substantially pure preparation of the HHV-8 glycoprotein L polypeptide of claim 17, wherein said polypeptide shares at least about 40% homology with SEQ ID NO:4.
19. The substantially pure preparation of the HHV-8 glycoprotein L polypeptide of claim 17, wherein said polypeptide has the sequence of SEQ ID NO:4.
20. A cell comprising the substantially pure preparation of an HHV-8 glycoprotein L polypeptide of claim 17.
21. A substantially pure preparation of a soluble HHV-8 glycoprotein
H-glycoprotein L complex.
22. The complex of claim 21, wherein said glycoprotein H is truncated.
23. The complex of claim 22, wherein said truncated glycoprotein H comprises a signal sequence and an ectodomain.
24. The complex of claim 23, wherein said glycoprotein H is truncated after amino acid 704.
25. The complex of claim 21, wherein said glycoprotein L is substantially full length.
26. The complex of claim 21, wherein the amino acid sequence of said glycoprotein H shares at least about 40%> homology with SEQ ID NO: 2 and the amino acid sequence of said glycoprotein L shares at least about 40% homology with SEQ ID NO:4.
27. The complex of claim 26, wherein the amino acid sequence of said glycoprotein H is amino acids 1-704 of SEQ ID NO: 2 and the amino acid sequence of said glycoprotein L is SEQ ID NO:4.
28. A cell comprising the soluble HHV-8 glycoprotein H-glycoprotein L complex of claim 21.
29. The cell of claim 28, wherein said cell is selected from the group consisting of a prokaryotic cell and a eukaryotic cell.
- 55 -
30. The cell of claim 29, wherein said eukaryotic cell is selected from the group consisting of a yeast cell, an insect cell and a mammalian cell.
31. The cell of claim 30, wherein said cell is a murine cell.
32. The cell of claim 31, wherein said cell is KS gH/L-9.
33. An isolated nucleic acid encoding a soluble HHV-8 glycoprotein H- glycoprotein L complex.
34. A pharmaceutical composition comprising an isolated nucleic acid encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex.
35. A pharmaceutical composition comprising a soluble HHV-8 glycoprotein H-glycoprotein L complex.
36. A vaccine comprising an isolated nucleic acid encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex.
37. A vaccine comprising a soluble HHV-8 glycoprotein H-glycoprotein L complex.
38. An antibody which specifically binds an HHN-8 glycoprotein H polypeptide.
39. The antibody of claim 38, wherein said antibody is selected from the group consisting of a polyclonal, a monoclonal and a synthetic antibody.
40. The antibody of claim 39, wherein said antibody is a monoclonal antibody.
41. The antibody of claim 40, wherein said antibody is 6F 12AB 1.
42. A hybridoma cell line which produces the antibody of claim 38.
43. An antibody which specifically binds an HHN-8 glycoprotein L polypeptide.
44. The antibody of claim 43, wherein said antibody is selected from the group consisting of a polyclonal, a monoclonal and a synthetic antibody.
45. The antibody of claim 44, wherein said antibody is a monoclonal antibody.
46. A hybridoma cell line which produces the antibody of claim 43.
- 56 -
47. A vaccine comprising a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
48. A vaccine comprising at least one polynucleotide encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
49. A method of preventing an HHV-8 infection in a human, said method comprising administering to said human a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
50. A method of preventing an HHV-8 infection in a human, said method comprising administering to said human at least one polynucleotide encoding a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
51. A method of treating an HHV-8 infection in a human, said method comprising administering to said human a substantially pure preparation of a soluble HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
52. A method of treating an HHV-8 infection in a human, said method comprising administering to said human at least one polynucleotide encoding a soluble
HHV-8 glycoprotein H-glycoprotein L complex, suspended in a pharmaceutically acceptable carrier.
53. A method of diagnosing an HHV-8 infection in a human, said method comprising contacting a biological sample obtained from said human with an antibody which specifically binds to a protein selected from the group consisting of
HHV-8 glycoprotein H, HHV-8 glycoprotein L, and HHV-8 glycoprotein H- glycoprotein L complex, wherein when said antibody specifically binds to a composition in said biological sample, said human has said HHV-8 infection.
- 57 -
54. A method of diagnosing an HHV-8 infection in a human, said method comprising contacting a biological sample obtained from said human with a protein selected from the group consisting of HHV-8 glycoprotein H, HHV-8 glycoprotein L, and HHV-8 glycoprotein H-glycoprotein L complex, and determining whether said protein specifically binds to an antibody in said biological sample, wherein specific binding of said protein to an antibody in said biological sample is an indication that said human has an HHV-8 infection.
55. The method of claim 54, wherein said protein has a detectable label attached thereto and specific binding of said protein to an antibody in said biological sample is assessed by assessing the association of said label with said antibody.
56. A method of diagnosing an HHV-8 infection in a human, said method comprising contacting a biological sample obtained from said human with an isolated nucleic acid selected from the group consisting of an HHV-8 glycoprotein H polynucleotide and an HHV-8 glycoprotein L polynucleotide, and determining whether said isolated nucleic acid binds to a nucleic acid in said biological sample, wherein binding of said isolated nucleic acid to nucleic acid in said biological sample, is an indication that said human has an HHV-8 infection.
57. A method of diagnosing an HHV-8 infection in a human, said method comprising contacting a biological sample obtained from said human with a substantially pure preparation of an HHV-8 gH polypeptide, or an HHV-8 gL polypeptide and determining whether said polypeptide binds to an antibody in said biological sample, wherein binding of said polypeptide to an antibody in said biological sample is an indication that said human has an HHV-8 infection.
58. A method of diagnosing an HHV-8 infection in a human, said method comprising contacting a biological sample obtained from said human with a substantially pure preparation of an HHV-8 gH-gL complex and determining whether said complex binds to an antibody in said biological sample, wherein binding of said complex to an antibody in said biological sample is an indication that said human has an HHV-8 infection.
- 58 -
PCT/US1999/005464 1998-03-12 1999-03-12 Reagents for detection and treatment of kaposi's sarcoma WO1999045948A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU31848/99A AU3184899A (en) 1998-03-12 1999-03-12 Reagents for detection and treatment of kaposi's sarcoma

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7767098P 1998-03-12 1998-03-12
US60/077,670 1998-03-12

Publications (1)

Publication Number Publication Date
WO1999045948A1 true WO1999045948A1 (en) 1999-09-16

Family

ID=22139409

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/005464 WO1999045948A1 (en) 1998-03-12 1999-03-12 Reagents for detection and treatment of kaposi's sarcoma

Country Status (2)

Country Link
AU (1) AU3184899A (en)
WO (1) WO1999045948A1 (en)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
AUSUBEL F. M.: "CURRENT PROTOCOLS IN MOLECULAR BIOLOGY.", 1 January 1987, NEW YORK, WILEY & SONS., US, article AUSUBEL, ET AL.: "PROTEIN EXPRESSION CURRENT PROTOCOLS IN MOLECULAR BIOLOGY", pages: 16.0.01 - 16.11.07, XP002920437, 016728 *
HARLOW E., LANE D.: "ANTIBODIES. LABORATORY MANUAL.", 1 January 1988, NEW YORK, COLD SPRING HARBOR LABORATORY., US, article HARLOW E., LANE D.: "ANTIBODIES A LABORATORY MANUAL, PASSAGE.", pages: 01/02 + 71 - 82., XP002920436, 016726 *
LI M., ET AL.: "KAPOSI'S SARCOMA-ASSOCIATED HERPESVIRUS ENCODES A FUNCTIONAL CYCLIN", JOURNAL OF VIROLOGY., THE AMERICAN SOCIETY FOR MICROBIOLOGY., US, vol. 71., no. 03., 1 March 1997 (1997-03-01), US, pages 1984 - 1991., XP002920435, ISSN: 0022-538X *
NEIPEL F., ET AL.: "HUMAN HERPESVIRUS 8 ENCODES A HOMOLOG OF INTERLEUKIN-6.", JOURNAL OF VIROLOGY., THE AMERICAN SOCIETY FOR MICROBIOLOGY., US, vol. 71., no. 01., 1 January 1997 (1997-01-01), US, pages 839 - 842., XP000645323, ISSN: 0022-538X *
RUSSO J. J., ET AL.: "NUCLEOTIDE SEQUENCE OF THE KAPOSI SARCOMA-ASSOCIATED HERPESVIRUS (HHV8).", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 93., no. 25., 1 December 1996 (1996-12-01), US, pages 14862 - 14867., XP000645332, ISSN: 0027-8424, DOI: 10.1073/pnas.93.25.14862 *

Also Published As

Publication number Publication date
AU3184899A (en) 1999-09-27

Similar Documents

Publication Publication Date Title
US6537594B1 (en) Vaccina virus comprising cytokine and/or tumor associated antigen genes
US5880103A (en) Immunomodulatory peptides
JP3254128B2 (en) Method for producing antibody against glycoprotein of HCMV
US8124105B2 (en) Compositions, methods and kits relating to poxvirus subunit vaccines
US6780407B1 (en) Pox virus comprising DNA sequences encoding CEA and B7 antigen
Hung et al. Structural basis of C3b binding by glycoprotein C of herpes simplex virus
NZ229297A (en) Immunogenic particle comprising gag precursor protein and its expression in eukaryctic cells
CA2134898A1 (en) Compositions and methods for vaccination against coronaviruses
US7825085B2 (en) Fragments of NKp44 and NKp46 for targeting viral-infected and tumor cells
EP0400010A1 (en) Soluble human cd4 fragments and uses therefor
EP0249390A2 (en) Synthetic peptides related to the HIV glycoprotein gp 120
KR100380953B1 (en) Unsplit variant of gp350 / 220
AU2638295A (en) Compositions of transactivating proteins of human immunodeficiency virus
EP0249394B1 (en) Small peptides which inhibit binding to T-4 receptors and act as immunogens
US20030022158A1 (en) Peptides from the TT virus sequence and monospecific antibodies binding to the TT virus
CA2067469C (en) Recombinant vaccine against marek's disease
EP0624198A1 (en) Synthetic peptides for a rubella vaccine
WO1999045948A1 (en) Reagents for detection and treatment of kaposi's sarcoma
WO1999020761A2 (en) Compositions and methods for identifying and testing therapeutics against hsv infection
US20040234542A1 (en) Recombinant orf2 proteins of the swine hepatitis e virus and their use as a vaccine and as a diagnostic reagent for medical and veterinary applications
JP2001524821A (en) Pakistani strain recombinant proteins of hepatitis E and their use in diagnostics and vaccines
US20030162263A1 (en) Peptides derived from the superantigen (SAg) ENV protein of HERV-K18 and their use in obtaining SAG-inhibitory antibodies and in vaccination against SAG
AU604719B2 (en) Small peptides which inhibit binding to t-4 receptors and act as immunogens
WO1995004756A1 (en) Complement inhibitor proteins of non-human primates
AP96A (en) Small peptides which inhibit binding to T-4 receptors and act as immunogens.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 09660320

Country of ref document: US

122 Ep: pct application non-entry in european phase