WO1999041397A1 - Anti-viral vectors - Google Patents

Anti-viral vectors Download PDF

Info

Publication number
WO1999041397A1
WO1999041397A1 PCT/GB1999/000325 GB9900325W WO9941397A1 WO 1999041397 A1 WO1999041397 A1 WO 1999041397A1 GB 9900325 W GB9900325 W GB 9900325W WO 9941397 A1 WO9941397 A1 WO 9941397A1
Authority
WO
WIPO (PCT)
Prior art keywords
viral
nucleotide sequence
vector
hiv
genome
Prior art date
Application number
PCT/GB1999/000325
Other languages
French (fr)
Inventor
Alan John Kingsman
Kyriacos Mitrophanous
Narry Kim
Original Assignee
Oxford Biomedica (Uk) Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=10827139&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1999041397(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Oxford Biomedica (Uk) Limited filed Critical Oxford Biomedica (Uk) Limited
Priority to DE69935714T priority Critical patent/DE69935714T2/en
Priority to JP2000531578A priority patent/JP2002503477A/en
Priority to EP99904956A priority patent/EP1054988B1/en
Priority to AU25274/99A priority patent/AU757284B2/en
Priority to CA002321097A priority patent/CA2321097A1/en
Publication of WO1999041397A1 publication Critical patent/WO1999041397A1/en
Priority to US09/552,950 priority patent/US6541248B1/en
Priority to US10/351,938 priority patent/US7790419B2/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to novel viral vectors capable of delivering anti-viral inhibitory RNA molecules to target cells.
  • the gene encodes protein products that inhibit the virus in a number of possible ways.
  • One example of such a protein is the RevMlO derivative of the HIV Rev protein (16).
  • the RevMlO protein acts as a transdominant negative mutant and so competitively inhibits Rev function in the virus.
  • the RevMlO protein is a derivative of a native HIV protein. While this provides the basis for the anti-HIV effect, it also has serious disadvantages. In particular, this type of strategy demands that in the absence of the virus there is little or no expression of the gene.
  • RNA molecules may be anti-sense RNA (15, 31), ribozymes (5) or competitive decoys (1).
  • Ribozymes are enzymatic RNA molecules which catalyse sequence-specific RNA processing. The design and structure of ribozymes has been described extensively in the literature in recent years (3, 7, 31). Amongst the most powerful systems are those that deliver multitarget ribozymes that cleave RNA of the target virus at multiple sites (5, 21).
  • HIV vectors In recent years a number of laboratories have developed retroviral vector systems based on HIV (2, 4, 18, 19, 22-24, 27, 32, 35, 39, 43). In the context of anti-HIV gene therapy these vectors have a number of advantages over the more conventional murine based vectors -2- such as murine leukaemia virus (MLV) vectors. Firstly, HIV vectors would target precisely those cells that are susceptible to HIV infection (22, 23). Secondly, the HIV- based vector would transduce cells such as macrophages that are normally refractory to transduction by murine vectors (19, 20). Thirdly, the anti-HIV vector genome would be propagated through the CD4+ cell population by any virus (HIV) that escaped the therapeutic strategy (7). This is because the vector genome has the packaging signal that will be recognised by the viral particle packaging system. These various attributes make HIV -vectors a powerful tool in the field of anti-HIV gene therapy.
  • MMV murine leukaemia virus
  • a combination of the multitarget ribozyme and an HIV-based vector would be attractive as a therapeutic strategy.
  • Vector particle production takes place in producer cells which express the packaging components of the particles and package the vector genome.
  • the ribozymes that are designed to destroy the viral RNA would therefore also interrupt the expression of the components of the HIV- based vector system during vector production.
  • the present invention aims to overcome this problem.
  • the system includes both a viral genome encoding the inhibitory RNA molcules and nucleotide constructs encoding the components required for packaging the viral genome in a producer cell.
  • the packaging components have substantially the same amino acid sequence as the corresponding components of the target virus
  • the inhibitory RNA molecules do not affect production of the viral particles in the producer cells because the nucleotide sequence of the packaging components used in the viral system have been modified to prevent the inhibitory RNA molecules from effecting cleavage or degradation of the RNA transcripts produced from the constructs.
  • Such a viral particle may be used to treat viral infections, in -3- particular HIV infections.
  • the present invention provides a viral vector system comprising: (i) a first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles; and
  • the present invention provides a viral vector production system comprising: (i) a viral genome comprising at least one first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles;
  • the gene product is typically an RNA inhibitory sequence selected from a ribozyme and an anti-sense ribonucleic acid, preferably a ribozyme.
  • the viral vector is a retroviral vector, more preferably a lentiviral vector, such as an HIV vector.
  • the second nucleotide sequence and the third nucleotide sequences are typically from the same viral species, more preferably from the same viral strain.
  • the viral genome is also from the same viral species, more preferably from the same viral strain.
  • the polypeptide required for the assembly of viral particles is selected from gag, pol and env proteins.
  • at least the gag and pol sequences are lentiviral sequences, more preferably HIV sequences.
  • the env sequence is a lentiviral sequence, more preferably an HIV sequence.
  • the third nucleotide sequence is resistant to cleavage directed by the gene product as a result of one or more conservative alterations in the nucleotide sequence which remove cleavage sites recognised by the at least one gene product and/or binding sites for the at least one gene product.
  • the gene product is a ribozyme
  • the third nucleotide sequence is adapted to be resistant to cleavage by the ribozyme.
  • the third nucleotide sequence is codon optimised for expression in host cells.
  • the host cells which term includes producer cells and packaging cells, are typically mammalian cells.
  • the viral genome is an HIV genome comprising nucleotide sequences encoding anti-HIV ribozymes and/or anti-HIV antisense sequences directed against HIV packaging component sequences (such as gag.pol) in a target HIV and
  • the viral system for producing packaged HIV particles further comprises nucleotide constructs encoding the same packaging components (such as gag.pol proteins) as in the target HIV wherein the sequence of the nucleotide constructs is different from that found in the target HIV so that the anti-HIV ribozyme and/or antisense HIV sequences cannot effect cleavage or degradation of the gag.pol transcripts during production of the HIV particles in producer cells.
  • the present invention also provides a viral particle comprising a viral vector according to the present invention and one or more polypeptides encoded by the third nucleotide sequences according to the present invention.
  • the present invention provides a viral particle produced using the viral vector production system of the invention. -5-
  • the present invention provides a method for producing a viral particle which method comprises introducing into a host cell (i) a viral genome vector according to the present invention; (ii) one or more third nucleotide sequences according to the present invention; and (iii) nucleotide sequences encoding the other essential viral packaging components not encoded by the one or more third nucleotide sequences.
  • the present invention further provides a viral particle produced using by the method of the invention.
  • the present invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising a viral particle according to the present invention together with a pharmaceutically acceptable carrier or diluent.
  • the viral system of the invention or viral particles of the invention may be used to treat viral infections, particularly retroviral infections such as lentiviral infections including HIV infections.
  • the present invention provides a method of treating a viral infection which method comprises administering to a human or animal patient suffering from the viral infection an effective amount of a viral system, viral particle or pharmaceutical composition of the present invention.
  • the invention relates in particular to HIV-based vectors carrying anti-HIV ribozymes.
  • the invention can be applied to any other virus, in particular any other lentivirus, for which treatment by gene therapy may be desirable.
  • the invention is illustrated herein for HIV, but this is not considered to limit the scope of the invention to HIV-based anti- HIV vectors.
  • viral vector refers to a nucleotide construct comprising a viral genome capable of being transcribed in a host cell, which genome comprises sufficient viral genetic information to allow packaging of the viral RNA genome, in the presence of packaging components, into a viral particle capable of infecting a target cell. Infection of the target -6- cell includes reverse transcription and integration into the target cell genome, where appropriate for particular viruses.
  • the viral vector in use typically carries heterologous coding sequences (nucleotides of interest) which are to be delivered by the vector to the target cell, for example a first nucleotide sequence encoding a ribozyme.
  • a viral vector is incapable of independent replication to produce infectious viral particles within the final target cell.
  • viral vector system is intended to mean a kit of parts which can be used when combined with other necessary components for viral particle production to produce viral particles in host cells.
  • the first nucleotide sequence may typically be present in a plasmid vector construct suitable for cloning the first nucleotide sequence into a viral genome vector construct.
  • a kit with a third nucleotide sequence which will also typically be present in a separate plasmid vector construct, the resulting combination of plasmid containing the first nucleotide sequence and plasmid containing the third nucleotide sequence comprises the essential elements of the invention.
  • kit may then be used by the skilled person in the production of suitable viral vector genome constructs which when transfected into a host cell together with the plasmid containing the third nucleotide sequence, and optionally nucleic acid constructs encoding other components required for viral assembly, will lead to the production of infectious viral particles.
  • the third nucleotide sequence may be stably present within a packaging cell line that is included in the kit.
  • the kit may include the other components needed to produce viral particles, such as host cells and other plasmids encoding essential viral polypeptides required for viral assembly.
  • the kit may contain (i) a plasmid containing a first nucleotide sequence encoding an anti-HIV ribozyme and (ii) a plasmid containing a third nucleotide sequence encoding a modified HIV gag.pol construct which cannot be cleaved by the anti-HIV ribozyme.
  • Optional components would then be (a) an HIV viral genome construct with suitable restriction enzyme recognition sites for cloning the first nucleotide sequence into the viral genome; (b) a plasmid encoding a VSV-G env protein.
  • nucleotide -7- sequence encoding viral polypeptides required for assembly of viral particles may be provided in the kit as packaging cell lines comprising the nucleotide sequences, for example a VSV-G expressing cell line.
  • viral vector production system refers to the viral vector system described above wherein the first nucleotide sequence has already been inserted into a suitable viral vector genome.
  • Viral vectors are typically retroviral vectors, in particular lentiviral vectors such as HIV vectors.
  • the retroviral vector of the present invention may be derived from or may be derivable from any suitable retrovirus.
  • retro viruses A large number of different retro viruses have been identified. Examples include: murine leukemia virus (MLV), human immunodeficiency virus (HIV), simian immunodeficiency virus, human T-cell leukemia virus (HTLV).
  • Mo-MLV FBR murine osteosarcoma virus
  • FBR MSV FBR murine osteosarcoma virus
  • MC29 Avian erythroblastosis virus
  • AEV Avian erythroblastosis virus
  • the lentivirus group can be split even further into “primate” and "non-primate”.
  • primate lentiviruses include human immunodeficiency virus (HIV), the causative agent of human auto-immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (SIV).
  • the non-primate lentiviral group includes the prototype "slow virus” visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV). -8-
  • the basic structure of a retrovirus genome is a 5' LTR and a 3' LTR, between or within which are located a packaging signal to enable the genome to be packaged, a primer binding site, integration sites to enable integration into a host cell genome and gag, pol and env genes encoding the packaging components - these are polypeptides required for the assembly of viral particles.
  • More complex retroviruses have additional features, such as rev and RRE sequences in HIV, which enable the efficient export of RNA transcripts of the integrated provirus from the nucleus to the cytoplasm of an infected target cell.
  • LTRs long terminal repeats
  • the LTRs are responsible for pro viral integration, and transcription. LTRs also serve as enhancer-promoter sequences and can control the expression of the viral genes. Encapsidation of the retroviral RNAs occurs by virtue of apsi sequence located at the 5' end of the viral genome.
  • the LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5.
  • U3 is derived from the sequence unique to the 3' end of the RNA.
  • R is derived from a sequence repeated at both ends of the RNA and
  • U5 is derived from the sequence unique to the 5' end of the RNA.
  • the sizes of the three elements can vary considerably among different retroviruses.
  • pol and env may be absent or not functional.
  • the R regions at both ends of the RNA are repeated sequences.
  • U5 and U3 represent unique sequences at the 5' and 3' ends of the RNA genome respectively.
  • At least part of one or more of the gag, pol and env protein coding regions essential for replication may be removed from the virus.
  • the removed portions may even be replaced by a nucleotide sequence of interest (NOI), such as a first nucleotide sequence of the invention, to generate a virus capable of integrating its genome into a host genome but wherein the modified viral genome is unable to propagate itself due to a lack of structural proteins.
  • NOI nucleotide sequence of interest
  • the transfer of an NOI into a site of interest is typically achieved by: integrating the NOI into the recombinant viral vector; packaging the modified viral vector into a virion coat; and allowing transduction of a site of interest - such as a targeted cell or a targeted cell population.
  • a minimal retroviral genome for use in the present invention will therefore comprise (5') R - U5 - one or more first nucleotide sequences - U3-R (3').
  • the plasmid vector used to produce the retroviral genome within a host cell/packaging cell will also include transcriptional regulatory control sequences operably linked to the retroviral genome to direct transcription of the genome in a host cell/packaging cell.
  • These regulatory sequences may be the natural sequences associated with the transcribed retroviral sequence, i.e. the 5' U3 region, or they may be a heterologous promoter such as another viral promoter, for example the CMV promoter.
  • rev and RRE sequence are preferably included. However the requirement for rev and RRE can be reduced or eliminated by codon optimisation.
  • the promoter is located in the 5' LTR U3 region of the provirus.
  • the promoter driving expression of a therapeutic gene may be the native retroviral promoter in the 5' U3 region, or an alternative promoter engineered into the vector.
  • the alternative promoter may physically replace the 5' U3 promoter native to the retrovirus, or it may be incorporated at a different place within the vector genome such as between the LTRs.
  • the first nucleotide sequence will also be operably linked to a transcriptional regulatory control sequence to allow transcription of the first nucleotide sequence to occur in the target cell.
  • the control sequence will typically be active in mammalian cells.
  • the control sequence may, for example, be a viral promoter such as the natural viral promoter or a CMV promoter or it may be a mammalian promoter. It is particularly preferred to use a promoter that is preferentially active in a particular cell type or tissue type in which the JO- virus to be treated primarily infects.
  • a tissue-specific regulatory sequences may be used.
  • the regulatory control sequences driving expression of the one or more first nucleotide sequences may be constitutive or regulated promoters.
  • Replication-defective retroviral vectors are typically propagated, for example to prepare suitable titres of the retroviral vector for subsequent transduction, by using a combination of a packaging or helper cell line and the recombinant vector. That is to say, that the three packaging proteins can be provided in trans.
  • a "packaging cell line” contains one or more of the retroviral gag, pol and env genes.
  • the packaging cell line produces the proteins required for packaging retroviral DNA but it cannot bring about encapsidation due to the lack of a psi region.
  • the helper proteins can package the j ⁇ yz-positive recombinant vector to produce the recombinant virus stock. This virus stock can be used to transduce cells to introduce the NOI into the genome of the target cells.
  • psi plus a psi packaging signal that contains additional sequences spanning from upstream of the splice donor to downstream of the gag start codon (Bender et al. (46)) since this has been shown to increase viral titres.
  • the recombinant virus whose genome lacks all genes required to make viral proteins can tranduce only once and cannot propagate.
  • These viral vectors which are only capable of a single round of transduction of target cells are known as replication defective vectors.
  • the NOI is introduced into the host/target cell genome without the generation of potentially harmful retrovirus.
  • Retroviral packaging cell lines in which the gag, pol and env viral coding regions are carried on separate expression plasmids that are independently transfected into a packaging cell line are preferably used.
  • This strategy sometimes referred to as the three plasmid transfection method (Soneoka et al. (33)), reduces the potential for production of a replication-competent virus since three recombinant events are required for wild type viral -11- production.
  • As recombination is greatly facilitated by homology, reducing or eliminating homology between the genomes of the vector and the helper can also be used to reduce the problem of replication-competent helper virus production.
  • transiently transfected packaging cell lines An alternative to stably transfected packaging cell lines is to use transiently transfected cell lines.
  • Transient transfections may advantageously be used to measure levels of vector production when vectors are being developed. In this regard, transient transfection avoids the longer time required to generate stable vector-producing cell lines and may also be used if the vector or retroviral packaging components are toxic to cells.
  • Components typically used to generate retroviral vectors include a plasmid encoding the gag/pol proteins, a plasmid encoding the env protein and a plasmid containing an NOI. Vector production involves transient transfection of one or more of these components into cells containing the other required components.
  • the vector encodes toxic genes or genes that interfere with the replication of the host cell, such as inhibitors of the cell cycle or genes that induce apotosis, it may be difficult to generate stable vector-producing cell lines, but transient transfection can be used to produce the vector before the cells die. Also, cell lines have been developed using transient transfection that produce vector titre levels that are comparable to the levels obtained from stable vector-producing cell lines (Pear et al. (47)).
  • Producer cells/packaging cells can be of any suitable cell type. Most commonly, mammalian producer cells are used but other cells, such as insect cells are not excluded. Clearly, the producer cells will need to be capable of efficiently translating the env and gag, pol mRNA. Many suitable producer/packaging cell lines are known in the art. The skilled person is also capable of making suitable packaging cell lines by, for example stably introducing a nucleotide construct encoding a packaging component into a cell line.
  • the retroviral genome encodes an inhibitory RNA molecule capable of effecting the cleavage of gag, pol and/or env RNA transcripts
  • the nucleotide sequences present in the packaging cell line either integrated or carried on plasmids, or in the transiently transfected producer cell line, which encode gag, pol and or env proteins will be modified so as to reduce or prevent binding of the inhibitory RNA molecule(s).
  • the inhibitory RNA molecule(s) will not prevent expression of -12- components in packaging cell lines that are essential for packaging of viral particles.
  • the use of different envelope proteins such as the G protein from vesicular-stomatitis virus has improved titres following concentration to 10 per ml (Cosset et ⁇ l. (48)).
  • the envelope protein will be chosen such that the viral particle will preferentially infect cells that are infected with the virus which it desired to treat.
  • the env protein used will be the HIV env protein.
  • Suitable first nucleotide sequences for use according to the present invention encode gene products that result in the cleavage and/or enzymatic degradation of a target nucleotide sequence, which will generally be a ribonucleotide.
  • ribozymes, and antisense sequences may be mentioned.
  • Ribozymes are RNA enzymes which cleave RNA at specific sites. Ribozymes can be engineered so as to be specific for any chosen sequence containing a ribozyme cleavage site. Thus, ribozymes can be engineered which have chosen recognition sites in transcribed viral sequences.
  • ribozymes encoded by the first nucleotide sequence recognise and cleave essential elements of viral genomes required for the production of viral particles, such as packaging components. Thus, for retroviral genomes, such essential elements include the gag, pol and env gene products.
  • a suitable ribozyme capable of recognising at least one of the gag, pol and env gene sequences, or more typically, the RNA sequences transcribed from these genes, is able to bind to and cleave such a sequence. This will reduce or prevent production of the gal, pol or env protein as appropriate and thus reduce or prevent the production of retroviral particles.
  • Ribozymes come in several forms, including hammerhead, hairpin and hepatitis delta antigenomic ribozymes. Preferred for use herein are hammerhead ribozymes, in part because of their relatively small size, because the sequence requirements for their target cleavage site are minimal and because they have been well characterised.
  • the ribozymes -13- most commonly used in research at present are hammerhead and hairpin ribozymes.
  • Each individual ribozyme has a motif which recognises and binds to a recognition site in the target RNA.
  • This motif takes the form of one or more "binding arms", generally two binding arms.
  • the binding arms in hammerhead ribozymes are the flanking sequences Helix I and Helix III, which flank Helix II. These can be of variable length, usually between 6 to 10 nucleotides each, but can be shorter or longer.
  • the length of the flanking sequences can affect the rate of cleavage. For example, it has been found that reducing the total number of nucleotides in the flanking sequences from 20 to 12 can increase the turnover rate of the ribozyme cleaving a HIV sequence, by 10-fold (44).
  • a catalytic motif in the ribozyme Helix II in hammerhead ribozymes cleaves the target RNA at a site which is referred to as the cleavage site. Whether or not a ribozyme will cleave any given RNA is determined by the presence or absence of a recognition site for the ribozyme containing an appropriate cleavage site.
  • Each type of ribozyme recognises its own cleavage site.
  • the hammerhead ribozyme cleavage site has the nucleotide base triplet GUX directly upstream where G is guanine, U is uracil and X is any nucleotide base.
  • Hairpin ribozymes have a cleavage site of BCUGNYR, where B is any nucleotide base other than adenine, N is any nucleotide, Y is cytosine or thymine and R is guanine or adenine. Cleavage by hairpin ribozymes takes places between the G and the N in the cleavage site.
  • the nucleic acid sequences encoding the packaging components may be resistant to the ribozyme or ribozymes because they lack any cleavage sites for the ribozyme or ribozymes. This prohibits enzymatic activity by the ribozyme or ribozymes and therefore there is no effective recognition site for the ribozyme or ribozymes.
  • the potential recognition sites may be altered in the flanking sequences which form the part of the recognition site to which the ribozyme binds.
  • flanking sequences are altered, they are preferably altered such that catalytic activity of the ribozyme at -14- the altered target sequence is negligible and is effectively eliminated.
  • a series of several anti-HIV ribozymes is employed in the invention (5, 7, 10, 13, 21, 36, 38, 40). These can be any anti-HIV ribozymes but must include one or more which cleave the RNA that is required for the expression of gag, pol or env.
  • a plurality of ribozymes is employed, together capable of cleaving gag, pol and env RNA of the native retrovirus at a plurality of sites. Since HIV exists as a population of quasispecies, not all of the target sequences for the ribozymes will be included in all HIV variants. The problem presented by this variability can be overcome by using multiple ribozymes.
  • ribozymes can be included in series in a single vector and can function independently when expressed as a single RNA sequence.
  • a single RNA containing two or more ribozymes having different target recognition sites may be referred to as a multitarget ribozyme.
  • the placement of ribozymes in series has been demonstrated to enhance cleavage.
  • the use of a plurality of ribozymes is not limited to treating HIV infection but may be used in relation to other viruses, retroviruses or otherwise.
  • Antisense technology is well known on the art. There are various mechanisms by which antisense sequences are believed to inhibit gene expression. One mechanism by which antisense sequences are believed to function is the recruitment of the cellular protein RNAseH to the target sequence/antisense construct heteroduplex which results in cleavage and degradation of the heteroduplex. Thus the antisense construct, by contrast to ribozymes, can be said to lead indirectly to cleavage/degradation of the target sequence.
  • a first nucleotide sequence may encode an antisense RNA that binds to either a gene encoding an essential/packaging component or the RNA transcribed from said gene such that expression of the gene is inhibited, for example as a result of RNAseH degradation of a resulting heteroduplex. It is not necessary for the antisense construct to encode the entire complementary sequence of the gene encoding an essential/packaging component - a portion may suffice. The skilled person will easily be able to determine how to design a suitable antisense construct.
  • the nucleic acid sequences encoding the essential/packaging components of the viral particles required for the assembly of viral particles in the host cells/producer -15- cells/packaging cells are resistant to the inhibitory RNA molecules encoded by the first nucleotide sequence.
  • resistance is typically by virtue of alterations in the sequences which eliminate the ribozyme recognition sites.
  • the amino acid coding sequence for the essential/packaging components is retained so that the viral components encoded by the sequences remain the same, or at least sufficiently similar that the function of the essential/packaging components is not compromised.
  • viral polypeptide required for the assembly of viral particles means a polypeptide normally encoded by the viral genome to be packaged into viral particles, in the absence of which the viral genome cannot be packaged.
  • polypeptides would include gag, pol and env.
  • packaging component and "essential component” are also included within this definition.
  • the third nucleotide sequence differs from the second nucleotide sequence encoding the target viral packaging component antisense sequence to the extent that although the antisense sequence can bind to the second nucleotide sequence, or transcript thereof, the antisense sequence can not bind effectively to the third nucleotide sequence or RNA transcribed from therefrom.
  • the changes between the second and third nucleotide sequences will typically be conservative changes, although a small number of amino acid changes may be tolerated provided that, as described above, the function of the essential/packaging components is not significantly impaired.
  • the alterations to the coding sequences for the viral components improve the sequences for codon usage in the mammalian cells or other cells which are to act as the producer cells for retroviral vector particle production.
  • This improvement in codon usage is referred to as "codon optimisation".
  • Many viruses, including HIV and other lentiviruses use a large number of rare codons and by changing these to correspond to commonly used mammalian codons, increased expression of the packaging components in mammalian producer cells can be achieved. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. -16-
  • the sequences encoding the packaging components are codon optimised. More preferably, the sequences are codon optimised in their entirety. Following codon optimisation, it is found that there are numerous sites in the wild type gag, pol and env sequences which can serve as ribozyme recognition sites and which are no longer present in the sequences encoding the packaging components. In an alternative but less practical strategy, the sequences encoding the packaging components can be altered by targeted conservative alterations so as to render them resistant to selected ribozymes capable of cleaving the wild type sequences.
  • codon optimising HIV packaging components can increase gene expression.
  • it can render gag, pol expression Rev independent so that rev and RRE need not be included in the genome (11).
  • Rev-independent vectors are therefore possible. This in turn enables the use of anti-rev or RRE factors in the retroviral vector.
  • the packaging components for a retroviral vector include expression products of gag, pol and env genes.
  • gag and pol employed in the packaging system are derived from the target retrovirus on which the vector genome is based.
  • gag and pol would normally be cleavable by the ribozymes present in the vector genome.
  • the env gene employed in the packaging system may be derived from a different virus, including other retroviruses such as MLV and non-retroviruses such as VSV (a Rhabdovirus), in which case it may not need any sequence alteration to render it resistant to ribozyme cleavage.
  • env may be derived from the same retrovirus as gag and pol, in which case any recognition sites for the ribozymes will need to be eliminated by sequence alteration.
  • the process of producing a retroviral vector in which the envelope protein is not the native envelope of the retrovirus is known as "pseudotyping".
  • Certain envelope proteins such as MLV envelope protein and vesicular stomatitis virus G (VSV-G) protein, pseudotype retroviruses very well. Pseudotyping can be useful for altering the target cell range of the retrovirus.
  • VSV-G vesicular stomatitis virus G
  • the envelope protein may be the same as that of the target virus, for example HIV.
  • therapeutic coding sequences may be present along with the first nucleotide sequence or sequences.
  • Other therapeutic coding sequences include, but are not limited to, sequences encoding cytokines, hormones, antibodies, immunoglobulin fusion proteins, enzymes, immune co-stimulatory molecules, anti-sense RNA, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a single chain antibody, tumour suppresser protein and growth factors.
  • a suitable promoter which may be the promoter driving expression of the first nucleotide sequence or a different promoter or promoters.
  • the invention comprises two components.
  • the first is a genome construction that will be packaged by viral packaging components and which carries a series of anti-viral inhibitory RNA molecules such as anti-HIV ribozymes (5, 7, 10, 13, 21, 36, 38, 40). These could be any anti-HIV ribozymes but the key issue for this invention is that some of them cleave RNA that is required for the expression of native or wild type HIV gag, pol or env coding sequences.
  • the second component is the packaging system which comprises a cassette for the expression of HIV gag, pol and a cassette either for HIV env or an envelope gene encoding a pseudotyping envelope protein - the packaging system beig resistant to the inhibitory RNA molecules.
  • the viral particles of the present invention, and the viral vector system and methods used to produce may thus be used to treat or prevent viral infections, preferably retroviral infections, in particular lentiviral, especially HIV, infections.
  • the viral particles of the invention, typically produced using the viral vector system of the present invention may be used to deliver inhibitory RNA molecules to a human or animal in need of treatment for a viral infection.
  • the viral production system may be used to transfect cells obtained from a patient ex vivo and then returned to the patient.
  • Patient cells transfected ex vivo may be formulated as a pharmaceutical composition (see below) prior to -18- readminstration to the patient.
  • the viral particles are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition.
  • the present invention also provides a pharmaceutical composition for treating an individual, wherein the composition comprises a therapeutically effective amount of the viral particle of the present invention, together with a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
  • the pharmaceutical composition may be for human or animal usage.
  • Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline.
  • the pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system).
  • the pharmaceutical composition may be formulated for parenteral, intramuscular, intravenous, intracranial, subcutaneous, intraocular or transdermal administration.
  • the pharmaceutical compositions can be administered by any one or more of: inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously.
  • compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
  • compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner. -19-
  • the amount of virus administered is typically in the range of from 10 to 10 pfu, preferably from 10 to 10 pfu, more preferably from 10 to 10 pfu.
  • typically 1-10 ⁇ l of virus in a pharmaceutically acceptable suitable carrier or diluent is administered.
  • the amount of nucleic acid administered is typically in the range of from 1 ⁇ g to 10 mg, preferably from 100 ⁇ g to 1 mg.
  • the first nucleotide sequence (or other therapeutic sequence) is under the control of an inducible regulatory sequence, it may only be necessary to induce gene expression for the duration of the treatment. Once the condition has been treated, the inducer is removed and expression of the NOI is stopped. This will clearly have clinical advantages.
  • Such a system may, for example, involve administering the antibiotic tetracycline, to activate gene expression via its effect on the tet repressor/VP16 fusion protein.
  • Figure 1 shows schematically ribozymes inserted into four different HIV vectors
  • Figure 2 shows schematically how to create a suitable 3' LTR by PCR
  • Figure 3 shows the codon usage table for wild type HIV gagpol of strain HXB2 (accession number: K03455).
  • Figure 4 shows the codon usage table of the codon optimised sequence designated gag,pol- SYNgp. -20-
  • Figure 5 shows the codon usage table of the wild type HIV env called env-mn.
  • Figure 6 shows the codon usage table of the codon optimised sequence of HIV env designated SYNgpl ⁇ Omn.
  • Figure 7 shows three plasmid constructs for use in the invention.
  • Figure 8 shows the principle behind two systems for producing retroviral vector particles.
  • the HIV gag.pol sequence was codon optimised ( Figure 4 and SEQ I.D. No. 1) and synthesised using overlapping oligos of around 40 nucleotides. This has three advantages. Firstly it allows an HIV based vector to carry ribozymes and other therapeutic factors. Secondly the codon optimisation generates a higher vector titre due to a higher level of gene expression. Thirdly gag.pol expression becomes rev independent which allows the use of anti-rev or RRE factors.
  • gag.pol conserved sequences within gag.pol were identified by reference to the HIV Sequence database at Los Alamos National Laboratory (http:// hiv-web.lanl.gov/) and used to design ribozymes. Because of the variability between subtypes of HIV-1 the ribozymes were designed to cleave the predominant subtype within North America, Latin America and the Caribbean, Europe, Japan and Australia; that is subtype B. The sites chosen were cross- referenced with the synthetic gagpol sequence to ensure that there was a low possibility of cutting the codon optimised gagpol mRNA. The ribozymes were designed with Xhol and -21-
  • the ribozymes are hammerhead (25) structures of the following general structure:
  • the catalytic domain of the ribozyme (Helix II) can tolerate some changes without reducing catalytic turnover.
  • cleavage sites, targeting gag and pol, with the essential GUX triplet are as follows:
  • GAG 2 5 AACCCAGAUUGUAAGACUAUUU
  • the ribozymes are inserted into four different HIV vectors (pH4 (10), pH6, pH4J, or pH6J) ( Figure 1). In pH4 and pH6, transcription of the ribozymes is driven by an internal
  • HCMV promoter (9). From pH4J and pH6J, the ribozymes are expressed from the 5'
  • pH4 and pH4J have the HIV U3 in the 3' LTR.
  • pH6 and pH6J have HCMV in the 3'LTR.
  • the HCMV promoter replaces most of the U3 and will drive expression at high constitutive levels while the HIV-1 U3 will support a high level of expression only in the presence of Tat.
  • the HCMV/HIV-1 hybrid 3' LTR is created by recombinant PCR with three PCR primers ( Figure 2).
  • the first round of PCR is performed with RIB1 and RIB2 using pH4 (12) as the template to amplify the HIV-1 HXB2 sequence 8900-9123.
  • the second round of PCR makes the junction between the 5' end of the HIV-1 U3 and the HCMV promoter by amplifying the hybrid 5' LTR from pH4.
  • the PCR product from the first PCR reaction and RIB 3 serves as the 5' primer and 3' primer respectively.
  • pH6 The PCR product is then cut with Sphl and Sail and inserted into pH4 thereby replacing the 3' LTR.
  • the resulting plasmid is designated pH6.
  • the internal HCMV promoter (Spel - Xhol) in pH4 and pH6 is replaced with the polycloning site of pBluescript II KS+ (Stratagene) (Spel - Xhol).
  • the ribozymes are inserted into the Xhol sites in the genome vector backbones. Any ribozymes in any configuration could be used in a similar way.
  • the packaging system can take various forms.
  • the HIV gag, pol components are co-expressed with the HIV env coding sequence.
  • both the gag, pol and the env coding sequences are altered such that they are resistant to the anti-HIV ribozymes that are built into the genome.
  • the codons can be chosen to match the usage pattern of the most highly expressed mammalian genes. This dramatically increases expression -23- levels (28, 29) and so increases titre.
  • a codon optimised HIV env coding sequence has been described by Haas et al (9).
  • a modified codon optimised HIV env sequence is used (SEQ I.D.
  • the corresponding env expression plasmid is designated pSYNgpl ⁇ Omn.
  • the modified sequence contains extra motifs not used by Haas et al. The extra sequences were taken from the HIV env sequence of strain MN and codon optimised. Any similar modification of the nucleic acid sequence would function similarly as long as it used codons corresponding to abundant tRNAs (42) and lead to resistance to the ribozymes in the genome.
  • a gag, pol coding sequence with optimised codon usage overlapping oligonucleotides are synthesised and then ligated together to produce the synthetic coding sequence.
  • the sequence of a wild-type (Genbank accession no. K03455) and synthetic (gagpol-SYNgp) gagpol sequence is shown in SEQ I.D. Nos 1 and 2, respectively and their codon usage is shown in Figures 3 and 4, respectively.
  • the sequence of a wild type env coding sequence (Genbank Accession No. Ml 7449) is given in SEQ I.D. No 3
  • the sequence of a synthetic codon optimised sequence is given in SEQ. I.D. No. 4 and their codon usage tables are given in Figures 5 and 6, respectively.
  • gag, pol sequence that achieves resistance to the ribozymes could be used.
  • the synthetic sequence shown is designated gag, pol-SYNgp and has an EcoRI site at the 5' end and a Notl site at the 3' end. It is inserted into pClneo (Promega) to produce plasmid pSY ⁇ gp.
  • a synthetic gag, pol cassette is coexpressed with a non-HIV envelope coding sequence that produces a surface protein that pseudotypes HIV.
  • Vector particles can be produced either from a transient three-plasmid transfection system similar to that described by Soneoka et al. (33) or from producer cell lines similar to those used for other retroviral vectors (20, 35, 39). These principles are illustrated in Figures 7 and 8. For example, by using pH6Rz, pSYNgp and pRV67 (VSV-G expression plasmid) in a three plasmid transfection of 293T cells ( Figure 8), as described by Soneoka et al (33), vector particles designated H6Rz-VSV are produced. These transduce the H6Rz genome to CD4+ cells such as C1866 or Jurkat and produce the multitarget ribozymes. HIV replication in these cells is now severely restricted.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • AIDS & HIV (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Communicable Diseases (AREA)
  • Veterinary Medicine (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A viral vector production system is provided which system comprises: (i) a viral genome comprising at least one first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles; (ii) a third nucleotide sequence encoding said viral polypeptide required for the assembly of the viral genome into viral particles, which third nucleotide sequence has a different nucleotide sequence to the second nucleotide sequence such that said third nucleotide sequence, or transcription product thereof, is resistant to cleavage directed by said gene product. The viral vector production system may be used to produce viral particles for use in treating or preventing viral infection.

Description

-1-
ANTI-VIRA VECTORS
Field of the Invention
The present invention relates to novel viral vectors capable of delivering anti-viral inhibitory RNA molecules to target cells.
Background to the Invention
The application of gene therapy to the treatment of AIDS and HIV infection has been discussed widely (14). The types of therapeutic gene proposed usually fall into one of two broad categories. In the first the gene encodes protein products that inhibit the virus in a number of possible ways. One example of such a protein is the RevMlO derivative of the HIV Rev protein (16). The RevMlO protein acts as a transdominant negative mutant and so competitively inhibits Rev function in the virus. Like many of the protein-based strategies, the RevMlO protein is a derivative of a native HIV protein. While this provides the basis for the anti-HIV effect, it also has serious disadvantages. In particular, this type of strategy demands that in the absence of the virus there is little or no expression of the gene. Otherwise, healthy cells harbouring the gene become a target for the host cytotoxic T lymphocyte (CTL) system, which recognises the foreign protein (17, 25). The second broad category of therapeutic gene circumvents these CTL problems. The therapeutic gene encodes inhibitory RNA molecules; RNA is not a target for CTL recognition. The RNA molecules may be anti-sense RNA (15, 31), ribozymes (5) or competitive decoys (1).
Ribozymes are enzymatic RNA molecules which catalyse sequence-specific RNA processing. The design and structure of ribozymes has been described extensively in the literature in recent years (3, 7, 31). Amongst the most powerful systems are those that deliver multitarget ribozymes that cleave RNA of the target virus at multiple sites (5, 21).
In recent years a number of laboratories have developed retroviral vector systems based on HIV (2, 4, 18, 19, 22-24, 27, 32, 35, 39, 43). In the context of anti-HIV gene therapy these vectors have a number of advantages over the more conventional murine based vectors -2- such as murine leukaemia virus (MLV) vectors. Firstly, HIV vectors would target precisely those cells that are susceptible to HIV infection (22, 23). Secondly, the HIV- based vector would transduce cells such as macrophages that are normally refractory to transduction by murine vectors (19, 20). Thirdly, the anti-HIV vector genome would be propagated through the CD4+ cell population by any virus (HIV) that escaped the therapeutic strategy (7). This is because the vector genome has the packaging signal that will be recognised by the viral particle packaging system. These various attributes make HIV -vectors a powerful tool in the field of anti-HIV gene therapy.
A combination of the multitarget ribozyme and an HIV-based vector would be attractive as a therapeutic strategy. However, until now this has not been possible. Vector particle production takes place in producer cells which express the packaging components of the particles and package the vector genome. The ribozymes that are designed to destroy the viral RNA would therefore also interrupt the expression of the components of the HIV- based vector system during vector production. The present invention aims to overcome this problem.
Summary of the Invention
It is therefore an object of the invention to provide a system and method for producing viral particles, in particular HIV particles, which carry nucleotide constructs encoding inhibitory RNA molecules such as ribozymes and/or antisense RNAs directed against a corresponding virus, such as HIV, within a target cell, that overcomes the above-mentioned problems. The system includes both a viral genome encoding the inhibitory RNA molcules and nucleotide constructs encoding the components required for packaging the viral genome in a producer cell. However, in contrast to the prior art, although the packaging components have substantially the same amino acid sequence as the corresponding components of the target virus, the inhibitory RNA molecules do not affect production of the viral particles in the producer cells because the nucleotide sequence of the packaging components used in the viral system have been modified to prevent the inhibitory RNA molecules from effecting cleavage or degradation of the RNA transcripts produced from the constructs. Such a viral particle may be used to treat viral infections, in -3- particular HIV infections.
Accordingly the present invention provides a viral vector system comprising: (i) a first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles; and
(ii) a third nucleotide sequence encoding said viral polypeptide required for the assembly of viral particles, which third nucleotide sequence has a different nucleotide sequence to the second nucleotide sequence such that the third nucleotide sequence, or transcription product thereof, is resistant to cleavage directed by said gene product.
In another aspect, the present invention provides a viral vector production system comprising: (i) a viral genome comprising at least one first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles;
(ii) a third nucleotide sequence encoding said viral polypeptide required for the assembly of the viral genome into viral particles, which third nucleotide sequence has a different nucleotide sequence to the second nucleotide sequence such that said third nucleotide sequence, or transcription product thereof, is resistant to cleavage directed by said gene product.
The gene product is typically an RNA inhibitory sequence selected from a ribozyme and an anti-sense ribonucleic acid, preferably a ribozyme.
Preferably, the viral vector is a retroviral vector, more preferably a lentiviral vector, such as an HIV vector. The second nucleotide sequence and the third nucleotide sequences are typically from the same viral species, more preferably from the same viral strain. Generally, the viral genome is also from the same viral species, more preferably from the same viral strain. In the case of retroviral vectors, the polypeptide required for the assembly of viral particles is selected from gag, pol and env proteins. Preferably at least the gag and pol sequences are lentiviral sequences, more preferably HIV sequences. Alternatively, or in addition, the env sequence is a lentiviral sequence, more preferably an HIV sequence.
In a preferred embodiment, the third nucleotide sequence is resistant to cleavage directed by the gene product as a result of one or more conservative alterations in the nucleotide sequence which remove cleavage sites recognised by the at least one gene product and/or binding sites for the at least one gene product. For example, where the gene product is a ribozyme, the third nucleotide sequence is adapted to be resistant to cleavage by the ribozyme.
Preferably the third nucleotide sequence is codon optimised for expression in host cells. The host cells, which term includes producer cells and packaging cells, are typically mammalian cells.
In a particularly preferred embodiment, (i) the viral genome is an HIV genome comprising nucleotide sequences encoding anti-HIV ribozymes and/or anti-HIV antisense sequences directed against HIV packaging component sequences (such as gag.pol) in a target HIV and (ii) the viral system for producing packaged HIV particles further comprises nucleotide constructs encoding the same packaging components (such as gag.pol proteins) as in the target HIV wherein the sequence of the nucleotide constructs is different from that found in the target HIV so that the anti-HIV ribozyme and/or antisense HIV sequences cannot effect cleavage or degradation of the gag.pol transcripts during production of the HIV particles in producer cells.
The present invention also provides a viral particle comprising a viral vector according to the present invention and one or more polypeptides encoded by the third nucleotide sequences according to the present invention. For example the present invention provides a viral particle produced using the viral vector production system of the invention. -5-
In another aspect, the present invention provides a method for producing a viral particle which method comprises introducing into a host cell (i) a viral genome vector according to the present invention; (ii) one or more third nucleotide sequences according to the present invention; and (iii) nucleotide sequences encoding the other essential viral packaging components not encoded by the one or more third nucleotide sequences.
The present invention further provides a viral particle produced using by the method of the invention.
The present invention also provides a pharmaceutical composition comprising a viral particle according to the present invention together with a pharmaceutically acceptable carrier or diluent.
The viral system of the invention or viral particles of the invention may be used to treat viral infections, particularly retroviral infections such as lentiviral infections including HIV infections. Thus the present invention provides a method of treating a viral infection which method comprises administering to a human or animal patient suffering from the viral infection an effective amount of a viral system, viral particle or pharmaceutical composition of the present invention.
The invention relates in particular to HIV-based vectors carrying anti-HIV ribozymes. However, the invention can be applied to any other virus, in particular any other lentivirus, for which treatment by gene therapy may be desirable. The invention is illustrated herein for HIV, but this is not considered to limit the scope of the invention to HIV-based anti- HIV vectors.
Detailed Description of the Invention
The term "viral vector" refers to a nucleotide construct comprising a viral genome capable of being transcribed in a host cell, which genome comprises sufficient viral genetic information to allow packaging of the viral RNA genome, in the presence of packaging components, into a viral particle capable of infecting a target cell. Infection of the target -6- cell includes reverse transcription and integration into the target cell genome, where appropriate for particular viruses. The viral vector in use typically carries heterologous coding sequences (nucleotides of interest) which are to be delivered by the vector to the target cell, for example a first nucleotide sequence encoding a ribozyme. A viral vector is incapable of independent replication to produce infectious viral particles within the final target cell.
The term " viral vector system" is intended to mean a kit of parts which can be used when combined with other necessary components for viral particle production to produce viral particles in host cells. For example, the first nucleotide sequence may typically be present in a plasmid vector construct suitable for cloning the first nucleotide sequence into a viral genome vector construct. When combined in a kit with a third nucleotide sequence, which will also typically be present in a separate plasmid vector construct, the resulting combination of plasmid containing the first nucleotide sequence and plasmid containing the third nucleotide sequence comprises the essential elements of the invention. Such a kit may then be used by the skilled person in the production of suitable viral vector genome constructs which when transfected into a host cell together with the plasmid containing the third nucleotide sequence, and optionally nucleic acid constructs encoding other components required for viral assembly, will lead to the production of infectious viral particles.
Alternatively, the third nucleotide sequence may be stably present within a packaging cell line that is included in the kit.
The kit may include the other components needed to produce viral particles, such as host cells and other plasmids encoding essential viral polypeptides required for viral assembly. By way of example, the kit may contain (i) a plasmid containing a first nucleotide sequence encoding an anti-HIV ribozyme and (ii) a plasmid containing a third nucleotide sequence encoding a modified HIV gag.pol construct which cannot be cleaved by the anti-HIV ribozyme. Optional components would then be (a) an HIV viral genome construct with suitable restriction enzyme recognition sites for cloning the first nucleotide sequence into the viral genome; (b) a plasmid encoding a VSV-G env protein. Alternatively, nucleotide -7- sequence encoding viral polypeptides required for assembly of viral particles may be provided in the kit as packaging cell lines comprising the nucleotide sequences, for example a VSV-G expressing cell line.
The term "viral vector production system" refers to the viral vector system described above wherein the first nucleotide sequence has already been inserted into a suitable viral vector genome.
Viral vectors are typically retroviral vectors, in particular lentiviral vectors such as HIV vectors. The retroviral vector of the present invention may be derived from or may be derivable from any suitable retrovirus. A large number of different retro viruses have been identified. Examples include: murine leukemia virus (MLV), human immunodeficiency virus (HIV), simian immunodeficiency virus, human T-cell leukemia virus (HTLV). equine infectious anaemia virus (EIAV), mouse mammary tumour virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus
(Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus
(Mo-MSV), Abelson murine leukemia virus (A-MLV), Avian myelocytomatosis virus-29
(MC29), and Avian erythroblastosis virus (AEV). A detailed list of retroviruses may be found in Coffin et al., 1997, "Retroviruses", Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763.
Details on the genomic structure of some retroviruses may be found in the art. By way of example, details on HIV and Mo-MLV may be found from the NCBI Genbank (Genome Accession Nos. AF033819 and AF033811, respectively).
The lentivirus group can be split even further into "primate" and "non-primate". Examples of primate lentiviruses include human immunodeficiency virus (HIV), the causative agent of human auto-immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (SIV). The non-primate lentiviral group includes the prototype "slow virus" visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV). -8-
The basic structure of a retrovirus genome is a 5' LTR and a 3' LTR, between or within which are located a packaging signal to enable the genome to be packaged, a primer binding site, integration sites to enable integration into a host cell genome and gag, pol and env genes encoding the packaging components - these are polypeptides required for the assembly of viral particles. More complex retroviruses have additional features, such as rev and RRE sequences in HIV, which enable the efficient export of RNA transcripts of the integrated provirus from the nucleus to the cytoplasm of an infected target cell.
In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs). The LTRs are responsible for pro viral integration, and transcription. LTRs also serve as enhancer-promoter sequences and can control the expression of the viral genes. Encapsidation of the retroviral RNAs occurs by virtue of apsi sequence located at the 5' end of the viral genome.
The LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5. U3 is derived from the sequence unique to the 3' end of the RNA. R is derived from a sequence repeated at both ends of the RNA and U5 is derived from the sequence unique to the 5' end of the RNA. The sizes of the three elements can vary considerably among different retroviruses.
In a defective retroviral vector genome gag, pol and env may be absent or not functional. The R regions at both ends of the RNA are repeated sequences. U5 and U3 represent unique sequences at the 5' and 3' ends of the RNA genome respectively.
In a typical retroviral vector for use in gene therapy, at least part of one or more of the gag, pol and env protein coding regions essential for replication may be removed from the virus. This makes the retroviral vector replication-defective. The removed portions may even be replaced by a nucleotide sequence of interest (NOI), such as a first nucleotide sequence of the invention, to generate a virus capable of integrating its genome into a host genome but wherein the modified viral genome is unable to propagate itself due to a lack of structural proteins. When integrated in the host genome, expression of the NOI occurs - resulting in, ffυ ι°" PCT/GB99/00325
-9- for example, a therapeutic and/or a diagnostic effect. Thus, the transfer of an NOI into a site of interest is typically achieved by: integrating the NOI into the recombinant viral vector; packaging the modified viral vector into a virion coat; and allowing transduction of a site of interest - such as a targeted cell or a targeted cell population.
A minimal retroviral genome for use in the present invention will therefore comprise (5') R - U5 - one or more first nucleotide sequences - U3-R (3'). However, the plasmid vector used to produce the retroviral genome within a host cell/packaging cell will also include transcriptional regulatory control sequences operably linked to the retroviral genome to direct transcription of the genome in a host cell/packaging cell. These regulatory sequences may be the natural sequences associated with the transcribed retroviral sequence, i.e. the 5' U3 region, or they may be a heterologous promoter such as another viral promoter, for example the CMV promoter.
Some retroviral genomes require additional sequences for efficient virus production. For example, in the case of HIV, rev and RRE sequence are preferably included. However the requirement for rev and RRE can be reduced or eliminated by codon optimisation.
Once the retroviral vector genome is integrated into the genome of its target cell as proviral DNA, the ribozyme sequences need to be expressed. In a retrovirus, the promoter is located in the 5' LTR U3 region of the provirus. In retroviral vectors, the promoter driving expression of a therapeutic gene may be the native retroviral promoter in the 5' U3 region, or an alternative promoter engineered into the vector. The alternative promoter may physically replace the 5' U3 promoter native to the retrovirus, or it may be incorporated at a different place within the vector genome such as between the LTRs.
Thus, the first nucleotide sequence will also be operably linked to a transcriptional regulatory control sequence to allow transcription of the first nucleotide sequence to occur in the target cell. The control sequence will typically be active in mammalian cells. The control sequence may, for example, be a viral promoter such as the natural viral promoter or a CMV promoter or it may be a mammalian promoter. It is particularly preferred to use a promoter that is preferentially active in a particular cell type or tissue type in which the JO- virus to be treated primarily infects. Thus, in one embodiment, a tissue-specific regulatory sequences may be used. The regulatory control sequences driving expression of the one or more first nucleotide sequences may be constitutive or regulated promoters.
Replication-defective retroviral vectors are typically propagated, for example to prepare suitable titres of the retroviral vector for subsequent transduction, by using a combination of a packaging or helper cell line and the recombinant vector. That is to say, that the three packaging proteins can be provided in trans.
A "packaging cell line" contains one or more of the retroviral gag, pol and env genes. The packaging cell line produces the proteins required for packaging retroviral DNA but it cannot bring about encapsidation due to the lack of a psi region. However, when a recombinant vector carrying an NOI and a psi region is introduced into the packaging cell line, the helper proteins can package the jϊλyz-positive recombinant vector to produce the recombinant virus stock. This virus stock can be used to transduce cells to introduce the NOI into the genome of the target cells. It is preferred to use a psi packaging signal, called psi plus, that contains additional sequences spanning from upstream of the splice donor to downstream of the gag start codon (Bender et al. (46)) since this has been shown to increase viral titres.
The recombinant virus whose genome lacks all genes required to make viral proteins can tranduce only once and cannot propagate. These viral vectors which are only capable of a single round of transduction of target cells are known as replication defective vectors. Hence, the NOI is introduced into the host/target cell genome without the generation of potentially harmful retrovirus. A summary of the available packaging lines is presented in Coffin et al., 1997 (ibid).
Retroviral packaging cell lines in which the gag, pol and env viral coding regions are carried on separate expression plasmids that are independently transfected into a packaging cell line are preferably used. This strategy, sometimes referred to as the three plasmid transfection method (Soneoka et al. (33)), reduces the potential for production of a replication-competent virus since three recombinant events are required for wild type viral -11- production. As recombination is greatly facilitated by homology, reducing or eliminating homology between the genomes of the vector and the helper can also be used to reduce the problem of replication-competent helper virus production.
An alternative to stably transfected packaging cell lines is to use transiently transfected cell lines. Transient transfections may advantageously be used to measure levels of vector production when vectors are being developed. In this regard, transient transfection avoids the longer time required to generate stable vector-producing cell lines and may also be used if the vector or retroviral packaging components are toxic to cells. Components typically used to generate retroviral vectors include a plasmid encoding the gag/pol proteins, a plasmid encoding the env protein and a plasmid containing an NOI. Vector production involves transient transfection of one or more of these components into cells containing the other required components. If the vector encodes toxic genes or genes that interfere with the replication of the host cell, such as inhibitors of the cell cycle or genes that induce apotosis, it may be difficult to generate stable vector-producing cell lines, but transient transfection can be used to produce the vector before the cells die. Also, cell lines have been developed using transient transfection that produce vector titre levels that are comparable to the levels obtained from stable vector-producing cell lines (Pear et al. (47)).
Producer cells/packaging cells can be of any suitable cell type. Most commonly, mammalian producer cells are used but other cells, such as insect cells are not excluded. Clearly, the producer cells will need to be capable of efficiently translating the env and gag, pol mRNA. Many suitable producer/packaging cell lines are known in the art. The skilled person is also capable of making suitable packaging cell lines by, for example stably introducing a nucleotide construct encoding a packaging component into a cell line.
As will be discussed below, where the retroviral genome encodes an inhibitory RNA molecule capable of effecting the cleavage of gag, pol and/or env RNA transcripts, the nucleotide sequences present in the packaging cell line, either integrated or carried on plasmids, or in the transiently transfected producer cell line, which encode gag, pol and or env proteins will be modified so as to reduce or prevent binding of the inhibitory RNA molecule(s). In this way, the inhibitory RNA molecule(s) will not prevent expression of -12- components in packaging cell lines that are essential for packaging of viral particles.
It is highly desirable to use high-titre virus preparations in both experimental and practical applications. Techniques for increasing viral titre include using a psi plus packaging signal as discussed above and concentration of viral stocks. In addition, the use of different envelope proteins, such as the G protein from vesicular-stomatitis virus has improved titres following concentration to 10 per ml (Cosset et αl. (48)). However, typically the envelope protein will be chosen such that the viral particle will preferentially infect cells that are infected with the virus which it desired to treat. For example where an HIV vector is being used to treat HIV infection, the env protein used will be the HIV env protein.
Suitable first nucleotide sequences for use according to the present invention encode gene products that result in the cleavage and/or enzymatic degradation of a target nucleotide sequence, which will generally be a ribonucleotide. As particular examples, ribozymes, and antisense sequences may be mentioned.
Ribozymes are RNA enzymes which cleave RNA at specific sites. Ribozymes can be engineered so as to be specific for any chosen sequence containing a ribozyme cleavage site. Thus, ribozymes can be engineered which have chosen recognition sites in transcribed viral sequences. By way of an example, ribozymes encoded by the first nucleotide sequence recognise and cleave essential elements of viral genomes required for the production of viral particles, such as packaging components. Thus, for retroviral genomes, such essential elements include the gag, pol and env gene products. A suitable ribozyme capable of recognising at least one of the gag, pol and env gene sequences, or more typically, the RNA sequences transcribed from these genes, is able to bind to and cleave such a sequence. This will reduce or prevent production of the gal, pol or env protein as appropriate and thus reduce or prevent the production of retroviral particles.
Ribozymes come in several forms, including hammerhead, hairpin and hepatitis delta antigenomic ribozymes. Preferred for use herein are hammerhead ribozymes, in part because of their relatively small size, because the sequence requirements for their target cleavage site are minimal and because they have been well characterised. The ribozymes -13- most commonly used in research at present are hammerhead and hairpin ribozymes.
Each individual ribozyme has a motif which recognises and binds to a recognition site in the target RNA. This motif takes the form of one or more "binding arms", generally two binding arms. The binding arms in hammerhead ribozymes are the flanking sequences Helix I and Helix III, which flank Helix II. These can be of variable length, usually between 6 to 10 nucleotides each, but can be shorter or longer. The length of the flanking sequences can affect the rate of cleavage. For example, it has been found that reducing the total number of nucleotides in the flanking sequences from 20 to 12 can increase the turnover rate of the ribozyme cleaving a HIV sequence, by 10-fold (44). A catalytic motif in the ribozyme Helix II in hammerhead ribozymes cleaves the target RNA at a site which is referred to as the cleavage site. Whether or not a ribozyme will cleave any given RNA is determined by the presence or absence of a recognition site for the ribozyme containing an appropriate cleavage site.
Each type of ribozyme recognises its own cleavage site. The hammerhead ribozyme cleavage site has the nucleotide base triplet GUX directly upstream where G is guanine, U is uracil and X is any nucleotide base. Hairpin ribozymes have a cleavage site of BCUGNYR, where B is any nucleotide base other than adenine, N is any nucleotide, Y is cytosine or thymine and R is guanine or adenine. Cleavage by hairpin ribozymes takes places between the G and the N in the cleavage site.
The nucleic acid sequences encoding the packaging components (the "third nucleotide sequences") may be resistant to the ribozyme or ribozymes because they lack any cleavage sites for the ribozyme or ribozymes. This prohibits enzymatic activity by the ribozyme or ribozymes and therefore there is no effective recognition site for the ribozyme or ribozymes. Alternatively or additionally, the potential recognition sites may be altered in the flanking sequences which form the part of the recognition site to which the ribozyme binds. This either eliminates binding of the ribozyme motif to the recognition site, or reduces binding capability enough to destabilise any ribozyme-target complex and thus reduce the specificity and catalytic activity of the ribozyme. Where the flanking sequences only are altered, they are preferably altered such that catalytic activity of the ribozyme at -14- the altered target sequence is negligible and is effectively eliminated.
Preferably, a series of several anti-HIV ribozymes is employed in the invention (5, 7, 10, 13, 21, 36, 38, 40). These can be any anti-HIV ribozymes but must include one or more which cleave the RNA that is required for the expression of gag, pol or env. Preferably, a plurality of ribozymes is employed, together capable of cleaving gag, pol and env RNA of the native retrovirus at a plurality of sites. Since HIV exists as a population of quasispecies, not all of the target sequences for the ribozymes will be included in all HIV variants. The problem presented by this variability can be overcome by using multiple ribozymes. Multiple ribozymes can be included in series in a single vector and can function independently when expressed as a single RNA sequence. A single RNA containing two or more ribozymes having different target recognition sites may be referred to as a multitarget ribozyme. The placement of ribozymes in series has been demonstrated to enhance cleavage. The use of a plurality of ribozymes is not limited to treating HIV infection but may be used in relation to other viruses, retroviruses or otherwise.
Antisense technology is well known on the art. There are various mechanisms by which antisense sequences are believed to inhibit gene expression. One mechanism by which antisense sequences are believed to function is the recruitment of the cellular protein RNAseH to the target sequence/antisense construct heteroduplex which results in cleavage and degradation of the heteroduplex. Thus the antisense construct, by contrast to ribozymes, can be said to lead indirectly to cleavage/degradation of the target sequence. Thus according to the present invention, a first nucleotide sequence may encode an antisense RNA that binds to either a gene encoding an essential/packaging component or the RNA transcribed from said gene such that expression of the gene is inhibited, for example as a result of RNAseH degradation of a resulting heteroduplex. It is not necessary for the antisense construct to encode the entire complementary sequence of the gene encoding an essential/packaging component - a portion may suffice. The skilled person will easily be able to determine how to design a suitable antisense construct.
By contrast, the nucleic acid sequences encoding the essential/packaging components of the viral particles required for the assembly of viral particles in the host cells/producer -15- cells/packaging cells (the third nucleotide sequences) are resistant to the inhibitory RNA molecules encoded by the first nucleotide sequence. For example in the case of ribozymes, resistance is typically by virtue of alterations in the sequences which eliminate the ribozyme recognition sites. At the same time, the amino acid coding sequence for the essential/packaging components is retained so that the viral components encoded by the sequences remain the same, or at least sufficiently similar that the function of the essential/packaging components is not compromised.
The term "viral polypeptide required for the assembly of viral particles" means a polypeptide normally encoded by the viral genome to be packaged into viral particles, in the absence of which the viral genome cannot be packaged. For example, in the context of retroviruses such polypeptides would include gag, pol and env. The terms "packaging component" and "essential component" are also included within this definition.
In the case of antisense sequences, the third nucleotide sequence differs from the second nucleotide sequence encoding the target viral packaging component antisense sequence to the extent that although the antisense sequence can bind to the second nucleotide sequence, or transcript thereof, the antisense sequence can not bind effectively to the third nucleotide sequence or RNA transcribed from therefrom. The changes between the second and third nucleotide sequences will typically be conservative changes, although a small number of amino acid changes may be tolerated provided that, as described above, the function of the essential/packaging components is not significantly impaired.
Preferably, in addition to eliminating the ribozyme recognition sites, the alterations to the coding sequences for the viral components improve the sequences for codon usage in the mammalian cells or other cells which are to act as the producer cells for retroviral vector particle production. This improvement in codon usage is referred to as "codon optimisation". Many viruses, including HIV and other lentiviruses, use a large number of rare codons and by changing these to correspond to commonly used mammalian codons, increased expression of the packaging components in mammalian producer cells can be achieved. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. -16-
Thus preferably, the sequences encoding the packaging components are codon optimised. More preferably, the sequences are codon optimised in their entirety. Following codon optimisation, it is found that there are numerous sites in the wild type gag, pol and env sequences which can serve as ribozyme recognition sites and which are no longer present in the sequences encoding the packaging components. In an alternative but less practical strategy, the sequences encoding the packaging components can be altered by targeted conservative alterations so as to render them resistant to selected ribozymes capable of cleaving the wild type sequences.
An additional advantage of codon optimising HIV packaging components is that this can increase gene expression. In particular, it can render gag, pol expression Rev independent so that rev and RRE need not be included in the genome (11). Rev-independent vectors are therefore possible. This in turn enables the use of anti-rev or RRE factors in the retroviral vector.
As described above, the packaging components for a retroviral vector include expression products of gag, pol and env genes. In accordance with the present invention, gag and pol employed in the packaging system are derived from the target retrovirus on which the vector genome is based. Thus, in the RNA transcript form, gag and pol would normally be cleavable by the ribozymes present in the vector genome. The env gene employed in the packaging system may be derived from a different virus, including other retroviruses such as MLV and non-retroviruses such as VSV (a Rhabdovirus), in which case it may not need any sequence alteration to render it resistant to ribozyme cleavage. Alternatively, env may be derived from the same retrovirus as gag and pol, in which case any recognition sites for the ribozymes will need to be eliminated by sequence alteration.
The process of producing a retroviral vector in which the envelope protein is not the native envelope of the retrovirus is known as "pseudotyping". Certain envelope proteins, such as MLV envelope protein and vesicular stomatitis virus G (VSV-G) protein, pseudotype retroviruses very well. Pseudotyping can be useful for altering the target cell range of the retrovirus. Alternatively, to maintain target cell specificity for target cells infected with the -17- particular virus it is desired to treat, the envelope protein may be the same as that of the target virus, for example HIV.
Other therapeutic coding sequences may be present along with the first nucleotide sequence or sequences. Other therapeutic coding sequences include, but are not limited to, sequences encoding cytokines, hormones, antibodies, immunoglobulin fusion proteins, enzymes, immune co-stimulatory molecules, anti-sense RNA, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a single chain antibody, tumour suppresser protein and growth factors. When included, such coding sequences are operatively linked to a suitable promoter, which may be the promoter driving expression of the first nucleotide sequence or a different promoter or promoters.
Thus the invention comprises two components. The first is a genome construction that will be packaged by viral packaging components and which carries a series of anti-viral inhibitory RNA molecules such as anti-HIV ribozymes (5, 7, 10, 13, 21, 36, 38, 40). These could be any anti-HIV ribozymes but the key issue for this invention is that some of them cleave RNA that is required for the expression of native or wild type HIV gag, pol or env coding sequences. The second component is the packaging system which comprises a cassette for the expression of HIV gag, pol and a cassette either for HIV env or an envelope gene encoding a pseudotyping envelope protein - the packaging system beig resistant to the inhibitory RNA molecules.
The viral particles of the present invention, and the viral vector system and methods used to produce may thus be used to treat or prevent viral infections, preferably retroviral infections, in particular lentiviral, especially HIV, infections. Specifically, the viral particles of the invention, typically produced using the viral vector system of the present invention may be used to deliver inhibitory RNA molecules to a human or animal in need of treatment for a viral infection.
Alternatively, or in addition, the viral production system may be used to transfect cells obtained from a patient ex vivo and then returned to the patient. Patient cells transfected ex vivo may be formulated as a pharmaceutical composition (see below) prior to -18- readminstration to the patient.
Preferably the viral particles are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition. Thus, the present invention also provides a pharmaceutical composition for treating an individual, wherein the composition comprises a therapeutically effective amount of the viral particle of the present invention, together with a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The pharmaceutical composition may be for human or animal usage.
The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system).
The pharmaceutical composition may be formulated for parenteral, intramuscular, intravenous, intracranial, subcutaneous, intraocular or transdermal administration.
Where appropriate, the pharmaceutical compositions can be administered by any one or more of: inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner. -19-
The amount of virus administered is typically in the range of from 10 to 10 pfu, preferably from 10 to 10 pfu, more preferably from 10 to 10 pfu. When injected, typically 1-10 μl of virus in a pharmaceutically acceptable suitable carrier or diluent is administered.
When the polynucleotide/vector is administered as a naked nucleic acid, the amount of nucleic acid administered is typically in the range of from 1 μg to 10 mg, preferably from 100 μg to 1 mg.
Where the first nucleotide sequence (or other therapeutic sequence) is under the control of an inducible regulatory sequence, it may only be necessary to induce gene expression for the duration of the treatment. Once the condition has been treated, the inducer is removed and expression of the NOI is stopped. This will clearly have clinical advantages. Such a system may, for example, involve administering the antibiotic tetracycline, to activate gene expression via its effect on the tet repressor/VP16 fusion protein.
The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention. The Examples refer to the Figures. In the Figures:
Figure 1 shows schematically ribozymes inserted into four different HIV vectors;
Figure 2 shows schematically how to create a suitable 3' LTR by PCR;
Figure 3 shows the codon usage table for wild type HIV gagpol of strain HXB2 (accession number: K03455).
Figure 4 shows the codon usage table of the codon optimised sequence designated gag,pol- SYNgp. -20-
Figure 5 shows the codon usage table of the wild type HIV env called env-mn.
Figure 6 shows the codon usage table of the codon optimised sequence of HIV env designated SYNgplόOmn.
Figure 7 shows three plasmid constructs for use in the invention.
Figure 8 shows the principle behind two systems for producing retroviral vector particles.
The invention will now be further described in the Examples which follow, which are intended as an illustration only and do not limit the scope of the invention.
EXAMPLES
Example 1 - Construction of a Genome
The HIV gag.pol sequence was codon optimised (Figure 4 and SEQ I.D. No. 1) and synthesised using overlapping oligos of around 40 nucleotides. This has three advantages. Firstly it allows an HIV based vector to carry ribozymes and other therapeutic factors. Secondly the codon optimisation generates a higher vector titre due to a higher level of gene expression. Thirdly gag.pol expression becomes rev independent which allows the use of anti-rev or RRE factors.
Conserved sequences within gag.pol were identified by reference to the HIV Sequence database at Los Alamos National Laboratory (http:// hiv-web.lanl.gov/) and used to design ribozymes. Because of the variability between subtypes of HIV-1 the ribozymes were designed to cleave the predominant subtype within North America, Latin America and the Caribbean, Europe, Japan and Australia; that is subtype B. The sites chosen were cross- referenced with the synthetic gagpol sequence to ensure that there was a low possibility of cutting the codon optimised gagpol mRNA. The ribozymes were designed with Xhol and -21-
Sall sites at the 5' and 3' end respectively. This allows the construction of separate and tandem ribozymes.
The ribozymes are hammerhead (25) structures of the following general structure:
Helix I Helix II Helix III
5 ' - NNNNNNNN- CUGAUGAGGCCGAAAGGCCGAA -NNNNNNNN-
The catalytic domain of the ribozyme (Helix II) can tolerate some changes without reducing catalytic turnover.
The cleavage sites, targeting gag and pol, with the essential GUX triplet (where X is any nucleotide base) are as follows:
GAG 1 5 ' UAGUAAGAAUGUAUAGCCCUAC
GAG 2 5 ' AACCCAGAUUGUAAGACUAUUU
GAG 3 5 ' UGUUUCAAUUGUGGCAAAGAAG
GAG 4 5 ' AAAAAGGGCUGUUGGAAAUGUG
POL 1 5 ' ACGACCCCUCGUCACAAUAAAG
POL 2 5 ' GGAAUUGGAGGUUUUAUCAAAG
POL 3 5 ' AUAUUUUUCAGUUCCCUUAGAU
POL 4 5 UGGAUGAUUUGUAUGUAGGAUC
POL 5 5 ' CUUUGGAUGGGUUAUGAACUCC
POL 6 5 ' CAGCUGGACUGUCAAUGACAUA
POL 7 5 AACUUUCUAUGUAGAUGGGGCA
POL 8 5 AAGGCCGCCUGUUGGUGGGCAG
Figure imgf000023_0001
POL 9 5 UAAGACAGCAGUACAAAUGGCA
The ribozymes are inserted into four different HIV vectors (pH4 (10), pH6, pH4J, or pH6J) (Figure 1). In pH4 and pH6, transcription of the ribozymes is driven by an internal
HCMV promoter (9). From pH4J and pH6J, the ribozymes are expressed from the 5'
LTR. The major difference between pH4 and pH6 (and pH4J and pH6J) resides in the 3' -22-
LTR in the production plasmid. pH4 and pH4J have the HIV U3 in the 3' LTR. pH6 and pH6J have HCMV in the 3'LTR. The HCMV promoter replaces most of the U3 and will drive expression at high constitutive levels while the HIV-1 U3 will support a high level of expression only in the presence of Tat.
The HCMV/HIV-1 hybrid 3' LTR is created by recombinant PCR with three PCR primers (Figure 2). The first round of PCR is performed with RIB1 and RIB2 using pH4 (12) as the template to amplify the HIV-1 HXB2 sequence 8900-9123. The second round of PCR makes the junction between the 5' end of the HIV-1 U3 and the HCMV promoter by amplifying the hybrid 5' LTR from pH4. The PCR product from the first PCR reaction and RIB 3 serves as the 5' primer and 3' primer respectively.
RIB1 5 ' -CAGCTGCTCGAGCAGCTGAAGCTTGCATGC-3 '
RIB2 5 ' -GTAAGTTATGTAACGGACGATATCTTGTCTTCTT-3 ' RIB3 5 ' -CGCATAGTCGACGGGCCCGCCACTGCTAGAGATTTTC-3 '
The PCR product is then cut with Sphl and Sail and inserted into pH4 thereby replacing the 3' LTR. The resulting plasmid is designated pH6. To construct pH4J and pH6J, the internal HCMV promoter (Spel - Xhol) in pH4 and pH6 is replaced with the polycloning site of pBluescript II KS+ (Stratagene) (Spel - Xhol).
The ribozymes are inserted into the Xhol sites in the genome vector backbones. Any ribozymes in any configuration could be used in a similar way.
Example 2 - Construction of a Packaging System
The packaging system can take various forms. In a first form of packaging system, the HIV gag, pol components are co-expressed with the HIV env coding sequence. In this case, both the gag, pol and the env coding sequences are altered such that they are resistant to the anti-HIV ribozymes that are built into the genome. At the same time as altering the codon usage to achieve resistance, the codons can be chosen to match the usage pattern of the most highly expressed mammalian genes. This dramatically increases expression -23- levels (28, 29) and so increases titre. A codon optimised HIV env coding sequence has been described by Haas et al (9). In the present example, a modified codon optimised HIV env sequence is used (SEQ I.D. No. 3). The corresponding env expression plasmid is designated pSYNgplόOmn. The modified sequence contains extra motifs not used by Haas et al. The extra sequences were taken from the HIV env sequence of strain MN and codon optimised. Any similar modification of the nucleic acid sequence would function similarly as long as it used codons corresponding to abundant tRNAs (42) and lead to resistance to the ribozymes in the genome.
In one example of a gag, pol coding sequence with optimised codon usage, overlapping oligonucleotides are synthesised and then ligated together to produce the synthetic coding sequence. The sequence of a wild-type (Genbank accession no. K03455) and synthetic (gagpol-SYNgp) gagpol sequence is shown in SEQ I.D. Nos 1 and 2, respectively and their codon usage is shown in Figures 3 and 4, respectively. The sequence of a wild type env coding sequence (Genbank Accession No. Ml 7449) is given in SEQ I.D. No 3, the sequence of a synthetic codon optimised sequence is given in SEQ. I.D. No. 4 and their codon usage tables are given in Figures 5 and 6, respectively. As with the env coding sequence any gag, pol sequence that achieves resistance to the ribozymes could be used. The synthetic sequence shown is designated gag, pol-SYNgp and has an EcoRI site at the 5' end and a Notl site at the 3' end. It is inserted into pClneo (Promega) to produce plasmid pSYΝgp.
In a second form of the packaging system a synthetic gag, pol cassette is coexpressed with a non-HIV envelope coding sequence that produces a surface protein that pseudotypes HIV. This could be for example VSV-G (20, 41), amphotropic MLV env (6, 34) or any other protein that would be incorporated into the HIV particle (37). This includes molecules capable of targeting the vector to specific tissues. Coding sequences for non- HIV envelope proteins not cleaved by the ribozymes and so no sequence modification is required (although some sequence modification may be desirable for other reasons such as optimisation for codon usage in mammalian cells). -24-
Example 3 - Vector Particle Production
Vector particles can be produced either from a transient three-plasmid transfection system similar to that described by Soneoka et al. (33) or from producer cell lines similar to those used for other retroviral vectors (20, 35, 39). These principles are illustrated in Figures 7 and 8. For example, by using pH6Rz, pSYNgp and pRV67 (VSV-G expression plasmid) in a three plasmid transfection of 293T cells (Figure 8), as described by Soneoka et al (33), vector particles designated H6Rz-VSV are produced. These transduce the H6Rz genome to CD4+ cells such as C1866 or Jurkat and produce the multitarget ribozymes. HIV replication in these cells is now severely restricted.
All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.
-25-
References
1. Bahner, I., K. Kearns, Q. L. Hao, E. M. Smogorzewska, and D. B. Kohn. 1996. Transduction of human CD34+ hematopoietic progenitor cells by a retroviral vector expressing an RRE decoy inhibits human immunodeficiency virus type 1 replication in myelomonocytic cells produced in long-term culture. J Virol. 70:4352-60.
2. Blomer, U., L. Naldini, T. Kafri, D. Trono, I. M. Verma, and F. H. Gage. 1997. Highly efficient and sustained gene transfer in adult neurons with a lentivirus vector. J Virol. 71 :6641-6649. 3. Breaker, R.R. and Joyce, G.F. 1994. Inventing and improving ribozyme function: rational design versus interactive selection methods. TIBTECH. 12: 268-75.
4. Buchschacher, G. L., Jr., and A. T. Panganiban. 1992. Human immunodeficiency virus vectors for inducible expression of foreign genes. J Virol. 66:2731-2739.
5. Chen, C. J., A. C.:Banerjea, G. G. Harmison, K. Haglund, and M. Schubert. 1992. Multitarget-ribozyme directed to cleave at up to nine highly conserved HIV-1 env RNA regions inhibits HIV-1 replication-potential effectiveness against most presently sequenced HIV-1 isolates. Nucleic Acids Res. 20:4581-9.
6. Chesebro, B., K. Wehrly, and W. Maury. 1990. Differential expression in human and mouse cells of human immunodeficiency virus pseudotyped by murine retroviruses. J Virol. 64:4553-7.
7. Couture, L.A. and Stinchcomb, D.T. 1996. Anti-gene therapy: the use of ribozymes to inhibit gene function. TIG 12: 510-5.
8. Dropulic, B., M. Hermankova, and P. M. Pitha. 1996. A conditionally replicating HIV-1 vector interferes with wild-type HIV-1 replication and spread. Proc Natl Acad Sci U S A. 93:11103-8.
9. Foecking, M. K., and H. Hofstetter. 1986. Powerful and versatile enhancer- promoter unit for mammalian expression vectors. Gene. 45:101-105.
10. Gervaix, A., X. Li, G. Kraus, and F. Wong Staal. 1997. Multigene antiviral vectors inhibit diverse human immunodeficiency virus type 1 clades. J Virol. 71 : 3048-53. 11. Haas, J., E.-C. Park, and B. Seed. 1996. Codon usage limitation in the expression of HIV-1 envelope glycoprotein. Current Biology. 6:315. -26-
12. Kim, V. N., K. Mitrophanous, S. M. Kingsman, and K. A. J. 1998. Minimal Requirement for a Lentiviral Vector Based on Human Immunodeficiency Virus Type 1. J Virol 72: 811-816.
13. Larsson, S., G. Hotchkiss, J. Su, T. Kebede, M. Andang, T. Nyholm, B. Johansson, A. Sonnerborg, A. Vahine, S. Britton, and L. Ahrlund Richter. 1996. A novel ribozyme target site located in the HIV-1 nef open reading frame. Virology. 219: 161
14. Lever, A. M. 1995. Gene therapy for HIV infection. Br Med Bull. 51 :149-66.
15. Liu, D., J. Donegan, G. Nuovo, D. Mitra, and J. Laurence. 1997. Stable human immunodeficiency virus type 1 (HIV-1) resistance in transformed CD4+ monocytic cells treated with multitargeting HIV-1 antisense sequences incorporated into Ul snRNA. J Virol. 71:4079-85.
16. Malim, M. H., S. Bohnlein, J. Hauber, and B. R. Cullen. 1989. Functional dissection of the HIV-1 Rev trans-activator-derivation of a trans-dominant repressor of Rev function. Cell. 58:205-14. 17. Miller, N., and J. Whelan. 1997. Progress in transcriptionally targeted and regulatable vectors for genetic therapy. Hum Gene Ther. 8:803-15.
18. Naldini, L., U. Blomer, F. H. Gage, D. Trono, and 1. M. Verma. 1996. Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci U S A. 93:11382-11388. 19. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, 1. M. Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector [see comments]. Science. 272:263-7.
20. Ory, D. S., B. A. Neugeboren, and R. C. Mulligan. 1996. A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes. Proc Natl Acad Sci U S A. 93 : 11400-6.
21. Paik, S. Y., A. Banerjea, C. J. Chen, Z. Ye, G. G. Harmison, and M. Schubert. 1997. Defective HIV-1 provirus encoding a multitarget-ribozyme inhibits accumulation of spliced and unspliced HIV-1 mRNAs, reduces infectivity of viral progeny, and protects the cells from pathogenesis. Hum Gene Ther. 8:1115-24. 22. Poeschla, E., P. Corbeau, and F. Wong Staal. 1996. Development of HIV vectors for anti-HIV gene therapy. Proc Natl Acad Sci U S A. 93:11395-9. -27-
23. Poznansky, M., A. Lever, L. Bergeron, W. Haseltine, and J. Sodroski. 1991. Gene transfer into human lymphocytes by a defective human immunodeficiency virus type 1 vector. J Virol. 65:532-6.
24. Ramezani, A., and S. Joshi. 1996. Comparative analysis of five highly conserved target sites within the HIV-1 RNA for their susceptibility to hammerhead ribozyme- mediated cleavage in vitro and in vivo. Antisense Nucleic Acid Drug Dev. 6:229-35.
25. Riddell, S. R., M. Elliott, D. A. Lewinsohn, M. J. Gilbert, L. Wilson, S. A. Manley, S. D. Lupton, R. W. Overell, T. C. Reynolds, L. Corey, and P. D. Greenberg. 1996. T-cell mediated rejection of gene-modified HIV specific cytotoxic T lymphocytes in HlV-infected patients [see comments]. Nat Med. 2:216-23.
26. Ruffner, D. E., S. C. Dahm, and O. C. Uhlenbeck. 1989. Studies on the hammerhead RNA self-cleaving domain. Gene. 82:31-41.
27. Sarver, N., E. M. Cantin, P. S. Chang, J. A. Zaia, P. A. Ladne, D. A. Stephens, and J. J. Rossi. 1990. Ribozymes as potential anti-HIV-1 therapeutic agents. Science. 247:1222.
28. Schneider, R., M. Campbell, G. Nasioulas, B. K. Felber, and G. N. Pavlakis. 1997. Inactivation of the human immunodeficiency virus type 1 inhibitory elements allows Rev- independent expression of Gag and Gag/protease and particle formation. J Virol. 71 :4892- 903. 29. Schwartz, S., M. Campbell, G. Nasioulas, J. Harrison, B. K. Felber, and G. N. Pavlakis.1992. Mutational inactivation of an inhibitory sequence in human immunodeficiency virus type 1 results in Rev-independent gag expression. J Virol. 66:7176-82.
30. Scott, W.G. and Klug, A. 1996. Ribozymes: structure and mechanism in RNA catalysis. TIBS. 21 : 220-4.
31. Sczakiel, G., and M. Pawlita. 1991. Inhibition of human immunodeficiency virus type 1 replication in human T cells stably expressing antisense RNA. J Virol. 65:468-72.
32. Shimada, T., H. Fujii, H. Mitsuya, and A. W. Nienhuis. 1991. Targeted and highly efficient gene transfer into CD4+ cells by a recombinant human immunodeficiency virus retroviral vector. Journal of Clinical Investigation. 88: 1043-47. -28-
33. Soneoka, Y., P. M. Cannon, E. E. Ramsdale, J. C. Griffiths, G. Romano, S. M. Kingsman, and A. J. Kingsman. 1995. A transient threeplasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res. 23:628-33.
34. Spector, D. H., E. Wade, D. A. Wright, V. Koval, C. Clark, D. Jaquish, and S. A. Spector. 1990. Human immunodeficiency virus pseudotypes with expanded cellular and species tropism. J Virol. 64:2298-2308.
35. Srinivasakumar, N., N. Chazal, C. Helga Maria, S. Prasad, M. L. Hammarskjold, and D. Rekosh. 1997. The effect of viral regulatory protein expression on gene delivery by human immunodeficiency virus type 1 vectors produced in stable packaging cell lines. J Virol. 71 :5841-8.
36. Sun, L. Q., L. Wang, W. L. Gerlach, and G. Symonds. 1995. Target sequence- speciEc inhibition of HIV- 1 replication by ribozymes directed to tat RNA. Nucleic Acids Res. 23:2909-13.
37. Valsesia Wittmann, S., A. Drynda, G. Deleage, M. Aumailley, J. M. Heard, O. Danos, G. Verdier, and F. L. Cosset. 1994. Modifications in the binding domain of avian retrovirus envelope protein to redirect the host range of retroviral vectors. J Virol. 68:4609- 19.
38. Yamada, O., G. Kraus, M. C. Leavitt, M. Yu, and F. Wong Staal. 1994. Activity and cleavage site specificity of an anti-HIV- 1 hairpin ribozyme in human T cells. Virology. 205:121-6.
39. Yu, H., A. B. Rabson, M. Kaul, Y. Ron, and J. P. Dougherty. 1996. Inducible human immunodeficiency virus type 1 packaging cell lines. J Virol. 70:4530-37.
40. Zhou, C, I. Bahner, J. J. Rossi, and D. B. Kohn.1996. Expression of hammerhead ribozymes by retroviral vectors to inhibit HIV-1 replication: comparison of RNA levels and viral inhibition. Antisense Nucleic Acid Drug Dev. 6: 17-24.
41. Zhu, Z. H., S. S. Chen, and A. S. Huang. 1990. Phenotypic mixing between human immunodeficiency virus and vesicular stomatitis virus or herpes simplex virus. J Acquir Immune Defic Syndr. 3:215-9.
42. Zolotukhin, S., M. Potter, W. W. Hauswirth, J. Guy, and N. Muzyczka. 1996. A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells. J Virol. 70:4646-54. -29-
43. Zufferey, R., D. Nagy, R. J. Mandel, L. Naldini, and D. Trono. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol.l 5 : 871-875.
44. Goodchild, J., V. Kohli. 1991. Ribozymes that cleave an RNA sequence from human immunodeficiency virus: the effect of flanking sequence on rate. Arch Biochem
Biophys Feb 1; 284(2):386-391.
45. Hertel, Klemens J., Alessio PeracchI, Olke C. Uhlenbeck and Daniel Herschlag. 1997. Use of intrinsic binding energy for catalysis by an RNA enzyme. Proc. Natl. Acad. Sci. USA Vol. 94, pp. 8497-8502, August. 46. Bender et al, 1987, J Virol 61: 1639-1646
47. Pear et al, 1993, Proc Natl Acad Sci 90: 8392-8396
48. Cosset et al., 1995, J. Virol. 69: 7430-7436

Claims

-30-CLAIMS
1. A viral vector system comprising:
(i) a first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles; and
(ii) a third nucleotide sequence encoding said viral polypeptide required for the assembly of viral particles, which third nucleotide sequence has a different nucleotide sequence to the second nucleotide sequence such that the third nucleotide sequence, or transcription product thereof, is resistant to cleavage directed by said gene product.
2. A viral vector production system comprising:
(i) a viral genome comprising at least one first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles;
(ii) a third nucleotide sequence encoding said viral polypeptide required for the assembly of the viral genome into viral particles, which third nucleotide sequence has a different nucleotide sequence to the second nucleotide sequence such that said third nucleotide sequence, or transcription product thereof, is resistant to cleavage directed by said gene product.
3. A system according to claim 1 or 2 wherein the gene product is selected from a ribozyme and an anti-sense ribonucleic acid.
4. A system according to any one of claims 1 to 3 wherein the viral vector is a retroviral vector.
5. A system according to claim 4 wherein the retroviral vector is a lentiviral vector.
6. A system according to claim 5 wherein the lentiviral vector is an HIV vector. ,,1,H ' PCT/GB99/00325
-31-
7. A system according to any one of claims 4 to 6 wherein the polypeptide required for the assembly of viral particles is selected from gag, pol and env proteins.
8. A system according to claim 7 wherein at least the gag and pol proteins are from a lenti virus.
9. A system according to claim 7 wherein the env protein is from a lenti virus.
10. A system according to claim 8 or 9 wherein the lentivirus is HIV.
11. A system according to any one of the preceding claims wherein the third nucleotide sequence is resistant to cleavage directed by the gene product as a result of one or more conservative alterations in the nucleotide sequence which remove cleavage sites recognised by the at least one gene product and/or binding sites for the at least one gene product
12. A system according to any one of claims 1 to 10 wherein the third nucleotide sequence is adapted to be resistant to cleavage by the at least one gene product.
13. A system according to any one of the preceding claims wherein the third nucleotide sequence is codon optimised for expression in producer cells.
14. A system according to claim 13, wherein the producer cells are mammalian cells.
15. A system according to any one of the preceding claims comprising a plurality of first nucleotide sequences and third nucleotide sequences as defined therein.
16. A viral particle comprising a viral vector genome as defined in any one of claims 2 to 15 and one or more third nucleotide sequences as defined in any of claims 2 to 15.
17. A viral particle produced using a viral vector production system according to any one of claims 2 to 15. -32-
18. A method for producing a viral particle which method comprises introducing into a host cell (i) a viral genome as defined in any one of claims 2 to 15 (ii) one or more third nucleotide sequences as defined in any of claims 2 to 15 and (iii) nucleotide sequences encoding the other essential viral packaging components not encoded by the one or more third nucleotide sequences.
19. A viral particle produced by the method of claim 18.
20. A pharmaceutical composition comprising a viral particle according to claims 16, 17 or 19 together with a pharmaceutically acceptable carrier or diluent.
21. A viral system according to any one of claims 1 to 16 or a viral particle according to claims 16, 17 or 19 in treating a viral infection.
22. A viral system according to any one of claims 1 to 16 for use in a method of producing viral particles.
PCT/GB1999/000325 1998-02-17 1999-02-17 Anti-viral vectors WO1999041397A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
DE69935714T DE69935714T2 (en) 1998-02-17 1999-02-17 ANTI-VIRAL VECTORS
JP2000531578A JP2002503477A (en) 1998-02-17 1999-02-17 Antiviral vector
EP99904956A EP1054988B1 (en) 1998-02-17 1999-02-17 Anti-viral vectors
AU25274/99A AU757284B2 (en) 1998-02-17 1999-02-17 Anti-viral vectors
CA002321097A CA2321097A1 (en) 1998-02-17 1999-02-17 Anti-viral vectors
US09/552,950 US6541248B1 (en) 1998-02-17 2000-04-20 Anti-viral vectors
US10/351,938 US7790419B2 (en) 1998-02-17 2003-01-27 Antiviral vectors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB9803351.7 1998-02-17
GBGB9803351.7A GB9803351D0 (en) 1998-02-17 1998-02-17 Anti-viral vectors

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US09/552,950 Continuation-In-Part US6541248B1 (en) 1998-02-17 2000-04-20 Anti-viral vectors

Publications (1)

Publication Number Publication Date
WO1999041397A1 true WO1999041397A1 (en) 1999-08-19

Family

ID=10827139

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1999/000325 WO1999041397A1 (en) 1998-02-17 1999-02-17 Anti-viral vectors

Country Status (10)

Country Link
US (2) US6541248B1 (en)
EP (2) EP1790658A3 (en)
JP (1) JP2002503477A (en)
CN (1) CN1297486A (en)
AT (1) ATE358732T1 (en)
AU (1) AU757284B2 (en)
CA (1) CA2321097A1 (en)
DE (1) DE69935714T2 (en)
GB (1) GB9803351D0 (en)
WO (1) WO1999041397A1 (en)

Cited By (113)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000039302A2 (en) * 1998-12-31 2000-07-06 Chiron Corporation Improved expression of hiv polypeptides and production of virus-like particles
WO2000039304A2 (en) * 1998-12-31 2000-07-06 Chiron Corporation Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof
WO2000055341A1 (en) * 1999-03-17 2000-09-21 Oxford Biomedica (Uk) Limited Anti-viral vectors
WO2001036614A2 (en) * 1999-11-16 2001-05-25 Geneart Gmbh Gessellschaft Für Angewandte Biotechnologie The genome of the hiv-1 inter-subtype (c/b') and use thereof
WO2001079518A2 (en) 2000-04-19 2001-10-25 Oxford Biomedica (Uk) Limited Codon optimisation for expression in retrovirus packaging cells
WO2002024897A2 (en) * 2000-09-22 2002-03-28 Virxsys Conditionally replicating viral vectors and their use
EP1320621A2 (en) * 2000-09-15 2003-06-25 Merck & Co., Inc. Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol, nef and modifications
WO2003064665A2 (en) 2002-02-01 2003-08-07 Oxford Biomedica (Uk) Limited Viral vector
EP1535995A1 (en) * 1998-12-31 2005-06-01 Chiron Corporation Polynucleotides encoding the antigenic HIV type C env polypeptide and uses thereof
US6969598B2 (en) 2001-04-30 2005-11-29 Oxford Biomedica (Uk) Limited Methods for producing high titre vectors and compositions used in such methods
US7427474B2 (en) 2001-01-25 2008-09-23 Virxsys Corporation High-throughput methods for identifying gene function using lentiviral vectors
EP2020450A1 (en) * 2000-09-01 2009-02-04 Gen-Probe Incorporated Amplification of HIV-1 sequences for detection of sequences associated with drug-resistance mutations
US7618642B2 (en) 2000-07-05 2009-11-17 Novartis Vaccines And Diagnostics, Inc. Expression cassettes encoding modified human immunodeficiency virus type 1 subtype C envelope glycoproteins
EP2180057A1 (en) 2000-10-06 2010-04-28 Oxford Biomedica (UK) Limited Vector system
US7790419B2 (en) 1998-02-17 2010-09-07 Oxford Biomedica (Uk) Ltd. Antiviral vectors
US8043611B2 (en) 2001-10-30 2011-10-25 Virxsys Corporation Regulated nucleic acid expression system
US8133494B2 (en) 2001-07-05 2012-03-13 Novartis Vaccine & Diagnostics Inc Expression cassettes endcoding HIV-1 south african subtype C modified ENV proteins with deletions in V1 and V2
WO2012075337A2 (en) 2010-12-01 2012-06-07 Spinal Modulation, Inc. Directed delivery of agents to neural anatomy
WO2013061076A1 (en) 2011-10-28 2013-05-02 Oxford Biomedica (Uk) Limited Construct
WO2016042461A1 (en) 2014-09-15 2016-03-24 Molmed Spa Chimeric antigen receptors
WO2016063264A1 (en) 2014-10-24 2016-04-28 Ospedale San Raffaele S.R.L. Permanent epigenetic gene silencing
WO2016100389A1 (en) * 2014-12-16 2016-06-23 Synthetic Genomics, Inc. Compositions of and methods for in vitro viral genome engineering
WO2017091786A1 (en) 2015-11-23 2017-06-01 Novartis Ag Optimized lentiviral transfer vectors and uses thereof
EP3192874A1 (en) 2008-06-18 2017-07-19 Oxford BioMedica (UK) Limited Virus purification
EP3318285A1 (en) 2016-11-08 2018-05-09 Oxford University Innovation Limited Treatment of eye disease
WO2018099933A1 (en) 2016-12-01 2018-06-07 Nestec S.A. Methods of modulating fam46a
EP3375876A1 (en) 2017-03-13 2018-09-19 Evonetix Ltd Method for producing double stranded polynucleotides based on oligonucleotides with selected and different melting temperatures
WO2018178247A1 (en) 2017-03-31 2018-10-04 Nestec S.A. Methods of modulating ank1
WO2018193119A1 (en) 2017-04-21 2018-10-25 Ospedale San Raffaele S.R.L. Gene therapy
WO2018197492A1 (en) 2017-04-24 2018-11-01 Ospedale San Raffaele S.R.L. Tcr and peptides
GB201900687D0 (en) 2019-01-17 2019-03-06 King S College London Immunotherapeutic methods and compositions
WO2019068854A1 (en) 2017-10-06 2019-04-11 Ospedale San Raffaele S.R.L. Gene therapy of neurodegenerative diseases using aav vectors
WO2019079488A1 (en) 2017-10-17 2019-04-25 Nightstarx Limited Prenylation assay
WO2019101490A1 (en) 2017-11-21 2019-05-31 Nestec S.A. Methods of modulating alk
EP3502260A1 (en) 2017-12-22 2019-06-26 Oxford BioMedica (UK) Limited Retroviral vector
WO2019134866A1 (en) 2018-01-03 2019-07-11 Molmed Spa Chimeric antigen receptors containing optimal spacer region
WO2019222403A2 (en) 2018-05-15 2019-11-21 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
WO2019219308A1 (en) 2018-05-17 2019-11-21 Societe Des Produits Nestle S.A. Methods of modulating nkx6.3
WO2019229109A1 (en) 2018-05-30 2019-12-05 Glycostem Therapeutics B.V. Car nk cells
EP3587582A1 (en) 2013-10-24 2020-01-01 Adaptimmune Limited Vectors for transgene expression
WO2020014209A1 (en) 2018-07-09 2020-01-16 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
WO2020044055A1 (en) 2018-08-31 2020-03-05 King's College London Engineered regulatory t cell
WO2020089433A2 (en) 2018-10-31 2020-05-07 Ospedale San Raffaele S.R.L Tcr and peptides
EP3650548A1 (en) 2013-12-20 2020-05-13 Oxford BioMedica (UK) Limited Viral vector production system
WO2020102485A1 (en) 2018-11-14 2020-05-22 Flagship Pioneering Innovations V, Inc. Fusosome compositions for hematopoietic stem cell delivery
WO2020102503A2 (en) 2018-11-14 2020-05-22 Flagship Pioneering Innovations V, Inc. Fusosome compositions for t cell delivery
WO2020102499A2 (en) 2018-11-14 2020-05-22 Flagship Pioneering Innovations V, Inc. Fusosome compositions for cns delivery
WO2020128478A1 (en) 2018-12-19 2020-06-25 King's College London Immunotherapeutic methods and compositions
WO2020169974A1 (en) 2019-02-19 2020-08-27 King's College London Hypoxia-responsive chimeric antigen receptors
WO2020183374A1 (en) 2019-03-10 2020-09-17 Axovant Sciences Gmbh Gene therapy compositions and methods for treating parkinson's disease
WO2020212448A1 (en) 2019-04-15 2020-10-22 Ospedale San Raffaele S.R.L. Gene therapy
WO2020239964A1 (en) 2019-05-28 2020-12-03 Ospedale San Raffaele S.R.L. Agents and methods for treating viral infections
GB202018657D0 (en) 2020-11-26 2021-01-13 Ospedale San Raffaele Srl Agents and methods for increasing liver immune response
EP3786176A1 (en) 2015-10-28 2021-03-03 Syncona Investment Management Limited Gene therapy
WO2021038249A1 (en) 2019-08-30 2021-03-04 King's College London Engineered regulatory t cell
WO2021046143A1 (en) 2019-09-03 2021-03-11 Sana Biotechnology, Inc. Cd24-associated particles and related methods and uses thereof
GB202102637D0 (en) 2021-02-24 2021-04-07 Quell Therapeutics Ltd Engineered regulatory t cell
WO2021094752A1 (en) 2019-11-12 2021-05-20 Oxford Biomedica (Uk) Limited Production system
WO2021160993A1 (en) 2020-02-13 2021-08-19 Oxford Biomedica (Uk) Limited Production of lentiviral vectors
EP3868892A1 (en) 2016-03-10 2021-08-25 Nightstarx Limited Prenylation assay
WO2021170666A1 (en) 2020-02-25 2021-09-02 Quell Therapeutics Limited Chimeric receptors for use in engineered cells
DE102020111571A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. WPRE MUTANT CONSTRUCTS, COMPOSITIONS, AND RELATED PROCEDURES
WO2021181108A1 (en) 2020-03-13 2021-09-16 Oxford Biomedica (Uk) Limited Lentiviral vectors
DE102020106710A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. WPRE MUTANT CONSTRUCTS, COMPOSITIONS, AND RELATED PROCEDURES
WO2021202604A1 (en) 2020-03-31 2021-10-07 Sana Biotechnology, Inc. Targeted lipid particles and compositions and uses thereof
WO2021222222A1 (en) 2020-04-27 2021-11-04 Mccray Jr Paul B Compositions and methods for the treatment of cystic fibrosis
WO2021229075A2 (en) 2020-05-14 2021-11-18 Ospedale San Raffaele S.R.L. Epidermal growth factor receptor
WO2021229242A1 (en) 2020-05-15 2021-11-18 Oxford Biomedica (Uk) Limited Viral vector production
GB202114530D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Retroviral vectors
GB202114532D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Lentiviral Vectors
GB202114529D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Lentiviral vectors
WO2021236852A1 (en) 2020-05-20 2021-11-25 Sana Biotechnology, Inc. Methods and compositions for treatment of viral infections
WO2022043483A1 (en) 2020-08-27 2022-03-03 Quell Therapeutics Limited Nucleic acid constructs for expressing polypeptides in cells
WO2022047316A1 (en) 2020-08-28 2022-03-03 Sana Biotechnology, Inc. Modified anti-viral binding agents
WO2022101617A1 (en) 2020-11-10 2022-05-19 Oxford Biomedica (Uk) Limited Preparation of a solution of polymer/nucleic acid complexes
WO2022136874A1 (en) 2020-12-23 2022-06-30 Quell Therapeutics Limited Inducible signalling protein
WO2022150731A1 (en) 2021-01-11 2022-07-14 Sana Biotechnology, Inc. Use of cd8-targeted viral vectors
WO2022162247A1 (en) 2021-02-01 2022-08-04 Epsilen Bio S.R.L. Gene silencing
WO2022171902A1 (en) 2021-02-15 2022-08-18 Ospedale San Raffaele S.R.L. Epigenetic silencing for treatment of cancer
WO2022238556A1 (en) 2021-05-12 2022-11-17 Fondazione Telethon Vector system
WO2022251712A1 (en) 2021-05-28 2022-12-01 Sana Biotechnology, Inc. Lipid particles containing a truncated baboon endogenous retrovirus (baev) envelope glycoprotein and related methods and uses
WO2023015217A1 (en) 2021-08-04 2023-02-09 Sana Biotechnology, Inc. Use of cd4-targeted viral vectors
WO2023047100A1 (en) 2021-09-21 2023-03-30 Quell Therapeutics Ltd Anti-trem2 chimeric antigen receptor
WO2023047098A2 (en) 2021-09-21 2023-03-30 Quell Therapeutics Ltd Anti-p75ntr chimeric antigen receptor
WO2023062359A2 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Novel viral regulatory elements
WO2023062363A1 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2023077107A1 (en) 2021-10-29 2023-05-04 Sana Biotechnology, Inc. Methods and reagents for amplifying viral vector nucleic acid products
WO2023099886A1 (en) 2021-11-30 2023-06-08 Quell Therapeutics Limited Signalling protein
WO2023115041A1 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae attachment glycoproteins
WO2023115039A2 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae fusion glycoproteins
WO2023114949A1 (en) 2021-12-16 2023-06-22 Sana Biotechnology, Inc. Methods and systems of particle production
WO2023118878A1 (en) 2021-12-22 2023-06-29 Quell Therapeutics Limited Constitutive cytokine receptors
EP4209511A1 (en) 2022-01-05 2023-07-12 Gyala Therapeutics Sociedad Limitada Anti-cd84 antibodies amd chimeric antigen receptors
WO2023131657A1 (en) 2022-01-05 2023-07-13 Gyala Therapeutics Sociedad Limitada Anti-cd84 antibodies and chimeric antigen receptors
WO2023133595A2 (en) 2022-01-10 2023-07-13 Sana Biotechnology, Inc. Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023150647A1 (en) 2022-02-02 2023-08-10 Sana Biotechnology, Inc. Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023150518A1 (en) 2022-02-01 2023-08-10 Sana Biotechnology, Inc. Cd3-targeted lentiviral vectors and uses thereof
WO2023193015A1 (en) 2022-04-01 2023-10-05 Sana Biotechnology, Inc. Cytokine receptor agonist and viral vector combination therapies
EP4269426A1 (en) 2022-04-29 2023-11-01 Ospedale San Raffaele S.r.l. Gene therapy
EP4303226A1 (en) 2022-07-08 2024-01-10 Ospedale San Raffaele S.r.l. Transgene cassettes and epigenetic silencers for the treatment of disorders
WO2024008950A1 (en) 2022-07-08 2024-01-11 Ospedale San Raffaele S.R.L. Transgene cassettes
WO2024026377A1 (en) 2022-07-27 2024-02-01 Sana Biotechnology, Inc. Methods of transduction using a viral vector and inhibitors of antiviral restriction factors
WO2024033544A1 (en) 2022-08-12 2024-02-15 Ospedale San Raffaele S.R.L. Deglycosylation of native glycoproteins expressed on a tumor cell surface
WO2024038266A1 (en) 2022-08-16 2024-02-22 Oxford Biomedica (Uk) Limited Envelope proteins
WO2024044655A1 (en) 2022-08-24 2024-02-29 Sana Biotechnology, Inc. Delivery of heterologous proteins
WO2024064838A1 (en) 2022-09-21 2024-03-28 Sana Biotechnology, Inc. Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof
WO2024081820A1 (en) 2022-10-13 2024-04-18 Sana Biotechnology, Inc. Viral particles targeting hematopoietic stem cells
WO2024100294A1 (en) 2022-11-11 2024-05-16 Ospedale San Raffaele S.R.L. Cdh17 car
WO2024100145A1 (en) 2022-11-08 2024-05-16 Ospedale San Raffaele S.R.L. Polynucleotide and vector
WO2024110751A1 (en) 2022-11-24 2024-05-30 Quell Therapeutics Limited Constitutively active chimeric antigen receptor for treg cell survival and/or persistence
WO2024119157A1 (en) 2022-12-02 2024-06-06 Sana Biotechnology, Inc. Lipid particles with cofusogens and methods of producing and using the same
WO2024133472A1 (en) 2022-12-22 2024-06-27 Quell Therapeutics Limited Constitutive cytokine receptors
EP4403580A1 (en) 2023-01-23 2024-07-24 Medizinische Hochschule Hannover Anti-entpd3 chimeric antigen receptor

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8202846B2 (en) 2000-03-16 2012-06-19 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
JP2003526367A (en) * 2000-03-16 2003-09-09 ジェネティカ インコーポレイテッド RNA interference method and RNA interference composition
GB0526211D0 (en) * 2005-12-22 2006-02-01 Oxford Biomedica Ltd Viral vectors
WO2008134879A1 (en) 2007-05-04 2008-11-13 University Health Network Il-12 immunotherapy for cancer
US20090088625A1 (en) * 2007-10-01 2009-04-02 Kenneth Oosting Photonic Based Non-Invasive Surgery System That Includes Automated Cell Control and Eradication Via Pre-Calculated Feed-Forward Control Plus Image Feedback Control For Targeted Energy Delivery
US10106816B2 (en) * 2012-12-14 2018-10-23 Case Western Reserve University Genomic RNA packaging enhancer element
WO2023064860A1 (en) * 2021-10-13 2023-04-20 The Cleveland Clinic Foundation Mrna vaccine design via the alteration of codon usage

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0612844A2 (en) * 1993-02-25 1994-08-31 Ortho Pharmaceutical Corporation Expression constructs containing HIV inhibitory antisense and other nucleotide sequences, retroviral vectors and recombinant retroviruses containing same
EP0759471A1 (en) * 1994-05-10 1997-02-26 Hisamitsu Pharmaceutical Co., Inc. Recombinant human immunodeficiency virus vector and process for producing the same
WO1997020060A1 (en) * 1995-11-28 1997-06-05 The Johns Hopkins University School Of Medicine Conditionally replicating viral vectors and their use

Family Cites Families (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2038247T5 (en) 1987-07-29 2009-11-06 Basf Lacke + Farben Ag ELECTROINMERSION WATERPROOF BATHS CONTAINING CATHYDICALLY PRECIPITABLE SYNTHETIC RESINS AND PROCEDURE FOR THE COATING OF ELECTRICAL DRIVING SUBSTRATES.
EP0689601B1 (en) 1993-02-22 2006-10-04 The Rockefeller University Production of high titer helper-free retroviruses by transient transfection
US5834256A (en) 1993-06-11 1998-11-10 Cell Genesys, Inc. Method for production of high titer virus and high efficiency retroviral mediated transduction of mammalian cells
ES2297831T3 (en) 1994-05-09 2008-05-01 Oxford Biomedica (Uk) Limited RETROVIRIC VECTORS THAT PRESENT A REDUCED RECOMBINATION RATE.
US6013517A (en) 1994-05-09 2000-01-11 Chiron Corporation Crossless retroviral vectors
US5786464C1 (en) * 1994-09-19 2012-04-24 Gen Hospital Corp Overexpression of mammalian and viral proteins
US5795737A (en) * 1994-09-19 1998-08-18 The General Hospital Corporation High level expression of proteins
WO1996037781A1 (en) * 1995-05-26 1996-11-28 Asahi Kasei Kogyo Kabushiki Kaisha Method for assaying antibody inhibiting reverse transcriptase activity
US6013516A (en) 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
GB9525639D0 (en) 1995-12-15 1996-02-14 Isis Innovation Improved retroviral vectors
WO1997027310A1 (en) 1996-01-23 1997-07-31 Oxford Biomedica (Uk) Limited Retroviral vector and its use in gene therapy
JP2000505299A (en) 1996-02-22 2000-05-09 メルク エンド カンパニー インコーポレーテッド Synthetic HIV gene
ATE424463T1 (en) 1996-05-06 2009-03-15 Oxford Biomedica Ltd RECOMBINATION-INCAPABLE RETROVIRAL VECTORS
US6114148C1 (en) 1996-09-20 2012-05-01 Gen Hospital Corp High level expression of proteins
GB9621680D0 (en) 1996-10-17 1996-12-11 Oxford Biomedica Ltd Lentiviral vectors
ES2153654T3 (en) 1996-10-17 2001-03-01 Oxford Biomedica Ltd RETROVIRAL VECTORS.
US6696291B2 (en) * 1997-02-07 2004-02-24 Merck & Co., Inc. Synthetic HIV gag genes
EE9900343A (en) * 1997-02-07 2000-02-15 Merck & Co., Inc. Synthetic Polynucleotide, Immune Response Method, Immunogenic Composition, Anti-HIV Immune Response Induction Method, Antigen-Inducing Cell Indication, and Pharmaceutical Composition
AU741747B2 (en) 1997-05-13 2001-12-06 University Of North Carolina At Chapel Hill, The Lentivirus-based gene transfer vectors
CN1322137C (en) 1997-12-22 2007-06-20 牛津生物医学(英国)有限公司 Equine infections anaemia virus (EIAV) based
GB9803351D0 (en) 1998-02-17 1998-04-15 Oxford Biomedica Ltd Anti-viral vectors
WO2000015819A1 (en) 1998-09-11 2000-03-23 The Children's Medical Center Corporation Packaging cell lines for hiv-derived retroviral vector particles
US6958226B1 (en) * 1998-09-11 2005-10-25 The Children's Medical Center Corp. Packaging cells comprising codon-optimized gagpol sequences and lacking lentiviral accessory proteins
GB9825524D0 (en) 1998-11-20 1999-01-13 Oxford Biomedica Ltd Vector
JP2002533124A (en) 1998-12-31 2002-10-08 カイロン コーポレイション Improved expression of HIV polypeptide and generation of virus-like particles
GB9906177D0 (en) 1999-03-17 1999-05-12 Oxford Biomedica Ltd Anti-viral vectors
WO2000065076A2 (en) 1999-04-26 2000-11-02 K.U. Leuven Research & Development Synthetic gene for expressing active retroviral protein in eukaryotes
GB9923558D0 (en) 1999-10-05 1999-12-08 Oxford Biomedica Ltd Producer cell

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0612844A2 (en) * 1993-02-25 1994-08-31 Ortho Pharmaceutical Corporation Expression constructs containing HIV inhibitory antisense and other nucleotide sequences, retroviral vectors and recombinant retroviruses containing same
EP0759471A1 (en) * 1994-05-10 1997-02-26 Hisamitsu Pharmaceutical Co., Inc. Recombinant human immunodeficiency virus vector and process for producing the same
WO1997020060A1 (en) * 1995-11-28 1997-06-05 The Johns Hopkins University School Of Medicine Conditionally replicating viral vectors and their use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
VANDENDRIESSCHE T ET AL: "Inhibition of clinical human immunodeficiency virus (HIV) type 1 isolates in primary CD4+ T lymphocytes by retroviral vectors expressing anti-HIV genes", JOURNAL OF VIROLOGY, vol. 69, no. 7, July 1995 (1995-07-01), AMERICAN SOCIETY FOR MICROBIOLOGY US, pages 4045 - 4052, XP002109322 *

Cited By (159)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7790419B2 (en) 1998-02-17 2010-09-07 Oxford Biomedica (Uk) Ltd. Antiviral vectors
EP1980617A1 (en) * 1998-12-31 2008-10-15 Novartis Vaccines and Diagnostics, Inc. Improved expression of HIV polypeptides and production of virus-like particles
WO2000039302A3 (en) * 1998-12-31 2001-01-04 Chiron Corp Improved expression of hiv polypeptides and production of virus-like particles
WO2000039304A3 (en) * 1998-12-31 2001-01-18 Chiron Corp Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof
EP2206785A1 (en) * 1998-12-31 2010-07-14 Novartis Vaccines and Diagnostics, Inc. Improved expression of HIV polypeptides and production of virus-like particles
US7935805B1 (en) 1998-12-31 2011-05-03 Novartis Vaccines & Diagnostics, Inc Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof
WO2000039304A2 (en) * 1998-12-31 2000-07-06 Chiron Corporation Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof
WO2000039302A2 (en) * 1998-12-31 2000-07-06 Chiron Corporation Improved expression of hiv polypeptides and production of virus-like particles
EP1535995A1 (en) * 1998-12-31 2005-06-01 Chiron Corporation Polynucleotides encoding the antigenic HIV type C env polypeptide and uses thereof
US7943375B2 (en) 1998-12-31 2011-05-17 Novartis Vaccines & Diagnostics, Inc Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
WO2000055341A1 (en) * 1999-03-17 2000-09-21 Oxford Biomedica (Uk) Limited Anti-viral vectors
GB2363794A (en) * 1999-03-17 2002-01-09 Oxford Biomedica Ltd Anti-viral vectors
US6783981B1 (en) 1999-03-17 2004-08-31 Oxford Biomedica (Uk) Limited Anti-viral vectors
US7323557B2 (en) 1999-11-16 2008-01-29 Geneart Ag Genome of the HIV-1 inter-subtype (C/B') and use thereof
WO2001036614A3 (en) * 1999-11-16 2002-02-28 Geneart Gmbh Gessellschaft Fue The genome of the hiv-1 inter-subtype (c/b') and use thereof
WO2001036614A2 (en) * 1999-11-16 2001-05-25 Geneart Gmbh Gessellschaft Für Angewandte Biotechnologie The genome of the hiv-1 inter-subtype (c/b') and use thereof
US7332588B1 (en) 1999-11-16 2008-02-19 Geneart Ag Genome of the HIV-1 inter-subtype (C/B) and use thereof
AP1674A (en) * 1999-11-16 2006-10-30 Geneart Ag The genome of the HIV-1 inter-subtype (C/B') and use thereof.
EP2194137A3 (en) * 2000-04-19 2010-07-28 Oxford BioMedica (UK) Limited Cells comprising codon optimized retroviral particles
AU2001248619B2 (en) * 2000-04-19 2006-06-15 Oxford Biomedica (Uk) Limited Method
EP2194137A2 (en) 2000-04-19 2010-06-09 Oxford BioMedica (UK) Limited Cells comprising codon optimized retroviral particles
WO2001079518A3 (en) * 2000-04-19 2002-05-16 Oxford Biomedica Ltd Codon optimisation for expression in retrovirus packaging cells
JP2004508808A (en) * 2000-04-19 2004-03-25 オックスフォード バイオメディカ(ユーケイ)リミテッド Codon optimization for expression in retrovirus packaging cells
WO2001079518A2 (en) 2000-04-19 2001-10-25 Oxford Biomedica (Uk) Limited Codon optimisation for expression in retrovirus packaging cells
US7618642B2 (en) 2000-07-05 2009-11-17 Novartis Vaccines And Diagnostics, Inc. Expression cassettes encoding modified human immunodeficiency virus type 1 subtype C envelope glycoproteins
EP2020450A1 (en) * 2000-09-01 2009-02-04 Gen-Probe Incorporated Amplification of HIV-1 sequences for detection of sequences associated with drug-resistance mutations
EP1320621A4 (en) * 2000-09-15 2005-11-23 Merck & Co Inc Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol, nef and modifications
EP1320621A2 (en) * 2000-09-15 2003-06-25 Merck & Co., Inc. Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol, nef and modifications
WO2002024897A3 (en) * 2000-09-22 2003-07-31 Virxsys Conditionally replicating viral vectors and their use
WO2002024897A2 (en) * 2000-09-22 2002-03-28 Virxsys Conditionally replicating viral vectors and their use
EP2180057A1 (en) 2000-10-06 2010-04-28 Oxford Biomedica (UK) Limited Vector system
US7427474B2 (en) 2001-01-25 2008-09-23 Virxsys Corporation High-throughput methods for identifying gene function using lentiviral vectors
US6969598B2 (en) 2001-04-30 2005-11-29 Oxford Biomedica (Uk) Limited Methods for producing high titre vectors and compositions used in such methods
US9598469B2 (en) 2001-07-05 2017-03-21 Novartis Vaccines And Diagnostics, Inc. HIV-1 south african subtype C env proteins
US8133494B2 (en) 2001-07-05 2012-03-13 Novartis Vaccine & Diagnostics Inc Expression cassettes endcoding HIV-1 south african subtype C modified ENV proteins with deletions in V1 and V2
US8043611B2 (en) 2001-10-30 2011-10-25 Virxsys Corporation Regulated nucleic acid expression system
JP2010263904A (en) * 2002-02-01 2010-11-25 Oxford Biomedica (Uk) Ltd Viral vector
WO2003064665A2 (en) 2002-02-01 2003-08-07 Oxford Biomedica (Uk) Limited Viral vector
EP2348119A2 (en) 2002-02-01 2011-07-27 Oxford BioMedica (UK) Limited Multicistronic lentiviral vector
EP3192874A1 (en) 2008-06-18 2017-07-19 Oxford BioMedica (UK) Limited Virus purification
WO2012075337A2 (en) 2010-12-01 2012-06-07 Spinal Modulation, Inc. Directed delivery of agents to neural anatomy
WO2013061076A1 (en) 2011-10-28 2013-05-02 Oxford Biomedica (Uk) Limited Construct
EP3219801A1 (en) 2011-10-28 2017-09-20 Oxford BioMedica (UK) Limited Construct
EP3587582A1 (en) 2013-10-24 2020-01-01 Adaptimmune Limited Vectors for transgene expression
EP3650548A1 (en) 2013-12-20 2020-05-13 Oxford BioMedica (UK) Limited Viral vector production system
EP4159752A1 (en) 2014-09-15 2023-04-05 MolMed SpA Chimeric antigen receptors
US11299529B2 (en) 2014-09-15 2022-04-12 Agc Biologics S.P.A. Chimeric antigen receptors
WO2016042461A1 (en) 2014-09-15 2016-03-24 Molmed Spa Chimeric antigen receptors
EP3575315A1 (en) 2014-09-15 2019-12-04 MolMed SpA Chimeric antigen receptors
WO2016063264A1 (en) 2014-10-24 2016-04-28 Ospedale San Raffaele S.R.L. Permanent epigenetic gene silencing
US10711253B2 (en) 2014-12-16 2020-07-14 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering
US11913032B2 (en) 2014-12-16 2024-02-27 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering
US10221398B2 (en) 2014-12-16 2019-03-05 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering
EA038595B1 (en) * 2014-12-16 2021-09-21 Си3Джей ТЕРАПЬЮТИКС, ИНК. Compositions and methods for in vitro viral genome engineering
WO2016100389A1 (en) * 2014-12-16 2016-06-23 Synthetic Genomics, Inc. Compositions of and methods for in vitro viral genome engineering
US10837004B2 (en) 2014-12-16 2020-11-17 C3J Therapeutics, Inc. Compositions of and methods for in vitro viral genome engineering
EP3786176A1 (en) 2015-10-28 2021-03-03 Syncona Investment Management Limited Gene therapy
WO2017091786A1 (en) 2015-11-23 2017-06-01 Novartis Ag Optimized lentiviral transfer vectors and uses thereof
EP3868892A1 (en) 2016-03-10 2021-08-25 Nightstarx Limited Prenylation assay
EP3318285A1 (en) 2016-11-08 2018-05-09 Oxford University Innovation Limited Treatment of eye disease
WO2018099933A1 (en) 2016-12-01 2018-06-07 Nestec S.A. Methods of modulating fam46a
EP3375876A1 (en) 2017-03-13 2018-09-19 Evonetix Ltd Method for producing double stranded polynucleotides based on oligonucleotides with selected and different melting temperatures
WO2018167475A1 (en) 2017-03-13 2018-09-20 Evonetix Ltd Method for producing double stranded polynucleotides based on oligonucleotides with selected and different melting temperatures
WO2018178247A1 (en) 2017-03-31 2018-10-04 Nestec S.A. Methods of modulating ank1
CN110785488A (en) * 2017-04-21 2020-02-11 圣拉斐尔医院有限责任公司 Gene therapy
WO2018193119A1 (en) 2017-04-21 2018-10-25 Ospedale San Raffaele S.R.L. Gene therapy
US11597755B2 (en) 2017-04-24 2023-03-07 Ospedale San Raffaele S.R.L. TCR and peptides
WO2018197492A1 (en) 2017-04-24 2018-11-01 Ospedale San Raffaele S.R.L. Tcr and peptides
WO2019068854A1 (en) 2017-10-06 2019-04-11 Ospedale San Raffaele S.R.L. Gene therapy of neurodegenerative diseases using aav vectors
WO2019079488A1 (en) 2017-10-17 2019-04-25 Nightstarx Limited Prenylation assay
WO2019101490A1 (en) 2017-11-21 2019-05-31 Nestec S.A. Methods of modulating alk
EP3696272A1 (en) 2017-12-22 2020-08-19 Oxford BioMedica (UK) Limited Retroviral vector
EP3502260A1 (en) 2017-12-22 2019-06-26 Oxford BioMedica (UK) Limited Retroviral vector
EP3633040A1 (en) 2017-12-22 2020-04-08 Oxford BioMedica (UK) Limited Retroviral vector
WO2019134866A1 (en) 2018-01-03 2019-07-11 Molmed Spa Chimeric antigen receptors containing optimal spacer region
WO2019222403A2 (en) 2018-05-15 2019-11-21 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
WO2019219308A1 (en) 2018-05-17 2019-11-21 Societe Des Produits Nestle S.A. Methods of modulating nkx6.3
WO2019229109A1 (en) 2018-05-30 2019-12-05 Glycostem Therapeutics B.V. Car nk cells
WO2020014209A1 (en) 2018-07-09 2020-01-16 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
WO2020044055A1 (en) 2018-08-31 2020-03-05 King's College London Engineered regulatory t cell
WO2020089433A2 (en) 2018-10-31 2020-05-07 Ospedale San Raffaele S.R.L Tcr and peptides
WO2020102485A1 (en) 2018-11-14 2020-05-22 Flagship Pioneering Innovations V, Inc. Fusosome compositions for hematopoietic stem cell delivery
WO2020102499A2 (en) 2018-11-14 2020-05-22 Flagship Pioneering Innovations V, Inc. Fusosome compositions for cns delivery
WO2020102503A2 (en) 2018-11-14 2020-05-22 Flagship Pioneering Innovations V, Inc. Fusosome compositions for t cell delivery
WO2020128478A1 (en) 2018-12-19 2020-06-25 King's College London Immunotherapeutic methods and compositions
GB201900687D0 (en) 2019-01-17 2019-03-06 King S College London Immunotherapeutic methods and compositions
WO2020169974A1 (en) 2019-02-19 2020-08-27 King's College London Hypoxia-responsive chimeric antigen receptors
WO2020183374A1 (en) 2019-03-10 2020-09-17 Axovant Sciences Gmbh Gene therapy compositions and methods for treating parkinson's disease
WO2020212448A1 (en) 2019-04-15 2020-10-22 Ospedale San Raffaele S.R.L. Gene therapy
WO2020239964A1 (en) 2019-05-28 2020-12-03 Ospedale San Raffaele S.R.L. Agents and methods for treating viral infections
WO2021038249A1 (en) 2019-08-30 2021-03-04 King's College London Engineered regulatory t cell
WO2021046143A1 (en) 2019-09-03 2021-03-11 Sana Biotechnology, Inc. Cd24-associated particles and related methods and uses thereof
WO2021094752A1 (en) 2019-11-12 2021-05-20 Oxford Biomedica (Uk) Limited Production system
WO2021160993A1 (en) 2020-02-13 2021-08-19 Oxford Biomedica (Uk) Limited Production of lentiviral vectors
WO2021170666A1 (en) 2020-02-25 2021-09-02 Quell Therapeutics Limited Chimeric receptors for use in engineered cells
DE102020111571A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. WPRE MUTANT CONSTRUCTS, COMPOSITIONS, AND RELATED PROCEDURES
WO2021183643A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. Wpre mutant constructs, compositions and methods thereof
DE102020106710A1 (en) 2020-03-11 2021-09-16 Immatics US, Inc. WPRE MUTANT CONSTRUCTS, COMPOSITIONS, AND RELATED PROCEDURES
WO2021181108A1 (en) 2020-03-13 2021-09-16 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2021202604A1 (en) 2020-03-31 2021-10-07 Sana Biotechnology, Inc. Targeted lipid particles and compositions and uses thereof
WO2021222222A1 (en) 2020-04-27 2021-11-04 Mccray Jr Paul B Compositions and methods for the treatment of cystic fibrosis
WO2021229075A2 (en) 2020-05-14 2021-11-18 Ospedale San Raffaele S.R.L. Epidermal growth factor receptor
WO2021229242A1 (en) 2020-05-15 2021-11-18 Oxford Biomedica (Uk) Limited Viral vector production
WO2021236852A1 (en) 2020-05-20 2021-11-25 Sana Biotechnology, Inc. Methods and compositions for treatment of viral infections
WO2022043483A1 (en) 2020-08-27 2022-03-03 Quell Therapeutics Limited Nucleic acid constructs for expressing polypeptides in cells
WO2022047316A1 (en) 2020-08-28 2022-03-03 Sana Biotechnology, Inc. Modified anti-viral binding agents
EP4335458A2 (en) 2020-11-10 2024-03-13 Oxford BioMedica (UK) Limited Preparation of a solution of polymer/nucleic acid complexes
WO2022101617A1 (en) 2020-11-10 2022-05-19 Oxford Biomedica (Uk) Limited Preparation of a solution of polymer/nucleic acid complexes
EP4335457A2 (en) 2020-11-10 2024-03-13 Oxford BioMedica (UK) Limited Preparation of a solution of polymer/nucleic acid complexes
GB202018657D0 (en) 2020-11-26 2021-01-13 Ospedale San Raffaele Srl Agents and methods for increasing liver immune response
WO2022112522A1 (en) 2020-11-26 2022-06-02 Ospedale San Raffaele S.R.L. Agents and methods for increasing liver immune response
WO2022136874A1 (en) 2020-12-23 2022-06-30 Quell Therapeutics Limited Inducible signalling protein
WO2022150731A1 (en) 2021-01-11 2022-07-14 Sana Biotechnology, Inc. Use of cd8-targeted viral vectors
WO2022162247A1 (en) 2021-02-01 2022-08-04 Epsilen Bio S.R.L. Gene silencing
WO2022171902A1 (en) 2021-02-15 2022-08-18 Ospedale San Raffaele S.R.L. Epigenetic silencing for treatment of cancer
WO2022180152A1 (en) 2021-02-24 2022-09-01 Quell Therapeutics Limited Engineered regulatory t cell
GB202102637D0 (en) 2021-02-24 2021-04-07 Quell Therapeutics Ltd Engineered regulatory t cell
WO2022238556A1 (en) 2021-05-12 2022-11-17 Fondazione Telethon Vector system
WO2022251712A1 (en) 2021-05-28 2022-12-01 Sana Biotechnology, Inc. Lipid particles containing a truncated baboon endogenous retrovirus (baev) envelope glycoprotein and related methods and uses
WO2023015217A1 (en) 2021-08-04 2023-02-09 Sana Biotechnology, Inc. Use of cd4-targeted viral vectors
WO2023047100A1 (en) 2021-09-21 2023-03-30 Quell Therapeutics Ltd Anti-trem2 chimeric antigen receptor
WO2023047098A2 (en) 2021-09-21 2023-03-30 Quell Therapeutics Ltd Anti-p75ntr chimeric antigen receptor
WO2023062365A2 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Lentiviral vectors
GB202114529D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Lentiviral vectors
WO2023062363A1 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2023062366A1 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Retroviral vectors
WO2023062367A1 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2023062359A2 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Novel viral regulatory elements
GB202114530D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Retroviral vectors
GB202114532D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Lentiviral Vectors
WO2023077107A1 (en) 2021-10-29 2023-05-04 Sana Biotechnology, Inc. Methods and reagents for amplifying viral vector nucleic acid products
WO2023099886A1 (en) 2021-11-30 2023-06-08 Quell Therapeutics Limited Signalling protein
WO2023114949A1 (en) 2021-12-16 2023-06-22 Sana Biotechnology, Inc. Methods and systems of particle production
WO2023115041A1 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae attachment glycoproteins
WO2023115039A2 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae fusion glycoproteins
WO2023118878A1 (en) 2021-12-22 2023-06-29 Quell Therapeutics Limited Constitutive cytokine receptors
EP4209511A1 (en) 2022-01-05 2023-07-12 Gyala Therapeutics Sociedad Limitada Anti-cd84 antibodies amd chimeric antigen receptors
WO2023131657A1 (en) 2022-01-05 2023-07-13 Gyala Therapeutics Sociedad Limitada Anti-cd84 antibodies and chimeric antigen receptors
WO2023133595A2 (en) 2022-01-10 2023-07-13 Sana Biotechnology, Inc. Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023150518A1 (en) 2022-02-01 2023-08-10 Sana Biotechnology, Inc. Cd3-targeted lentiviral vectors and uses thereof
WO2023150647A1 (en) 2022-02-02 2023-08-10 Sana Biotechnology, Inc. Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023193015A1 (en) 2022-04-01 2023-10-05 Sana Biotechnology, Inc. Cytokine receptor agonist and viral vector combination therapies
EP4269426A1 (en) 2022-04-29 2023-11-01 Ospedale San Raffaele S.r.l. Gene therapy
WO2023209221A1 (en) 2022-04-29 2023-11-02 Ospedale San Raffaele S.R.L. Gene therapy
WO2024008966A1 (en) 2022-07-08 2024-01-11 Ospedale San Raffaele S.R.L. Transgene cassettes and epigenetic silencers for the treatment of disorders
WO2024008950A1 (en) 2022-07-08 2024-01-11 Ospedale San Raffaele S.R.L. Transgene cassettes
EP4303226A1 (en) 2022-07-08 2024-01-10 Ospedale San Raffaele S.r.l. Transgene cassettes and epigenetic silencers for the treatment of disorders
WO2024026377A1 (en) 2022-07-27 2024-02-01 Sana Biotechnology, Inc. Methods of transduction using a viral vector and inhibitors of antiviral restriction factors
WO2024033544A1 (en) 2022-08-12 2024-02-15 Ospedale San Raffaele S.R.L. Deglycosylation of native glycoproteins expressed on a tumor cell surface
WO2024038266A1 (en) 2022-08-16 2024-02-22 Oxford Biomedica (Uk) Limited Envelope proteins
WO2024044655A1 (en) 2022-08-24 2024-02-29 Sana Biotechnology, Inc. Delivery of heterologous proteins
WO2024064838A1 (en) 2022-09-21 2024-03-28 Sana Biotechnology, Inc. Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof
WO2024081820A1 (en) 2022-10-13 2024-04-18 Sana Biotechnology, Inc. Viral particles targeting hematopoietic stem cells
WO2024100145A1 (en) 2022-11-08 2024-05-16 Ospedale San Raffaele S.R.L. Polynucleotide and vector
WO2024100294A1 (en) 2022-11-11 2024-05-16 Ospedale San Raffaele S.R.L. Cdh17 car
WO2024110751A1 (en) 2022-11-24 2024-05-30 Quell Therapeutics Limited Constitutively active chimeric antigen receptor for treg cell survival and/or persistence
WO2024119157A1 (en) 2022-12-02 2024-06-06 Sana Biotechnology, Inc. Lipid particles with cofusogens and methods of producing and using the same
WO2024133472A1 (en) 2022-12-22 2024-06-27 Quell Therapeutics Limited Constitutive cytokine receptors
EP4403580A1 (en) 2023-01-23 2024-07-24 Medizinische Hochschule Hannover Anti-entpd3 chimeric antigen receptor

Also Published As

Publication number Publication date
ATE358732T1 (en) 2007-04-15
DE69935714D1 (en) 2007-05-16
EP1790658A3 (en) 2007-09-12
US6541248B1 (en) 2003-04-01
EP1054988A1 (en) 2000-11-29
AU757284B2 (en) 2003-02-13
JP2002503477A (en) 2002-02-05
US20040009603A1 (en) 2004-01-15
CA2321097A1 (en) 1999-08-19
EP1790658A2 (en) 2007-05-30
EP1054988B1 (en) 2007-04-04
AU2527499A (en) 1999-08-30
DE69935714T2 (en) 2007-12-27
US7790419B2 (en) 2010-09-07
CN1297486A (en) 2001-05-30
GB9803351D0 (en) 1998-04-15

Similar Documents

Publication Publication Date Title
EP1054988B1 (en) Anti-viral vectors
Li et al. Inhibition of HIV-1 infection by lentiviral vectors expressing Pol III-promoted anti-HIV RNAs
US6168953B1 (en) Genetic antiviral agents and methods for their use
EP1192265A1 (en) Anti-viral vectors
Sparacio et al. Generation of a flexible cell line with regulatable, high-level expression of HIV Gag/Pol particles capable of packaging HIV-derived vectors
EP3060668B1 (en) Vectors for transgene expression
Mautino et al. Enhanced inhibition of human immunodeficiency virus type 1 replication by novel lentiviral vectors expressing human immunodeficiency virus type 1 envelope antisense RNA
EP0871757B1 (en) Conditionally replicating viral vectors and their use
US20050221491A1 (en) In vivo selection method for determining inhibitory RNA molecules
Poluri et al. Genetic therapy for HIV/AIDS
US20020102537A1 (en) Retroviral production

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99805126.8

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 09552950

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 1999904956

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 25274/99

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2321097

Country of ref document: CA

Ref document number: 2321097

Country of ref document: CA

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: KR

WWP Wipo information: published in national office

Ref document number: 1999904956

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 25274/99

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 1999904956

Country of ref document: EP