WO1999029159A9 - Plant senescence-associated genes - Google Patents

Abstract

Isolated genes which are expressed during plant senescence are provided. In particular, a gene is provided which encodes a receptor-like protein kinase which is preferentially expressed in plant leaves early in the process of plant senescence. Additionally, a gene encoding S-adenosyl methionine synthase which is expressed during the process of plant senescence is provided. Promoters from genes expressed during plant senescence are provided and operably linked to a foreign gene to provide developmental-specific expression of the foreign gene in a transformed plant.

Description

PLANT SENESCENCE-ASSOCIATED GENES

BACKGROUND OF THE INVENTION

I. Field of Invention

The present invention relates to isolated genes which are expressed early in the process of plant senescence. These genes are referred to as senescence-associated genes or sag genes. The present invention is directed to a class of sag genes which encode protein kinase. In particular, the present invention is directed to a senescence-associated regulatory protein kinase gene, or sark gene, which was isolated from bean and is expressed early in the plant senescence process.

The present invention is directed to another class of sag genes which encode S- adenosyl methionine (SAM) synthase and designated sam. The invention further relates to isolation of the promoter from a sag gene, such as the sark or sam gene promoter, and operably linking this promoter to a foreign gene. A sag gene promoter is used to drive expression of a gene product that inhibits or accelerates the senescence process. Alternatively, a sag gene promoter is used to drive expression of a desired product, such as a pharmaceutical, during the process of plant maturation. A sag gene promoter is used to drive expression of a gene which confers resistance, or enhances resistance to, a pathogen or pest during senescence when the plant is particularly susceptible to pathogen infection or pest infestation. Preferably, a first sag gene promoter is used to drive expression of a gene product that inhibits the senescence process, and a second sag gene promoter is used to drive expression of the foreign gene, such as gene encoding a pharmaceutical or disease resistance product, at later stages of plant maturation. The invention further relates to induction of sark gene expression in a detached plant part. The promoter of the sark gene is operably linked to a foreign gene to drive expression in a detached plant part.

π. Background Senescence refers to an active developmental process which is genetically controlled by the plant. Plants and their parts develop continuously and the latter part of this developmental process, which includes maturity and ultimately the loss of organization and function, is termed senescence. Plants exhibit senescence in many different ways. The whole plant may undergo senescence and die at one time as occurs in many annuals following completion of flowering. There may be a progressive senescence of plant parts as the whole plant ages. Typically, plant parts nearest the tips of shoots and roots remain active and in the juvenile stage while the older parts, such as older leaves, senesce and die. There may be senescence of a part of the plant, such as the top of an overwintering perennial, while the rest of the plant remains alive. Finally, certain cell types, such as xylem vessel and tracheids, may undergo senescence and die while the plant as a whole is growing vigorously.

Patterns of senescence differ with respect to process and reversibility. On the one hand, some types of senescence are closely related to developmental events in the whole plant. Senescence in monocarpic plants, for example, is closely related to flowering and growth of fruits. If flower or fruits are removed from a monocarpic plant, senescence may be postponed. Many monocarpic crop plants, including legumes and cereals, undergo abrupt chlorosis and death following fruit production, even under optimal growing conditions. On the other hand, the rapid senescence of a detached flower or leaf can be reversed by application of plant hormone, such as cytokinin or rooting the leaf. The senescence of older leaves on bean plants can be reversed if the top of the plant is removed. These observations reveal that senescence is a programmed part of development.

Biochemically, the senescence process is carefully regulated. Decreases in DNA, RNA, and proteins occur during the senescence process. The export of a substantial portion of plant nutrients from tissues undergoing senescence to the growing shoot is also associated with the process of senescence. Likewise, senescing cells undergo a reduction in their structure as the membranous subcellular compartments are disrupted. Morphological changes such as chlorosis of cotyledons and older leaves, or withering and shedding of flower petals following pollination, are aspects of senescence.

Significant evidence for genetic, programmed control of senescence has accumulated. For example, in Elodea leaf protoplasts produced by exposure to hypertonic conditions, only some protoplasts contain nuclei. Protoplasts containing nuclei undergo senescence while protoplasts lacking a nuclei remained green and photosynthetic. See Yoshida, Protoplasma 54: 476-492 (1961). It has also been shown that protein and RNA synthesis inhibitors block particular senescence phenomena. For example, see Nooden, THE PHENOMENON OF SENESCENCE AND AGING; WHOLE PLANT SENESCENCE, In Senescence and Aging in Plants, L. Nooden Eds. (Academic Press, San Diego, CA, 1988), pages 1-50, 391-439. Catabolism in senescing tissues involves a very diS-l-lct "aiTfl ϋrαereα"'Seφie__ee of cytological and biochemical events. In senescing cells, chloroplasts are the first organelles to deteriorate during onset of leaf senescence. Thylakoid protein components and stomal enzymes disappear in an ordered sequence. Gepstein, S., PHOTOSYNTHESIS IN SENESCENCE AND AGING IN PLANTS, Nooden and Leopold, eds. (1988), Hensel et al, Plant Cell 5: 553-564 (1993). In contrast, mitochondria and nuclei remain structurally and functionally intact until late stages of senescence. Thompson et al, ULTRASTRUCTURE AND SENESCENCE IN PLANTS In Plant Senescence: Its Biochemistry and Physiology, pages 20-30 W. Thomson et al, (eds) American Society of Plant Physiologists, Rockville, MD (1987)

The metabolism of senescing tissues requires the de novo synthesis of various hydrolytic enzymes such as proteases, nucleases, Upases and chlorophyll-degrading enzymes.

Not surprisingly, the levels of the majority of leaf mRNAs significantly declines during senescence while the abundance of certain other transcripts increases. Watanable and Imaseki, Plant Cell Physiol. 23: 489-497 (1982)

The expression levels of certain genes decrease during senescence and these are referred to as senescence down-regulated genes or sdg genes. The sdg genes include genes which encode proteins involved in photosynthesis. Gepstein, S., PHOTOSYNTHESIS IN

SENESCENCE AND AGING IN PLANTS, Nooden and Leopold, eds. (1988); Hensel et al, supra; John et al, Plant J. 1: 483-490 (1995).

The expression of other genes increase during plant senescence and a gene in this category is referred to as a senescence-associated gene or sag gene. About 30 different sag genes have been isolated and identified in several plant species including Arabidopsis, tomato, maize, barley, asparagus, Brassica napus, and carnation. These gene are expressed in different plant tissues. The functions of the proteins encoded by these genes generally have been deduced on the basis of their sequence homology to known genes.

One class of sag genes encode degradative enzymes such as proteases, ribonucleases and lipases. See Hensel et al. (1993), supra; Oh et al, Plant Mol. Biol. 30: 739-754 (1996); Taylor et al, Proc. Natl Acad. Sci. USA 90: 5118-5122 (1993); Ryu and Wang, Plant Physiol. 108:713-719 (1995)

Another class of sag genes encode ACC synthase and ACC oxidase which are enzymes involved in the biosynthesis of ethylene. Woodson et al. Plant Physiol. 99_j[2):526-532 (1992); and Nadeau et al, Plant Physiol. 103 (1) : 31-39 (1993). The enzyme S-adenosyl methionine (SAM) synthase comprises the first step in the ethylene biosynthetic pathway. The product of SAM synthase or SAM has additional roles in the plant cell, i.e. in the synthesis of polyamines and in the methylation of DNA. Therefore, the gene encoding SAM synthase, unlike the genes encoding ACC synthase or ACC oxidase, was not expected to be preferentially expressed during senescence.

Yet another class of sag genes encode products having secondary functions in senescence. These genes code for enzymes involved in the conversion or remobilization of breakdown products. One of these enzymes is glutamine synthetase (GS) which catalyzes the conversion of ammonium to glutamine and is responsible for nitrogen recycling from senescing tissues. Watanable et al, Plant Mol. Biol. 26: 1807-1817 (1994)

Transgenic plants expressing antisense of genes coding for enzymes involved in the ethylene biosynthetic pathway, such as ACC synthase and ACC oxidase, synthesize ethylene at very low levels. The antisense mutants have been shown to exhibit delayed leaf senescence as well as delayed fruit ripening in tomato. Oeller et al., Science 254: 437-439 (1991); Hamilton et al, Nature 346: 284-287 (1990); John et al, Plant Molecular Biology 30 (2): 297-306 (1996). The total life-span of these mutants increased by only 30% over the wild-type. Accordingly, ethylene appears to modulate the rate of senescence rather than completely control the process. Senescence was also delayed by transforming plants with a gene encoding isopentenyl transferase (IPT) , a key enzyme in cytokinin biosynthesis. Overexpression of IPT causes an overproduction of cytokinins, leading to delayed leaf senescence. Smart et al, Plant Cell 3 (7). : 647-656 (1991); Li et al, Dev. Biol. 153(2 386-395 (1992); Gan and Amasino, Science 270: 1986-1988 (1995)

The number of isolated and characterized plant promoters available for expression of foreign proteins in transgenic plants is very limited. Well- known examples of plant promoters include those associated with the CaMV 359, Agrobactenum nopaline synthase, and maize ubiquitin genes. See Odell et al, Plant Mol. Biol. K⁾: 263-272 (1988), Herrera-

Estrella et al, Nature 303: 209-213 (1983), Fox et al, Va. J. Sci. 43: 287 (1992).

There is a critical need for a broader repertoire of plant promoters, especially developmentally regulated and tissue-specific promoters that are only expressed at precise stages in plant development or in specific tissues. Such a promoter is used to drive expression of operably linked genes to provide the required level of expression of foreign genes at the required stage of development, or in specific tissues, of the transformed plant. There is also a need for additional promoters for construction of plants transformed with multiple foreign genes. Numerous difficulties have arisen when two or more different genes are introduced into a plant wherein each of the genes are operably linked to the same or similar promoters. Some of these difficulties include: (1) gene inactivation; (2) recombination as a result of pairing along homologous regions within the nucleotide sequence of the promoter leading to cross-over events and loss of the intervening region prior, or subsequent to, integration; and (3) competition among different copies of the same promoter region for binding of promoter-specific transcription factors or other regulatory DNA-binding proteins. A need therefore exists for a broader repertoire of promoters to be used for expression of foreign genes in transformed plants.

A need also exists for genes which encode proteins associated with senescence. A need exists for nucleotide sequences which can be used to control the onset of senescence. A need exists for expression control sequences such as transcription control sequences which can be operably linked to a foreign gene to drive expression during plant maturation. Furthermore, senescence-associated regulatory genes are needed for coordinated regulatory control of multiple senescence phenomena, for example, tissue senescence, organ senescence, hypersensitivity response, plant death, and programmed cell death (PCD). Additionally, senescence-associated regulatory genes which are expressed in detached plant parts are highly desirable. Presently known sag gene promoters are not tissue specific. Tissue-specific sag gene promoters would be useful to direct production of desired gene products in specific senescing plant tissues. Promoters exhibiting closely controlled temporal expression, different from the expression of known sag genes, are also needed to expand the repertoire of gene expression regulatory sequences.

SUMMARY OF THE INVENTION

Accordingly, it is an object of the present invention to provide an isolated gene which is expressed during the process of plant senescence.

It is another object of the present invention to provide an isolated gene which is expressed early in the plant senescence process. Yet another object of the present invention is to provide an isolated gene which encodes a protein that regulates the plant senescence process. Another object of the present invention to provide a gene which is preferentially expressed during the senescence process in a detached plant part such as a detached leaf or flower.

Yet another object of the present invention is to provide a promoter from a gene which is preferentially expressed during the process of plant senescence. This promoter is operably linked to a foreign gene to direct expression of the foreign gene product during plant maturation.

It is a further object of the present invention to provide a method for control of senescence by providing a ligand, or ligand analog, to a protein receptor in the signal transduction pathway for plant senescence.

In accomplishing these and other objectives, there is provided in accordance with one aspect of the invention, an isolated DNA molecule comprising a sark gene.

In accordance with another aspect of the present invention, there is provided a sark gene which encodes a serine/threonine protein kinase. In accordance with yet another aspect of the present invention, there is provided an isolated DNA molecule which is (a) SEQ ID NO: 1; (b) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 1; or (c) a functional fragment of (a) or (b), wherein the DNA molecule encodes a senescence-associated regulatory protein kinase (SARP). Also provided is an expression vector and transformed host comprising a DNA molecule encoding SARP.

In accordance with another object of the present invention, there is provided an isolated DNA molecule comprising a nucleotide sequence which is (a) SEQ ID NO: 5; (b) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 5; and (c) a functional fragment of (a) or (b), wherein said DNA molecule has the transcriptional activity of a sark gene promoter. Also provided is an expression vector and transformed host comprising an isolated DNA molecule which has the transcriptional activity of a sark gene promoter.

In accordance with another aspect of the invention, there is provided a method of producing a foreign protein in a transformed host plant or plant cell, comprising the steps of (a) constructing an expression vector comprised of a promoter operably linked to a foreign gene, wherein the promoter comprises a nucleotide sequence which is (i) SEQ ID NO: 5; (ii) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 5; and (iii) a functional fragment of (i) or (ii), wherein said nucleotide sequence has the transcriptional activity of a sark gene promoter; and (b) ttansforming a host.

In accordance with yet another aspect of the invention, there is provided a method of inhibiting plant senescence comprising the steps of (a) constructing an expression vector comprised of a promoter, wherein said promoter comprises a nucleotide sequence which is (i) SEQ ID NO: 5; (ii) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 5; and (iii) a functional fragment of (i) or (ii), wherein the nucleotide sequence has the transcriptional activity of a sark gene promoter; (b) operably linking said promoter to a foreign gene which is an antisense gene of a senescence-associated gene, a sark antisense gene, a S-adenosyl methionine synthase antisense gene, an ACC synthase antisense gene, an ACC oxidase antisense gene or gene encoding isopentenyl transferase, a gene encoidng ribozyme or a external guide sequence gene; and (c) transforming a host.

In accordance with another aspect of the present invention, there is provided a method of increasing plant resistance to pathogen infection or pest infestation comprising the steps of (a) constructing an expression vector comprised of a promoter, wherein the promoter is (i) SEQ ID NO: 5; (ii) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 5; and (iii) a functional fragment of (i) or (ii), wherein the nucleotide sequence has the transcriptional activity of a sark gene promoter; (b) operably linking the promoter to a disease resistance gene; and (c) transforming a host. The disease resistance gene may be an antisense gene, a coat protein gene, a ribozyme gene, a protease inhibitor gene, a Bacillus thuringiensis toxin gene, or a chitinase gene.

In accordance with another aspect of the present invention, there is provided a method of preferentially producing a foreign protein in the detached part of transformed plant, comprising the steps of (a) constructing an expression vector comprised of a promoter operably linked to a foreign gene, wherein said promoter comprises a nucleotide sequence which is (i) SEQ ID NO: 5; (ii) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 5; and (iii) a functional fragment of (i) or (ii), wherein the nucleotide sequence has the transcriptional activity of a sark gene promoter; (b) trar_sforming said plant; and (c) detaching said plant part. The foreign gene may encode the enzyme isopentyl transferase.

In accordance with another aspect of the present invention, there is provided an isolated DNA molecule comprising the nucleotide sequence of SEQ ID NO: 6. In accordance with another aspect of the present invention, there is provided an isolated peptide having the amino acid sequence of SEQ ID NO: 4.

BRIEF DESCRIPTION OF' THE DRAWINGS

Figure 1 presents the nucleotide sequence [SEQ ID NO: 1] of a senescence-associated regulatory kinase gene (sark) isolated from bean with its corresponding amino acid sequence [SEQ ID NO: 2). * represents the TAA stop codon. A leucine rich amino acid region which is believed to be involved in ligand binding is shown in bold. A domain expected by its hydrophobicity to be membrane-traversing is highlighted. A sequence which is expected to be involved in export of the protein to the cellular membrane is double underlined. Underlined and identified by roman numerals are eleven conserved regions that are typical of protein kinases.

Figure 2 presents the nucleotide sequence [SEQ ID NO: 3], and its corresponding amino acid sequence [SEQ ID NO: 4] of a region from the sark gene selected for expression in Escheήchia coli. Figure 3 presents the nucleotide sequence [SEQ ID NO: 5] upstream of the sark structural gene. The underlined sequence overlaps the nucleotide sequence of Figure 1.

Figure 4 presents the partial nucleotide sequence of a gene [SEQ ID NO: 6] encoding S-adenosyl methionine (SAM) and its corresponding amino acid sequence [SEQ ID NO: 7].

DETAILED DESCRIPTION

I. Definitions

The following definitions are provided to facilitate understanding of the invention. Senescence in plants or in plant parts is a genetically controlled process leading to morphological and biochemical changes associated with aging and death. Transcription of DNA into mRNA is generally reduced although expression of certain genes increases during senescence. Chlorophyll and protein degradation occurs during senescence. Increased transcription of genes encoding proteins responsible for conversion and mobilization of the breakdown products occurs during plant senescence. A senescence-associated down- regulated gene is referred to as a sdg. A senescence-associated gene which exhibits increased transcription during senescence is designated sag. A class of sag genes is the senescence-associated recjulatorv kinase gene or sark which encodes a protein kinase which is preferentially expressed early in the process of plant senescence. Typically, a sark gene is expressed prior to apparent changes in plant morphology or biochemistry generally associated with senescence.

A structural gene is a DNA sequence that is transcribed into messenger RNA (mRNA) which is then translated into a sequence of amino acids characteristic of a specific polypeptide.

A promoter is a DNA sequence that directs the transcription of a structural gene. Typically, a promoter is located in the 5' region of a gene, proximal to the transcriptional start site of a structural gene. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. For example, a promoter may be regulated in a tissue specific manner such that it is predominantly active in transcribing the associated coding region in a specific tissue type(s) such as leaves, roots or meristem. In contrast, if the rate of transcription is not regulated by either an inducing or a suppressing agent, the promoter is a constitutive promoter. If transcription from the promoter is predominant only at certain stages of plant development, then the promoter is a temporal promoter or a developmentallv-regulated promoter.

An isolated DNA molecule is a fragment of DNA that is not integrated in the genomic DNA of an organism. For example, a cloned sark gene is an illustration of an isolated DNA molecule. Another example of an isolated DNA molecule is a chemically-synthesized DNA molecule that is not integrated in the genomic DNA of an organism. Complementary DNA (cDNA) is a single-stranded DNA molecule that is formed from an mRNA template by the enzyme reverse transcriptase. Typically, a primer complementary to portions of mRNA is employed for the initiation of reverse transcription. Those skilled in the art also use the term "cDNA" to refer to a double-stranded DNA molecule consisting of such a single-stranded DNA molecule and its complementary DNA strand. In eukaryotes, RNA polymerase II catalyzes the transcription of structural genes to produce mRNA. A DNA molecule can be designed to contain an RNA polymerase II template in which the RNA transcript has a sequence that is complementary to at least a significant section (at least 10 nucleotides) of a specific mRNA. This particular RNA transcript is termed an antisense RNA and a DNA sequence that encodes the antisense RNA is termed an antisense gene. Antisense RNA molecules are capable of hybridizing in vivo to mRNA molecules, resulting in an inhibition of gene expression. A ribozyme is an RNA molecule that contains a catalytic center. The term includes RNA enzymes, self splicing RNAs, and self-cleaving RNAs. A DNA sequence that encodes a ribozyme is termed a ribozyme gene.

An external guide sequence is an RNA molecule that directs the endogenous ribozyme, RNase P, to a particular species of intracellular mRNA, resulting in the cleavage of the mRNA by RNase P. A DNA sequence that encodes an external guide sequence is termed an external guide sequence gene.

The term gene expression refers to the biosynthesis of a gene product. For example, in the case of a structural gene, expression involves transcription of the structural gene into mRNA and the translation of mRNA into one or more polypeptides.

A cloning vector is a DNA molecule, such as a plasmid, cosmid, or bacteriophage, that has the capability of replicating autonomously in a host cell. Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites at which foreign DNA sequences can be inserted in a deteraiinable fashion without loss of an essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance or ampicillin resistance.

An expression vector is a DNA molecule comprising a gene that is expressed in a host cell. Typically, gene expression is placed under the control of certain regulatory elements, including constitutive or inducible promoters, tissue-specific regulatory elements, and enhancers. Such a gene is said to be "operably linked to" the regulatory elements.

A recombinant host may be any prokaryotic or eukaryotic cell that contains either a cloning vector or expression vector. This term also includes those prokaryotic or eukaryotic cells that have been genetically engineered to contain the cloned gene(s) in the chromosome or genome of the host cell.

A foreign gene or a transgene refers in the present description to a DNA sequence that is operably linked to at least one heterologous regulatory element. For example, any gene other than a sag or sark gene is considered to be a foreign gene if the expression of that gene is controlled by the sag or sark gene promoter. A foreign gene includes an antisense gene. A transformed host may be any prokaryotic or eukaryotic cell that contains either a foreign gene, cloning vector or expression vector. This term includes those prokaryotic or eukaryotic cells that have been genetically engineered to contain the cloned gene(s) in the chromosome or genome of the host cell or transiently express the cloned gene. A transgenic plant is a plant having one or more plant cells that contain an expression vector or a stably integrated foreign gene.

A first nucleotide sequence has substantial seauence similarity to the coding sequence of a sag, sark or sam gene if the former sequence shares a similarity of at least 25%, preferably 50%, with the nucleotide sequence of a plant sag, sark or sam gene and encodes a protein which functions as a senescence-associated protein, protein kinase, or SAM synthase, respectively. Likewise a first nucleotide sequence has substantial sequence similarity to the promoter sequence associated with a sag, sark or sam gene if the former sequence shares a similarity of at least 25%, preferably 50%, with the nucleotide sequence of a plant sag, sark or sam gene promoter and has the same transcriptional activity as the sag, sark or sam gene promoter, respectively. Sequence similarity determinations can be performed, for example, using the FAST A program (Genetics Computer Group; Madison, WI). Alternatively, sequence similarity determinations can be performed using BLAST (Basic Local Alignment Search Tool) of the Experimental GENIFO^® BLAST Network Service. See Altschul et al, J. Mol. Biol. 215:403 (1990); Pasternak et al, "Sequence Similarity Searches, Multiple Sequence Alignments, and Molecular Tree Building," in METHODS IN PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY, Glick et al. (eds.), pages 251-267 (CRC 35 Press 1993) [hereafter "Glick (1993)"]. Promoter activity of the isolated nucleotide sequence can be assayed by means of fusing the nucleotide sequence to a coding region of a foreign reporter gene. Promoter activity is measured by assaying reporter expression. For example, see An et al, "Techniques for Isolating and Characterizing Transcription Promoters, Enhancers, and Terminators," be. cit., pages 155-66.

A detached plant part is any morphologically distinct explant from the plant. Representative detached plant parts include a cut flower, detached leaf, detached fruit, detached root or tissue culture cells.

II. Overview

For bean plants, a convenient visual marker for senescence onset is chlorosis of a first leaf. Plants grown under greenhouse conditions exhibit chlorosis of the first leaf at about 45 days following seed germination. The time of senescence onset is dependent on many factors including environmental conditions and genotype of the plant, but chlorosis of the first leaf provides a convenient visual marker. The isolated cDNAs of the present invention were obtained by differential display.

The two mRNA pools used in the differential display process were extracted from (1) fully expanded young bean leaves harvested from plants that been grown for not more than 15 days post-germination and (2) primary leaves displaying initial chlorosis harvested 45 days post- germination.

Two cDNA clones were isolated by differential display which are preferentially expressed in leaves during senescence, as confirmed by Northern blot analysis. Each cDNA clone was amplified, labeled, and used as a hybridization probe against mRNA extracted from young leaves and senescence-stage leaves. The isolated sag genes were inserted into plasmid pUC55 and subjected to nucleotide sequence analysis.

Nucleotide sequence analysis of an isolated cDNA clone obtained through differential display revealed that it encodes a protein which resembles the C-terminus a protein kinase. The cloned cDNA was used as a hybridization probe to obtain an isolated nucleotide sequence which is a senescence-associated regulatory protein kinase (sark) gene. The nucleotide sequence of the sark gene and its corresponding amino acid sequence are shown in Figure 1. The coding sequence of the sark gene is found between nucleotides 152 and 2863 of Figure 1. Accordingly the sark gene encodes a protein having 904 amino acids.

The sark gene is expressed early in the senescence process. An early event in plant senescence is a decrease in the level of the chlorophyll protein LHC2. The sark gene is expressed prior to a detectable decrease in LHC2. Additionally, the sark gene is expressed prior to chlorosis of the first leaf.

Northern analysis using the sark gene as a hybridization probe revealed that the sark gene is expressed in a detached bean leaf tissue, in the dark, 1 day after removal of the leaf tissue. Further analysis revealed that sark gene expression is developmentally controlled. The time of expression of the sark gene was constant relative to the age of an individual leaf. Accordingly, the youngest leaves near the top of the plant express the sark gene later in the overall life span of the plant than older leaves near the bottom of the plant.

Nucleotide sequence analysis revealed that another cDNA clone obtained through differential display corresponds to a sam gene. Figure 4 shows the partial nucleotide sequence of the isolated sam gene and the corresponding amino acid sequence. SAM synthase catalyses the first step in plant ethylene biosynthesis. Northern analysis using the cDNA clone corresponding to the same gene as a hybridization probe revealed that transcription of the sam gene occurs in young leaves, decreases in leaves at about 20 days post-germination and then increases as the leaves mature. Expression of the saw gene continues to increase as the leaves mature.

Ethylene production is known to occur during senescence. However, SAM synthase is involved in other plant processes such as polyamine synthesis and DNA methylation. Woodson et al., supra and Nadeau et al, supra. Consequently, the pattern of regulation of sam gene expression revealed by Northern analysis was surprising.

III. Identification of sag and sark Genes

Isolation of sag genes relies on identification of genes expressed preferentially during senescence. Approaches are well known to the skilled artisan for identification of mRNA expressed differentially in certain cell types of specific stages in plant development process or during infection by a parasite or a virus. Those studies generally employ substractive hybridization to reveal the differentially expressed mRNA(s). The substractive hybridization method generally employs preferential amplification of novel cDNA. "Tester" and "driver" cDNA pools are created. The tester DNA may have short DNA "tails" or "adaptors" attached by ligation to allow for amplification via polymerase chain reaction (PCR) primers complementary to these tails. The tester and driver cDNA pools are mixed, heated and allowed to reanneal. The remaining single-stranded cDNA is enriched for the unique sequences. The remaining single-stranded cDNA is PCR amplified as above, reannealed to driver cDNA, and the process is repeated, to allow further enhancement of the unique cDNA. Variation of the method may consist in having restriction enzyme sites build-in within the tails. This allows for addition of new adaptor molecules to the unique cDNA to enhance amplification of only unique cDNA in subsequent rounds.

Yet other variations to this basic scheme are known to one skilled in the art. For example, see the method by Ace et. al, Endocrinology 134: 1305-09 (1994). According to the Ace method, the adapters are attached to the driver cDNA and the adopters are biotinylated. This allows use of streptavidin or avidin to substract effectively the background cDNA.

Experiments that led to actual identification of the sag genes herein disclosed relied on a method by Liang et al, Nucleic Acids Res. 21: 3269-75 (1993) called "differential display." The method relies on the anchored-end technique of Borson et al, PCR Methods and

Applications 2: 144-48 (1992). It entails the use of a "lock-docking oligo (dT)." The locking mechanism involves extending the poly dT primer, by either one nucleotide (A, C or G) or by two nucleotides (also A, C or G) and yet one more of the four possible nucleotides, at the 3'- end of the primer. This "locks" the primer to the beginning of the poly dT tail, either the natural dT or a poly dT tail attached to the first strand cDNA 3 '-end by use of terminal deoxy transferase (TdT), resulting in the synthesis of cDNA's of discrete lengths.

The differential display method of Liang further employs a decanucleotide of arbitrary sequence as a primer for PCR, internal to the mRNA, in conjunction with a lock-docking oligo at the 3 '-end of mRNAs. When such sets of primers are employed, patterns of cDNAs can be visualized upon polyacrylamide gel electrophoresis of the PCR product, and the comparison of such patterns produced from mRNAs from two sources reveal the differentially expressed mRNAs. Variations to this approach are known to one skilled in the art. The observation that sark genes encode protein kinases enables yet another approach to identify those genes. As discussed hereinabove, plant protein kinases have regions of high homology. Nucleic acid probes based on the highly conserved regions can identify other protein kinase genes, preferably by screening of cDNA libraries. The temporal expression of any identified sark gene can be deduced from hybridization of the cDNA to mRNA isolated at different time points during plant development to identify isoalted nucleotide sequences having the transcriptional activity of a sark gene promoter.

IV. Cloning of Plant sag or sark Gene Promoters

Promoters associated with a sag or sark gene are isolated by identifying genes having substantial sequence similarity with the coding sequence of a plant sag or sark gene. Alternatively, a regulatory sequence from the sag or sark gene promoter is used as a hybridization probe to identify other promoters having substantial sequence similarity with these regulatory sequences.

The promoter associated with the sag or sark gene is isolated by conventional methods. The coding sequence of a bean sark gene is provided in Figure 1 and the upstream regulatory region of this gene is shown in Figure 3. A portion of the coding sequence of a bean sag gene, the sam gene, is shown in Figure 4. Oligonucleotides of defined sequence are chemically synthesized. Itakura et al, Anna. Rev. Biochem. 53: 323 (1984). Numerous automated and commercially available DNA synthesizers are currently available. The probe can be a single and relatively short oligonucleotide of defined sequence, pools of short oligonucleotides whose sequences are highly degenerate or pools of long oligonucleotides of lesser degeneracy. Sambrook et al, MOLECULAR CLONING: A LABORATORY

MANUAL 2d ed. (Cold Spring Harbor Press 1989). Alternatively, the entire sag or sark gene coding region, or fragments thereof, are labeled, for example radiolabeled, by conventional methods and used to detect related nucleotides sequences in plant genomic libraries by means of DNA hybridization. See Yang, supra and Sambrook (1989), supra.

A plant genomic DNA library can be prepared by means well-known in the art. See, for example, Slightom et al. "Construction of λ Clone Banks," in Glick (1993), pages 121- 46. Genomic DNA can be isolated from plant tissue, for example, by lysing plant tissue with the detergent Sarkosyl, digesting the lysate with proteinase K, clearing insoluble debris from the lysate by centrifugation, precipitating nucleic acid from the lysate using isopropanol, and purifying resuspended DNA on a cesium chloride density gradient. Ausubel et al. (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, pages 2.3.1-2.3.3. (1990). DNA fragments that are suitable for the production of a genomic library can be obtained by the random shearing of genomic DNA or by the partial digestion of genomic DNA with restriction endonucleases. See, for example, Ausubel et al, supra, at pages 5.3.2- 5.4.4, and Slightom et al, supra.

Genomic DNA fragments can be inserted into a vector, such as a bacteriophage or cosmid vector, in accordance with conventional techniques, such as the use of restriction enzyme digestion to provide appropriate termini, the use of alkaline phosphatase treatment to avoid undesirable joining of DNA molecules, and ligation with appropriate ligases. Techniques for such manipulation are disclosed by Slightom et al, supra, and are well-known in the art. Also see Ausubel et al, supra, at pages 3.0.5-3.17.5. A library containing genomic clones is screened with DNA hybridization probes based on the nucleotides sequence of the sag, sark or sam gene coding sequence by standard techniques. See, for example, Ausubel et al, supra, at pages 6.0.3-6.6.1; Slightom et al, supra.

V. Characterization of sag or sark Gene Promoters Genomic clones can be analyzed using a variety of techniques such as restriction analysis, Southern analysis, primer extension analysis, and DNA sequence analysis. Primer extension analysis or SI nuclease protection analysis, for example, can be used to localize the putative start site of transcription of the cloned gene. Ausubel et al, supra, at pages 4.8.1- 4.8.5; Walmsley et al, "Quantitative and Qualitative Analysis of Exogenous Gene Expression by the SI Nuclease Protection Assay," in METHODS IN MOLECULAR BIOLOGY, VOL.

7: GENE TRANSFER AND EXPRESSION PROTOCOLS, Murray (ed.), pages 271-81

(Humana Press Inc. 1991). Structural analysis can be combined with functional analysis for a complete characterization of the promoter region. The general approach of such functional analysis involves subcloning fragments of the genomic clone into an expression vector which contains a reporter gene, introducing the expression vector into various plant tissues, and assaying the tissue to detect the transient expression of the reporter gene. Methods for generating fragments of a genomic clone are well-known. Preferably, enzymatic digestion is used to form nested deletions of genomic DNA fragments. See, for example, Ausubel et al., supra, at pages 7.2.1-7.2.20; An et al, supra.

Alternatively, DNA that resides "upstream," or 5 '-ward, of the transcriptional start site can be tested by subcloning a DNA fragment that contains the upstream region, digesting the DNA fragment in either the 5' to 3' direction or in the 3' to 5' direction to produce nested deletions, and subcloning the small fragments into expression vectors for transient expression.

The selection of an appropriate expression vector will depend upon the method of introducing the expression vector into host cells. Typically, an expression vector contains: (1) prokaryotic DNA elements coding for a bacterial replication origin and an antibiotic resistance marker to provide for the growth and selection of the expression vector in the bacterial host; (2) eukaryotic DNA elements that control initiation of transcription, such as a promoter; (3) DNA elements that control the processing of transcripts, such as a transcription termination/polyadenylation sequence; and (4) a reporter gene that is operably linked to the DNA elements that control transcription initiation. Useful reporter genes include β- glucuronidase, β-galactosidase, chloramphenicol acetyl transferase, green florescent protein (GFP), luciferase, and the like. Preferably, the reporter gene is either the β-glucuronidase (GUS) gene or the luciferase gene. For example, see Jefferson et al, Plant Molecular Biology Reporter 5: 387 (1987). General descriptions of plant expression vectors and reporter genes can be found in Gruber et al, "Vectors for Plant Transformation," in Glick (1993), pages 89-119. Moreover, GUS expression vectors and GUS gene cassettes are available from Clontech Laboratories, Inc. (Palo Alto, CA), while luciferase expression vectors and luciferase gene cassettes are available from Promega Corporation (Madison, WI).

Expression vectors containing test genomic fragments can be introduced into protoplasts, or into intact tissues or isolated cells. Preferably, expression vectors are introduced into intact tissues. General methods of culturing plant tissues are provided, for example, by Miki et al, "Procedures for Introducing Foreign DNA into Plants," in Glick (1993), pages 67-88. Methods of introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant tissue with Agrobactenum tumefaciens. Horsch et al., "A simple and general method for transferring genes into plants, "Science 227: 1229-31 (1985). Descriptions of Agrobactenum vector systems and methods for Agrobacterium- mediated gene transfer are provided by Gruber et al (1993), supra, and Miki et al. (1993), supra. Methods of introducing expression vectors into plant tissue also include direct gene transfer method such as microprojectile-mediated delivery, DNA injection, electroporation, and the like. Id.

Variants, or functional fragments, of the sag, sark or sam gene promoter can be produced by deleting, adding and/or substituting nucleotides. Such variants or functional fragments can be obtained, for example, by oligonucleotide-directed mutagenesis, linker- scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like. Ausubel et al, supra, at pages 8.0.3-8.5.9. Also see generally, McPherson (ed.), DIRECTED MUTAGENESIS: A PRACTICAL APPROACH, IRL Press (1991). Thus, the present invention also encompasses the promoter DNA molecules comprising nucleotide sequences that have substantial sequence similarity with the coding region of a sag gene, including a sark and sam gene.

VI. Agronomically Important Genes

By means of the present invention, agronomically important, foreign genes, can be operably linked to a sag, sark or sam gene promoter and expressed in transformed plants during plant maturation. A sag, sark or sam gene promoter is advantageously utilized to overexpress an operably linked gene because gene expression does not occur until later stages in the development of the plant thereby limiting the demand on plant metabolic resources that could reduce plant vigor during early stages of development. These promoters therefore increase the utility of using plants as bioreactors for pharmaceutical production. Preferably, a first sag gene promoter is used to drive expression of a gene product that inhibits the senescence process and a second sag gene promoter is used to drive expression of the foreign gene, such as gene encoding a pharmaceutical or disease resistance product, at later stages of plant maturation. Furthermore, a gene can be selectively expressed in detached plant parts, for example a stem of cut flowers and leaves, or in fruit.

The agronomic genes implicated in this regard include, but are not limited to, genes which control senescence. Other agronomic genes include genes which increase or enhance resistance to plant pathogens or pests, enhance plant vigor, height, fragrance or color.

With regard to control of plant senescence, genes encoding enzymes involved in cytokinin biosynthesis such as isopentyl transferase, are operably linked to a sag, sark or sam gene promoter and expressed in transformed plants during plant senescence. Production of increased cytokinin during senescence inhibits the senescence process. Cyto__inins play a role in leaf senescence. The sag or sark gene promoters are particularly suited for expression of a gene encoding isopentenyl transferase, the enzyme that catalyzes the rate-limiting step in cytokinin biosynthesis. Gan and Amasino, Science 270:1966 (1995). Alternatively, an antisense gene of an ethylene biosynthetic gene such as ACC synthase, ACC oxidase or SAM synthase is operably linked to a sag, sark or sam gene promoter and expressed in transformed plants during plant senescence to inhibit the senescence process. An antisense gene of a plant senescence-associated gene such as a sag, sark or sam gene, is operably linked to a sag, sark or sam gene promoter and expressed in transformed plants during plant senescence to inhibit the senescence process. Other alternative strategies for control os senscence-associated gene expression include use of genes encoding ribozyme or external guide sequences to control gene expression.

Plant or pest disease resistance genes, or genes which enhance resistance to plant pathogens or pests, are operably linked to a sag, sark or sam gene promoter and expressed in transformed plants during plant senescence. Plants are particularly susceptible to infection by certain plant pathogens and infestation by certain insect pests during senescence. Certain plant pathogenic fungi such as Botrytis sp. or Sclerotinia sp. generally first infect dead or senescing plant tissue and then proceed to infect healthy plant tissue. Accordingly, expression of disease resistance gene products in senescing tissue increases or enhances resistance to pathogen infection and pest infestation.

The sag, sark or sam gene promoters may drive expression of insecticidal toxin genes. For example, the gram-positive bacterium Bacillus thuringiensis produces polypeptides that are toxic to a variety of insect pests, but have no activity against vertebrates and beneficial insects. Thompson, "Biological Control of Plant Pests and Pathogens: Alternative Approaches," in BIOTECHNOLOGY IN PLANT DISEASE CONTROL, Chet (ed.), pages 275-290 (Wiley-Liss, Inc. 1993). An enzyme inhibitor such as a protease inhibitor, or an amylase inhibitor gene, is operably linked to a sag, sark or sam gene promoter. See, for example, Abe et al, J. Biol. Chem. 262: 16793 (1987) (nucleotide sequence of rice cysteine proteinase inhibitor) , Huub et al, Plant Molec. Biol. 21: 985 (1993) (nucleotide sequence of cDNA encoding tobacco proteinase inhibitor I), and Sumitani et al, Biosci. Biotech. Biochem. 57:1243 (1993) (nucleotide sequence of Streptomyces nitrosporeus α-amylase inhibitor) Other insects toxins include an insect-specific hormone or pheromone such as an ecdy steroid and juvenile hormone, a variant thereof, a mimetic based thereon, or an antagonist or agonist thereof. See, for example, the disclosure by Hammock et al, Nature 344:458 (1990), of baculo virus expression of cloned juvenile hormone esterase, an inactivator of juvenile hormone. Alternatively, an insect-specific peptide or neuropeptide which, upon expression, disrupts the physiology of the affected pest can be utilized. For example, see the disclosures of Regan, J. Biol. Chem. 269:9 (1994) (expression cloning yields DNA coding for insect diuretic hormone receptor), and Pratt et al., Biochem. Biophys. Res. Comm. 163:1243 (1989) (an allostatin is identified in Diploptera puntata) . See also Tomalski et al, U.S. patent No. 5,266,317, who disclose genes encoding insect-specific, paralytic neurotoxins.

Another alternatively is the insect-specific venom produced in nature by a snake, a wasp, etc. For example, see Pang et al., Gene 116:165 (1992), for disclosure of heterologous expression in plants of a gene coding for a scorpion insectotoxic peptide.

Chitinase genes are useful for inhibiting insect pests. Chitinase also can be used for combating fungal pathogens. Additional antifungal genes include genes encoding β-1,3- glucanase, which degrades a major polysaccharide of fungal cell walls, and ribosome inactivating protein, which inactivates fungal ribosomes. Full-length cDNAs of glucanase and ribosome-inactivating protein are disclosed in Leah et al, J. Biol. Chem. 266:1564 (1991). In addition, Logemann et al, Bio/Technology 10:305 (1992), demonstrate that the expression of a foreign ribosome inactivating protein increases resistance to fungal disease in transgenic plants.

Those of skill in the art are aware of additional polypeptides useful to protect plants against bacterial and fungal pathogens. See, for example, During, Molec. Breeding 2:297 (1996). Such polypeptides include the bactericidal native and recombinant cecropins, insect attacin, frog magainin, cereal thionins, T4 and hen egg white lysozyme, horseshoe crab tachyplesin I, Erwinia oligogalacturonide lyase. Moreover, a variety of plant disease resistance genes are available for use. Bent, The Plant Cell 8:1757 (1996)

Preferred antibacterial and antifungal genes include DNA molecules that encode natural and synthetic lytic peptides and plant defensins. Lytic peptides are broad-spectrum antibiotic peptides that are active against Gram-negative and Gram-positive bacteria, fungi and protozoa. These peptides can be classified into many categories based upon their structure (e.g., linear vs. cyclic), their size (20-45 amino acids) and their source (e.g., insect, amphibian, plant) However, despite their apparent diversity, numerous defense-related peptides have the common features of being highly basic and being capable of forming amphipathic structures. These unifying features suggest that most peptides appear to act by a direct lysis of the pathogenic cell membrane. Their basic structure facilitates their interaction with the cell membrane, and their amphipathic nature allow them to be incorporated into the membrane ultimately disrupting its structure.

Frog skin secretions of the African clawed frog, Xenopus laevis, have been discovered to be a particularly rich source of antibiotic peptides. Known peptides include magainins, PGL\ xenopsin, and caerulein. Gibson et al., J. Biol. Chem. 261:5341 (1986); Jacob and Zasloff, Ciba Found. Symp. 186:197 (1994); James et al, Anal. Biochem. 217:84 (1994); Maloy and Kari, Biopolymers 37:105 (1995); Wechselberger and Kreil, J. Molec. Endocrinal 14:357 (1995). Magainins 1 and 2 have 23 amino acid residues in length, contain no cysteine, and form an amphipathic α-helix. PGL^a is a small peptide processed from a larger precursor and is both cationic and amphipathic in nature. It has the somewhat unusual feature of containing a COOH-terminal amide group rather than the expected carboxyl group. Moreover, it has been reported that magainin 2 (but not magainin 1) and PGL^a can interact synergistically with one another to exert enhanced levels of anti-microbial activity. Westerhoff et al, Eur. J. Biochem. 228:257 (1995).

Insects have also been demonstrated to possess a variety of defense-related peptides. Cecropins from moths and flies are slightly larger than the frog-derived peptides (31-39 residues), are basic due to the presence of multiple arginine and lysine residues, and therefore interact strongly with the negatively charged lipid bilayer. Boman, Cell 65:205 (1991). Studies of these peptides have shown that they form an N-terminal α-helical region connected by a hinge region to a C-terminal cy-helical domain.

In addition to the naturally-occurring peptides, a wide array of synthetic analogs representing deletion, substitution and variable chain length derivatives have been generated for structure/activity relationship studies. A number of these synthetic variants exhibit increased anti-microbial activity against bacteria and fungi. Moreover, in some cases, not only has the anti-microbial potency of the synthetic lytic peptides increased dramatically, but their spectrum of anti-microbial activity has also broadened. The isolation and characterization of plant defensins from a number of plant species has revealed that these small peptides possess potent anti-microbial activity. Broekaert et al, Plant Physiol. 108:1353 (1995); Epple et al, FEBS Lett. 400:168 (1997). One of these defensins, Rs-AFP2 from radish seeds, has been extensively characterized. Terras et al., Plant Cell 7:573 (1995). A cDNA molecule that encodes this peptide has been cloned and overexpressed in tobacco. Transgenic tobacco which accumulate high levels of this peptide show enhanced resistance to infection by the fungal pathogen, Alternaria longipes.

Preferred insect resistance genes include DNA molecules that encode tryptophan decarboxylase (TDC) and lectins. TDC catalyzes the decarboxylation and conversion of L- tryptophan into tryptamine. Tryptamine arjd secologanin, another secondary compound, are then condensed to form strictosidine, the precursor for all terpenoid indole alkaloids in Catharanthus roseus (periwinkle). The cloning and characterization of a TDC cDNA molecule from Catharanthus seedlings has been described by De Luca et al., Proc. Nat 'I Acad. Sci. USA 86:2582 (1989).

Thomas et al, Plant Physiol. JO9: 717 (1995) demonstrated that tobacco plants which accumulated tryptamine adversely affected the development and reproduction of Bemisia tabaci (sweet potato whitefly) Whitefly emergence tests revealed that pupae emergence (to adulthood) on trypt__mine-accumulating plants was typically reduced three to seven-fold relative to control plants. They speculated that tryptamine may exert its anti- whitefly effect(s) during either larval and pupal development and/or adult selection of a leaf for feeding and oviposition. Studies with the TDC gene are presented below.

An alternative to the tryptamine strategy focuses on the use of lectins to disrupt the normal life cycle of insect pests. A considerably large number of artificial feeding studies have shown that a wide range of insects are susceptible to these compounds. One particular lectin, isolated from Galon thus nivalis (snowdrop plant), has been demonstrated to exhibit anti-insect activity against phloem-feeders like aphids and leafhoppers. The production of transgenic plants that express GNA lectin is described below.

In one approach for providing protection against viral infections, transgenic plants express a viral protein. The accumulation of viral coat or replicase proteins in transformed plant cells provides resistance to viral infection and/or disease development by the virus from which the coat protein gene was derived, as well as by related viruses. See Beachy et al, Ann. Rev. Phytopathol. 28: 451 (1990); Beachy, "Virus Resistance Through Expression of Coat Protein Genes," in BIOTECHNOLOGY IN PLANT DISEASE CONTROL, 3rd Edition, Chet (Ed.), pages 89-104 (Wiley-Liss, Inc. 1993). For example, coat protein-mediated resistance has been conferred upon transformed plants against alfalfa mosaic virus, cucumber mosaic virus, tobacco streak virus, potato virus X, potato virus Y, tobacco etch virus, tobacco rattle virus, and tobacco mosaic virus. Id. Alternatively, protection against viral disease can be achieved using a vector that expresses mammalian 2'-5' oligoadenylate synthetase. Truve et al, Bio/Technobogy 11: 1048 (1993), disclose the cloning and nucleotide sequence of a rat cDNA encoding 2 '-5' oligoadenylate synthetase, a component of the mammalian interferon-induced antivirus response. Truve et al, also disclose that transgenic plants expressing 2'-5' oligoadenylate synthetase are protected against viral infection under field conditions.

In a third approach to providing protection against viral infection, a transgenic plant expresses a viral genome antisense RNA. For example, antisense RNA has been used to confer resistance to cucumber mosaic virus, as disclosed by Rezaian et al, Plant Molec. Biol 11: 463 (1988). Moreover, Day et al, Proc. Nat'l. Acad. Sci. 88: 6721 (1991), have demonstrated the use of antisense RNA to confer resistance to tomato golden mosaic virus.

In a fourth approach to providing protection against viral infection, a transgenic plant expresses pokeweed antiviral protein (PAP), a ribosome-inhibiting protein found in the cell walls of Phytolacca americana. Lodge et al, Proc. Nat'l Acad. Sci USA 90:7089 (1993), for example, show that PAP-expressing transgenic plants are resistant to a broad spectrum of plant viruses. Lodge et al. also disclose a method for isolating PAP cDNA.

A variety of genes have been shown to create a more compact habit and earlier flowering in transgenic plants. These include the rol genes (A, B, and C) from Agrobactenum rhizogenes (U.S. Patent No. 5,648,598), phytochrome genes such as phyA (McCormac et al, Planta 185: 162-170 (1991)), developmental genes such as Ify (Wegel and Nilsson, Nature 'ill: 495-496 (1995)), and the MADS-box containing family of genes such as apetala (Mandel and Yanofski, Nature 377: 522-524 (1995)), and OsMADSl (Chung et. al, Plant Mol. Biol. 26: 657-665, (1994))

A variety of genes have been shown to create modified color expression in transgenic plants. These include the cnO gene which can lead to the synthesis of the bright red pigment called astaxanthin, the lycopene cyclase gene which can lead to the synthesis of the orange pigment β-carotene, the β-carotene, hydroxylase gene which can lead to the synthesis of the golden pigment zeaxanthin, as well as the genes in the flavonoid biosynthesis pathway which leads to the various anthocyananin pigments which can be red, blue, pale yellow, as well as a wide range of intermediates and pastels.

Several genes have been cloned which affect plant fragrance. These genes include, but are not limited to, the linalool synthase gene which causes the synthesis of aromatic linalool and the limonene synthase gene which causes synthesis of the fragrant limonene (Alonsa et al, J. Biob. Chem. 267: 7582-7587 (1992). The Us gene encoαes the δhzyme l_n__Tdf_r synthase and will be fused to the sark gene promoter and will be used for plant transformation. Accordingly, the desired fragrance is produce at later stages of plant maturation as the plant approaches market stage. Other agronomic genes include those involved in ethylene biosynthesis. Ethylene is a key regulator of plant growth and development. Ethylene affects seed germination, stem and root elongation, flower initiation, and senescence of leafs and flowers. Many important floricultural products are very sensitive to ethylene, and under current practice, plants are treated with silver thiosulfate to eliminate ethylene sensitivity. This practice, however, is being phased out because the use of silver thiosulfate has negative environmental consequences.

Plants which are insensitive to ethylene are produced by expressing a gene that affects the synthesis or perception of ethylene. For example, the Arabidopsis etr-1 and the tomato NR genes encode mutated receptors that confer dominant ethylene insensitivity. Alternatively, genes encoding enzymes involved in ethylene biosynthesis are inactivated. For example, a sag gene promoter is operably linked to an antisense gene of ACC synthase, ACC oxidase or SAM synthase. Alternatively, if increased ethylene synthesis is desired, the sag gene promoters here identified can be used to express ACC synthase, ACC oxidase, or the bacterially derived ACC deaminase. Another agronomic gene implicated by the present invention is the Vitreoscibba hemoglobin gene ("vhb gene"), which is expressed by bacteria under oxygen limited conditions. Khosla and Bailey, Nature 331:633 (1988). Holmberg et al, Nature Biotechnology 15:244 (1997), have shown that transgenic tobacco plants that express the vhb gene exhibit enhanced growth and a reduction in germination time, presumably due to an increased availability of oxygen and/or energy in the plant cells.

Synthesis of genes can be effected by the polymerase chain reaction. See, for example, Ausubel et al. (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, pages 8.2.8 to 8.2.13 (Wiley Interscience 1990), and Wosnick et al, Gene 60: 115 (1987). Moreover, current techniques which employ the polymerase chain reaction permit the synthesis of large genes. See Adang et al, Plant Molec. Biol. 21: 1131 (1993), and Bambot et al, PCR Methods and Applications 2: 266 (1993). VI. Plant Transformation

As an initial step to the introduction of a foreign gene into plants, an appropriate expression vector must be chosen. The selection of an appropriate expression vector will depend upon the method of introducing the expression vector into host cells. Typically, an expression vector contains: (1) prokaryotic DNA elements coding for a bacterial replication origin and an antibiotic resistance gene to provide for the growth and selection of the expression vector in the bacterial host; (2) a cloning site for insertion of an exogenous DNA sequence; (3) eukaryotic DNA elements that control initiation of transcription of the exogenous gene, such as a promoter; (4) DNA elements that control the processing of transcripts, such as a transcription termination/polyadenylation sequence; and (5) a gene encoding a marker protein (e.g., a reporter gene) , wherein the gene is operably linked to the DNA elements that control transcription initiation. General descriptions of plant expression vectors and reporter genes can be found in Gruber et al, "Vectors for Plant Transformation," in METHODS IN PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY, Glick et al. (eds.), pages 89-119 (CRC Press, 1993).

The expression may comprise a selectable or screenable marker. Many of the commonly used positive selectable marker genes for plant transformation were isolated from bacteria and code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide. Other positive selective marker genes encode an altered target which is insensitive to the inhibitor.

The most commonly used selectable marker gene for plant transformation is the neomycin phosphotransferase II (nptll) gene, isolated from Tn5, which when placed under the control of plant regulatory signals confers resistance to kanamycin. Fraley et al., Proc. Natl Acad. Sci. U.S.A. 80: 4803 (1983). Another commonly used selectable marker is the hygromycin phosphotransferase gene which confers resistance to the antibiotic hygromycin. Vanden Elzen et al, Plant Mol. Biol. 5: 299 (1985). Additional positive selectable marker genes of bacterial origin that confer resistance to antibiotics include gentamicin acetyl transferase, streptomycin phosphotransferase, aminoglycoside-3'-adenyl transferase and the bleomycin resistance determinant. Hayford et al, Plant Physiol. 86: 1216 (1988); Jones et al, Mol. Gen. Genet. 210: 86 (1987); Svab et al, Plant Mob. Biol. 14: 197 (1990), Hille et al, Plant Mol. Biol. 7: 171 (1986).

Other positive selectable marker genes for plant transformation are not of bacterial origin. These genes include mouse dihydrofolate reductase, plant 5-enolpyruvylshikimate-3- phosphate synthase and plant acetolactate synthase. Eichholz et al., Somatic Cell Mol. Genet. 13: 67 (1987); Shah et al, Science 233:478 (1986); Charest et al, Plant Cell Rep. 8: 643 (1990).

Other common selectable marker genes for plants confer resistance to herbicidal inhibitors of glutamine synthetase. European Patent application No. 0 333 033 to Kumada et al. and U.S. Patent No. 4,975,374 to Goodman et al. disclose nucleotide sequences of glutamine synthetase genes which confer resistance to herbicides such as L-phosphinothricin. The nucleotide sequence of a phosphinothricin-acetyl-transferase gene is provided in European application No. 0 242 246 to Leemans et al. De Greef et al, Bio/Technology 1: 61 (1989), describe the production of transgenic plants that express chimeric bar genes coding for phosphinothricin-acety 1-transferase activity .

Another class of marker genes for plant transformation requires screening of presumptively transformed plant cells rather than direct genetic selection of transformed cells for resistance to a toxic substance such as an antibiotic. These genes are particularly useful to quantify or visualize the spatial pattern of expression of a gene in specific tissues and are frequently referred to as reporter genes because they can be fused to a gene or gene regulatory sequence for the investigation of gene expression.

Commonly used genes for screening presumptively transformed cells include β- glucuronidase (GUS), β-galactosidase, luciferase and chloramphenicol acetyltransferase. Jefferson, Plant Mol. Biol. Rep. 5:387 (1987); Teeri et al, EMBO J. 8: 343 (1989); Koncz et al, Proc. Natl Acad. Sci. U.S.A. 84: 131 (1987); De Block et al, EMBO J. 3: 1681 (1984). Another approach to the identification of relatively rare transformation events employs a gene that encodes a dominant constitutive regulator of the Zea mays anthocyanin pigmentation pathway. Ludwig et al, Science 247: 449 (1990). Expression vectors containing a foreign gene can be introduced into protoplast, or into intact tissues, such as immature embryos and meristems, or into callus cultures, or into isolated cells. Preferably, expression vectors are introduced into intact tissues. General methods of culturing plant tissues are provided, for example, by Miki et al, "Procedures for Introducing Foreign DNA into Plants," in METHODS IN PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY, Glick et al. (eds.), pages 67-88 (CRC Press, 1993), and by Phillips et al, "Cell/Tissue Culture and In Vitro Manipulation," in CORN AND CORN IMPROVEMENT, 3^rd Edition, Sprague et al. (eds.), pages 345-387 (American Society of Agronomy, Inc. et al. 1988). Methods of introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant tissue with Agrobactenum tumefaciens. Horsch et al, Science 227: 1229 (1985) Preferably, a disarmed Ti-plasmid is used as a vector for foreign DNA sequences. Transformation can be performed using procedures described, for example, in European patent application Nos. 116 718 (1984) and 270 822 (1988). Preferred Ti-plasmid vectors contain the foreign DNA sequence between the border sequences, or at least located upstream of the right border sequence.

Other types of vectors can be used for transforming plant cells using procedures such as direct gene transfer (see, for example, PCT application WO 85/01856 and European application 275 069), in vitro protoplast transformation (for example, U.S. patent No. 204,684,611), plant virus-mediated transformation (for example, European application No. 067 553 and U.S. patent No. 4,407,956), and liposome-mediated transformation (for example, U.S. patent No. 4,536,475). Suitable methods for corn transformation are provided by Fromm et al, Bio /Technology 8: 833 (1990), and by Gordon-Kamm et al, The Plant Cell 2:603 (1990). Standard methods for the transformation of rice are described by Christou et al, Trends in Biotechnology : 239 (1992), and by Lee et al, Proc. Nat'l. Acad. Sci. USA 88: 6389 (1991). Wheat can be transformed using methods that are similar to the techniques for tr∑tnsfoπning corn or rice. Furthermore, Casas et al, Proc. Nat'l. Acad. Sci. USA 90: 11212 (1993), describe a method for transforming sorghum, while Wan et al, Plant Physiol. JO4: 37 (1994), describe a method for transforming barley.

In general, direct transfer methods are preferred for the transformation of a monocotyledonous plant, particularly a cereal such as rice, corn, sorghum, barley or wheat. Suitable direct transfer methods include microprojectile-mediated delivery, DNA injection, electroporation, and the like. See, for example, Gruber et al, supra, Miki et al, supra, and Klein et al, Bio/Technology JO: 268 (1992). More preferably, expression vectors are introduced into tissues of a monocotyledonous plant using microprojectile-mediated delivery with a biolistic gun.

VII. Control of Plant Senescence

A. Gene Control Strategies A sag gene, including a sark or sam gene of the instant invention, is inactivated in a transgenic plant by expression of a gene construct that inhibits expression of the senescence gene thereby retarding the senescence process. In a preferred embodiment, expression of a sark gene is targeted for inhibition. Strategies that allow suppression of a specific gene are known and include antisense, ribozymes and external sequence guide genes. Preferably, the expression of an anti-senescence DNA construct is operably linked to a plant compatible developmentally regulated promoter such as that isolated from a sag or sark gene, or an inducible promoter. The binding of antisense RNA molecules to target mRNA molecule results in hybridization arrest of translation. Paterson, et al, Proc. Natl. Acad. Sci. USA 74: 4370 (1987). In the context of the present invention, a suitable antisense RNA molecule would have a sequence that is complementary to sag or sark gene mRNA. In a preferred embodiment of the invention, the antisense RNA is under the control of sark gene promoter. Activation of this promoter, in this context allows inhibition of senescence

In an alternative approach, ribozymes can be designed to express endonuclease activity that is directed to a certain target sequence in a mRNA molecule. For example, Steinecke et al, EMBO J. H:1525 (1992), achieved up to 100% inhibition of neomycin phosphotransferase gene expression by ribozymes in tobacco protoplast. More recently, Perriman et al, Antisense Res. & Deveb. 3: 253 (1993), inhibited chloramphenicol acetyl transferase activity in tobacco protoplast using a vector that expressed a modified hammerhead ribozyme. In the context of the present invention, mRNA of the newly identified sag gene, and in particular of the sark gene, provides the appropriate target RNA molecule for ribozymes. In a preferred embodiment of the invention, the ribozyme is under the control of an inducible promoter. Activation of this promoter, in this context, allows retardation of a senescence phenomena.

In a further alternative approach, expression vectors are constructed in which an expression vector encodes RNA transcripts capable of promoting RNase P-mediated cleavage of sag or sark gene mRNA molecules. According to this approach, an external guide sequence can be constructed for directing the endogenous ribozyme, RNaseP, to the target mRNA, which is subsequently cleaved by the cellular ribozyme. Airman et al, U.S. Patent No. 5,168,053; Yuan et al, Science 263: 1269 (1994). Preferably, the external guide sequence comprises a ten to fifteen nucleotide sequence complementary to sag or sark gene mRNA, and a 3'-NCCA nucleotide sequence, wherein N is preferably a purine. Id. The external guide sequence transcripts bind to the targeted mRNA species by the formation of base pairs between the mRNA and the complementary external guide sequences, thus promoting cleavage of mRNA by RNase P at the nucleotide located at the 5' side of the base- paired region. Id. In a preferred embodiment of the invention, the external guided sequence RNA is under the control of an inducible promoter. Activation of this promoter, in mis context, allows retardation of a senescence phenomena.

In an alternative approach, senescence can be enhanced in a transgenic plant by providing additional copies of a sag gene, preferably a sark gene, or variants thereof. In a preferred embodiment, the sark is under control of tissue-specific promoter. Overexpression of a sag gene would be desirable, for example, for ripening fruit or induction of flowering at precise time points, such as time of sale.

Transcription of the sark gene is induced prior to onset of chlorophyll degradation. Transcription of the sark gene is repressed later in the plant senescence process and therefore sark gene expression is not detectable late in plant development. This temporal expression pattern provides an opportunity to transcribe agronomic genes operably linked to the sark promoter prior to onset of chlorophyll degradation but before plant senescence is fully expressed. Expression of heterologous proteins in plants might be toxic to the plant, cause a significant decrease in available plant metabolic resources leading to poor plant vigor, and/or prevent normal plant development if produced at earlier developmental stages. Inhibition of plant growth can be advantageously avoided by producing the protein encoded by the agronomic gene during later stages of plant development. Preferably, a first sag gene promoter is used to drive expression of a gene product that inhibits the senescence process and a second sag gene promoter is used to drive expression of the agronomic gene, such as gene encoding a pharmaceutical or disease resistance product, so that the agronomic gene product is produced in mature plants. Agronomic genes that can be advantageously expressed under these conditions are numerous and include color genes, fragrance genes, or pharmaceutical genes. Agronomic genes for inhibition of sag gene expression, such as antisense, ribozyme or external guide sequence genes, may benefit from expression just prior to onset of plant senescence and chlorophyll degradation.

The sark gene is expressed in detached leaves, starting about one day after being detached from the plant. Leaf senescence controls senescence of other plant organs, for example, flowers or fruit. A limiting factor in the sale or marketing of cut flowers, for example, is their limited postharvest life-span due to rapid wilting and senescence of petals and leaves. Cytokinin spraying retards leaf chlorosis and improves the quality of cut flowers. See Hadas et al. Postharvest Biol Tech. 9 :65-73 (1996). Plant senescence can be inhibited in detached plant parts such as cut flowers by any of the methods described above. For example, a sag promoter, such as a sark gene promoter, is operably linked to a cytokinin biosynthetic gene such as isopentyl transferase. Alternatively, the sag gene promoter is operably linked to an antisense gene of a sag, sark, sam or ethylene biosynthetic gene. Furthermore, a sark gene promoter can be used to express agronomic genes in the detached plant part including color genes, fragrance genes, or ethylene biosynthesis genes important for fruit ripening.

B. Ligand Binding

Another approach to the control of plant senescence is production in a transgenic plant of a ligand, or ligand analog, to the protein receptor encoded by the sark gene which inhibits or inactivates the protein kinase. Nucleotide sequence analysis of the isolated sark gene revealed conserved domains that correspond to the kinase activity, an ATP binding domain, a hydrophobic domain which appears to be a trans-membrane domain, and a membrane targeting sequence. These regions are shown in Figure 1.

Interestingly, the protein kinase comprises a region of leucine-rich repeats starting at about amino acid 407. Leucine-rich regions facilitate association of a protein with a proteinaceous ligand. See Rothenburg et al, Gene Develop. 4.: 2169-87 (1990) Signal transduction by kinases control many aspects of cell growth, development and differentiation. Over 100 protein kinase genes, mostly from animal and fungi, have been identified to date. The nucleotide sequence of protein kinase genes are generally well conserved. Accordingly, nucleic acid sequences are commonly identified as protein kinase receptor genes if conserved membrane targeting, transmembrane domains and kinase domains are present. Additionally, certain amino acids are invariant or nearly invariant in the protein kinases. Several plant protein kinases have also been identified which maintain structure similarity to animal kinases. In particular, the C-terminal domains of plant and animal protein kinases comprise eleven well conserved domains. See Hanks et al., Science 241: 42-52 (1988); Chang et al, Plant Cell 4 1263-71 (1992); Zhou et ab., Cell 83: 925-35 (1995); Schulze-Muth et al, J. Biol. Chem. 271:26684-9 (1996); Deeken and Kaldenhoff Planta 202; 479-86 (1997)

The ligand to the sark gene protein kinase is identified by incubating leaf protein extracts with the purified protein kinase, or a functional domain thereof, according to methods well known to the skilled artisan. Protein interaction between the ligand and receptor is stabilized by crosslinking the ligand onto the receptor. A crosslinker for two interacting proteins could be, for example, glutaraldehyde, which contains two amine-interacting carboxyl acid groups. The cross-linked protein kinase and ligand is identified by incubation with an antibody specific for the protein kinase. Alternative technologies for identification of the ligand are based on one of a number of transcription based interaction cloning methods. See Chien et al., Proc. Nat'l. Acad. Sci. 88: 9578-9582 (1991), Dalton and Treisman, Cell 68: 597-612 (1992), Durfee et al, Gene Dev. 7: 555-569 (1993), Vojtek et al, Cell 74:205-214 (1993) Yet another approach, isolation of the ligand relies on a transcription based interaction cloning method referred to as the "two-hybrid-system." See Gyurius et al, Cell 75: 791-803 (1993) and Golemis et al, Interaction Trap /Two-Hybrid System to Identify Interacting Proteins in CURRENT PROTOCOLS IN MOL. BIOL., Ausubel et al, Eds. (Green Publ. Assoc, John Wiley & Sons, New York, 1994) pages 20.1.1 -28 (Supp 33). The principle of the Two-Hybrid system is that a host cell, preferably yeast, is stably transformed with at least two constructs. One type of construct comprises the LexAop-reporter coding sequence. The reporter is a selectable marker such as an auxotroph or an antibiotic gene. A preferred selectable marker is a leu2 gene in a leu genetic background. Preferably, more than one reporter gene, each operably linked to LexA-op, is stably introduced into the cell. The other reporter may be a screenable marker such as lacZ. The host cell is also stably transformed with a second type of DNA construct, referred to as "the bait." The bait comprise the sark gene fused in frame to a LexA DNA-binding domain. The chimeric gene would be downstream an inducible promoter, ex., gal promoter. The DNA constructs comprising the LexA-op-reporter gene is transcriptionaly inert, absent LexA. Each of the two types of constructs, above, would typically further comprise marker genes and origins of replication to allow engineering the construct in bacteria.

An expression library of plant cDNAs is prepared in a construct wherein the cDNA would give rise to a chimera protein. The amino-terminal domain of the chimeric protein represents LexA activation factor. The expression library is transformed into the host cell comprising at least one each of the reporter and bait constructs described above. The LexAop-selectable marker construct will express only in a cell where the C-terminal of the chimeric protein comprises the ligand for the sark.

Once the gene encoding the ligand is cloned, a synthetic gene sequence is synthesized which encodes a portion of the ligand protein, or variants of the ligand, and is expressed in transgenic plants using the methods described herein. The gene encoding the ligand analog is operably linked to an inducible promoter and expressed in a plant to inhibit the sark gene protein kinase function. Methods for creating synthetic genes which code for variant protein are well known to one skilled in the art. They include such methodologies as site-directed mutagenesis and use of synthetic oligonucleotides for gene synthesis. See Ausubel et al, Eds., in CURRENT PROTOCOLS IN MOL. BIOL., (Green Publ. Assoc, John Wiley & Sons, New York, 1994 and suup.). By these methods, variant ligand proteins are produced. Nevertheless, the variant nucleotide sequences would have substantial sequence similarity to the native gene. At least 90%, preferably 80%, more preferably 70%, most preferably 60% of the nucleotides are the same in the two genes.

In-vitro assays for the isolated protein kinase receptor are known. The protein kinase assays measure self-phosphorylation or phosphorylation of other substrates. See for example, Sesse et al, The Plant Cell, 8: 2223-34 (1996). Ligand protein analogs or variant proteins are tested to identify those that bind but do not stimulate the receptor. The gene encoding the ligand or variant ligand is expressed in transformed plants to inhibit senescence. Alternatively, plant senescence is inhibited by administering the ligand protein or variant protein to plants.

Alternatively, antisense, ribozyme or external guided sequence genes designed to inhibit expression of the ligand gene in planta are operably linked to an inducible and/or tissue specific-promoter. Inhibition of ligand gene expression leads to inhibition of plant senescence.

The present invention, thus generally described, will be understood more readily by reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present invention.

Example 1

Cloning and Analysis of sag Genes

Bean plants (Phaseolus vulgaris cv. bulgaήan) were grown in a temperature-regulated greenhouse at 25°C. Primary leaves (at the bottom) were harvested 15 days (young) and 45 days (senescing) post-germination. Leaves were macerated and total mRNA was extracted as described by Puissant, C, Houdebine, L.M., Biotechniques 8: 148-149 (1990).

The mRNA was isolated from the total RNA extract with the Poly Tract mRNA isolation system (Promega) according the manufacturer's instructions. The protocol for the differential display technique was that employed by Liang et al, NAR 21: 3269-3275 (1993).

An aliquot of lOOng of poly A mRNA was reverse transcribed using the T12MC 3' primer (M designates that the primer consisted of a mixture of the nucleotides A,G and C using moloney

Murine leukemia virus reverse transcriptase) for 90 min at 37^°C.

One tenth of the reverse transcriptase mixture was used as a template in polymerase chain reaction (PCR) reaction containing the given T12MC primer with a combination of an arbitrary decameric primer having the nucleotide sequence GGTCCCTGAC. Primers were synthesized in "Biotechnology, Rehovot, Israel". The PCR reaction was performed with the red hot DNA polymerase (Advanced Biotechnologies) and the reaction conditions were as follows: 94°C for 30 sec; 40°C for 2 mm.; 72°C for 30 sec. for 40 cycles followed by 72°C for 5 mm.

The PCR amplified products were separated on 6% poly aery lamide sequencing gel. The differentially displayed bands were excised and eluted in 50μl of sterile distilled water. A 5 xl aliquot of each elution was reamplified using the same primers. Amplified fragments were purified from a 1.5 agarose gel using the purification kit of Quigene. The reamplified cDNA fragments were used as probes for Northern blot analysis.

Fragments of interest which displayed the differential upregulation in senescing leaves, were cloned in the Pac57 Vector of the T-cloning Kit (MBI Fermentas). Inserts derived from individual plasmids from each ligation were labelled and used to confirm the Northern hybridization pattern obtained with the originally preamplified product. The cDNA clones of interest were sequenced with M13 standard sequencing primers at the Weizmann Institute of Science, Rehovot, Israel. Sequence analysis was carried out using the BLAST network services at the National Center for Biotechnology Information, Israel.

Sequence analysis of one of the 3' cDNA fragments obtained by the differential display technique revealed that it the nucleotide sequence encodes a protein kinase. Sequence analysis of another cDNA fragment exhibited sequence similarity to a SAM synthase.

In order to isolate the full length protein kinase cDNA, an amplified cDNA library was constructed from polyA mRNA of senescing bean leaves. The cDNA library was constructed using the lambdaZAPII vector (Stratagene) according to manufacturer's instructions. lxlO⁵ recombinant phages were screened using a cDNA clone obtained by the differential display technique which encodes a protein kinase as a hybridization probe. A total of 10 positive clones were selected, the inserts were excised and the longest insert that corresponded to the size of the mRNA (approximately 3.2 kb) was used for sequencing analysis. T3 and T7 primers were used for initial sequencing. Further sequencing was done using primers that were chosen according to the initial sequencing. Sequence analysis showed sequence similarity to other serine/threonine protein kinase domains.

The nucleotide sequence of the sark cDNA clone and its corresponding amino acid sequence are shown in Figure 1. The nucleotide sequence of a partial cDNA clone of the sam gene and its corresponding amino acid sequence are shown in Figure 5. Example 2 Isolation of the sark Gene Promoter

The promoter region of the sark gene was isolated by the inverse PCR (chromosome crawling) approach as described by Maniatis et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd ed, Cold Spring Harbor Laboratory Press (1988). Bean genomic DNA was isolated with the Nucleon Phytopure Plant DNA extraction kit (Scotlab) according to the manufacturer's instructions. The DNA was treated with the restriction enzyme Xbal. The following two PCR primers were used: 1) 5ΑCGTCCCAACCAAAGACC3' 2) 5'TCTGCAGCTAGTGCGATATCC3'

The PCR reaction was carried out under the following conditions: 30 sec 94°C, 30 sec 55°C, 2 mm 72°C for 40 cycles and then 10 mm at 72°C. A DNA fragment measuring 1.4kb was amplified. Nucleotide sequence analysis revealed that it contained 340bp of the 5' end of the sark cDNA. This sequence revealed the existence of an intron close to the 5' end of the sark gene.

In order to isolate a longer DNA fragment containing the sark gene promoter, a thermal asymmetric interlaced (TAIL) PCR technique was carried out as described by Liu, Y.G. et al, The Plant Journal 8:457-463 (1995). The following three PCR primers were used: 1) 5 CTGCAGCTAGTGCGATATCC3'; 2) 5 TGGTGGATGAATAATGGAG3'; 3) 5'ACTGTAACTCACAAATTAGA. In this procedure 3 PCR reactions are carried out sequentially to amplify target sequences. The PCR products were sequenced. About 820 bases upstream the 5 '-end of the cDNA were identified and are shown in Figure 3.

Example 3

Developmental Regulation of the sark Gene Study I

Bean plants (Phaseolus vulgaris cv. bulgaήan) were grown in a temperature-controlled greenhouse at 25 _+ 2°C. As the plants developed, primary leaves (positioned at the bottom) 10, 15, 20, 25, 30, 40, 50 and 60 days old were harvested. Total RNA was extracted as described by Puissant et ab., Biotechniqjues 8: 148-149 (1990) and total protein as reported by Ben-David et al, Plant Physiol. 73: 507-510 (1993) and subjected to Northern and Western blot analysis.

Northern blot analysis was undertaken using full-length sark cDNA clone as a hybridization probe. Northern blot analysis was performed according to John andAmasino, /. Bacteriol. 170: 790-795 (1998). Northern blot analysis revealed that sark gene expression was induced at about 25 days post-germination. Expression of the sark gene began to decrease at about 50 days post-germination.

Western blot analysis was performed as reported by Ben-David et al., Plant Physiol, 21: 507-510 (1983). Antibodies to protein kinase encoded by the sark gene were made according to the following procedure. A domain of the protein kinase encoded by the sark gene was selected that did not encode the kinase domains. The selected nucleotide sequence and its corresponding amino acid sequence are shown in Figure 2. The nucleotide sequence was prepared and inserted into the vector pQE32 using the QIA expression system of Qiagene. The sark gene was expressed as a fusion protein with a His tail to aide purification. Cloning and isolation of the protein product were done in accordance to manufacturer's suggestions (Qiagene)

Antibodies (abs) were raised in rabbits against the purified protein. An aliquots containing lOOμg of protein was injected into rabbits on 3 different occassions. Serum was collected following the second and third injections. The specificity of the antibodies for the protein kinase encoded by the sark gene was confirmed by Western experiments in which extracts from non-transformed E. coli, E. coli transformed with the pQE32 derivative plasmid, and bean extracts were analyzed. The antibody did not detect any protein in the E. coli control but expected proteins measuring 100 kDa and 29 kDa were detected in extracts from the transformed E. coli and bean, respectively.

Western blot analysis revealed that expression of the protein kinase encoded by the sark gene was first detectable at about 30 days post-germination. Expression of the protein kinase encoded by the sark gene begins to decrease at 50 days post-germination.

A decrease in chlorophyll levels was not detectable in primary bean leaves 30 days post-germination. Chlorophyll levels begin to decrease in primary leaves approximately 40 days post-germination.

Western blots identical to the one described above were probed with antibodies recognizing chloroplast protein LHC2. Chloroplast protein LHC2 is a light-harvesting protein the expression of which is down-regulated at the onset of senescence. Typically, the chloroplast is the first organ to evidence senescence. Western blot analysis revealed that expression of the LHC2 protein decreases in bean leaves at about 40 days post-germination. Accordingly, in developing bean leaves expression of the sark gene occurs before the level of the LHC2 protein decreases. Example 4

Developmental Regulation of the sark Gene Study II

Bean seeds (Phaseolus vulgaris cv. bulgarian) were germinated and grown for 40 days in temperature controlled greenhouse. A total of 10 plants were evaluated. The 40 day-old plants show initial yellowing of the 2 primary leaves (at the bottom). Bean plants produce a pair of primary leaves which are the first to develop and they are the oldest.

Developmental regulation of sark gene expression was evaluated by Northern blot analysis. The oldest leaves at the bottom of each plant were designated "1", harvested and pooled. The next leaf from the bottom was designated "2", harvested and pooled. This process was continued until pooled leaf samples for each age group on the 40-day-old plants was obtained. Leaves at position 1 , 2 and 3 (the first 3 consecutive leaves from the bottom) and the youngest leaf at the top of the plant were analyzed.

Total RNA was isolated from each pooled leaf sample as described in the previous examples. The RNA samples were subjected to Northern blot analysis using the full-length sark gene as a hybridization probe.

The expression of the sark gene was highest in the oldest leaf (1). Expression of the sark gene in the second oldest leaf (2) was approximately 50% of that observed in the oldest leaf. Expression of the sark gene in the third oldest leaf was very weak. No sark mRNA was detected in the youngest leaf. Accordingly, expression of the sark gene is developmentally regulated.

Example 5 Expression of the sark Gene in Leaf Discs

Bean seeds (Phoseolus vulgaris cv. bulgarian) were germinated and grown in temperature controlled greenhouse at 25 °C. Leaf discs were removed with a 10 mm cork borer from fully expanded leaves of 15 day-old bean plants. The 15 day-old bean plants exhibited no visual evidence of senescence such as chlorosis of the oldest leaf. The leaf discs were incubated in distilled water in the dark. Total RNA and protein was extracted at time zero and at 24 hr intervals for a total of 6 consecutive days. Total RNA was extracted as described above. Total protein was extracted according to Ben David supra.

Chlorophyll levels were measured and no decrease was detectable after 24 hours. Chlorophyll levels decreased following approximately 48-72 hrs incubation of the leaf discs in distilled water. Northern blot analysis using the full-length sark cDNA as a hybridization probe revealed that sark gene mRNA was not detectable at time zero but was expressed 24 hdurs after harvest of leaf disc samples. An increase in the steady state levels of sark gene mRNA was found through the 4th day after harvest of leaf disc samples. The steady state level of the sark gene mRNA decreased sharply 5 days after harvest of the leaf disc samples.

Western blot analysis was performed using polyclonal antibody raised against the sark fusion protein revealed that the protein kinase encoded by the sark gene was not detectable at time zero. The protein kinase encoded by the sark gene was detectable at very low levels 24 hours after harvest of the leaf discs. The steady state level of the protein increased through day 4 after harvest of leaf discs and decreased thereafter. Accordingly, expression of the protein kinase was consistent with expression of the mRNA encoded by the sark gene.

The effect of cytokinin on sark gene expression was investigated. The protocol described above was repeated but 0.1 mM of the of the cytokinin benzyladenine was added to the distilled water incubation containing the harvested leaf discs. The addition of this cytolanin to the incubation medium delayed the expression of sark gene as revealed by Northern blot analysis. A sharp increase in the levels of sark gene mRNA was found only after 4 days of incubation in the cytoltinin-containing medium. In contrast, sark gene mRNA was detected in leaf discs incubated for only 24 hours in distilled water that did not contain cytokinin. These results demonstrate that in planta increases in cytokinin biosynthesis prior to the onset, or during plant senescence, will delay or inhibit senescence gene expression and thereby the senescence process. A cytokinin biosynthetic gene is therefore operably linked to a sag gene promoter, such as sark or sam gene promoter. Alternatively, the cytokinin biosynthetic gene is operably linked to an inducible promoter. Expression of the cytokitiin biosynthetic gene leading to increased in planta concentrations of cytokinin inhibits senescence.

Example 6 Construction of an Antisense sark Gene

A vector is constructed containing a portion of the sark gene nucleotide sequence presented in Example 1. This DNA is cloned in the antisense orientation into the vector

PBI121. A promoter is operably linked to the antisense gene. The promoter is a strong constitutive promoter such as the CaMV 35 S promoter. Alternatively, the promoter is an inducible, tissue-specific, or developmentally regulated promoter. A preferred promoter is the developmentally regulated sark gene promoter. The sequence and orientation of the sark antisense gene is confirmed by DNA sequence analysis.

The vector is transformed into plant cells and transgenic plants recovered. Senescence in the transgenic plants is inhibited. Although the foregoing refers to particular preferred embodiments, it will be understood that the present invention is not so limited. It will occur to those of ordinary skill in the art that various modifications may be made to the disclosed embodiments and that such modifications are intended to be within the scope of the present invention, which is defined by the following claims. All publications and patent applications mentioned in this specification are indicative of the level of skill of those in the art to which the invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference in its entirety.

Claims

What Is Claimed Is:

1. An isolated DNA molecule comprising a senescence-associated regulatory protein kinase (sark) gene.

2. The isolated DNA of claim 2, wherein said sark gene encodes a serine/threonine protein kinase.

3. An isolated DNA molecule comprising a nucleotide sequence selected from the group consisting of:

(a) SEQ ID NO: 1;

(b) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 1; and

(c) a functional fragment of (a) or (b), wherein said DNA molecule encodes a senescence-associated regulatory protein kinase.

4. The DNA molecule of claim 3, wherein said DNA molecule comprises the nucleotide sequence of SEQ ID NO: 1.

5. An expression vector comprising said DNA molecule of claim 1 or 3.

6. A transformed host comprising said DNA molecule of claim 1 or 3.

7. An isolated DNA molecule comprising a nucleotide sequence selected from the group consisting of:

(a) SEQ ID NO: 5;

(b) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO:

5; and

(c) a functional fragment of (a) or (b), wherein said DNA molecule has the transcriptional activity of a sark gene promoter.

8. The DNA molecule of claim 7, wherein said DNA molecule comprises the nucleotide sequence of SEQ ID NO: 5.

9. An expression vector comprising said DNA molecule of claim 7.

10. The expression vector of claim 9, further comprising a foreign gene operably linked to said promoter.

11. The expression vector of claim 9, wherein said foreign gene encodes a product which inhibits plant senescence.

12. The expression vector of claim 11, wherein said foreign gene is selected from the group consisting of a sark antisense gene, an ACC synthase antisense gene, ACC oxidase antisense gene and an isopentyl transferase gene.

13. The expression vector of claim 10, wherein said foreign gene is a color gene or a fragrance gene.

14. A transformed host comprising said DNA molecule of claim 7.

15. A method of producing a foreign protein in a transformed host plant or plant cell, comprising the steps of:

(a) constructing an expression vector comprised of a promoter operably linked to a foreign gene, wherein said promoter comprises a nucleotide sequence selected from the group consisting of:

(i) SEQ ID NO: 5;

(ii) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO:

5; and (iii) a functional fragment of (i) or (ii) wherein said nucleotide sequence has the transcriptional activity of a sark gene promoter; and

(b) transforming a host.

16. A method of inhibiting plant senescence comprising the steps of:

(a) constructing an expression vector comprised of a promoter, wherein said promoter comprises a nucleotide sequence selected from the group consisting of:

(i) SEQ ID NO: 5;

(ii) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO:

5; and (iii) a functional fragment of (i) or (ii) wherein said nucleotide sequence has the transcriptional activity of a sark gene promoter;

(b) operably linking said promoter to a foreign gene selected from the group consisting of an antisense gene of a senescence-associated gene, a sark antisense gene, a S- adenosyl methionine synthase antisense gene, an ACC synthase antisense gene, an ACC oxidase antisense gene and a gene encoding isopentyl transferase, ribozyme and external guide sequence; and (c) transforming a host.

17. A method of increasing plant resistance to pathogen infection or pest infestation comprising the steps of:

(a) constructing an expression vector comprised of a promoter, wherein said promoter comprises a nucleotide sequence selected from the group consisting of:

(i) SEQ ID NO: 5;

(ii) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO:

5; and (iii) a functional fragment of (i) or (ii), wherein said nucleotide sequence has the transcriptional activity of a sark gene promoter;

(b) operably linking said promoter to a disease resistance gene; and (c) transforming a host.

18. The method of claim 17, wherein said disease resistance gene is an antisense gene, a coat protein gene, a ribozyme gene, a protease inhibitor gene, a Bacillus thuringiensis toxin gene, or a chitinase gene.

19. A method of preferentially producing a foreign protein in the detached part of transformed plant, comprising the steps of:

(a) constructing an expression vector comprised of a promoter operably linked to a foreign gene, wherein said promoter comprises a nucleotide sequence selected from the group consisting of:

(i) SEQ ID NO: 5;

(ii) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 5; and

(iii) a functional fragment of (i) or (ii), wherein said nucleotide sequence has the transcriptional activity of a sark gene promoter;

(b) trai-sfoi-iiing said plant; and

(c) detaching said plant part.

20. The method of claim 19, wherein said foreign gene encodes isopentyl transferase.

21. An isolated DNA molecule comprising the nucleotide sequence of SEQ ID NO: 6.

22. An isolated peptide consisting essentially of the amino acid sequence of SEQ ID NO: 4. AMENDED CLAIMS

[received by the International Bureau on 2 July 1999 (02.07.99); original claims 1-22 replaced by amended claims 1-21 (3 pages)]

1. An isolated DNA molecule comprising a senescence-associated receptor-like protein kinase (sark) gene.

2. The isolated DNA of claim 1, wherein said sark gene encodes a serine/threonine protein kinase.

3. An isolated DNA molecule comprising a nucleotide sequence selected from the group consisting of:

(a) SEQ ID NO: 1;

(b) a nucleotide sequence that has substantial sequence similarity with SEQ ID NO: 1; and

(c) a functional fragment of (a) or (b), wherein said DNA molecule encodes a senescence-associated regulatory protein kinase.

4. The DNA molecule of claim 3, wherein said DNA molecule comprises the nucleotide sequence of SEQ ID NO: 1.

5. An expression vector comprising said DNA molecule of claim 1 or 3.

6. A transformed host comprising said DNA molecule of claim 1.

7. A method of inhibiting plant senescence comprising the steps of:

(a) constructing an expression vector comprising a plant-compatible promoter;

(b) operably linking said promoter to a foreign gene selected from the group consisting of a sark antisense gene, a sam antisense gene, a ribozyme directed to a sark gene or a sam gene and an external guide sequence directed to a sark gene or a sam gene; and

(c) trεmsfoπning a host.

8. An isolated DNA molecule comprising the nucleotide sequence of SEQ ID

9. An isolated peptide comprising the amino acid sequence of SEQ ID NO: 2.

10. An expression vector comprising said DNA of claim 8.

11. A transformed host comprising said DNA molecule of claim 8.

12. The isolated DNA molecule of claim 1, wherein said DNA molecule further comprises a region encoding a leucine rich domain.

13. The isolated DNA molecule of claim 1, wherein said gene is expressed in a plant prior to degradation of chloroplast protein LHC2.

14. The isolated DNA molecule of claim 13, wherein said gene is preferentially expressed in leaf tissue.

15. The isolated DNA molecule of claim 14, wherein expression of said gene is induced in a detached leaf tissue.

16. A method of controlling plant senescence, comprising the steps of:

(a) providing a genetic construct comprising a senescence-associated structural gene operably linked to a plant compatible promoter, said senescence- associated structural gene being selected from the group consisting of a sark/threonine protein kinase receptor structural gene, a structural gene comprising the nucleotide sequence of SEQ ID NO: 1, and a structural gene comprising the nucleotide sequence of SEQ ID NO: 6;

(b) transforming a plant with said genetic construct; and

(c) selecting and propagating a transformed plant.

17. The method of claim 16, wherein said sark/threonine protein kinase receptor structural gene is the nucleotide sequence of SEQ ID NO: 1.

18. The method of claim 17, wherein said plant compatible promoter is tissue- specific.

19. The method of claim 16, wherein said senescence-associated structural gene comprises said nucleotide sequence of SEQ ID NO: 6 and said plant-compatible promoter is a temporarily expressed promoter.

20. An isolated DNA molecule encoding a sam gene, wherein transcription of said sam gene increases in mature leaves of a plant.

21. The DNA molecule of claim 20, wherein the sequence of said DNA molecule comprises the nucleotide sequence of SEQ ID NO: 6.