Classifications

• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
  • A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
  • A01N37/44—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a nitrogen atom attached to the same carbon skeleton by a single or double bond, this nitrogen atom not being a member of a derivative or of a thio analogue of a carboxylic group, e.g. amino-carboxylic acids
  • A01N37/46—N-acyl derivatives
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]

Definitions

• Collectin is a collective term for proteins that have a sugar recognition region (CRD) and a collagen-like region that require Ca, and is thought to be involved in basic immunity against various microorganisms, including bacteria and viruses.
• -Collectins found so far include mannan-binding protein f (MBP), surfactant protein ⁇ (SP- ⁇ ) and surfactant protein D (SP-D), conglutinin, etc.
• the three basic structures form a subunit by forming a triflelix in the collagen-like region, and this subunit is further trimerized, tetramerized, Forms an oligomeric structure such as a hexamer:
• cell-mediated immune responses and specific antibody Force mechanism may be considered the largest defense system against invasion of pathogens, viruses, etc .: More recently, it has been suggested that lectins such as conglutinin impose a role on non-specific immune responses. It has been reported that it plays an important role in neutralizing and eliminating various microorganisms in children with poorly developed maternal antibodies and specific defense systems [Super et al., Lancet G. (Lancet), Vol. 2, pp.
• collectin is a material that is expected to have ffl properties in the elucidation of the biological defense mechanism and its utility as a bioactive drug substance, but it is a material ft. There is no report on its existence- [Indications of the invention]
• the present invention has been made in view of such circumstances, and has as its object to obtain a novel collectin that is expected to exhibit physiological activities such as antibacterial and antiviral activities in a human body. is there:
• ⁇ a collectin protein encoded by the polynucleotide described in 3 or ⁇ ,
• ⁇ a collectin protein comprising the amino acid sequence represented by SEQ ID NO: 2,
• a collectin protein comprising an amino acid sequence encoded by a polynucleotide having a nucleotide sequence represented by:
• one or more amino acids have a deletion, substitution, Z or addition amino acid sequence, and (1) a C a -required sugar recognition region (CRD); (2) a neck region; 3) A collectin protein that includes a collagen-like region and (4) a collectin protein containing an N-terminal region containing cysteine. 5) A novel collectin that has a characteristic structure of collectin and is different from those previously reported. Provides genes and proteins:
• FIG. 2 is a diagram showing the first half of the alignment of the amino acid sequences of the three collectins reported hitherto.
• FIG. 3 is a diagram showing the second half of the same alignment as FIG.
• FIG. 4 is a diagram (b) showing the name of each primer used to determine the nucleotide sequence of the novel collectin of the present invention, the nucleotide sequence read by a sequencer (b), and the obtained collectin 0RF.
• FIG. 7 is a diagram showing three types of collectins reported hitherto and the basic structure of the novel collectin of the present invention, namely, (a ) N-terminal region containing cysteine,
• FIG. 8 shows the result of the genomic Southern prayer of the novel collectin of the present invention:
• FIG. 9 shows various sets of humans showing the organ distribution of the novel collectin of the present invention.
• FIG. 10 shows various vertebrates, ie, (a) human, (b) monkey, (c) rat, (d) mouse, e) Results of genomic southern analysis in dogs, (f) puppies, (g) puppies, and (h) chicks- Figure 11 shows the genetic phylogenetic tree of various collectins. Yes: [Best mode for carrying out the invention]
• the probe in the above (3) has the following base sequence: TTTTGATGGAGGCTCCATACC (SEQ ID NO: 7) and
• CTGCCAACACACTCATCGCTG (SEQ ID NO: 8)
• SEQ ID NO: 8 In order to obtain a polynucleotide that encodes the desired collectin protein, it must be an amplification product of a PCR reaction performed using a primer having the nucleotide sequence represented by SEQ ID NO: 8. I like it,
• polynucleotide is preferably cl) NA c
• the protein of the present invention is expected to be derived from humans and to exhibit antibacterial and antiviral activities in humans, and is preferable in view of its usefulness as a bioactive drug substance. Therefore, the protein of the present invention is intended to be a human-derived collectin protein.When various human biological tissues were examined, it was found that a collectin protein considered to be useful was expressed in human liver. -The stringent hybridization conditions in (3) and (4) above were, for example, 5 X SSC (20 X SSC (3 M NaC), 0.3 M sodium citrate).
• the deletion, substitution, and / or addition of one or more amino acids in the above (1) means that the hydrophilicity / hydrophobicity, acidicity / basicity, group, etc. of the collectin protein are not significantly changed. Amino acid deletions and substitutions to the extent that the characteristics of the four regions (particularly (1) C + -requiring sugar recognition region (CKD) and (3) collagen-like region) have little change.
• substitution and ⁇ or addition based on the amino acid sequence and the structure of the collectin family protein reported so far, for example, (1) C ⁇ + -required sugar recognition region (CRD) and (2) neck region in ⁇ 1 () or so, (3) 1 to 100 approximately in the collagen-like region, preferably 1, and (4) Oite 21 to cysteine in ⁇ -terminal region and signal sequence containing () about the Amino acid Deletion, substitution and ⁇ or addition is considered its permissible operating:
• EST database search (Example 1), preparation of a screening probe (Example 2), screening of a human liver-derived cDII library (Example 3), nucleotide sequence analysis of a novel collectin Determination (Example 4), genomic Southern analysis of the novel collectin (Example 5), Northern analysis of various tissues of the novel collectin human (Example 6), and tissue analysis of the novel collectin in various animal species.
• genomic Southern analysis Example 7
• the genetic analysis of a novel collectin (Example 8) are described below.
• the clone was obtained from Hee-Sup Shin of Pohang Institute of Science & Technology (Pohang, Korea), which owns the clone from which this data is based: At approximately 600 hp, the 5 'end was subsequently incorporated into the nucleotide sequence shown in SEQ ID NO: 4, and the' end was incorporated into the plasmid pSK (-) (pBluescrip IISK (-)) at the Xhol site.
• T
• Example 2 Fabrication of a mouthpiece for screening
• the clones of the clones described above were cut out with EcoRI and Xhol, incorporated into pUC18, and subjected to a flyer (Pharmacia, M13 Universal Primer (SEQ ID NO: 5, 5'-fluorescein-CGACGTGTTAAAACGACGGCCAGT-3 ') and M13 Reverse Primer (sequence No .: 6, 5'-Fluorescein-CAGGAAACAGCTATGAC-3 '))
• the nucleotide sequence was determined by ::
• the reading frame was adjusted to the amino acid sequence of collectin, and the nucleotide sequence corresponding to the amino acid sequence that could be read therefrom was extracted.
• a digoxigenin (DK;)-labeled cDNA flower corresponding to this part ( Reverse primers, SEQ ID NO: 7 and Forward framers, SEQ ID NO: 8) were prepared using Applied Biosystems 392A DNA / RNA synthesizer.
• the DIG label was prepared using the PCR DIG probe synthesis kit (Behringer, Mannheim), and the reaction composition was as follows (the clone (F1-1006D) insert was replaced with EcoRI and Xh).
• PCR reaction is Toruichi: Using a Zymoryactor, 35 cycles of 1 minute at 92, 55 1 minute, and 72 C 2 minutes were performed ::
• Example 3 Screening of human liver-derived cD. ⁇ A library
• Escheric-hi co_H Y1090r-0.2 was cultured in an LB medium (10 mM MgS (and LB medium containing 0.2% maltose (1 g tribultone, 0.5 g yeast extract, 0.5 g NaCl / 100 ml)) at 37 for 16 hours.
• SM buffer 5.8 g NaCl 2 g gSO, 7110, 2 M Tris-HC) (pH 7.5) 25 ml 5 ml 1% gelatin / L 37C15
• Hybridization was performed at 55 C for 16 hours: After the hybridization was completed, the filter was washed with 2X SSC / 0.1% SDS solution for 5 minutes at room temperature. Washed twice, and washed twice at 55 : C with 0. ⁇ X SSC / ⁇ .1% SDS solution.Next, DIG buffer 1 (100 mM Tris-HC1, 150 mM NaCl ( SOS was removed for 1 minute with pH7.5)), and the filter was blocked with DIG buffer II (1% blocking agent, DIG buffer I) for 30 minutes.
• DIG buffer 1 100 mM Tris-HC1, 150 mM NaCl ( SOS was removed for 1 minute with pH7.5
• DIG buffer II 1% blocking agent, DIG buffer I
• DIG buffer 1 100 mM Tris-HCl, 100 mM NaCl (pH 9.5), 50 mM MgCl: 3
• concentration of Mg was increased by treating for 1 minute, and the color was developed using a solution of ⁇ / BCIP (manufactured by Wako Pure Chemical Industries, Ltd.) in DIG buffer 1] 1.
• Three positive clones were obtained Flags corresponding to these clones Cut a plate from the plate, add to a tube containing 1 ml of buffer solution, stir for 10 minutes, serially dilute with SM buffer solution, and culture in 0.1 ml of this diluted solution and mLB medium for
• Example 4 Determination of the nucleotide sequence of a novel human lectin
• the obtained DNA was used as type II, and the insert DNA was amplified with PC! Using TaKaRa LA PCR Kit Ver.2 (Takara Shuzo).
• the reaction composition of the PCR is as follows (top: 11 ⁇ l, 10 X LA PCR buffer II (Mg- 'not included): 2.5 ⁇ l, 25 mM gCl :: 5 ⁇ l, dNTP mix: 8 ⁇ l, 20 ⁇ gt11 Reverse primer (sequence No .: 9, 5′-TTGACACCAGACCAACTGGTAATG- ⁇ ′): 2.5 // U 20 ⁇ gtll Forward primer (SEQ ID NO: 1 (J, 5′-GGT (; GCGAC (; ACTCCTGGAGCCCG-3 ′)): ⁇ ⁇ LA Taq polymerase: 0.5 / 1, 11: 0: Added to a total volume of 501)
• the PCR reaction was carried out using a Gene Amp PCR System 9600 manufactured
• the excised fragment was incorporated into the pCR2.1 vector of the Invitrogen Inc. opening kit: The recombinant vector was transferred to the T0P10 cells in the Invitrogen Inc. Cloning Kit.
• Transformant The transformant was cultured in LB medium (100 ⁇ g / ml ambivicillin), and two types of each clone were prepared by alkaline SDS method (HL11-3M-U HL11-3-2, HLI 9- 1, HL11-9-2) was extracted, and the nucleotide sequence was determined using a Pharmaceutical Company's Folio Sequence Sequencing 'kit and F.
• 3MU0 5-fluorescein- 'rAATGGTAGCGACCGGCGCT-3' (SEQ ID NO: 11)
• 3MU1 -fluorescein-AAACCAATTTATACTCCT [; G-: r (SEQ ID NO: 12),
• 3MU2 5-fluorescein-AATATTGGCAAGACTGGGCC-: 3 '(SEQ ID NO: 13)
• 3MR1 -fluorescein-GATGATGTGTGTTGGCAG ⁇ -: 3' (SEQ ID NO: 14)
• 3MR2 5-fluorescein-GTATCTTCCACAATCACAGA-3 '(SEQ ID NO: 15),
• 3MR3 ⁇ -fluorescein-TTAATTCCTTTCGGCCCCAT-ii ′ (SEQ ID NO: 16),
• 3MR5 5-fluorescein-CATATCACCCAGTTCTCCTT-: V (SEQ ID NO: 18), 9U1: 5-fluorescein-AGCGAGGGATTAGGGAAACT (;-3 '(SEQ ID NO: 19),
• FIG. 4 (a) shows the obtained collectin 0RF, where GX-Y represents a collagen-like region.
• Figures 5 and 6 show the amino acid sequences of the three previously reported collectin proteins and the alignments of the amino acid sequences of the collectin proteins of the present invention, as in Figures 2 and 3, respectively.
• Example 5 Genomic Southern analysis of a novel collectin Genomic Southern analysis was performed to determine whether the gene of the novel collectin having the cD. ⁇ A sequence identified in Example 4 was a single-cole gene or a multicopy gene. Ivy:
• genomic DM extracted from placenta is digested with the restriction enzymes ££ RI, Hind ⁇ , Bamlll ⁇ Xbal or Sac1, and electrophoresed on a 0.7% agarose gel at 100 mA for 3 hours. After the electrophoresis, the membrane was transferred to a nylon membrane (Nitran 13N) to prepare a membrane for analysis. First, the gel after electrophoresis was immersed in 100 ml of 0.25 HC1 for 10 minutes and distilled.
• the membrane was washed twice with 20 ml of 2 ⁇ SSC; 0.1% SDS solution at room temperature for 5 minutes each, followed by 0.2 ⁇ SSC; 0.1% SDS solution 20 ml. Performed with shaking twice at 68 ml for 15 minutes each: 5 to remove SDS, DIG buffer I (1 (K) tn Tris-HC1, 150 mM NaCl (pH 7.5) ) Wash twice with 50 ml at room temperature for 1 minute, then block with 1 ml of DIG buffer 11 '(1.5% blocking agent, DIG buffer I) at room temperature for 1 hour. the c was then performed, 0.2% Tween20 for 30 minutes with anti DJ G Al force Rihosufata Ichize labeled antibody 10 ml that had been diluted 5000-fold with DIG buffer I containing, 0.2% '1 'ween
• I went twice. After immersion twice in 10 ml of DIG buffer III at room temperature for 3 minutes, transfer the membrane to the hybrid block, and dilute 1 () 0-fold with I) IG buffer 1 1 1 CSPD (registered trademark, Boehringer's Mannheim Co., Ltd., chemiluminescent substrate) is spread over the entire body, and instant film 5?
• IG buffer 1 1 1 CSPD registered trademark, Boehringer's Mannheim Co., Ltd., chemiluminescent substrate
• the mRNA was analyzed by Northern hybridization.
• a portion corresponding to 0RF of the d) NA sequence (SEQ ID NO: 1) of the obtained novel collectin 25 was prepared using a DIG RNA labeling kit (SP6 / T7, Boehringer-Mannheim).
• the membrane was prepared using Human Mu] tiplt 'Tissue-Northern (MTN) Blot (manufactured by Clontech), and the membrane was prepared from human (a) heart, b) brain, (c) placenta, (d) lung, (e) liver, ( ⁇ skeletal muscle, (g) kidney, and (h) (2 ⁇ g each of bovine / ⁇ RNA obtained from one spleen) Each was electrophoresed on a 1.2% formaldehyde-modified agarose gel, transferred to a nylon membrane with modified electric charge, and fixed by UV irradiation.
• MTN Human Mu] tiplt 'Tissue-Northern Blot
• hybridization was performed according to the following steps. First, the membrane was immersed in 2 ⁇ SSC for 5 minutes, and 10 ml of a hybridization solution (5 ⁇ SSC, 10 ⁇ Den Hearts solution, 10 ⁇ Perform the hybridization for 3 hours at 65 : C in mM sodium phosphate buffer (pH 6.5) 50% formamide, 0.5 / SDS, 0.1 mg / ml salmon sperm DNA) and probe ( (10 minutes, boiled for 10 minutes and quick-frozen with dry ice ethanol for 5 minutes), diluted with the hybridization solution to lg / ml, and used 2 ml of this solution at 65 18 for 18 hours. Hybridization was performed:
• the results are shown in FIG. 9.
• genomic Southern analysis was carried out.
• the cDNA sequence of the novel collectin was used.
• the part corresponding to 0RF is DIG-labeled using the DIG probe using a PCR DIG flow synthesis kit (Boehringer Mannheim), and the membrane is -BLOT (Clontech).
• the membranes were: (a) human (placenta), (b) Rhesus (kidney), (c) rat (Sprague-Dawley) (kidney HI), (d) mouse (Balb / c) (Kidney), (e) Dog (kidney), (f) Pepper (kidney), (g) Heron
• Genomic DNA obtained from the yeast (liver) were treated with the restriction enzyme EcoRI at 4 / g each, electrophoresed on an agarose gel, and then transferred to a nylon membrane with a modified charge. However, it is fixed by UV irradiation.
• hybridization was performed according to the following steps. First, the membrane was immersed in 2 ⁇ SSC for 5 minutes, and then subjected to brehybridization in 10 ml of ExpressHyb Hybridization Solution at 65 and C for 30 minutes. Then, freeze-treated the same probe as above and dilute to 10 ng / ml with ExpressHyb Hybridization Solution ';). Using 2 ml of this solution, hybridization was performed at 65 C for 1 hour.
• the membrane is washed twice with 20 ml of 2x SSC ⁇ 0.1% SDS solution for 5 minutes at room temperature, followed by 20 ml of 0.2x SSC ⁇ 0.1% S1] S solution Washed twice with DIG buffer 1 for 1 minute at room temperature to remove SDS, then at 50 C] with DK; Buffer II to remove SDS. ', Blocking was performed for 1 hour at room temperature.
• the mixture was treated for 30 minutes with 10 ml of the anti-DIG alkaline phosphatase-labeled antibody that had been diluted 5000-fold with Buffer I containing 0.2% Tween 20, and DK containing 0.2% Tween 20; Washing was performed twice with shaking using 50 ml of Buffer I at room temperature for 20 minutes.
• the collectin targeted for analysis was human. (Mannan binding protein)

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• Medicinal Chemistry (AREA)
• Genetics & Genomics (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Toxicology (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Engineering & Computer Science (AREA)
• Environmental Sciences (AREA)
• Wood Science & Technology (AREA)
• Dentistry (AREA)
• Plant Pathology (AREA)
• Pest Control & Pesticides (AREA)
• Agronomy & Crop Science (AREA)
• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (2)

Applications Claiming Priority (2)

Publications (1)

Family

ID=11773622

Family Applications (1)

Country Status (4)

Cited By (2)

Families Citing this family (5)

Family Cites Families (2)

• 1998
  • 1998-01-23 JP JP01128198A patent/JP3878737B2/ja not_active Expired - Fee Related
  • 1998-07-24 WO PCT/JP1998/003328 patent/WO1999037767A1/ja not_active Ceased
  • 1998-07-24 CA CA2319084A patent/CA2319084C/en not_active Expired - Fee Related
  • 1998-07-24 US US09/600,932 patent/US6787639B1/en not_active Expired - Fee Related

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events