WO1999043792A1

WO1999043792A1 - Recombinant protein having rna-dependent polymerase activity of human hepatitis c virus and process for producing the same

Info

Publication number: WO1999043792A1
Application number: PCT/JP1998/004204
Authority: WO
Inventors: Seishi Murakami; Tatsuya Yamashita
Original assignee: Eli Lilly And Company
Priority date: 1998-02-27
Filing date: 1998-09-18
Publication date: 1999-09-02

Abstract

A process for producing a recombinant RNA-dependent RNA polymerase which comprises transforming host cells by an expression vector containing a DNA originating in an RNA-dependent RNA polymerase of a human hepatitis C virus and encoding a soluble polypeptide having a polymerase activity and another DNA encoding a second polypeptide other than the above-mentioned one, culturing the resultant transformant, and taking up from the medium a fused protein having the polymerase activity, optionally followed by the separation and recovery of the polypeptide having the polymerase activity from the fused protein; and the recombinant RNA-dependent RNA polymerase thus obtained.

Description

Description Recombinant protein having RNA-dependent polymerase activity of human hepatitis C virus and method for producing the same

The present invention relates to a soluble type I protein having an RNA-dependent RNA polymerase activity of hepatitis C virus. Background art

Cffl- ¹ Flame Virus (HCV) is a + strand RNA virus isolated and identified in 1989 by the Chiron group as the causative virus of non-A, non-B hepatitis. Epidemiological studies estimate that the HCV-infected population worldwide is about 1%. Important routes of transmission other than those via blood, such as blood transfusion, are undecided, and it is estimated that the contribution of vertical transmission between parents and children is low. Prevention of infection by blood transfusion has achieved epoch-making results with the HCV immunodiagnosis developed by Chiron.

Although HCV is an RNA virus, it causes long-lasting infections in the liver and causes chronic hepatitis. HCV chronic hepatitis for more than 30 years has been the leading cause of subsequent hepatocellular carcinoma (liver cancer), and in Japan at least 75% of ^ ff cancers develop on the background of HCV hepatitis. I have.

HCV-related liver cancer develops through a series of courses, so that the risk of onset can be predicted from the course of the disease state. Therefore, blocking the growth of HCV virus is expected to be effective in alleviating HCV hepatitis and preventing liver cancer development.

At present, various methods are being studied toward HCV infection and HCV multiplication liJh, but a definitive method has not yet been established.

First, immunological studies targeting HCV surface proteins with the goal of stopping viral infection have the ability to mutate one after another during the course of infection. As a result, the desired effect has not been improved, and the identification of the host-side receptor required for HCV infection has not been successful.

In addition, viral proteins are synthesized as a single long polypeptide (see Figure 1), which is cleaved by proteolytic enzymes encoded by the host and HCV genes during synthesis to produce viral structural and nonstructural proteins. . Among the protein enzymes, studies on NS2 and NS3 aimed at inhibiting the protein cleavage process by the proteins encoded by HCV NS2 and NS3 have been carried out, In the situation where the development of the drug is progressing, ⁵

¾S

One of the major reasons behind the delay in research on HCV growth processes and vaccine development was the absence of HCV infection using cultured cells.In recent years, infectious HCV RNA clones have been used in chimpanzee-based systems. Once the HCV growth system of the cultured cells was established, the production of attenuated virus and the development of vaccines, the elucidation of the molecule in the HcV growth process ^ 開発, and the development of growth inhibitors were rapidly accelerated. It is expected to make progress. Thus, the development of the HCV propagation / M system is considered to enable the elucidation of the HCV replication process and its molecular mechanism, and eventually the design of a growth inhibitor based on the specificity of its growth. However, at present, the research is unable to respond directly to such a huge and urgent demand!

Disclosure of the invention

Apart from the traditional approach described above, NS5Β is the central enzyme of HCV replication.

By inhibiting the activity of RNA-dependent RNA polymerase (hereinafter referred to as RdRP) (see Fig. 1), it is thought that it can be used for treatment and prevention of HCV infection. That is, HCV is an RNA virus, but a nucleic acid that synthesizes RNA from RNA does not exist in the host. Therefore, the development of a substance that specifically inhibits the replication process of HCV by RdRP is being promoted. However, in order to obtain such substances, large amounts of purified NS5B protein are required to study the function of RdRP and to assay for inhibitors. For that purpose, recombinant NS5B with RdRP activity was Although the method for producing protein is optimal, it has not been possible to obtain a sufficient amount of purified NS5B.

For example, De Francesco et al. Obtained recombinant NS5B in insect cells and demonstrated RdRP activity biochemically, but could obtain sufficient amounts of enzyme to assay and develop P and harmful agents. (De Francesco, R., et al., Ethods Enzyraol. 275: 58-

67, 1996). Many researchers have tried to express and purify large amounts of recombinant NS5B having RdRP activity in E. coli, but could not obtain the insoluble standard, and it must be denatured and regenerated. Banara not a, a sufficient amount, it was not possible to obtain a NS 5 B tamper click for holding the biochemical activity (Tan, bE, et al. , Biochem. Biophys. Res. Co negation n. 1997) ₀

The present inventors have found that an anchor region exists in the C-terminal region of NS5B protein having the RNA-dependent RNA polymerase (hereinafter simply referred to as RdRP!) Activity of human hepatitis C virus. After examining its role, the fusion of a soluble protein (NS5Bt), which deletes a certain number of amino acids from the C-terminal region and maintains its activity, with other polypeptides The present inventors have found that expression of a protein in a host (for example, Escherichia coli) results in a soluble recombinant NS5Bt protein having RdRP activity, thereby completing the present invention. That is, NS5B becomes an insoluble fraction in the protein purification process due to the presence of the anchor region, whereas the NS5Bt mutant lacking the anchor region retains the R d RP activity while retaining the soluble fraction. The presence of RdRP in the cells allowed the cells to be recovered and purified from the transformants without losing their RdRP activity (Example 2 of Fiber, see Fig. 10).

That is, the present invention relates to a DNA encoding a polypeptide having polymerase activity derived from human hepatitis C virus RNA-dependent RNA polymerase, and a second polypeptide other than the polypeptide (eg, glutathione S A host cell is transformed with the present vector containing DNA encoding transferase (hereinafter referred to as GST), the resulting transformant is cultured, and a fusion protein having polymerase activity is recovered from the medium. Optionally, separating and recovering a polypeptide having polymerase activity from the fusion protein. It is intended to provide a method for producing merase, and a soluble or non-fusion protein having a soluble recombinant RdRP activity produced in such a manner.

As will be apparent from the examples described below, the method of the present invention has made it possible for the first time to provide a large amount of a purified recombinant recombinant NS5B protein having RdRP activity.

The soluble polypeptide derived from RdRP of human hepatitis C virus used in the present invention is generally a polypeptide in which the C-terminal region including all or a part of the anchor region of RdRP has been deleted.

Since NS5B of human hepatitis C virus has Rd RP activity in the HCV genome, the term "NS5B"

"A soluble polypeptide (protein) derived from NS5B and derived from NS5B and having an RdRP activity with the C-terminal amino acid deleted is referred to as NS5Bt. In addition, | “NS 5BJ and“ NS 5B t ”” may represent a DNA coding for the NS 5 BS.TJiNS 5 B t protein. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a schematic diagram showing the structure of the HCV polyprotein precursor and its NS5B protein. The upper part is a schematic diagram showing the structure of the HCV polyprotein precursor, and the middle part is the hydrophobic profile (Kyte and Doolittle) of the NS5B protein. The anchor area estimated by the SOSU I program is shaded. The lower panel is a schematic diagram showing the structures of expression constructs of various GST-NS5B fusion proteins. The amino acid numbers in the figure correspond to the amino acid numbers on the HCV polyprotein precursor. NS5B has all of the amino acids of NS5B, NS5Bt lacks the 2989-3010 21 amino acids, NS5Bt-ml has the GDD motif replaced with VDD, NS5Bt-m2 and NS5Bt-m3 have a cluster of salt S¾ residues replaced by alanine, and NS5B-m4 has a mutation in the putative anchor region.

Figure 2 is a restriction map of the GST fusion protein expression plasmid, pGENKS. Plastic Smid pGENKS encodes a consensus sequence for protein kinase A, a thrombin cleavage recognition site, and multicloning sites (EcoR I, Sacl, Kpn I, Xma I, Sall, BamH I), and a GST upstream of this. There is a DNA sequence to encode.

FIG. 3 is a schematic diagram of the construction of plasmid pGENKS. The location of the GST-NS5Bt fusion protein cut by Tobin is underlined. The nucleotide sequence of DNA shown in FIG. 3 and the amino acid sequence encoded thereby are shown in SEQ ID NO: 3. Fig. 4 shows the steps of purification of GST-NS5Bt expressed in E. coli.A is separated from SDS obtained from culture by 10% PAGE and stained by Coomassie staining method (CBB). It is a mimetic diagram of the result of having performed. Lane 1 is whole cell extract; Lane 2 is centrifuged supernatant of sonicated product; Lane 3 is cell-free extract after passing through DEAES-marked hacel; Lane 4 is eluate from daltathione sepharose 4B column Lane 5 shows the eluate from the poly (U) Sepharose column; Lane 6 shows the non-fused rNS5Bt after thrombin treatment. B is a mimetic diagram of the results of Western blotting using an anti-NS5B antibody, and C is a western blotting result using an anti-GST antibody.

Fig. 5 shows the results of analyzing the purified GST-NS5Bt protein corresponding to the band at 95 Kda in lane 5 in Fig. 4A by Western blotting using the serum of a chronic hepatitis patient infected with HCV1b type b and the serum of a normal person FIG. In FIG. 5, Lane 1 shows purified GST-NS5Bt, and Lane 2 shows only the control GST protein. The arrow points to the 95 kDa position.

FIG. 6 is a graph showing the RdRP activity of purified GST-NS5Bt in UMP uptake assays. A uses poly (A) or poly (dA) as a template and oligo (U) 14 or oligo (dT) as a primer, and examines substrate specificity for [a- ³² P] UMP or O-P] dTTP It is a graph showing the result,

B shows the time course of the reaction at 25 and 37 °, and C is a graph showing the relationship with the amount of GST-NS5Bt. .

Figure 7 shows UMP incorporation of purified GST-NS 5Bt under various reaction conditions. 1 is a graph showing RdRP activity. In the figure, A shows the relationship between pH, B shows temperature, and C shows the relationship between KC1 concentration and UMP uptake.

FIG. 8 is a graph showing Rd RP activity based on UMP incorporation of purified GST-NS5Bt under various reaction conditions. Figure, D is shows a relationship between the Mg ²⁺ ion, E is Zn ²⁺ concentration and (0, 10, 25 and ⁵ 0 // M) and UMP incorporation.

FIG. 9 is a diagram showing the results of an RNA synthesis assay using RNA transcribed in a test tube. A is a schematic diagram of the construction of an RNA template, and B is a reaction between the RNA transcribed in a test tube as a template and a primer at 30 ° C for 2 hours.The RNA product is extracted with an organic solvent, and then precipitated with ethanol. It is a mimetic diagram of the electrophoresis pattern obtained by separation and purification by 8% PAGE containing 8M urea.

FIG. 10 is a micrograph showing the localization of NS5Bt expressed in mammalian cells. (A) full length NS5B, (B) GFP-NS5Bt, (C) GFP-NS5B-m4, (D) GFP alone, HLE transfected with an expression plasmid that encodes 3 shows the results of observing the localization of the germ product in Example 2 under a fluorescence microscope.

BEST MODE FOR CARRYING OUT THE INVENTION

For the genome encoding the HCV protein, cDNA has also been cloned, and the organization of the genome has been elucidated. For example, as shown in Figure 1, the HCV-JK1 cDNA encodes 3010 polyprotein precursors, which are processed by viral and host proteases into at least 10 products . NS5B, which is located at C5 ^ ffi and is composed of 591 amino acids, is thought to encode RdRP polymerase by sequence comparison with other viruses (Honda, M., S. Kaneko, M. Unoura, K.

Kobayashi, and S. Murakami, 1993, Arch Virol. 128: 163-169).

Among these HCV-JK1 cDNAs, the nucleotide sequence of the DNA encoding NS5B consisting of 591 amino acids and the amino acid sequence of O¾t are shown in SEQ ID NOs: 1 and 2 in the sequence listing. In this specification and the drawings, for convenience, the nucleotide sequence of DNA is shown in large letters, but they are shown in lowercase letters in the corresponding sequence numbers in the sequence listing below. Represents the same DNA as the nucleotide sequence shown.

In the examples of the present specification, recombinant NS5Bt having R d RP activity is produced using NS5B of HCV—JK1 cDNA as a starting material. However, as long as it is suitable for the purpose of the present invention, it is optional. Using NS5B encoding RdRP derived from HCV, an active recombinant NS5Bt protein can be produced in the same manner as described herein. That is, if the amino acid sequence of the desired HCV-derived NS5B is known, the anchor region is identified from the sequence.If not, the sequence is determined as usual, and then the sequence is determined. The anchor region can be specified based on the sequence. The number of amino acids to be deleted is appropriately selected depending on the HCV protein from which NS5B is derived. The DNA encoding NS5Bt (ie, the first polypeptide) for which the amino ^ BS sequence has been determined is then obtained by synthetic or appropriate means, and the fusion protein with the appropriate second polypeptide is obtained. An expression vector encoding is constructed, a host cell is transformed, and the transformant is cultured to recover an active product. Such methods are within the ordinary skill in the art.

Here, as the second polypeptide, the DNA encoding it and the desired N

When a suitable host cell is transformed with DNA encoding S5Bt, it is expressed as a fusion protein having RdRP activity and is not particularly affected unless it has any adverse effect on the power of dRP activity. Not limited. However, the second polypeptide preferably has properties that are advantageous for purification and recovery of the fusion protein, and furthermore, if it is possible to separate NS5Bt from the fusion protein. More preferred.

Examples of such polypeptides include daltathione S-transferase (GST), and GST is used because of the availability of an expression vector having a multicloning site and the possibility of affinity purification. Preferred,. Therefore, in one embodiment of the present invention, the soluble polypeptide derived from the human hepatitis C virus Rd RP is an amino acid sequence represented by SEQ ID NOS: 1 and 2 in the sequence listing. Has a sequence from 1 to 570, or an amino acid sequence in which amino acid is deleted, substituted or added in the sequence, and has strong polymerase activity Things.

Those skilled in the art can determine the position at which an amino acid deletion, substitution, or addition should be introduced, the type and number of amino acids, and the like, based on the sequence disclosed herein and the method for measuring polymerase activity.

The recombinant R d RP of the present invention is novel and useful for the prevention and treatment of hepatitis C. Accordingly, the present invention provides a DNA encoding the recombinant RdRP, an expression vector containing the DNA, and a transformant transformed with the expression vector.

Hereinafter, the present invention will be described in detail by taking NS5B and GST derived from HCV-JK1 cDNA as examples.

In the present specification, the NS5B protein derived from HCV-JKlc DNA and the NS5Bt protein derived therefrom are simply referred to as NS5B and NS5Bt. The fusion protein of NS5Bt and glutathione S transferase (hereinafter referred to as GST) is called GST-NS5Bt, and the recombinant NS5Bt produced by the method of the present invention is called GST-NS5Bt. The protein is called rNS5Bt or NS5Bt. Furthermore, for the purpose of the present invention, the term “expression vector” and the term “expression plasmid J” are used interchangeably.

As described above, the HCV-JK1 cDNA encodes 3010 polyprotein precursors and encodes a length of 011¾?] ^ 358 is composed of the most C-terminal 591 amino acid (Fig. 1 ). According to corner晰the present inventors by HCV genomic cDNA, SEQ ID NO: 1 and a region very rich in hydrophobic C-terminal portion of the NS 5 B consisting of two 591 amino acids (aa570-586 (the entire sequence of the 2 ⁹⁸⁹ (Corresponding to -3005)), and the vicinity of the C-terminal 21 amino acids (No. 571-591 (2990-3010) in SEQ ID NOS: 1 and 2) is considered to be the anchor region. Attached part). The present inventors have expressed a fusion protein of this amino acid-deficient mutant (NS5Bt) with GST and GST in a host cell by gene recombination, and extremely efficiently. It was possible to obtain a fused or unfused soluble NS5Bt protein having RdRP activity.

NS 5B consisting of 591 amino acids and a certain number of amino acids deleted from the C-terminal side The obtained DNA encoding NS5Bt can be synthesized or obtained from known HCV-JK1c DNA by restriction enzyme digestion or PCR. The number of amino acids to be deleted from NS5B described in SEQ ID NOS: 1 and 2 is the number of amino acids from the amino acid at position 591 at the C-terminal to the amino acid at position 571. Preferred are polypeptides. An example of such a polypeptide is a polypeptide with 21 amino acids deleted.

In addition, the object of the present invention is not only the C-terminal-deleted polypeptide derived from SEQ ID NOS: 1 and 2 (NS5Bt), but also a polypeptide having the desired RdRP activity. Mutants having R d RP activity in the amino acid sequence are also useful. Such a mutant can be induced, for example, by introducing a deletion, substitution, and Z or insertion of an amino acid into a polypeptide consisting of the amino acid sequence of amino acids 1 to 570 by a method known to those skilled in the art. . Deletions and additions include deletions and Zs or additions of amino acids at the N and Z or c termini. Screening of the obtained mutant can be performed by a known method or by the method described in Reference Example 2 described later.

The DNA encoding NS5Bt obtained by any method and the DNA encoding the second polypeptide, GST, are ligated with an appropriate expression vector to construct an expression vector for the fusion protein. Such an expression vector is prepared by ligating the DNA of NS5Bt and DNA of GST in advance, and then inserting the DNA into an appropriate expression vector, or as a fusion protein, as described in Examples below. GST and DNA encoding NS5Bt A suitable GST expression vector [eg, pG ENK1 (Murakami, S. et al., 1994, J. Biol. Chem. 269: 15118- Et al., 1997, Virology 231: 119-129] by inserting the DNA of NS5Bt. The plasmid pGENKS described below is a protein kinase It encodes the consensus kinase kinase site of ZeA, the thrombin cleavage site and additional multiple cloning sites (EcoRI, Sad, Kpnl, Xmal, Sail and BamHI). GST is upstream of the multi-cloning site (MCS) of the GEN KS vector. Since the DNA to be inserted is inserted, it is suitable for the purpose of the present invention. However, the present invention can be practiced with any other expression plasmid. Next, a suitable host cell (eg, Escherichia coli) is transformed with the obtained expression vector and cultured in a suitable medium to produce a target fusion protein. To purify the obtained fusion protein, the cell-free extract was adsorbed to a Glutathion Sepharose 4B column (manufactured by Pharmacia), and phosphate buffered saline (PBS) containing 1% Triton X-100, followed by DTT After washing with Tris-hydrochloric acid buffer, daltathione was eluted with tf ^ buffer, and a large amount of high-purity GST-NS5Bt could be obtained. NS 5 B t protein of the type can be separated.

Hereinafter, the present invention will be described in detail with reference to Examples, but these do not limit the present invention. Plasmids, various restriction enzymes, T4DN ligase, and other enzymes used in the following examples were obtained from commercial products and used according to the supplier's instructions. In addition, DNA cloning, construction of each plasmid, transformation of a host, culture of the transformant, and recovery of the enzyme from the culture were carried out according to methods known to those skilled in the art or described in the literature.

Reference example 1 Western blotting

(1) Preparation of antiserum to NS B

Anti-hematosis was induced in the egret by subcutaneous injection of 200 # g of purified bacterial hexahistidine-labeled NS5Bt in egret in complete Freund's adjuvant (Sigma Chemicals Co. Ltd.) . The IgG fraction of the antiserum was purified using a Protein A Sepharose column according to the instructions of the supplier (Pharmacia LB Co. Ltd.). Both antiserum and purified IgG fraction were used for Western blotting.

(2) Western plotting

Sample (prepared from E. coli or mammalian cell extract (lysate))

Suspend in S sample buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 5% 2-mercaptoethanol), heat for 5 minutes, and fractionate with 10% SDS-PAGE. , Developing solution (192 mM glycine, 25 m Tris and 20% methanol) Electrotransfer to a nitrocellular membrane (Schleicher and Schuel 1 Co. Ltd.) inside. The various expressed recombinant NS5B proteins are then detected by Western blotting using anti-NS5B as usual. The Nord follows the instructions of the supplier (Amershamifc)! / \ ECL (trade name: ECL Western Blotting Detection Reagent Set, catalog code RPN2106P, Amersham) was used for observation. Reference Example 2 Measurement of polymerase activity

NS5B, GST—NS5Bt and rNS5Bt, and the RNA-dependent RNA polymerase activity of samples containing the same were measured in principle by the following method. At the same time, other polymerase activities (reverse transcriptase activity, DNA-dependent RNA polymerase activity, DNA-dependent DNA polymerase activity) and terminal transfectase (TT) activity were also measured.

The activity is described in the literature (Behrens, S. E. et al., EBO J. 15: 12-22, 1996; De

Francesco, R. R., Methods Enzymol. 275: 58-67, 1996; Lama, J. et al., J.

Biol. Chem. 270: 14430-14438, 1995) and evaluated based on incorporation of [a- ³² P] UMP or [α- ³² P] dTMP.

The standard reaction (10 / zl) is 20 mM Tris-HCl (pH 7.5), 5 nM MgCl ₂ , ImM DTT, lmM EDTA, 20 U Rase inhibitor (Wako 2 ^ Ci [a- ³² P] UT P (800 Ci / nmol, Amersham Co. Ltd.), 10 μM UTP, 10 / xg / ml in a buffer containing poly (A) and oligo (U) 14. Purified NS 5 B t , And incubated for 2 hours at 25, then filter the sample with DE 81 filter (Whatman

Co. Ltd.) and stopped the reaction. The filter was thoroughly washed with _{_{0.5 Na 2 HP0 4 (pH7.0)}} , rinsed with 70% ^ ethanol, dried in air, the radioactivity bound to the final filter one was measured with a liquid scintillation counter one .

2) For measurement of RdRP activity, both oligo (U) 14 and oligo (dT) were used as primers. For the measurement of RT activity, poly (A), oligo (dT) and [a- ³² P] dTT

P was used as template, primer and substrate, respectively. The measurement of RN A polymerase activity, poly (dA), oligo ( U), and, using the [ct- ³² P] UTP. To examine the effect of polymerase from E. coli, use rifampicin (Rifampicin) and actinomycin D (Sigma) were dissolved in ethanol and added to the reaction system.

3) RNA-dependent RNA polymerase (RdRP)

The Rd RP activity was determined by measuring the total reaction volume of 40 μl [20 DAI Tris-HCl (pH 7.5), 5πΜ MgCl _2> lmM DTT, lm EDTA, 20U RNase inhibitor (Wako Fiber), 50 # g / ral actinomycin D (Sigma Co. Ltd.), 5 / zCi [a- ³² P] UT P and 0.5 n each of the remaining NT class (ie, ATP, CTP and GTP), and l O g / ral RNA This was performed using the template and. The concentration of restriction nucleotides was adjusted to {ΙμΜ}. After addition of the purified NS5Bt sample, the reaction mixture was incubated at 30 for 2 hours. After incubation, an equal volume of 2X proteinase K buffer (300 mM

The reaction was stopped by adding NaCl, 100 mM Tris-HCl (pH 7.5), 1% SDS) and digesting with 50 zg proteinase K (Boehringer Mannheim Co. Ltd. :) for 30 minutes. RNA products were extracted with phenol-cloth form (1: 1), subjected to ethanol precipitation, and analyzed with 8 M urea- 8% PAGE. After electrophoresis, the gel is dried, exposed to an imaging plate, and the BAS 1000 Bioimage Analyzer

(Fuji Co. Ltd).

Example 1 Production of recombinant GST—NS5Bt and NS5Bt

1. Construction of Plasmid _P GENKS

The GST fusion protein expression plasmid pGENKS was constructed using pGENKl (Murakami, S. et al., 1994, J. Biol. Chem. 269: 15118-15123; Yi, Μ · —Κ. Et al., 1997,

Virology 231: 119-129) was digested with EcoRI and BamHI to prepare pGENKl EcoRI / BamHI beta, and synthetic oligonucleotides encoding the following multicloning sites were inserted.

S SFor (SEQ ID NO: 4) GAATTCGAGC TCCGGTACCC CCGGGGTCGA CGGATCC

S SRev (SEQ ID NO: 5) GGATCOGTOG ACCCCGGGGG TACCGGAGCT CGAATTC

The above synthetic oligonucleotide was annealed with 65 in the presence of NaC1, digested with EcoR I-BamHI, extracted with phenol monoclonal form, ethanoled, and dissolved in Tris EDTA (hereinafter TE). Ligation Ligation was conducted at ligation high (Toyobo) according to the supplier's instructions. Thereafter, Escherichia coli strain XLl-Blue was transformed by an ordinary method to prepare plasmid pGENKS.

Blasmid p GENKS encodes a consensus sequence for protein kinase A, a thrombin cleavage ^^ site, and multiple cloning sites (EcoR I, Sac I, Kpn I, Xma I, Sall, BamHI). There is a DNA sequence encoding GST. Figure 2 shows a restriction map of this plasmid pGENKS, and Figure 3 shows a schematic diagram of its construction. In Figure 3, thrombin of the GST-NS5Bt fusion protein

13

Are cut off underlined.

2. Transformation of E. coli

Transformation of Escherichia coli is performed by a usual molecular biological method. Add the plasmid DNA or ligation reaction mixture to 60 / il of competent E. coli, incubate on ice for 30 minutes, then incubate at 42 for about 1 minute, then on ice for 2 minutes, add SOC solution, After incubating at 37¾ for 45 minutes, plate on an LB plate containing 100 gZml ampicillin for approximately 12 to 20 hours. Culture in C to obtain a transformant.

3. Construction of GST-NS 5 Bt expression vector pGENKS / NS 5 Bt

(1) Preparation of NS 5B DNA

The NS5B-containing HCV JK1 subgenomic cDNA (Honda, M. et al., 1 " ³ , Arch Virol. 128: 163-169) was converted to a protein synthesis initiation codon, artificial Sac I and Sal I restriction sites. Subcloning was performed by PCR using the following set of primers having

GGGAGCTCCA TGT0GATGTCT TACACGTGGAC A (NS5B For) (S3 column number ^ 6)

GGGTCGACCC GGTTGGGGAGC AGGTAGATGCC (NS5B Rev) (SEQ ID NO: 7)

Using these two primers and Taq polymerase (TaKaRa Ex Taq; manufactured by Takara Shuzo Co., Ltd.), PCR was performed according to the following procedure according to the supplier's instructions. That is, a series of processing consisting of (94¾, 1 minute; 58, 1 minute; 72¾, 2 minutes) was performed for 30 cycles. By this operation, about 1.7 kb of NS5B cDNA was amplified by PCR. Then, this PCR product was subjected to low-melting point agarose gel electrophoresis, a DNA band was cut out, and recovered using ordinary phenol, black form, and ethanol precipitation. The recovered cDNA was treated with Sac I and Sal I restriction enzymes (Takara Shuzo), treated with phenol, black mouth form, precipitated with ethanol, purified, and used for the next step.

(2) Construction of pGENKS / NS5B

A plasmid expressing the full length NS5B was first constructed. pGENKS is treated with Sacl and SalI restriction enzymes to create pGENKS SacI / SalI vector, and the NS5BcDNASacIZSalI fragment obtained in (1) is ligated as a T4 DNA ligase kit. Using 'Hi (Toyobo), a ligation reaction was performed according to the supplier's instructions, and the cells were transformed into Escherichia coli to obtain pGENKSZNS 5B.

(3) Construction of pGENKSZNS5Bt

NS5Bt in which the C-terminal 21 amino acids have been deleted awakens the pG ENKS NS5B obtained in (2) above, with NS5BFor and the next primer (NS5BtRev):

GGGTCGACGC GGGGTCGGGCA OGAGACAGGCT (NS5BtRev) (SEQ ID NO: 8)

Was used to carry out a PCR reaction in the same manner as described above to produce NS5Bt cDNA, and to obtain pGENKS / NS5Bt in the same manner.

(3) Expression of GST-NS5Bt by Escherichia coli transformant and its purification

The Escherichia coli strain was transformed by the method described in 2 above, cultured by the following method, and the expression product was purified.

Samples were taken at various stages of the purification, separated by SDS-10% PAGE, and the protein concentration was determined. At the same time, analysis was performed by Western blotting (using anti-NS5B and T ^ GST antibodies) described in Reference Example 1. In addition, the protein concentration was measured by the Bradford method (Bradford method) or the Coomassie staining method (CBB) using standard serum albumin (BSA) as a standard. Furthermore, the polymerase activity of the sample at various purification steps was examined based on UMP incorporation, as described in Reference Example 2 and (7) below. These results are shown in Figure ⁴ and Table 1. ing.

1) Preparation of protein-producing bacteria

Escherichia coli strain obtained by transformation with pGENKS / NS 5Bt plasmid

One colony of (BL21pLysS) was suspended in 1 Oml of LB medium containing 100 ig / ml ampicillin, and precultured at 30 overnight. Contains 100 / zg / ml ampicillin

And in LB medium 1 1, OD _B at 30¾. The culture was cultured until ₀ became 0.6 to 0.7, and 0.4 raM isopropyl-13-D-thiogalactovyranoside (IPTG) was added to these cultures and induced overnight.

This culture 11 was centrifuged, E. coli was harvested, and washed once with a phosphorous-digested diet: fek (PBS). Then, the pellet was mixed with InM dithiothreitol (DTT) and

The cells were suspended in 32ral PBS containing 1% Triton X-100 (hereinafter referred to as “Noffer A”).

2) Ultrasonic treatment

The suspension was sonicated on ice until viscous and centrifuged at 2,000 _g for 20 minutes. The supernatant 1 (S1) and the pellet were separated, and the supernatant (S1) was left on ice. The pellet was suspended in 32 ml of buffer A containing 1.0 M NaCl, the suspension was similarly sonicated, and the centrifuged supernatant was collected (S 2), mixed with the above SI, and mixed with buffer A. The concentration of NaCl was adjusted to 0.33M with, and supernatant 3 (S3) was obtained.

3) Purification by DEAE Sephacel

S3 was passed through a DEAE Sephacel column equilibrated with buffer 1A to obtain a fraction after passage.

4) Glutathione Sepharose 4B column purification

The fraction obtained in 3) above was mixed with 1 ml of glutathione Sepharose 4B beads (Pharmacia Biotech Co. Ltd.) equilibrated in buffer A, and the protein was incubated at 4¾ for 1 hour. The beads were absorbed. The beads were then buffer A, then ImM DTT containing 5 OmM Tris-HCl (pH

8,0) and eluted with 4 ml of elution buffer [50m Tris-HCl (pH 8.0), 10πΜglutathione, 10πΜDTT and 0.1% Triton X-100], then 50 OmM NaC Elution was performed with 4 ml of the elution buffer containing 1 (FIG. 4A, lane 4). 5) Purification using heparin Sepharose column

Next, the NaCl concentration of the eluate was adjusted to 15 OmM, and then applied to a heparin sepharose column (Pharmacia Biotech Co. Ltd,) equilibrated with an elution buffer containing 15 OmM NaCl. After washing with LG buffer containing 15 OmM NaCl, the column was washed with 0 buffer with NaCl concentration of 10001 \ 1 ~ 11 ^ [20raM

It was eluted with Tris-HCl (pH 7.5), lmM EDTA, 5 mM DTT, 20% glycerol, 0.5% Triton X-100] and separated into the respective fractions.

The eluate was analyzed by 10% SDS-PAGE. As a result, the eluate was eluted in a wide range of NaCl concentration of GST-NS5B3500 mM to 90 On.

6) Purification using poly (U) Sepharose column

The fractions obtained in 5) above were collected, and the NaC1 concentration was adjusted to 150 mM with an LG buffer. Next, this solution was applied to a poly (U) Sepharose column (Pharmacia Biotech Co. Ltd.) equilibrated with an LG buffer containing 150 nM NaCl.

After washing with an LG buffer containing 15 OmM NaCl, the column was eluted with an LG buffer containing 200 mM to 1 M NaCl. 10% SD as in 5)

As a result of analysis by S-PAGE, GST-NS5Bt was eluted in the range of 1 ^ & 〇1 concentration 500111 \ 1 to 70 OmM. This fraction was collected and dialyzed against an LG buffer containing 150 mM NaCl (FIG. 4A, lane 5).

(5) Purification of non-fused rNS 5Bt

GST bound to daltathione resin prepared in (4), 4) above

NS5Bt was treated with thrombin and cut with an artificial consensus sequence at the GST binding site (Figure 3 underlined). That is, daltathione beads (Daltathione Sepharose 4B beads) to which GST-NS5Bt was bound were converted into thrombin cleavage buffer ((50 mM Tris-HCl (pH 7.5), 150 nAf NaCl, 2.5 mM CaCl ₂ , 1% After washing thoroughly with Triton X-100), then thrombin (50 U) (Pharmacia)

Biotech Co. Ltd.) containing thrombin cleavage buffer was treated overnight at 4 with GST carrier to allow fusion of GST with NS5Bt protein. Centrifuge the beads and remove the supernatant containing NS5Bt protein for 15 minutes. The sample was dialyzed against LG buffer containing OmM NaCl, and the obtained sample was analyzed by measuring protein concentration and Western blotting (FIG. 4A, lane 6). In addition, polymerase activity was also measured.

(6) Effect of purification

FIG. 4 shows changes in the degree of purification in each purification step, and Table 1 shows changes in the polymerase activity. In FIG. 4, A is a simulated view of the result of separating the sample by SDS-10% PAGE and staining with Coomassie staining method (CBB). Lane 1 is whole cell extract

(lysate); Lane 2 is the centrifuged supernatant of the sonicated product; Lane 3 is the cell-free extract after passing through DEAE Sephacel; Lane 4 is the eluate from the G / letathion Sepharose 4 B column; 5 is an eluate from a poly (U) Sepharose column; lane 6 represents non-fused rNS5Bt after thrombin treatment. B is a mimetic diagram of the results obtained by subjecting the samples from these six purification stages to Western blotting using an anti-NS5B antibody, and C being subjected to Western blotting using an anti-GST antibody.

As shown in FIG. 4A, lane 5, a 95 kDa recombinant GST-NS5Bt protein was obtained in 90% or more.

Analysis of this 95 kDa band by Western blotting revealed that it was specifically recognized by both egrets, anti-NS5Bt IgG and GST IgG.

(Fig. 4, lane 5 in B and C. Then, purified GST-NS5Bt protein corresponding to the 95 kDa band was used in serum of a HCV type 1b-infected chronic hepatitis patient and healthy human serum. Analysis by Western blotting In Fig. 5, lane 1 shows purified GST-NS5Bt only, and lane 2 shows only control GST protein GST-NS5Bt of about 95 kDa shows HCV1b-infected chronic hepatitis It was specifically recognized by the patient's serum (arrow) Based on the results shown in Fig. ⁴ and Fig. 5, it was concluded that the purified GST-NS5Bt was a protein derived from the HCV virus. This result also proves that the obtained protein power ^{s is} recombinant GST-NS5Bt.

Lane 6 of Figure 4A shows the approximately 63 kDa protein of the non-bound fraction of the thrombin digest. A double band is observed at the position corresponding to the protein. This band is specifically recognized and recognized by anti-NS5BtIgG in Western blotting, but is not recognized by anti-GST IgG, indicating that it is a non-fused rNS5Bt protein. Was confirmed (Figs. 4B and C).

In addition, Table 1 shows that UMP uptake of purified GST-NS5Bt was detected, indicating that the relative activity was at least 10,000-fold or more. The non-fused NS5Bt truncated tombin was slightly lower than the fusion protein, but showed UMP uptake activity. The final purified fusion protein (GST-NS5Bt) and non-fusion protein (NS5Bt) were dialyzed extensively against LG-buffer containing 150 mM NaC1. Saved in.

(7) Detection of polymerase activity

The polymerase activity of the purified GST-NS5Bt having a purity of 90% or more purified in the above (6) was analyzed according to the method described in Reference Example 2. That is, as a substrate - an [α ³² P] UMP or [tx- ³² P] dTMP incorporation was determined using purified GST- NS 5B t (90 ng) . Figure 6 shows the results. In the figure, A indicates the substrate specificity when poly (A) or poly (dA) was used as a template and oligo (U) 14 or oligo (dT) was used as a primer. B is the time course of the reaction at 25 and 37. C shows the relationship between the amount of GST-NS5Bt and UMP uptake.

Figure 6. Force, et al. Clearly, UMP uptake increases in a dose dependent manner.

Poly (A) -dependent UMP incorporation in Atsushi was much higher with oligo (U) primers than with oligo (dT) primers (about 2 times). 6 A). In addition, purified GST-NS5Bt did not show any reverse transcriptase activity, DNA-dependent RNA polymerase or DNA polymerase activity under the conditions tested. (Fig. 6A>).

Incorporation was at least 25 hours for at least ⁴ hours. However, at 37 ° C, the speed was low and became constant after 2 hours (Fig. 6B). Table 1 Purification of HCV RNA polymerase

*: Incorporation of [α- ³² P] UMP into the reaction

**: pmole / μg / B

***: Uptake of whole cell extract is used as standard.

We also investigated the effects of various factors on polymerase activity. The results are shown in FIGS. 7 and 8 and Tables 2 and 3.

As shown in Table 2, it can be seen that UMP uptake is not observed in the case of GST insects. Furthermore, even without a primer or template, no UMP incorporation was detected, indicating that the NS5Bt protein does not have terminator retransferase activity (Table 2). This is a property different from the activity of NS5B expressed in insect cells.

In the presence of 20 / zg / ml rifampicin or 50 / g / ral actinomycin D, NS5Bt is not harmful and its concentration is increased to 200 μg ml and 500 μg / ml, respectively. It was not inhibited by addition (Table 2).

Table 2 Summary of Rd RP activity in GST-NS 5 Bt

*: Controls contain equal amounts of ethanol.

Rd RP activity based on UMP incorporation of purified GST-NS5Bt under various conditions was examined. The reaction used GST-NS5Bt (30-45 ng). The optimal pH was determined by incubation in sodium phosphate buffer at 25 ° C for 2 hours. The results are shown in FIGS.

In Fig. 7, A is pH, B is temperature, C is KC1 concentration, and in Fig. 8, D is Mg2 ⁺ ion, E is Zn2 ⁺ concentration (0, 10, 25 and 50 μΜ). This figure shows the UMP uptake in the case of a dagger. The results are as follows.

1) The optimal ρΗ for UMP uptake is wide and near neutral (Fig. 7Α).

2) UMP uptake is most effective at 30 (Figure 7B).

3) UMP uptake is inhibited by KC1 concentrations above 100 mM KC1 and is strictly dependent on Mg2 ⁺ ions, with optimal concentrations of Mg2 ⁺ ranging from 2.5 to 5πΜ (Figure 8D). ).

4) Other divalent ions such as ^{Zn 2+} have no effect on UMP uptake 図 ^ property (Fig. Also, the effect of surfactant was examined. As a result, ionic surfactant (0.01% Sarkosyl or SDS) Although the activity was completely inhibited, it was found that up to 0.1% of non-ionic surfactants (eg, Triton X-100, Nonidet P-40, Tween 20, and CHAPS) had little effect ( Table 3). Table 3 Effect of surfactant on activity

*: The activity ( ²⁵ 755c _Pra >) in the standard reaction (without surfactant) is set to 100%.

: Final concentration (vZv)

***: CHAPS concentrations are 0.1 lmM and lmM_¾t 10 mM, respectively.

(8) RNA synthesis assay using HCV RNA as template and primer In the UMP uptake test described in (7) above, a synthetic template and primer were used, but GST-NS5Bt used HCV RNA as a template and primer. We examined whether it was possible or not. The reaction was carried out at 30 ° C. for 2 hours using the same solution as the above RNA polymerase assay.

The 3, UTR of HCV, which should function as a replication initiation site, was divided into three regions, as shown in Figure 9A. 5B Bg is the region from the Bglll site of NS 5B to 3, UTR; poly (U) is a poly (U) stretch; and 3, X is a highly conserved sequence at the 3, terminus of HCV genomic RNA. Yes, contains 3 'X which has been suggested to play an important role in viral replication

(Kolykhalov, A. A. et al., J Virol. 70: 3363-3371, 1996: Tanaka, T. et al., J Virol. 70: 3307-3312, 1996). These various HCV subgenomic RNAs were synthesized by in vitro transcription and used for RNA synthesis (see FIG. 9A).

1) Creating a template

Various plasmids for preparing RNA templates

(pGEM3zf (+) / NS5BBg, pGEM3zf (+) / pol (U) and pGEM3zf (+) / 3'X) were constructed and RNA templates were prepared by in vitro transcription. These plasmids are It was constructed by PCR using the following synthetic oligonucleotide primers.

pGEM3zf (+) / NS5BBg is the primer:

GCGGATCCAG ATCTACGGGGC CACTTA (5BBgFor) (sequence number)

GCGAATTCAA GACAAAGGGAA TGGCCTAT (5BBgRev) (SEQ ID NO: 10)

(These have synthetic BamHI and EcoRI sites, respectively) and contain the HCV JK-1 cDNA between the EcoRI and BamHI sites.

It was constructed with PCR using pGEM3zf (+) / HCV JK-1 as a template.

pGEM3zf (+) / poly (U) is an oligonucleotide:

GCGAATTCGA AGACTTGCCTT TTTTTTTGTT ΤΤΤΤΤΤΤΤΤΠ CTTTTTTTTTT TTTCTTTTTT TTCCTTTTTTT TTTTTTCT (polyUFor) (SEQ ID NO: 11)

GCGGATCCGA AGACGCCACCA AAGAAGGAAAA GGGAAAAAAAA AAAACAAAGAA GAAAAAAAAA AAAAGGAAAAA AAAGA (polyURev) (SEQ ID NO: 12)

(Each of which has synthetic EcoR I, BamH I and BbsI sites) and subjected to PCR cloning to obtain a fragment containing the HCV pol va U) stretch, and this DNA fragment was pGEM3zf (+) (Promega Co. Ltd.) was constructed by inserting into EcoRI and BamHI vectors.

pGEM3zf (+) / 3'X is a set of oligonucleotides:

GCGAATTCGA AGACTTGGTGG CTCCATCTTAG CCCTAGTCACG GCTAGCTGTGA AAGGTCCGTG AGCCGCATGAC TGCAG (3 'X For) (SEQ ID NO: 13)

GCGGATCCCT TAAGACA GAT CTGCAGAGAGG CCAGTATCAGC ACTCTCTGCAG

TCATGCGGCT CAC (3, X Rev) (SEQ ID NO: 14)

. (These are respectively the synthesis of EcoR I, Bbs l _lambda to Aflll and BamH I) were subjected to PCR Kuroyungu anneal to, 3, X (Kolykhalov, A. et al., 1996, J Virol 70: 3363 - 3371; Tanaka, T. et al., 1996, J Virol. 70: 3307-3312), and obtained a DNA fragment having EcoR I and BamHI sites by pGEM3zf (+) (Promega Co. Ltd.) EcoR I and It was constructed by inserting into the BamHI vector.

All constructs were prepared using Taq sequencing kits and DNA sequencer (374A, Applied Biosystems Co. Ltd.) confirmed the sequence.

2) Creating a template

The above plasmids pGEM3zf (+) / 5BBg, pGEM3zf (+) / poly (U), and

pGEM3zf (+) / 3'X was digested with BamHI or EcoRI and linearized. On the other hand, pNKF LAG constructed by the method described in Test Example 1 described below was digested with Bglll and used to prepare control RNA.

In vitro transcription using these templates was performed using T7 RNA polymerase or SP6 RNA polymerase (Promega Co. Ltd.) according to the supplier's instructions.

After incubation, the DNA template was digested with RNase-free DNase. The RNA product was extracted with phenol-monochrome form (1: 1), passed through an S-marked hadex G-50 column (Pharmacia Biotech Co., Ltd.) to remove free nucleotides, and then subjected to ethanol precipitation. The RNA concentration was measured by J2 spectrophotometry, adjusted to 1 / igZj "1 with RNase-free distilled water, and stored at 1-20.

The quality of the RNA samples was confirmed by electrophoresis using MOPS denaturing gel or urea denaturing polyacrylamide gel.

According to the description in Reference Examples 2 and 3), RNA-dependent RNA polymerase (RdRP) was assayed. The RNA product was treated with proteinase K, extracted with phenol monochloroform, precipitated with ethanol, and finally separated and purified by 8% * 8% PAGE. The size of each RNA is as shown in Fig. 9A.

The results are shown in FIG. 9B. A new, radioactive-labeled RNA larger than the input RNA was detected (Fig. 9B, lanes 1, 3, and 4).

RNA synthesis by GST-NS5Bt of the present invention required all four types of liponucleotides as substrates, and no uptake was detected when UTP or CTP ^ M was used as a substrate. HCV RNA and control RNA acted as templates and primers (FIG. 9). RNA synthesis ability using 3'X of HCV3 and UTR is slightly lower than other RNAs (Fig. 9, lanes 1 and 4; Compared to 3), 11 <3 ¥ 3,1; the 0 ^ (1)) stretch of the cho 1 ^ did not act as a template or primer by itself (Fig. 9, lane 2). These results indicate that RNA is used as a template and primer, and that GST-NS5Bt has no terminal transferase activity, as indicated by UMP incorporation.

As described above (7) and (8), the recombinant GST-NS5Bt and the recombinant NS5Bt expressed by the Escherichia coli transformant of the present invention share a common RdRP. It can be seen that the protein is an active soluble protein having properties (requirements of template and primer, Mg ²⁺ dependence, and optimal reaction conditions, etc.). The GST-NS5Bt and NS5Bt of the present invention also differ from the recombinant NS5B expressed in insect cells in that they do not exhibit terminal transferase activity. . Test Example 1 Relationship between GST-NS5Bt and NS5Bt Activities and Amino ^ S3 Sequence Mutants in various amino ^ IB sequences were prepared, and the effect of the mutation on Rd RP activity was examined.

As a variant of NS5Bt, it is highly conserved among all RdRPs,

A substitution mutant in the GDD motif of HCV NS5B (NS5Bt-ml), a mutant in YRHRAR (NS5Bt-m2) and a mutant in CGYRRCR (NS5Bt-m3) were designed (Fig. 1). See).

These mutants were obtained by substituting GDD with VDD (amino acid number 317-317 in SEQ ID NOS: 1 and 2 (amino acid number 2736-2738 in HCV protein; the same applies hereinafter)), Y

RHRAR was substituted with AAAAAA (500-505 (2919-2924)), and CGYRR CR was replaced with AAAAAA (274-280 (2693-2699)).

DNAs encoding these substitution mutants were prepared by PCR mutagenesis with overlapping extensions using primers designed for mutagenesis, NS5BFor and O ^ SSBtRev (Yi, M.-K. Et al., 1997, Virology.

231: 119-129).

A substitution mutant in the terminal region of NS5B (NS5B-m4) was obtained by PCR using NS5BFor and NS5Bm4Rev having the following sequence as primers. GCGGATCCTC ACCGGTTGGGG AGCAGGTAGAT GCCTACCCCGG AGAAGGTAGGA

GTAGGCACCA CAT (NS5Bra Rev) (SEQ ID NO: 15) This NS5Bm4Rev has a synthetic BaroHI site and was used as a 3 ′ primer. In NS5B-m4, both L and V at amino acid numbers 579 and 582 have been converted to P (see Figure 1).

The activities of these mutants were measured, and the results are shown in Table 4. Table 4 Rd RP activity of GST-NS5Bt mutant

Among the GST-NS5Bt mutant proteins recovered from E. coli transformants, NS5Bt-ml did not show any Rd RP activity (see Table 4). This result suggests that GST-NS5Bt or NS5Bt protein requires a GDD motif for RNA synthesis activity. Neither NS5Bt-m2 nor NS5Bt-m3, which is a relatively salty Stt residue-rich, cluster-one substitution mutant, shows any R d RP activity, and the GST-NS obtained in Example 1 In the presence of 5Bt, it did not inhibit its R d RP activity (Table 4). From the above, it can be seen that the obtained RdRP activity is derived from GST-NS5Bt, and the GDD motif is essential for the activity.

Test Example 2 Study on localization of GST-NS 5Bt in mammalian cells

The effect of deletion of 21 amino acids at the C-terminus of NS5B on the localization of NS5B in mammalian cells was investigated in mammalian cells (hepatocellular carcinoma cell line HLE cells, HepG2 cells, non-liver cells). Transient expression system using cancer cells (COS 1 cells) was examined. To facilitate detection, an expression plasmid encoding a fusion protein of green fluorescent protein (GFP) and full-length NS5B, NS5Bt and NS5B-m4 was constructed. HLE of mammalian cells was transformed with these plasmids and a plasmid encoding GFP warrior, and the localization of the expressed protein in the cells was examined.

(1) Construction of plasmid for expression of fusion protein with GFP in mammalian cells

pSG 5UTP L (Lin, Y. et al., 1997, J. Biol. Chem. 272: 7132-7139;

Murakami, S. et al., 1994, J. Biol. Chem. 269: 15118-15123).

CDNA of green fluorescent protein (GFP) is phGF P

— Prepared by PCR using S 65T (Clontech Co. Ltd.) as a template and the following primers:

AAGATATCGC GGCCGCATGGT GAGCAAGGGCG AG (GFPNotFor) (SEQ ID NO: 16) AAGGATCCGA ATTCTTGTACA GCTCGTCCAT (GFPEcoRev) (SEQ ID NO: 17) These have synthetic EcoRV, Notl and EcoRI sites, respectively. The DNA fragment having the synthesized EcoRV and OamHI sites was treated with EcoRV and BamHI, and the EcoRI site of PSG5UTPL was blunt-ended with the Klenow fragment, and then inserted into the BamHI-digested vector to obtain pGFP. Was. Use this pGFP vector to construct another mammalian expression vector, pNKF LAG.

A sequence encoding a FLAG-tag (label) epitope sequence having a region related to translation initiation was obtained from pF LAGHis / p53 (obtained from R. Roeder) using the PCR method described below. This DNA fragment is combined with the following set of primers:

ATGCGGCCGCCACCATGGACTACAAAGACGAT (KFLAGFor) (SEQ ID NO: 18) CGGGATCCTCAGTCTGAGTCAGGCCCTTCT (p53Rev) (SEQ ID NO: 19) (These are synthetic Notl site, consensus translation open & gp position, and

(Having a BamHI site) and inserted into a pGFP Notl and BamHI vector by PCR to obtain pNKF L AGZp53.

Plasmid pNKF LAG contains EcoRI and BamHI sites as described above. And was constructed by replacing the p53 insert with a multiple cloning site.

NS5B DNA was inserted into the EcoRI and BamHI sites of these plasmids pNKFLAG and pGFP according to a conventional method, and the GFP-NS5B expression plasmid (pGFP / NS5B) or FLAG-labeled NS5B Expression plasmid

(pNKF G / NS5B) was constructed. Similarly, DNAs encoding NS5Bt and NS5B-m4 were inserted to construct respective expression plasmids.

(2) Expression in mammalian cells

About 1x10 ⁵ of ^ 11 ^ £ cells were plated on Suraidogurasu, placed microscope slide culture Ueru of Quadriperm (microscope slide culture well) ( Heraeus Co. Ltd.), the next day, GFP-NS 5B expression plasmid _(P GFP / NS5B) or FLAG-tagged NS5B expression plasmid (pKFLAG / NS5B) was transfected. After rinsing with PBS, the cells were fixed with PBS containing 1.5% / ° laformaldehyde. Then, the cells were fixed with 100% cold methanol for 5 minutes and then fixed. They were air dried at 25 and stored at 80. GF PH-conjugated protein in PBS, 0.0005% Evans

It was detected by counterstaining with Blue. Samples expressing FLAG-labeled protein were blocked with 0.5% BSA in PBS and stained overnight with anti-FLAG M2 antibody diluted (1: 330) with PBS containing 0.5% BSA.

Immunostaining is performed by counterstaining with Evans Blue using standard methods to absorb absorbed egret anti-mouse IgG, biotinylated goat anti-pea IgG, and streptavidin-FITC (Amersham). went.

The result was a BX-50 fluorescence microscope equipped with a NI BARX WI B filter.

(Olympus) and visualized by digital printing (Pictrography 3000, Fuji Co. Ltd.). Expression levels of similar GFP-fusion proteins in HLE cells were determined using anti-NS5B IgG and anti-GFP-IgG (Clontech Co.,

Using the method described in Reference Example 1 to detect immunologically by Western blotting. Similarly, the experiment also other variants NS ⁵ B.

The results are shown in FIG. In the figure, (A) is full-length NS5B, (B) is GFP—NS5 Bt, (C) is the result of GFP-NS5B-m4, (D) is the result of GFP alone. Fig. 10 shows that GFP-NS5B protein was mainly distributed around the cytoplasmic nuclear membrane and dispersed in the cytoplasm, but GFP alone diffused and localized in both the cytoplasm and nucleus. (Figure 10A). In addition, GFP-NS5Bt protein mainly accumulates in the nucleus, and its localization was significantly affected by the C-terminal and truncated regions.

(Figure 10B). In FIG. 10, the fluorescent intranuclear signal of GFP-NS5Bt is observed as a cluster of several clusters with large, spherical, lj-like shapes.

In addition, GFP-NS5B-m4, which has two substitution mutations designed to impair the function of the C-terminal anchor region of NS5B, is also localized in the nucleus and partially found in the cytoplasm. (Figure 10C). Similar results were seen with other mammalian cells, COS1 cells or HepG2 cells. The above results indicate that the 21 amino acids at the C-terminus of NS5B play an important role in the subcellular localization of NS5B protein, and the role of anchors on the membrane is important. It was considered to indicate.

Claims

The scope of the claims

1. A DNA encoding a soluble polypeptide having a polymerase activity, derived from an RNA-dependent RNA polymerase of human hepatitis C virus, and encoding a second polypeptide other than the polypeptide A host cell is transformed with the vector containing the DNA, the resulting transformant is cultured, and a fusion protein having the polymerase activity is recovered from the medium. A method for producing a recombinant RNA-dependent RNA polymerase, comprising separating and recovering a polypeptide having zealase activity.

2. The soluble polypeptide is a sequence of amino acid numbers 1 to 570 of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, in which amino acids are deleted, substituted or added. 2. The method according to claim 1, which has an amino acid sequence and has the polymerase activity.

3. The method of claim 1, wherein the second polypeptide is glutathione S-transferase.

4. A recombinant RNA-dependent RNA polymerase produced by the method of claim 1.

5. A sequence having amino acid numbers from 1 to 570 of the amino acid sequence described in SEQ ID NO: 2 in the sequence listing, a polypeptide having an amino acid sequence in which amino acid is deleted, substituted or added in the sequence, and daltathione S —Recombinant protein with transferase, which has RNA-dependent RNA polymerase activity of human hepatitis C virus.

6. A DNA encoding the protein of claim 5.

7. An expression vector containing the DNA according to claim 6.

8. A transformant transformed with the expression vector according to claim 7.