WO1999034016A2

WO1999034016A2 - A method for identifying and characterizing cells and tissues

Info

Publication number: WO1999034016A2
Application number: PCT/IL1998/000625
Authority: WO
Inventors: Ben-Zion Vider
Original assignee: Genena Ltd.
Priority date: 1997-12-29
Filing date: 1998-12-28
Publication date: 1999-07-08
Also published as: WO1999034016A3; EP1042504A2; AU1681099A

Abstract

A method for determining the genetic proximity of two cells. The pattern of expression of genes in a selected family is determined in both cells and is a proximity index calculated based upon the patterns of gene expression. A large proximity index indicates that the two cells are genetically proximal to each other, while a small proximity index indicates that the two cells are genetically distant from each other.

Description

A METHOD FOR IDENTIFYING AND CHARACTERIZING CELLS AND TISSUES

FIELD OF THE INVENTION

The invention relates to diagnostic methods and more specifically to methods for characterizing cells.

BACKGROUND OF THE INVENTION

There are many situations in which it is important to be able to characterize a cell so as to be able to identify it. For example, during metastasis, tumorigenic cells leave their tissue of origin and migrate to other locations in the body where they are capable of forming secondary tumors. These tumors are thus derived from cells foreign to the surrounding host tissue. Effective treatment of these tumors relies, inter alia, on identifying the tissue of origin of the cells forming the tumor.

There are also situations when it is important to know whether the genetic status of a cell, (the combination of genes expressed in the cell) has been altered following a particular treatment, e.g. drugs, irradiation, transfection or prolonged culturing.

There are also cases when it is desirable to know whether a cell carries a genetic defect, for example in prenatal detection of genetic defects.

The few methods presently available for characterizing cells in order to determine their origin or genetic status are laborious and require a highly competent person to carry them out (e.g. evaluating histological stainings). Most of these techniques are only able to characterize cells on the basis of aberrations in chromosome morphology. The homeobox (HB) containing genes comprise a major group of genes known to play a key role in developmental processes. Their gene products, the homeoproteins, all contain a highly conserved 61 -amino acid homeobox domain, which forms a helix-turn-helix DNA-binding site. Sequences flanking the homeodomain possess activating or repressing functions.

HB genes are classified by several criteria including sequence homology within and adjacent to the homeodomain (HD), the developmental stages at which they are expressed, and the tissues in which they are expressed. The Drosophila homeobox genes have been shown to have a sequential pattern of expression during embryonic development, i.e. a specific set of homeobox genes are expressed at each developmental stage. The mammalian homologues of the single Hox gene cluster in Drosophila correspond to four mammalian

Hox gene clusters which is the largest group of mammalian HB genes. These genes form four clusters termed Hox A, B, C and D located on four different chromosomes and are characterized in having a size of less than 5 kB and comprising a single intron. Other groups of mammalian homeobox genes are also dispersed on different chromosomes but are typically larger (more than fifty kB) and have several introns. The involvement of the mammalian homeobox genes in various processes (e.g. malignancy) has been suggested (Vider et al, Biochem.

Biophys. Research Communications 232:742-748, 1997). However, to date, the analysis of the expression of genes belonging to this family has typically focused on the expression of a specific gene in various cells or under different conditions.

Enzymes of the eukaryotic protein kinase superfamily catalyze the reversible transfer of the γ-phosphate from ATP to the amino acid side chains of proteins. The state of phosphorylation of a protein can have profound effects on its activity and its ability to interact with other proteins. Protein - j -

kinases are thus involved in many aspects of cellular regulation and metabolism. The catalytic domains of the eukaryotic protein kinases are 250 to 300 amino acids in length with 12 highly conserved subdomains. Phylogenetic analysis of the catalytic domains has revealed five main groups in the protein kinase super family.

The mitogen-activated protein kinase (MAPK) family is one family in the serine threonine kinase super family. This family is involved in the signal transduction pathways of cell cycle regulated events. MAPKs are extracellular signal-regulated kinases (ERKs), that are activated by phosphorylation on their theonine and tyrosine residues. Protein tyrosine kinases (PTK) are also known to play important roles in oncogenesis. Many PTKs form the cytoplasmic moiety of various membrane receptors.

The present invention provides a method for characterizing a cell by means of a genetic proximity index. The method is based upon the pattern of expression of genes in a selected gene family. The method of the invention may be used for example for determining the origin of a cell, its genetic status, whether it carries a genetic defect, or whether it is transformed.

SUMMARY OF THE INVENTION In the following description and set of claims the term "gene family " will denote a set of genes present in the cells of an organism whose gene products have an homology with one another of at least 70%. Examples of such gene families are the homeobox gene family and the kinase gene family.

The term "pattern of gene expression " of a selected gene family in a cell will refer to a set of genes of the gene family expressed in the cell.

The present invention is based on the novel finding that a particular cell of an organism expresses a unique combination of genes from a selected gene family. This pattern of gene expression thus serves as a signature of the cell. The expression pattern of the gene family in a particular cell will sometimes herein be referred to as the genetic status of the cell. Thus, in accordance with the invention, it was shown that cells orisinatins from a specific organ demonstrate a characteristic pattern of expression of genes from a selected gene family while cells originating from organs of different embryonic origin express a different pattern of expression of genes from the same gene family.

The method of the invention is based on comparing the expression pattern of a selected gene family in a first cell to that in a second cell. Generally, the number of genes in the gene family expressed in both of the two cells is compared to the total number of genes in the family expressed in at least one of them. The larger the number of genes from the selected gene family expressed in both cell types, the greater the likelihood that the first and second cells are of a similar origin.

For the first time, in accordance with the present invention, the expression pattern of genes in a selected family of a first cell is compared with that of a second cell by means of a "proximity index " which enables a person versed in the art to easily compare various characteristics of the two cells including for example their origin and genetic status.

For the calculation of the proximity index between a first cell and a second cell for a selected gene family, the expression level of each gene in the gene family is quantitatively determined for each of the two cells, for example, as described in the examples below. The proximity index I between the two cells for the selected gene family is then calculated according to the expression:

wherein aj and b_; are the expression level of the gene i in the first and second cell, respectively, and the summations are performed over all genes i in the gene family.

The proximity index I is a number between 0 and 1 , inclusive. A proximity index of 0 means that the two cells do not express any genes from the selected family in common, indicating for example that the two cells are of different origins. An index of 1 means that the cells express an identical set of genes from the selected family, indicating for example a high probability that the two cells have a common origin. The present invention thus provides a method for determining the genetic proximity of a first cell and a second cell comprising the steps of:

(a) obtaining said first cell and said second cell;

(b) determining in said first cell and said second cell the pattern of expression of genes in a selected gene family; (c) calculating a proximity index I, wherein

∑min(α,.,b,.)

∑max(α,.,b.)

wherein a; and bj are the expression level of the gene i in the first and second cell, respectively, and the summations are performed over all genes i in the gene family.

A large proximity index indicating that said first cell and said second cell are genetically proximal to each other, a small proximity index indicating that said first cell and said second cell are genetically distant from each other.

The expression pattern of the selected gene family in one of the two cells may be determined before the method of the invention is carried out on the second cell. In this case, the expression pattern of the first cell may be provided in accordance with the invention e.g. in the form of a catalogue. The expression pattern of the second cell when subsequently determined by the method of the invention may be compared to that of the first cell provided in the catalogue so as to allow calculation of the proximity index of the two cells. It should be noted that, while the expression pattern of the genes in a given family is essentially the same in all cells of a particular origin, there may be some variability, for example in cells obtained from individuals of different genetic backgrounds. Thus, when using a predetermined expression pattern of a cell minor adaptations may occasionally be necessary.

Alternatively, the gene expression pattern of the two cells may be determined simultaneously by the method of the invention.

In order to determine the pattern of expression of genes from the selected gene family in a cell, any of the methods known in the art for detecting gene expression in cells may be used, such as for example one of the methods described in Sambrook et al. (Sambrook et al. in: Molecular Cloning, A Laboratory Manual, Coldspring Harbour Laboratory. Coldspring Harbour Lab. Press, USA, 1989). In addition, there are a number of commercially available kits which may be used to determine the genetic expression pattern of cells in accordance with the invention.

By a preferred embodiment, gene expression is determined in tested or reference cells using the reverse transcriptase (RT) PCR (RT-PCR) method. RNA samples from the tested cells are first reverse transcribed and the cDNA products are then used as templates for PCR using conserved primers or primers specific for each of the genes.

Typically, a first stage of the method of the invention involves rapid screening for gene expression followed by a second stage involving a more specific analysis. For the rapid screening, PCR is performed in the presence of primers designed to complement conserved regions in the gene family. In the case of the HB genes, for example, the primers used may be complementary to regions of the genes or to regions of dispersed homeobox genes.

For the specific analysis. PCR is performed using sense primers specific to a given gene in the family and internal to the upstream sense primers used in the rapid screening stage. The conserved antisense primers used in the first screening stage may also be used in the second specific stage if either the sequence upstream or downstream to the gene is specific. A more detailed explanation of the above two stages used in accordance with the invention to determine the genetic status of a tested cell is explained in more detail below in the Examples. Lists of the primers used in accordance with the invention are also provided below. However, the primers included in the lists should not be construed as limiting and any primer as defined above may be used in the method of the invention. The relative expression level of genes in a cell used in the calculation of the proximity index may be determined for example by comparing the level of expression of the genes to that of a standard gene. Alternatively, the expression level of the genes may be determined as follows. Sense and antisense primers designed to match conserved sequences in the gene family are used to obtain PCR products of several different genes in the gene family. These PCR products are ligated to a cloning vector and propagated in an appropriate bacterial host. The colonies are isolated and the clones sequenced. The total number of clones sequenced in each of the two cells must be the same. The identity of the PCR products is determined and the number of clones of each gene represents its relative expression in the PCR reaction. When the proximity index I between two cells is calculated from relative expression levels obtained by this procedure, a; and bj are the number of clones of gene /^' isolated from the first and second cell, respectively. Sequencing the PCR products may optionally be simplified by utilizing the fact that within conserved sequences there are nonetheless nucleotides specific for each particular gene. It is thus only necessary to sequence a fragment of about 30 bp within the sequence to be able to identify every PCR product by using databank sequences. A sequencing procedure capable of separating 200-300 bp is thus able to analyze about 10 different stranded PCR products.

In accordance with the invention it has also been found that the genetic status of a cell as determined by the expression pattern of a selected gene family may undergo specific and detectable changes following exposure of the cells to a given treatment such as irradiation, drugs, exposure to growth factors, gene transfection, etc. The genetic status of a cell may also change spontaneously, for example, during the transition from the fetal stage to the adult stage. The method of the invention may therefore be used for determining whether a treatment has altered the genetic status of a cell by calculating the proximity index of the cell before having been exposed to the treatment and the same cell after having been exposed to the treatment.

The present invention is based on the further finding that the set of genes in a given family expressed by a transformed cell may be different from that of its untransformed counterpart. The invention may therefore be used for determining whether a cell is transformed by calculating the proximity index of a cell and its^' untransformed counterpart.

In accordance with the invention, it has also been found that the expression pattern of a selected gene family in a cell may be abnormal in cases where the cell carries a genetic defect in its genome. The method of the invention may therefore be used for detecting the presence of a selected genetic defect in the genome of a cell by calculating the proximity index of the cell and a cell of the same type not having the genetic defect. In one embodiment of the invention, a genetic defect in an unborn fetus is detected by calculating the proximity index of an amniotic cell of the fetus obtained for example by amniocentesis and a cell of the same type obtained from a fetus not having a genetic defect.

By yet another aspect of the present invention, it has been realized that cells expressing a particular set of genes in a given gene family may possess a specific phenotype. Thus, it may be possible to alter the phenotype of a cell by transfecting it with a set of genes known to give rise to a desired phenotype. For example, it is known that placental cells are capable of producing and secreting a number of hormones useful in various therapeutic applications. Following identification of the set of genes from a selected gene family expressed in these cells, it is possible, in accordance with the invention, to transfect with the identified set of genes cells that normally do not produce these hormones or produce them in small quantities so as to obtain cells capable of producing the desired hormones in large quantities. In other cases, the transfection of a specific set of genes into target cells may result in their transdifferentiation into cells having a desired property. For example, human placental cells may be transfected with a set of HB genes causing them to differentiate into adrenal or kidney cells having close genetic proximity. This would be useful, for example, for maintaining tissues in a tissue or organ bank. The tissue may be maintained in the form which is easiest to grow or maintain in culture and made" to transdifferentiate into the desired tissue according to transplantation needs.

Thus, by yet another aspect of the invention, there is provided a method for obtaining cells capable of expressing an HB related desired property comprising the steps of: (a) identifying a specific pattern of expression of HB genes in cells having a desired property;

(b) transfecting said identified set of HB genes into target cells lacking said desired property under conditions enabling expression of said HB cells in said target cells, said transfection resulting in expression of said desired property in said transfected cells.

By another of its aspects, the present invention provides a kit for carrying out the method of the invention comprising: (a) means for obtaining the mRNA from said first cell and said second cell;

(b) means for performing the reverse transcriptase polymer chain reaction on the mRNA obtained from said first cell and said second cell;

(c ) means for detecting the genes of said selected gene family expressed in said first cell and in said second cell;

(d) instructions for carrying out the method.

The invention also provides a kit for carrying out the invention comprising:

(a) means for obtaining the mRNA from said first cell; (b) means for performing the reverse transcriptase polymer chain reaction on the mRNA obtained from said first cell;

(c) means for detecting the genes of said selected gene family expressed in said first cell;

(d) a catalogue providing the genes of said selected gene family expressed in said second cell;

(e) instructions for carrying out the method.

BRIEF DESCRIPTION OF THE FIGURES

The invention will now be demonstrated by way of non-limiting examples with reference to the following figures in which:

Figs. 1 A-D are photographs showing the expression pattern of the conserved HOX PCR products detected using the primers shown in List 1 below, in which (A) is from placenta, (B) is from S. nigra, (C) is from normal colon and (D) is from tumorous colon. The primers used were in Lane 1 HOX 1(+) and HOX l(-). in Lane 2 HOX 1(+) and HOX 2(-), in Lane 3 HOX 2(+) and HOX l (-), in Lane 4 HOX 2(+) and HOX 2(-), in Lane 5 HOX 3(+) and HOX l(-), in Lane 6 HOX 3(+) and HOX 2(-), and M is the molecular weight standards. Figs. 1 E-G are photographs showing the expression pattern of the conserved HOX PCR products detected using the primers shown in List 4. The OCT 1 * and PBX* PCR products also separated on these gels. E- Adrenal, F- Fetal Brain, G- Adult Brain. The primers used were, Lane 1 : 1(+)1(-), Lane 2: l(+)2(-), Lane 3: 2(+)l(-), Lane 4: 2(+)2(-), Lane 5: 3(+)l(-), Lane 6: 3(+)2(-), Lane 7: OCT 1, Lane 8: PBX 1, Lane 9: marker Low DNA Mass Ladder, Lane 10: φX174RF DNA/Hae III.

Figs. 2 A-C are photographs showing the expression pattern of several HOX genes obtained by reverse transcriptase of RNAs using specific HOX oligo -dT primers (List 2) in which A, B, C and D are as described above for Fig. 1. The primers used were in Lane 1 is A5, Lane 2 A7, Lane 3 Al l, Lane 4 A13, Lane 5 B l, Lane 6 B2, Lane 7 B3, Lane 8 B6,7, Lane 9 C5, Lane 10 C8, Lane 11 C12, Lane 12 C13, and Lane 13 D3.

Figs. 3 A-B are photographs showing the expression pattern of dispersed homeobox genes using primers of List 3 in which A and B are as described above for Fig. 1. The primers used Lane 1 is EVE2, Lane 2 MSXl, Lane 3 MSX2, Lane 4 OCT, Lane 5 PAX, Lane 6 CFB1, Lane 7 LFB3, Lane 8 Bicoid, Lane 9 Goosecoid, Lane 10 Engrailed, Lane 11 EMX, Lane 12 OTX, Lane 14 OTX, Lane 14 CDX, Lane M PUC 19 Hea II.

Figs. 3C-G are. photographs showing the expression pattern of several other dispersed homebox genes using primers of list 3.

C- Placenta: Lane 1 is OCT 1 *, Lane 2 is PBX 1 *, Lanes 3 and 4 are empty, Lane 5 is Bicoid, Lane 6 s Engrailed, Lane 7 is DLX a, Lane 8 is DLX b, Lane 9 is DLX c, Lane 10 is DLX d. Lane 11 is GBX, Lane 12 is MEI, Lane 13 is P HOX, Lane 14 is PROX 1, Lane 15 is marker Low DNA Mass Ladder. Land 16 is φX174 RF DNA/Hae III.

D- Fetal Kidney: Lane 1 is OCT 1*, Lane 2 is PBX 1 *, Lane 3 is OCT,

Lane 4 is CDX, Lane 5 is Bicoid, Lane 6 is Engrailed. Lane 7 is DLX a, Lane 8 is DLX b, Lane 9 is DLX c, Lane 10 is DLX d, Lane 11 is GBX, Lane 12 is

MEI, Lane 13 is P HOX, Lane 14 is PROX 1, Lane 15 is Marker Low DNA

Mass Ladder, Lane 16 is φX174 RF DNA/Hae III.

E- Adrenal Gland: Lane 1 is OCT, Lane 2 is BRN a, Lane 3 is BRN b,

Lane 4 is CDX, Lane 5 is Bicoid, Lane 6 is Engrailed. Lane 7 is DLX a, Lane 8 is DLX b, Lane 9 is DLX c, Lane 10 is DLX d, Lane 1 1 is GBX, Lane 12 is

MEI, Lane 13 is P HOX, Lane 14 is PROX 1, Lane 15 is marker Low DNA

Mass Ladder, Lane 16 is φX174 RF DNA/Hae III.

F- Adult Brain: Lane 1 is OCT, Lane 2 is BRN a, Lane 3 is BRN b,

Lane 4 is CDX, Lane 5 is Bicoid, Lane 6 is Engrailed, Lane 7 is DLX a, Lane 8 is DLX b, Lane 9 is DLX c, Lane 10 is DLX d, Lane 1 1 is GBX, Lane 12 is

MEI, Lane 13 is P HOX, Lane 14 is PROX 1, Lane 15 is marker Low DNA

Mass Ladder, Lane 16 is φX174 RF DNA/Hae III.

G- S. Nigra: Lane 1 is OCT 1, Lane 2 is PBX, Lane 3 is OCT, Lane 4 is

BRN a, Lane 5 is BRN b, Lane 6 is CDX, Lane 7 is Engrailed. Lane 8 is DLX a, Lane 9 is DLX b, Lane 10 is DLX c, Lane 1 1 is DLX d, Lane 12 is

GBX, Lane 13 is MEI, Lane 14 is P HOX, Lane 15 is PROX 1, Lane 16 is marker Low DNA Mass Ladder.

Figs. 4 A-F are photographs showing the expressin pattern of the conserved MAP kinase PCR products detected using the primers shown in List 1, in which (A) is Cytogenetic normal amniotic cell culture, (B) is Normal Colon, (C) is tumorigenic Colon, (D) is Adrenal, (E) is Fetal Brain, and (F) is Adult Brain. The primers used were in Lane 1 a(+) and a(-), in Lane 2a(+) and b(-), in Lane 3 a(+) and c(-), in Lane 4 b(+) and a(-), in Lane 5 b(+) and b(-), in Lane 6 b(+) and c(-), in Lane 7 c(+) and a(-), in Lane 8 c(+) and b(-), in Lane 9c(+) and c(-), in Lane 10 d(+) and a(-), in Lane 1 1 d(+) and b(-), in Lane 12 d(+) and c(-), Lane 13 is marker Low DNA Mass Ladder. Lane 14 is φX174 RF DNA/Hae III.

Figs. 5 A-G are photographs showing the expression of the pattern of the conserved PTK kinase PCR products detected using the primers shown in List 1, in which (A) is Placenta, (B) Cytogenetic normal amniotic cell culture (C) is Normal Colon, (D) is Tumorigenic Colon, (E) is Adrenal, (F) is Fetal Brain and (G) is Adult Brain. The primers used were in Lane 1 e(+) and e(-), in Lane 2 e(+) and f(-), in Lane 3 e(+) and g(-), in Lane 4 e(+) and h(-), in Lane 5 f(+) and e(-), in Lane 6 f(+) and f(-), in Lane 7 f(+) and g(-), in Lane 8 f(+) and h(-), in Lane 9 g(+) and e(-), in Lane 10 g(+) and f(-), in Lane 11 g(+) and g(-), in Land 12 g(+) and h(-), in Lane 13 h(+) and e(-), in Lane 14 h(+) and f(-), in Lane 15 h(+) and g(-), in Lane 16 is marker Low DNA Mass Ladder.

Fig. 6 is a photograph showing the expression pattern of several dispersed homeobox genes using primers of List 3 in amniotic cell cultures. Lane 1 is EVE 1, Lane 2 is EVE 2, Lane 3 is MSX 1, Lane 4 is MSX 2, Lane 5 is OCT, Lane 6 is OCT 1, Lane 7 is BRNa, Lane 8 is BRNb, Lane 9 is LFB3, Lane 10 is LFB1, Lane 11 is PAX, Lane 12 is Bicoid. Lane 13 is Goosecoid, Lane 14 is Engrailed, Lane 15 is CDX, Lane 16 is marker Low DNA Mass Ladder.

Figs. 7 A-F are photographs showing the expression pattern of the conserved MAP kinase PCR products detected using the primers shown in List 4, in amniotic cell cultures: in which (A) is culture 1, (B) is culture 3, (C) is culture 4, (D) is culture 5, (E) is culture 6, (F) is culture 7. The primers used were in Lane 1 a(+) and a(-), in Lane 2 a(+) and b(-). in Lane 3 a(+) and c(-), in Lane 4 b(+) and a(-) and a(-), in Lane 5 b(+) and b(-), in Lane 6 b(+) and c(-), in Lane 7 c(+) and a(-), in Lane 8 c(+) and b(-). in Lane 9 c(+) and c(-), in Lane 10 d(+) and a(-), in Lane 11 d(+) and b(-). in Lane 12 d(+) and c(-), Lane 13 is marker Low DNA Mass Ladder. In addition, lanes 14-16 contained in several photographs the following PCR products: Lane 14 is OCT1. Lane 15 is PBX, Lane 16 is β Actin.

Figs. 8 A-G are photographs showing the expression pattern of the conserved PTK kinase PCR products detected using the primers shown in List 5. in amniotic cell cultures, in which (A) is culture 1, (B) is culture 2, (C) is culture 3, (D) is culture 4, (E) is culture 5, (F) is culture 6, (G) is culture 7, (H) is culture 8. The primers used were in Lane 1 e(+) and e(-), in Lane 2 e(+) and f(-), in Lane 3 (+) and g(-), in Lane 4 e(+) and h(-), in Lane 5 f (+) and e(-), in Lane 6 (+) and f(-), in Lane 7 f(+) and g(-), in Lane 8 f(+) and h(-). in Lane 9 g(+) and e(-), in Lane 10 g(+) and f(-), in Lane 1 1 g(+) and g(-), in Lane 12 g(+) and h(-), in Lane 13 h(+) and e(-), in Lane 14 h(+) and f(-), in Lane 15 h(+) and g(-), in Lane 16 is marker Low DNA Mass Ladder.

Figs. 9 A-C are photographs showing the expression pattern of the conserved Serine Threonine kinase PCR products, detected using the primers designated STK 8-21 (List 6), in amniotic cell cultures: in which (A) is culture 1, (B) is culture 3, (C) is culture 4. The primers used were in Lane 1 i(+) and j(-), in Lane 2 j(+) and j(-), in Lane 3 k(+) and j(-), in Lane 4 1(+) and j(-), in Lane 5 m(+) and j(-), in Lane 6 n(+) and j(-), in Lane 7 o(+) and j(-), in Lane 8 i(+) and k(-), in Lane 9 j(+) and k(-), in Lane 10 k(+) and k(-), in Lane 11 1(+) and k(-), in Lane 12 m(+) and k(-), Lane 13 n(+) and k (-), Lane 14 o(+) and k(-), Lane 15 is marker Low DNA Mass Ladder.

EXAMPLES Materials and Methods Human poly A RNAs were obtained from Clontech. Reverse transcriptase (RT) - Polymerase Chain Reaction (PCR) was performed as follows. 1 μg samples of poly A RNA or total RNA were reverse-transcribed using recombinant AMV reverse transcriptase in the presence of oligo-dT as an anti-sense primer. 3μl of the reverse-transcribed mixture was used as a template for PCR. using AmpliTaq polymerase in the presence of the conserved primers shown in List 1 or the specific primers shown in Lists 2 and 3. Amplification was performed in an Eppendorf Master Cycler personal PCR instrument for 35 cycles. Each cycle consisted of 1 min. of denaturation at 94°C. followed by 1 min. of annealing usually at 55°C, and 1 min. of extension at 72°C. The same cDNAs were used as templates for parallel PCR reactions performed for 20 cycles in the presence of the β-actin primers:

5'-GTTGAGACCTTCAACACCCC-3' 5'-GTGGCCATCTCTTGCTCGAAGTC RNA samples from various cell populations were reverse transcribed. The cDNA produced from each sample, was used as a template for PCR using conserved and specific primers for each of the genes studied. Since genes belonging to the same group have specific domains in common such as the paired pou and Urn domains in HB genes, it was possible to use a single primer in each PCR reaction, instead of two. The RT-PCR products were analyzed by electrophoresis on 2% or 3% high resolution gels (Ambion), and photographed.

Amniotic cells cultures were provided by the Cytogenetic Unit of the Herzlia Medical Center. 5 cytogenetically normal cultures were used (cultures 1-3, 5 and 6 together with cultures of trisomy 21 cells (cultures 4 and 8) and a culture of cells showing balanced translocation 1 : 13 (culture 7) from a phenotypically normal fetus. The cultures are described in Table 10. After 3 weeks of incubation, RNA was extracted using the Total RNA Isolation Kit (Ambion). Cultures were analyzed by RT-PCR utilizing the primers given in Lists 1-10. EXAMPLE 1

The following tissues were analyzed by the method of the invention:

1. Human placenta - the placenta is derived primarily from embryonic trophoblast and mesodermal cells. This organ is considered to have embroyogenic proximity to epithelia derived from ectoderm, neural derived organs such as the adrenal medulla as well as mesodermal derived tissues such as the heart, hemangioblastic tissue, adrenal and cortex. 2. Human substantia nigra - This part of the midbrain is derived from neuroectoderm. 3. Normal and malignant colonic tissues - As part of the hindgut, the colon is derived from endoderm.

The study was divided into two stages, the first stage consisted of a rapid screening method, designed to determine whether a particular homeobox group is expressed in the examined organ. The second stage consisted of a secondary PCR in order to determine the specific genes expressed in the given homeobox group.

An oligo d(T) primer was used to synthesize cDNA from the polyA RNA. PCR reactions were then performed in the presence of primers designed to complement conserved regions of the homeobox groups (List 1). The degree of similarity between the primers and the conserved regions was 85% or more, with no mismatch in the last 2 nucleotides at the 3' termini between the primer and the matched sequence. List 2 shows the pairs of primers used and some of the HOX genes transcribed by them. The PCR products were analyzed by gel electrophoresis, stained with ethidium bromide and photographed under UV light. Results

The results of the screening stage are shown in Fig. 1 A-D. S. Nigra expresses low levels of HOX genes, with the genes at the 5' end in all clusters being not expressed at all. Human placenta and both normal and malignant colonic tissues express high levels of the HOX genes. Comparing the relative intensities of the bands shows that the placenta and colonic tissues possess different expression profiles. Normal and malignant colonic tissues have similar expression profiles although some differences are evident. For example, the pair of primers HOX 2(+), HOX 2(-) (Lanes 4, C and D in the Fig.). Each of the 4 samples originating from 4 organs studied thus have a unique expression profile with the pairs of primers used.

PCR was then performed using specific sense primers upstream to the homeodomain but internal to the upstream sense primers used in the screening stage (List 2). For each gene, a specific sense primer was used together with the most matched anti-sense primer from the 3 primers used in the screening stage. In order to ensure that different nucleotides appear at the 3' end of the specific primers, and that the primer matches only the desired HOX gene, specific HOX gene PCR was performed on cDNAs taking advantage of the conserved anti-sense primers, and the ability to compare results between the screening stage and specific stage in each organ.

The PCR products were then separated by gel as shown in Fig. 2. The expression level of each HOX gene was determined for each tissue and the results are summarized in Table 1. Comparison of Figs. 1 and 2 shows that there is a good correlation between the results obtained in the screening stage (Fig. 1) and those obtained with the specific HOX gene primers in each organ (Fig. 2). Moreoever, samples obtained from various organs tested demonstrate a characteristic pattern of expression of individual HOX genes. For example, organs having completely different embryonic region Nigra-(ectoderm), Colon-(endorderm), Placenta-(mesoectoderm) have a different HOX gene expression pattern.

The proximity of two tissues is given by the homeobox index I which is defined and calculated as explained above. Several examples of the proximity index obtained by the above method on the data of Table 1 are as follows:

Placenta - S. Nigra = 4.5/10 = 0.45

Placenta - Colon normal = 4/11.5 = 0.34

S. Nigra - Colon normal: 3.5/9.5 = 0.36 Colon Normal - Colon tumor = 7/8.5 = 0.82.

EXAMPLE 2

PCR was also performed on the samples used in Example 1 above using primers to the dispersed HB genes (List 3). These primers contained either both sense and antisense from conserved regions of HB groups (PAX, OCT, CDX), or contained one specific primer (EVE, MSX etc.). The PCR products were separated by gel and some of the products are shown in Fig. 3 A-B (from Placenta and S. Nigra).

As can be seen in Table 2, the expression pattern of these genes was also unique for each different tissue.

EXAMPLE 3

The proximity between cells originating from placenta, adrenal and fetal kidney was calculated on the basis of the expression level of HOX genes (Table 3 a) and dispersed homeobox genes (Table 3b) as described in Example 1 above.

On the basis of the results shown in Table 3 a and b, the proximity of the cells of the three above mentioned organs was calculated as explained above to give the following results: Fetal kidney and adrenal: 7.5/12 = 0.62

Placenta and fetal kidney: 5.5/12 = 0.46

Placenta and adrenal: 5.5/10.5 = 0.52

These results demonstrate a higher degree of proximity between the adrenal gland and F. kidney than between placenta, S. Nigra, and colon. It thus reflects the higher degree of embryogenic proximity of these organs including their final position in the body (Kidney and Adrenal) than that of S.

Nigra. placenta and colon.

EXAMPLE 4

The following tissues were analyzed by the method of the invention.

1. Adult kidney (A. kidney)

2. Fetal brain (F. brain) 3. Adult brain (A.brain).

The FIB genes screened are as follows: a. I. HOX conserved primers II. HOX specific primers b. POU domain containing genes:

I. OCT conserved primers II. OCT primers III. LFB specific primers IV. BRN specific primers c. Drosophila like maternally expressed genes I. CDX conserved primers.

II. CDX specific primers. Ill Bicoid specific primers. d. Drosophila like segmented expressed genes. I. PAX conserved primers. II. PAX specific primers. Ill Engrailed specific primers. IV Goosecoid specific primers. e. I. LIM domain containing genes conserved primers. LIM domain containing specific primers. f. I. NK genes conserved primers. II. NK genes specific primers. g. DLX genes conserved primers. f. CNS embryonic expressed genes: EMX, OTX. h. Miscellaneous HB genes: EVE1,2 MSX1.2 GBX, MEI 1. PHOX, PROX 1, PBX 1. The primers sequences are given in Lists 4. 5 and 6.

Three levels of gene expression were distinguished instead of just two as used in Example 1. The level of expression was referred to the levels of the homeobox genes PBX and OCT-1 (very low. regular, and high in comparison to the expression levels of OCT 1, and PBX1). A very low expression level was a level barely seen on the gel, and it is socred as 1. The regular level is any expression less than or equal to that of PBX or OCT 1 and is scored as 2. Levels greater than or equal to that of PBX 1 or OCT 1 (the maximum of the two) is scored as 3. PBX 1 and OCT 1 were found by the methods of the invention to be expressed in all cells examined. They have been suggested to work in concert with HOX genes, in order to tune and achieve their final effect.

Results

The expression pattern and scoring of PCR products is given in Tables 4-6.

The verification of the desired product was made by electrophoresing the PCR product on the gel, and deforming its molecular weight using molecular weight standards. In several cases secondary PCR was made on the primary PCR with internal primers, in order to confirm the molecular weight. PCR with internal primers was also used in instances where the primary PCR primers were designed to match conserved regions transcribing many genes that belong to the same group. Then a secondary PCR was performed with one specific internal primer that could match only one gene of that group.

Results of the scoring of the PCR products are summarized in Figs. 1 E-G and 3 C-G and Tables 4-5. All organs expresses HOX 7 and B5 and either B5 or B7. This might imply a central role of these genes in the cells. Brain samples express very low levels of HOX genes and a limited number of other genes. On the other hand, a similar pattern of expression using the conserved primers was observed in these brain samples.

HOX genes are more variably expressed in various physiological or pathological states of an organ relative to the dispersed homeobox genes.

There is a high level of expression of CDX in S. nigra with the conserved primers and of CDX-4 with the specific primer. A wide distribution of LFB3 expression, expression of ENGRAILED in brain and adrenal gland, and expression of PAX in adult kidney are also observed.

Comparison of the I score demonstrated the following ranges of scoring: low scoring of 0.24 between tumorous colon and adult brain, and the highest scoring 0.83 between normal and tumorous colonic tissues. Adrenal and fetal kidney demonstrated I score of 0.68 consistent with the known biological proximity of these organs. Placenta demonstrated a uniform score of 0.4-0.5 I score with most of the other cells except for brain in which it was lower scoring.

EXAMPLE 5

The method of the invention was performed using primers from the 11 conserved subdomains of the kinase family catalytic domain. The PCR products were separated by gel electrophoresis. Analysis of the PCR products showed variable expression of the different genes. As above, the extent of expression of a given gene was rated as 1 (very low), 2 (medium) or 3 (high). The results are given in Figs. 4 and 5 and Tables 7 and 8. The proximity of two cells is given by the proximity index for kinase index I which is defined and calculated as explained before. The obtained values of the kinase proximity index are summarized in Table 9. It is clear from Tables 7 and 8 that there is much more variability of the expression of the PTK genes among various organs in comparison to that of the MAPK genes.

EXAMPLE 6

The expression pattern of the homeobox genes in amniotic cell cultures was analyzed in 2 amniotic cell cultures. The CR products of culture 2 separated on gel are shown in Fig. 9. The expression of the homeeobox genes is summarized in Table 11. The BRN and PCR gene products were both expressed (similar to brain), but not that of LFB l and LFB3. The very low level of PROX expression observed is unusual. On the other hand, the HOX genes expressed at a level greater than that in placenta, for example. Although the placenta and the amniotic sac are both extra embryonic tissues their homeobox proximity index was found to be only 0.49.

EXAMPLE 7

The 8 amniotic cell cultures described in Table 10 were examined for kinase gene expression. The primers given in Lists 7-10 were used to obtain the RT-PCR products of these genes. Figs. 7, 8 and 9. demonstrate partial MAPK, partial PTK, 'and partial STK expression in these cultures.

Culture 3 does not present any cytogenetic abnormality, however, a PCR product of the MAP 3 PCR product was observed (Fig.7B, lane 3) that was absent from all other cultures (Fig. 7). Culture 3 also demonstrated a unique pattern of PTK expression (Fig. 8C, lanes 9-11) and a very low expression of the STK 11 gene (Fig. 9B, lane 4) in comparison to the other cultures (e.g. Fig. 9A and C, lane 4). Cultures 4 and 8 (trisomy 21) were also the only cultures in which a similar expression pattern of PCR products was obtained using primers PTK 9 and 11 (Fig. 8D and H). This is in contrast to the other cultures in which more PCR products were obtained using PTK 9. The karyotype of Culture 7 shows a balanced translocation between chromosomes 1 and 13. This translocation is also present in the healthy parents, so this translocation does not lead to a diseased state in the adult. Similarly, in the fetal cells of Culture 7. this translocation did not result in any changes in the expression of MAPK, PTK. or STK genes (Figs. 7F and 8G). Since genetic defects in one organ are often reflected in other organs (a phenomenon known as association in which apparently unrelated genetic anomalies occur together more frequently than would be expected by chance alone) this embodiment can be used to detect future developmental abnormalities. Examples of such associations include abnormal external ears associated with renal anomalies, a single umbilical artery associated with cardiac defects, and wide spaced eyes or no occipital hair were associated with brain malformations. The results obtained on the amniotic fetal cells also show that cells having a normal karyotype may have an aberrant pattern of gene expression. This embodiment of the invention can thus be used to perform a " genetic physical examination " on a fetus.

Example 8

The following cells were analyzed by the method of the invention for expression levels of serine-threonine phosphatase, tyrosine phosphatase and POU homeobox genes:

1. Normal colon cells

2. HT-29 cells

3. Caco-2 cells 4. 3T3 cells.

Expression levels were obtained using the primers given in Lists 11 to 14 and 19. Tables 12 to 14 show the expression levels of the genes studied in the 4 cell types used. The data in Tables 12-14 were then used to obtain proximity indexes between pairs of the cell types from the above list. The data in Table 12 produced the following proximity indexes:

When the data from Tables 13 and 14 were used to obtain proximity indexes the following results were obtained:

List 1 - Conserved oligonucleotide primers of the HOX genes used for RT-PCR reactions

Designation Sequence 5' -3' Position Product Matching size (bp) Hox genes

HOX 1 (+) TACACTCGCTACCAGACCCTGGAG 21-45 135 A6,A7,B6,

HOX l (-) CCGGTTCTGGAACCAGATCTT 156-136 B7,C5

HOX 1 (+) TACACTCGCTACCAGACCCTGGAG 21-45 129 A9,A13,B8

HOX 2 (-) CTGAAACCAGATTTTGACCTG 150-130 D9

HOX 2 (+) AAGCGCTGCCCCTACACCAA 10-30 146 A9,A10,

HOX 1 (-) CCGGTTCTGGAACCAGATCTT 156-136 A11,C9,D9

HOX 2 (+) AAGCGCTGCCCCTACACCAA 10-30 140 A9,A13,D9

HOX 2 (-) CTGAAACCAGATTTTGACCTG 150-130 D10

HOX 3 (+) GCCCGGACCACCTACACGCG 10-30 146 A4,A6,A7

HOX 1 (-) CCGGTTCTGGAACCAGATCTT 156-136 B4

HOX 3 (+) GCCCGGACCACCTACACGCG 10-30 140 A4

HOX 2 (-) CTGAAACCAGATTTTGACCTG 150-130

HOX 4 (+) CTGGAGCTGGAAAAGGAATT 40-59 116

HOX 1 (-) CCGGTTCTGGAACCAGATCTT 156-136

HOX 4 (+) CTGGAGCTGGAAAAGGAATT 40-59 110

HOX 2 (-) CTGAAACCAGATTTTGACCTG 150-130

HOX 4 (+) CTGGAGCTGGAAAAGGAATT 40-59 121

HOX 3 (-) CAT CCT GCC GTT CTG AAA CCA 161-141 List 2 - Specific oligonucleotide primers of HOX genes used for RT-PCR reactions

Designation Sequence 5'- Position Product Matching Hox size (bp) genes

A4 (+) TTCAATCGCTACCTGACCCGC 64-84 A4, D10

A5 (+) CGTTACCTGACCCGCAGAA 70-88 91 A5

HOX 3 (-) CATCCTGCCGTTCTGAAACCA 161-141

A6 (+) CACTTCAACCGCTACCTGACA 61-80 A6, B4, C8

A7 (+) CACTTCAACCGCTACCTGACC 61-80 95 A7

HOX 1 (-) CCGGTTCTGGAACCAGATCTT 156-136

A9 (+) TTCAACATGTACCTCACCAGG 64-84 A9, D9

A10 (+) TTCAATATGTACCTTACTCGA 64-84 A10

Al l (+) GTCTACATTAACAAAGAGAAG 70-90 92 Al l

HOX 3 (-) CATCCTGCCGTTCTGAAACCA 161-141

A13 (+) CGGGAATACGCCACGAATAAA 51-70 100 AI:

HOX 2 (-) CTGAAACCAGATTTTGACCTG 150-130

Bl (+) CATTTCAACAAGTACCTGAG 61-80 96 Bl

HOX 1 (-) CCGGTTCTGGAACCAGATCTT 156-136

B2(+) AATAAGTACCTGTGCCGGCCA 67-78 84 B2

HOX 2(-) CTGAAACCAGATTTTGACCTG 150-130 List 2 (continued)

B3(+) AACCGCTACCTGTGCCGGCCT 67-87 90 B3

HOX 1 (-) CCGGTTCTGGAACCAGATCTT 156-136

B5(+) AACCGCTACCTGACCCGGCGA 67-87 B5

B6(+) CACTACAATCGCTACCTGACG 61-80 96 B6, B7

HOXl(-) CCGGTTCTGGAACCAGATCTT 156-136

B8(+) TTTAATCCCTATCTGACTCGT 63-83 B8

B9(+) TACCTCACCAGGGACCGTAGGC 74-94 B9

C4(+) CGCTACCTGACCCGAAGGAGA 70-90 C4

C5(+) CACTTTAACCGCTACCTCACT 61-81 101 C5

HOX 3 (-) CATCCTGCCGTTCTGAAACCA 161-141

C6(+) TTTCACTTCAATCGCTACCTA 58-78 C6

C8(+) AATCCTTATTTGACACGAAAA 66-86 91 C8

HOXl(-) CCGGTTCTGGAACCAGATCTT 156-136

C9(+) GAGTTTCTCTTCAATATGTATTTA 57-77 C9

C12(+) CTGGAGGGCGAGTTTCTGG 46-64 105 C12

HOX2(-) CTGAAACCAGATTTTGACCTG 150-130

C13(+) GAGCTAGAGAAGGAATACGCG 43-63 119 C13

HOX 3 (-) CATCCTGCCGTTCTGAAACCA 161-141 List 2 (continued)

D3(+) AACCGCTACTTGTGCCGGCCG 67-87 90 D3

HOXl (-) CCGGTTCTGGAACCAGATCTT 156-136

D4(+) CATTTTAACAGGTATCTGACAA 61-82 96 D4

HOXl(-) CCGGTTCTGGAACCAGATCTT 156-136

D8(+) AACCCCTATCTGACCAGGAAA 67-87 D8

D10(+) CTCACCCGCGAGCGCCGCCTA 76-96 86 D10

HOX 3 (-) CATCCTGCCGTTCTGAAACCA 161-141

Dll(+) TTTTTCTTTAACGTGTACATA 58-78 104 Dll

HOX 3 (-) CATCCTGCCGTTCTGAAACCA 161-141

List 3 - Oligonucleotide primers from conserved and specific regions of various dispersed homebox gene groups, for RT-PCR reactions

Designation Sequence 5 '-3' Position Product Matching size (bp) homeobox genes

EVE 1.2 (+) AACCTGCCCGAAACCACCATC 170 EVE 1

EVE 1 (-) CAGGGGCAGGTGCGATGG

EVE 1.2 (+) AACCTGCCCGAAACCACCATC 147 EVE 2

EVE 2 (-) GGGGTAGGGCAGGCTTCCGGT

MSX 1 (+) CCGCTGGGCCATTTCTCG 760-780 350

MSX 1.2 (-) CGGGCTGCGGTTCTGGAACCA 2190-2170

MSX 2 (+) AATTCAGAAGATGGAGCGGCG 548-568

MSX 1.2 (-) CGGGCTGCGGTTCTGGAACCA 2190-2170

PAX (+) GGCTGTGTCAGCAAAATTCT

PAX (-) CAGCCTGTCTCGGATCTCCCA

Bicoid (+) ATGTCGTCCAGC ATGGTGCCC 11 10-1130 172

Bicoid (-) CGAGTTACACGTGTCCCTATA 1280-1260

Goosecoid(+) ACCATCTTTACGGAGGAGCA 1330-1350 143 Goosecoid(-) GTTCTTGAACCACACCTC 1473-1455

Engr l.2 (+) AAGATTTGGTTCCAGAACAA 180-200 96 Engr l.2 (-) GTTGTACAGGCCCTGTGCCAT 275-255

EMX 1.2 (+) AAACGCATCCGGACCGCCTT 1460-1479 EMX (-) TCGGTTCTGGAACAACACCTT 1610-1590

OTX 1.2 (+) TATCCGGACATATTC ATG 1155-1173

OTX 1.2 (-) CTGTTGGCGGCACTTGGC

List 3 (continued)

OTX 1,2 (+) TATCCGGACATATTCATG 1155-1173

OTX l,2 (-) TTTGCGCTTCTTCCATTT

CDX 1-4 (+) GAGCTGGAAAAGGAGTTTCA

CDX l-4 (-) TCCTTGGCTCTGCGGTTCTG

OCT (+) CTGAGCTTTAAGAACATGTG 1000-1020 290 OCT-l, OCT-2

OCT (-) CTGGCGCCGGTTACAGAACCA 1290-1270

OCT-1 (+) AGCCCAAGTGCCCTGAATTCT 1077-1097 OCT-1

OCT (-) CTGGCGCCGGTTACAGAACCA 1290-1270

OCT-2 (+) AGCCCCAGCCTGGGTTTC 1021-1038 OCT-2

OCT (-) CTGGCGCCGGTTACAGAACCA 1290-1270

BRN (+) ACCCTGTATGGCAACGTGTT

BRN (-) CCCCTTGAGGCTCACCTCGAT

LFBl (+) TCCGGCGACGAGGGCTCCGAG 420-440 663

LFB (-) GCGGTTGGC AAACC AGTTGTA 1102- 1082

LFB3 (+) TCGGAAGATGACACGGATGAC 210-230 790

LFB (-) GCGGTTGGCAAACC AGTTGTA 1102- 1082 List 4 - a. I. HOX conserved primers

Conserved oligonucleotide primers of the HOX genes for RT-PCR reactions

List 5 - a. II. HOX conserved primers

Specific oligonucleotide primers of the HOX genes for RT-PCR reactions

List 6 - b. POU domain containing genes: I. OCT conserved primers

II. OCT specific primers

III. LFB specific primers

IV. BRN conserved primers

c. Drosophila like maternally expressed genes I. CDX conserved primers

I. CDX specific primers

III. Bicoid specific primers

d. Drosophila like segmental expressed genes I. PAX concerved primers

II. PAX specific primers

III. Engrailed specific primers

IV. Goosecoid specific primers

e. I. LIM domain containing genes conserved primers

II. LIM domain containing genes specific primers

f. I. NK genes conserved primers

II. NK genes specific primers

σ to^* DLX genes conserved primers

CNS embryonic genes: EMX, OTX

h. Miscellaneous HB genes

List 7

List 8

- 41

List 8 continued

Position is given in protein kinase catalytic unit subdomain nomenclature Amino acid sequence is given in symbol letters

List 9

List 9 (continued)

List 10

List 10 (continued)

Position is giving in protein kinase catalytic unit subdomain nomenclature

Amino acids are given by single letter abbreviations.

0 List 11 - Serine Threonine kinase

List 12 - Tvrosine kinase

List 13 - Tyrosine phosphatase

Average distance between sense primers 705-706 and antisens primers 725-729 of Tyrosine phosphatase is 450-480 bp. Average distance between sense primers 708-711 and antisense primers 721-724 of Tyrosine phosphatase enzymes is 270 bp. List 14 - Serine Threonine Phosphatase:

Average distance between sense and antisense primer of PCR products of the Serine Threonine Phosphatase is 350-370 bp.

List 15 - P450 enzymes

Average distance between sense primers 800-806 and antisense primers of P450 enzymes is 250-300 bp. Average distance between sense primers 809-812 and antisense primers of P450 enzymes is 350 bp. List 16 - Steroid receptor super family

Average distance between sense and antisense primer of PCR products of the Steroid receptor super family is 150 bp.

List 17 - Cadherin super family

List 17 (continued)

Average distance between sense and antisense primer of PCR products of the Cadherin super family is 450-480 bp.

List 18 - Homeobox transcription factors

Average distance between sense and antisense primers of the POU domain transcription factor is 300 bp.

Average distance between sense and antisense primers of the Nkx transcription factor is 150 bp.

List 19 - House keeping genes

Levels of expression lower than any of the 4 house keeping genes' PCR products are scored as 1 , Levels of expression equal or higher than the highest of the 4 products are scored as 3. Any levels in between are scored as 2.

PCR reactions were produced with the above listed primers. The following tables summerize the results of the PCR expression levels in several tissues. They include primers designation and their composition in the PCR reactions.

REFERENCES

1. Acampora, D., et al, Nucl. Acids. Res., 17:10385-10402, 1989.

2. Boncinelli, E., et al, Genome, 31:745-756, 1989.

3. Giampaolo, A. et al, Differentiation, 40: 191-197, 1989. .

4. Petryniak, et al, Proc Natl. Acad. Set, USA, 87: 1100-1104, 1990.

5. Sturm, R.A., et al, Genes Dev., 2:1582-1599, 1988.

6. Chourd. T. et al, Genes Dev., 6:715-729, 1992.

7. Bach. I., et al, Nucl Acids. Res., 19:3553-3559, 1992.

8. Abbott. C, et al, Genomics, 8: 165-167, 1990. 9. Hara, Y.. et al, Proc. Natl. Acad. ScL, USA. 89:3280-3284, 1992.

10. Hu, Y., et al, J. Biol. Chem., 268:27214-27225, 1993.

11. Gamer. L.W., and Wright, C.V.E., Meek Dev., 43:71-81, 1993.

12. James, R., et al, J. Biol. Chem., 269: 15229-15237, 1994.

13. Semina, E.V., et al, Genet, 14:392- , 1996.

14. Macina, R.A., et al, Development, 119:419-431 , 1993.

15. Plachov, D., et la., Development, 110:643-651, 1990.

16. Adams, B., et al, Genes Dev., 6: 1589-1607, 1992.

17. Rothenpieler, U.W., and Dressier, G.R., Development, 119:711-720, 1993.

18. Ton, C.C.T., et al, Cell, 67:1059-1074, 1991.

19. Schafer, B.W., et al, Nucl. Acids Res., 22:5474-5482, 1994.

20. Poole, S.J., et al, Genomics, 4:225-231, 1989.

21. Bloom, M., et al, Genomics, 21:388-393, 1994.

22. German, M.S., et al, Genes Dev., 6:2165-2176, 1992.

23. Freyd, G., et al, Nature, 344:876-881, 1990.

24. Cohen, B., et al, Genes Dev., 6:715-729, 1992.

25. Dong, W.F., et al, DNA Cell Biol, 6:671-678, 1997.

26. Xu, Y., et al, Proc. Natl. Acad. ScL, USA, 90:227-231, 1993.

27. Kim, Y., and Nirenberg, M., Proc. Natl Acad. ScL USA, 86:7716-7720. 1989.

28. Guazzi, S., et al, EMBO J., 9:3631-3639, 1990. 29. Lints. T.J.. et al, Development. JU9.419-431. 1993.

30. Price. M., et al, Neuron, 8:241-255, 1992.

31. He, W.W., et al, Genomics, 43:69-77, 1997.

32. Inoue, H., et al, Genomics, 40:367-370, 1997.

33. Simeone, A., et al, Proc. Natl. Acad. ScL USA, 91:2250-2254. 1994.

34. Quinn, L.M., et al, Gene, 187:55-61, 1997.

35. Cohen, S.M., et al, Nature, 338:432-434, 1989.

36. Selski, D.J., et al, Gene, 132:301-303, 1993.

37. Scherer, S.W., et al, Mamm. Genome, 6:310-31 1, 1995.

38. Porteus, M.H., et al, Neuron, 7:221-229, 1992.

39. Dalton, D., et al, Genes, Dev., 3:1940-1956, 1989.

40. Finkelstein, R., et al, Genes Dev., 4: 1516-1527. 1990.

41. Simeone, A., et al, Neuron, 13:83-101, 1994.

42. Lin, X., et al, Genomics, 31:335-342, 1996.

43. Moskow, J.J., et al, Moll. Cell, Biol, 15:5434-5443, 1995.

44. Steelman, S., et al, Genome Res., 7: 142-156, 1997.

45. Monaghan, A.P., et al, Development, 112:1053-1062, 1991.

46. Hewitt, J.E., et al, Genomics, 11:670-678, 1991.

47. Gruenberg, D.A., et al, Science, 257:1089-1091, 1992.

48. Cserjesi, P., et al, Development, 115:1087-1101. 1992.

49. Zinovieva, R.D., et al, Genomics, 35:517-522. 1996. Table 1

Expression pattern of conserved HOX genes

Table 2

Table 3a Expression pattern of specific HOX genes

Table 3b Expression pattern of dispersed homeobox genes

Table 4: Expression pattern of HOX genes

Table 5: Expression pattern of dispersed homeobox genes

Table 5 continued

* Genes that serves as reference to the PCR HB expression. N.C = not checked.

The homeobox proximity indices for the pairs of tissues tested are summarized in Table 6.

Table 6

Table 7

Scoring of the expression pattern of MAP conserved region in various cells and organs

Table 8

Scoring of the expression pattern of PTK conserved region in various cells and organs

Table 9

Table 10

Table 11

The number of genes of each type expressed in placenta and amnion

Table 11 (continued)

Table 12

Serine Threonine phosphatase (STP) and Tyrosine phosphatase (TP) expression levels

Table 13

Kinase expression levels

Table 14

POU homeodomain expression levels

Claims

CLAIMS:

1. A method for determining the genetic proximity of a first cell and a second cell comprising the steps of:

(a) obtaining said first cell and said second cell;

(b) determining in said first cell and said second cell the pattern of expression of genes in a selected gene family;

(c) calculating a proximity index I, wherein

Γêæmin(╬▒,.,b_;)

Γêæmax(╬▒,.,b.)

wherein a₍ and b_; are the expression level of the gene i in the first and second cell, respectively, and the summations are performed over all genes i in the gene family, a large proximity index indicating that said first cell and said second cell are genetically proximal to each other, a small proximity index indicating that said first cell and said second cell are genetically distant from each other.

2. A method according to Claim 1, wherein said pattern of expression of genes in said selected gene family is determined in at least one of said first cell and said second cell by the method of reverse transcriptase polymerase chain reaction.

3. A method according to Claim 2, wherein said reverse transcriptase polymer chain reaction utilizes one or more conserved primers.

4. A method according to Claim 3, wherein one or more of said one or more conserved primers is a primer selected from the list comprising Lists 1 to 19.

5. A method according to Claim 1 to 4, wherein said selected gene family is a set of homeobox genes.

6. A method according to Claim 5, wherein said homeobox genes are HOX senes.

7. A method according to any one of Claims 5 or 6. wherein said homeobox genes are dispersed homeobox genes.

8. A method according to Claim 1 to 4, wherein said selected gene family is a set of kinase genes.

9. A method according to any one of Claims 1 to 4, wherein said gene family is a set of protein phosphatase genes.

10. A method according to any one of Claims 1 to 4, wherein said gene family is a set of P450 enzyme genes.

11. A method according to any one of Claims 1 to 4, wherein said gene family is a set of steroid receptor superfamily genes.

12. A method according to any one of Claims 1 to 4, wherein said gene family is a set of cadhedrin superfamily genes.

13. A method according to any one of the preceding claims, wherein at least one of said first cell and said second cell is an amniotic cell.

14. Use of the method according to any one of Claims 1 to 13, for determining the effect of a selected treatment on a test cell wherein:

(a) said first cell is said test cell before having been subjected to said treatment;

(b) said second cell is said test cell after having been subjected to said treatment;

(c) and wherein said first cell and said second cell being genetically proximal to each other indicating that said treatment has no substantial effect on said test cell, and said first cell and said second cell being genetically distant from each other indicating that said treatment has a substantial effect on said test cell.

15. Use of the method according to any one of Claims 1 to 13, for determining whether a given test cell is transformed wherein:

(a) said first cell is said test cell;

(b) said second cell is an untransformed cell of the same cell type as said test cell; (c) and wherein said first cell and said second cell being genetically proximal to each other indicating that said test cell is substantially untransformed. and said first cell and said second cell being genetically distant from each other indicating that said test cell is substantially transformed.

16. Use of the method according to any one of Claims 1 to 13. for detecting a selected genetic defect in a first individual wherein

(a) said first cell is a cell obtained from said first individual;

(b) said second cell is a cell of the same type as said first cell and obtained from a second individual not having the genetic defect; (c) and wherein said first cell and said second cell being genetically proximal to each other indicating that said first individual substantially does not carry said genetic defect, and said first cell and said second cell being genetically distant from each other indicating that said first individual substantially carries said genetic defect.

17. Use of the method according to any one of Claims 1 to 13, for detecting a selected genetic defect in a first fetus wherein:

(a) said first cell is an amniotic cell obtained from said first fetus;

(b) said second cell is an amniotic cell obtained from a second fetus not having said genetic defect; (c) and wherein said first cell and said second cell being genetically proximal to each other indicating that said first fetus substantially does not carry said genetic defect, and said first cell and said second cell being genetically distant from each other indicating that said first fetus substantially carries said genetic defect.

18. The use according to Claim 16 or 17, wherein said genetic defect is trisomy 21.

19. A kit for carrying out the method of any one of Claims 1-13. comprising:

(a) means for detecting the genes of said selected gene family expressed in said first cell and in said second cell; (b) instructions for carrying out the method.

20. A kit for carrying out the method of any one of Claims 1 to 13 comprising:

(a) means for detecting the genes of said selected gene family expressed in said first cell;

(b) a catalogue providing the genes of said selected gene family expressed in said second cell;

(c) instructions for carrying out the method.

21. A kit according to Claim 19 for carrying out the method of any one of the preceding claims comprising:

(a) means for obtaining the mRNA from said first cell and said second cell;

(b) means for performing the reverse transcriptase polymer chain reaction on the mRNA obtained from said first cell and said second cell; (c ) means for detecting the genes of said selected gene family expressed in said first cell and in said second cell;

(d) instructions for carrying out the method.

22. A kit according to Claim 20 for carrying out the method of any one of Claims 1 to 13 comprising: (a) means for obtaining the mRNA from said first cell;

(b) means for performing the reverse transcriptase polymer chain reaction on the mRNA obtained from said first cell;

(c) means for detecting the genes of said selected gene family expressed in said first cell; (d) a catalogue providing the genes of said selected gene family expressed in said second cell;

(e) instructions for carrying out the method.

23. A method for obtaining cells capable of expressing an HB related desired property comprising the steps of: (a) identifying a specific pattern of expression of HB genes in cells having a desired property;