WO1999020762A1 - Substances icam-6 et procedes correspondants - Google Patents

Substances icam-6 et procedes correspondants Download PDF

Info

Publication number
WO1999020762A1
WO1999020762A1 PCT/US1998/022442 US9822442W WO9920762A1 WO 1999020762 A1 WO1999020762 A1 WO 1999020762A1 US 9822442 W US9822442 W US 9822442W WO 9920762 A1 WO9920762 A1 WO 9920762A1
Authority
WO
WIPO (PCT)
Prior art keywords
leu
ser
glu
val
ala
Prior art date
Application number
PCT/US1998/022442
Other languages
English (en)
Inventor
Kate Loughney
Donald E. Staunton
Rosemay Vazeau
Original Assignee
Icos Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icos Corporation filed Critical Icos Corporation
Priority to JP52464099A priority Critical patent/JP2001506139A/ja
Priority to AU11170/99A priority patent/AU1117099A/en
Priority to EP98953918A priority patent/EP0968289A1/fr
Publication of WO1999020762A1 publication Critical patent/WO1999020762A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70525—ICAM molecules, e.g. CD50, CD54, CD102

Definitions

  • the present invention relates generally to cellular adhesion molecules and more particularly to the cloning and expression of DNA encoding a heretofore unknown polypeptide designated "ICAM-6" which possesses structural relatedness to the intercellular adhesion molecules ICAM-1, ICAM-2, ICAM-R, (Landsteiner-Weiner) LW-ICAM-4, and ICAM-5.
  • ICAM-6 heretofore unknown polypeptide designated "ICAM-6” which possesses structural relatedness to the intercellular adhesion molecules ICAM-1, ICAM-2, ICAM-R, (Landsteiner-Weiner) LW-ICAM-4, and ICAM-5.
  • CAMs Cell surface proteins, and especially the so-called Cellular Adhesion Molecules (“CAMs”) have correspondingly been the subject of pharmaceutical research and development having as its goal intervention in the processes of leukocyte extravasation to sites of inflammation and leukocyte movement to distinct target tissues, as well as neuronal differentiation and formation of complex neuronal circuitry.
  • the isolation and characterization of cellular adhesion molecules, the cloning and expression of DNA sequences encoding such molecules, and the development of therapeutic and diagnostic agents relevant to inflammatory processes and development and function of the nervous system have also been the subject of numerous U.S. and foreign applications for Letters Patent. See Edwards, Current Opinion in Therapeutic Patents, 1(11): 1617-1630 (1991) and particularly the published "patent literature references” cited therein.
  • CAMs single chain adhesion molecules
  • LFA-1 and ICAM-2 two distinct intercellular adhesion molecules
  • ICAM-1 and ICAM-2 are structurally homologous to other members of the immunoglobulin gene superfamily in that the extracellular portion of each is comprised of a series of domains sharing a similar structure.
  • a "typical" immunoglobulin-like domain contains a loop structure usually anchored by a disulfide bond between two cysteines at the extremity of each loop.
  • ICAM-1 and ICAM-R each include five immunoglobu- lin-like domains; ICAM-2 and LW-ICAM-4, which differ from ICAM-1 in terms of cell distribution, include two such domains; ICAM-5 includes nine; PEC AM- 1 includes six; NCAM includes six or seven, depending on splice variations, and so on.
  • CAMs typically include a hydrophobic "transmembrane" region believed to participate in orientation of the molecule at the cell surface and a carboxy terminal "cytoplasmic" region.
  • Graphic models of the operative disposition of CAMs generally show the molecule anchored in the cell membrane at the transmembrane region with the cytoplasmic "tail" extending into the cell cytoplasm and one or more immunoglobulin-like loops extending outward from the cell surface.
  • a number of neuronal cells express surface receptors with extracellular Ig-like domains, structurally similarity to the ICAMs. See for example, Yoshihara, et al, supra, and Mizuno, et al , J. Biol. Chem. 272: 1156-1163 (1997).
  • many adhesion molecules of the nervous system also contain tandemly repeated fibronectin-like sequences in the extracellular domain.
  • WO91/16928 published November 14, 1991 , for example, addresses humanized chimeric anti-ICAM-1 antibodies and their use in treatment of specific and non-specific inflammation, viral infection and asthma.
  • Anti- ICAM-1 antibodies and fragments thereof are described as useful in treatment of endotoxic shock in WO92/04034, published March 19, 1992.
  • Inhibition of ICAM-1 dependent inflammatory responses with anti-ICAM-1 anti-idiotypic antibodies and antibody fragments is addressed in WO92/06119, published April 16, 1992.
  • LW-ICAM-4 a blood group glycoprotein, designated herein as LW-ICAM-4 has been described [Bailly, et al, Proc. Natl. Acad. Sci. (USA) 7:53065-5310 (1994); Bailly, et al, Eur. J. Immunol. 25:3316-3320 (1995)].
  • LW-ICAM-4 was suggested to mediate red blood cell binding to CDlla/CD18 and CD1 lb/CD 18 and was shown to be structurally similar to ICAM-2 in that the surface protein includes two extracellular domains.
  • an ICAM-like surface molecule has been identified which has a tissue specific expression unlike that of any known ICAM molecule.
  • telencephalin-specific antigen in rabbit brain, specifically immunoreactive with monoclonal antibody 271A6. This surface antigen was named telencephalin or ICAM-5.
  • Yoshihara, et al. in Neuron i2:543-553 (1994) reported the cDNA and amino acid sequences for rabbit telencephalin which suggested that the 130 kD telencephalon is an integral membrane protein with nine extracellular immunoglobulin (Ig)-like domains. The distal eight of these domains showed homology to other ICAM Ig-like domains. Cloning of the human homolog to rabbit ICAM-5 was described by Mizuno, et al, supra.
  • the present invention provides polypeptides and underlying polynucleotides for the cellular adhesion molecule family designated ICAM-6.
  • the invention includes both naturally occurring and non-naturally occurring ICAM-6 polynucleotides and polypeptide products thereof.
  • Naturally occurring ICAM-6 polypeptides include distinct genes and polypeptides species within the family (i.e. , allelic variants and species homologs).
  • the invention further provides splice variants encoded by the same polynucleotide but which arise from distinct mRNA transcripts.
  • Non- naturally occurring ICAM-6 polypeptides include variants of the naturally occurring polypeptides such as analogs (t * . e.
  • the invention provides a polynucleotide comprising the sequence set forth in SEQ ID NO: 1.
  • the invention also embraces polynucleotides encoding the amino acid sequence set out in SEQ ID NO: 2.
  • a presently preferred polypeptide of the invention comprises the amino acid sequence set out in SEQ ID NO: 2.
  • a plasmid encoding the preferred polynucleotide of the invention was deposited with the American Type Culture Collection, 12301 Rockville MD, 20852 on October 16, 1997 and assigned Accession No: 98557.
  • the present invention provides novel purified and isolated polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands, including splice variants thereof) encoding the ICAM-6.
  • DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences.
  • “Synthesized,” as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides. "Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and “partially” synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means.
  • the invention further embraces species, preferably mammalian, homologs of the preferred ICAM-6 DNA.
  • the invention also embraces DNA sequences encoding ICAM-6 species which hybridize under stringent conditions to the non-coding strands, or complements, of the polynucleotides in SEQ ID NO: 1. DNA sequences encoding ICAM-6 polypeptides which would hybridize thereto but for the redundancy of the genetic code are contemplated by the invention.
  • Exemplary stringent hybridization conditions are as follows: hybridization in 50% formamide, 5X SSC, 42°C overnight and washing in 0.5X SSC and 0.1 % SDS at 50° C.
  • Autonomously replicating recombinant expression constructions such as plasmid and viral DNA vectors incorporating ICAM-6 polynucleotide sequences are also provided.
  • Expression constructs wherein ICAM-6-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided.
  • host cells including prokaryotic and eukaryotic cells, either stably or transiently transformed with DNA sequences of the invention in a manner which permits expression of ICAM-6 polypeptides of the invention.
  • Host cells of the invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with ICAM-6.
  • Host cells of the invention are also conspicuously useful in methods for large scale production of ICAM-6 polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptides are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification.
  • ICAM-6 DNA sequences allows for modification of cells to permit, or increase, expression of endogenous ICAM-6.
  • Cells can be modified (e.g. , by homologous recombination) to provide increased ICAM-6 expression by replacing, in whole or in part, the naturally occurring ICAM-6 promoter with all or part of a heterologous promoter so that the cells express ICAM-6 at higher levels.
  • the heterologous promoter is inserted in such a manner that it is operatively-linked to ICAM-6 encoding sequences. See, for example, PCT International Publication No. WO 94/12650, PCT International Publication No. WO 92/20808, and PCT International Publication No. 91/09955.
  • amplifiable marker DNA e.g. , ada, dhfr, and the multifunctional CAD gene which encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase
  • intron DNA may be inserted along with the heterologous promoter DNA. If linked to the ICAM-6 coding sequence, amplification of the marker DNA by standard selection methods results in co-amplification of the ICAM-6 coding sequences in the cells.
  • the DNA sequence information provided by the present invention also makes possible the development through, e.g. homologous recombination or "knock-out" strategies [Capecchi, Science 244: 1288-1292 (1989)], of animals that fail to express functional ICAM-6 or that express a variant of ICAM-6. Such animals are useful as models for studying the in vivo activities of ICAM-6 and modulators of ICAM-6.
  • the invention also provides purified and isolated ICAM-6 polypeptides.
  • a presently preferred ICAM-6 polypeptide is set out in SEQ ID NO: 2.
  • ICAM-6 peptides of the invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g. , glycosylation, truncation, lipidation, and phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention.
  • ICAM-6 polypeptides of the invention may be full length polypeptides, biologically active fragments, or variants thereof which retain specific ICAM-6 biological activity.
  • Variants may comprise ICAM-6 polypeptide analogs wherein one or more of the specified ( . e. , naturally encoded) amino acids is deleted or replaced or wherein one or more non-specified amino acids are added: (1) without loss of one or more of the biological activities or immunological characteristics specific for ICAM-6; or (2) with specific disablement of a particular biological activity of ICAM-6.
  • Variant polypeptides of the invention include mature, i.e. , ICAM-6 polypeptides wherein leader or signal sequences are removed, ICAM-6 polypeptides having additional amino terminal residues.
  • ICAM-6 polypeptides having an additional methionine residue at position -1 are contemplated, as are ICAM-6 polypeptides having additional methionine and lysine residues at positions -2 and -1 (Mef 2 -Lys "1 -ICAM-6). Variants of these types are particularly useful for recombinant protein production in bacterial cell types.
  • the invention also embraces ICAM-6 variants having additional amino acid residues which result from use of specific expression systems.
  • a desired polypeptide such as a glutathione-S-transferase (GST) fusion product
  • GST glutathione-S-transferase
  • variants having additional amino acid residues which result from use of specific expression systems.
  • use of commercially available vectors that express a desired polypeptide such as a glutathione-S-transferase (GST) fusion product provide the desired polypeptide having an additional glycine residue at position -1 as a result of cleavage of the GST component from the desired polypeptide.
  • GST glutathione-S-transferase
  • variants having additional amino acid residues which result from use of specific expression systems.
  • use of commercially available vectors that express a desired polypeptide such as a glutathione-S-transferase (GST) fusion product
  • GST glutathione-S-transfer
  • Truncated forms of ICAM-6 which comprise one or more extracellular domains are generated with respect to knowledge of the defined and distinct domains of the extracellular portion of the protein; the various domains are characteristically indicated by the presence of conserved cysteine residues and generally conserved and/ or similar neighboring amino acid residues.
  • the invention further includes ICAM-6 fragments which are covalently attached to amino acids sequences not normally associated with ICAM-6.
  • the resulting "chimeric” or “fusion” proteins are particularly useful for modulating ICAM-6 biological activity as well as for improving antigenic properties of ICAM-6 amino acid sequences.
  • Amino acid sequences not normally associated with ICAM-6 may be derived from any source and can be selected based on particular properties attachment of the amino acids may effect on ICAM-6.
  • the invention further embraces ICAM-6 polypeptides modified to include one or more water soluble polymer attachments.
  • ICAM-6 polypeptides covalently modified with polyethylene glycol (PEG) subunits.
  • PEG polyethylene glycol
  • Water soluble polymers may be bonded at specific positions, for example at the amino terminus of the ICAM-6 polypeptides, or randomly attached to one or more side chains of the polypeptide.
  • antibodies e.g. , monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like
  • binding proteins can be developed using isolated or recombinant ICAM-6 products, ICAM-6 variants, or cells expressing such products. Binding proteins are useful for purifying ICAM-6 polypeptides and detection or quantification of ICAM-6 polypeptides in fluid and tissue samples using known immunological procedures. Binding proteins are also manifestly useful in modulating (i.e. , blocking, inhibiting or stimulating) biological activities of ICAM-6, especially those activities involved in signal transduction. Anti-idiotypic antibodies specific for anti-ICAM-6 antibodies are also contemplated.
  • DNA and amino acid sequences of the present invention are manifest.
  • knowledge of the sequence of a cDNA for ICAM-6 makes possible through use of Southern hybridization or polymerase chain reaction (PCR) the identification of genomic DNA sequences encoding ICAM-6 and ICAM-6 expression control regulatory sequences such as promoters, operators, enhancers, repressors, and the like.
  • DNA/DNA hybridization procedures carried out with DNA sequences of the invention under moderately to highly stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of ICAM-6; allelic variants are known in the art to include structurally related proteins sharing one or more of the biochemical and/or immunological properties specific to ICAM-6.
  • species genes encoding proteins homologous to ICAM-6 can also be identified by Southern and/or PCR analysis.
  • complementation studies can be useful for identifying other ICAM-6 proteins, and DNAs encoding the proteins.
  • Polynucleotides of the invention are also useful in hybridization assays to detect the capacity of cells to express ICAM-6. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in a ICAM-6 locus that underlies a disease state or states.
  • antisense polynucleotides which recognize and hybridize to polynucleotides encoding ICAM-6. Full length and fragment antisense polynucleotides are provided. Antisense polynucleotides are particularly relevant to regulating expression of ICAM-6 by those cells expressing ICAM-6 mRNA.
  • DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of ICAM-6.
  • DNA and amino acid sequence information for ICAM-6 also permits identification of molecules with which ICAM-6 will interact.
  • Agents that modulate (i.e. , increase, decrease, or block) ICAM-6 binding activity may be identified by incubating a putative modulator with ICAM-6 and determining the effect of the putative modulator on ICAM-6 binding activity.
  • the selectivity of a compound that modulates the biological activity of the ICAM-6 can be evaluated by comparing its effect on ICAM-6 to its effect on other ICAM-6 binding proteins.
  • Cell based methods, such as di- hybrid assays and split hybrid assays, as well as in vitro methods, including assays wherein a polypeptide or its binding partner are immobilized, and solution assays are contemplated by the invention.
  • Selective modulators may include, for example, antibodies and other proteins or peptides which specifically bind to the ICAM-6 or ICAM-6 nucleic acid, oligonucleotides which specifically bind to the ICAM-6 or ICAM- 6 nucleic acid, and other non-peptide compounds (e.g. , isolated or synthetic organic molecules) which specifically react with ICAM-6 or ICAM-6-encoding nucleic acid. Modulators also include compounds as described above but which interact with a specific binding partner of ICAM-6. Mutant forms of ICAM-6 which affect the enzymatic activity or cellular localization of the wild-type ICAM-6 are also contemplated by the invention.
  • Presently preferred targets for the development of selective modulators include, for example: (1) cytoplasmic or transmembrane regions of ICAM-6 which contact other proteins and/or localize the ICAM-6 within a specific membrane region of a cell and (2) extracellular regions of the ICAM-6 which bind specific binding partners. Modulators of ICAM-6 activity may be therapeutically useful in treatment of diseases and physiological conditions in which ICAM-6 activity is involved. DETAILED DESCRIPTION OF THE INVENTION
  • Example 1 describes a search of an EST database in an attempt to identify novel ICAM cDNA sequences.
  • Example 2 relates to screening a mouse library to identify a full length ICAM-6 cDNA.
  • Example 3 addresses Northern tissue analysis of mouse ICAM-6 expression.
  • Example 4 relates to use of RACE PCR to identify a 5 " sequence encoding mouse ICAM-6.
  • Example 5 describes construction of expression plasmids encoding soluble forms of mouse ICAM-6.
  • Example 6 relates to isolation of a full length mouse ICAM-6 cDNA.
  • Example 7 describes construction of additional mouse ICAM-6 expression constructs.
  • Example 8 addresses production of ICAM-6 antibodies.
  • Example 9 describes functional analysis of mouse ICAM-6.
  • Example 10 describes in situ hybridization analysis of mouse ICAM-6.
  • Example 11 relates to identification of a partial human ICAM-6 cDNA.
  • Example 12 provides Northern analysis of human ICAM-6 expression in tissues and cells.
  • Example 13 describes isolation of a more complete human ICAM-6 cDNA.
  • Example 14 addresses use of RACE PCR to identify a correctly spliced 5 ' cDNA for human ICAM-6.
  • Example 15 describes cloning ICAM-6 domains 4 and 5 from sterile male patients.
  • Example 16 relates to expression of a soluble human ICAM-6 polypeptide.
  • Example 17 describes Western analysis and ICAM-6 antibody production.
  • NCBI NCBI expressed sequence tags
  • the search for novel CAMs included three steps.
  • the BLASTN program available through NBCI was used to identify ESTs with homology to cDNA sequences encoding known CAMs.
  • the program compares a query nucleotide sequence against all nucleotide sequences in the database.
  • cDNAs encoding human ICAM-1 [Staunton, et al. , Cell 52:925 (1988)]
  • ICAM-2 [Staunton, et al , Nature 339:61 (1989)]
  • ICAM-R [Vazeux, et al , Nature 360:485 (1992)]
  • LW-ICAM-4 [Bailly et al , Proc. Nat 'I. Acad. Sci.
  • a second TBLASTN search was carried out using as query sequences the amino acid sequences for the known human and mouse CAM genes discussed above.
  • polynucleotides in the EST sequence library are translated in six reading frames and each resultant amino acid sequence is compared to the query sequences.
  • ESTs identified in this search which corresponded to ESTs found in the first search were discarded.
  • the sequences identified in the TBLASTN search that did not correspond to a known CAM were examined further. The majority of the remaining sequences did not contain the conserved cysteine residues and extracellular domain structures typically found in cell adhesion molecules, and these sequences were also discarded.
  • AA065978 SEQ ID NO: 46
  • the AA065978 sequence was most closely related to mouse ICAM-5; alignment of the sequence for AA065978 with the corresponding mouse ICAM-5 region showed 47% identity overall.
  • the EST was ordered from Genome Systems (St. Louis, MO) which maintains and makes available deposits of ESTs identified and sequenced by I.M.A.G.E., Lawrence Livermore Laboratory, Livermore, CA.
  • Plasmid DNA was recovered from 18 ml of the bacterial culture using a Wizard Mini- Prep kit (Promega, Madison WI).
  • the EST insert was sequenced using vector primers T7.1 (SEQ ID NO: 3) and T3.1 (SEQ ID NO: 4) and primers I6MO24 (SEQ ID NO: 5) and I6MO20 (SEQ ID NO: 6) which were designed based on the database sequence of AA065978.
  • the DNA sequence of AA065978 was determined for both strands using DNA oligonucleotide primers set out above and a Perkin Elmer Applied Biosystems Division 373A DNA Sequencer according to the manufacturer's suggested protocol.
  • the amount of PCR product used as template was calculated based on the size of the PCR product and was sequenced using ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA Polymerase, FS (Perkin Elmer, Foster City, CA) and asymmetric PCR.
  • the reaction product was purified on a AGCT spin column (Advanced Genetic Technologies Corp., Gaithersburg, MD) and dried. Loading buffer was added to each purified sample and the mixture heated at 90°C for two minutes.
  • the EST was designated ICAM-6.
  • mouse testis library was screened in an attempt to isolate a full length cDNA encoding ICAM-6.
  • the PCR was carried out in a DNA thermal cycler 480 (Perkin Elmer, Foster City, CA); each reaction contained 250 mM KC1, 100 mM Tris, pH 8.3, (Perkin-Elmer PCR buffer), 2 mM MgCl 2 , 2 mM dNTPs, 100 ⁇ g/ml primers, with 0.125 ⁇ l Taq polymerase (Perkin-Elmer, Roche Molecular. Branchburg, N. J.) and 2 ⁇ l of AA065978 plasmid DNA per 25 ⁇ l reaction.
  • a four minute denaturation step was performed at 94° C, followed by thirty cycles of denaturation 94°C for one minute, annealing at 50°C for thirty seconds, and extension at 72 °C for one minute.
  • One single band was found to migrate on an agarose gel at the expected size. This 209 bp band was gel purified, diluted 1 :20 and used as template in a second PCR amplification.
  • the ICAM-6 domain 5 DNA was labeled by carrying out seven identical 25 ⁇ l PCR reaction in which the 2 mM dCTP in the nucleotide mix was replaced with 20 Ci of dCTP 32 P (New England Nuclear, Boston, MA.) and 0.02 mM of unlabeled dCTP. PCR conditions were otherwise as in the first round of amplification. PCR polypeptides from the seven reactions were pooled and the probe purified from unincorporated nucleotides on a Sephadex G50 spin column (5 Prime, 3 Prime, Inc. Boulder, CO).
  • Library phage were transferred to nylon membranes by standard methods and the filters were hybridized at 42 °C overnight in 50% formamide, 5X SSC, 5X Denhardt's solution and 0.5 % SDS with 1 x 10 6 cpm/ml of labeled domain 5 probe. The next day the filters were washed three times in 2X SSC and 0.1 % SDS at room temperature for 15 minutes and once in 0.5X SSC and 0.1 % SDS at 50 °C for ten minutes. Filters were then exposed to film.
  • MT-3 Eighteen positive clones were identified which were purified and sequenced. While three clones were found to be unspliced, fifteen were found to be correctly spliced and to include both transmembrane and cytoplasmic regions. The longest clone, designated MT-3, was found to be 2.3 kb long and encoded a region having four of the five extracellular domains characteristic of ICAM polypeptides and also included a poly(A) + tail. Sequencing indicated that the 5 ' sequences were missing from the clone.
  • a mouse multiple tissue northern blot (MTN) (Clontech, Palo Alto, CA) was screened with a 32 P-labeled ICAM-6 probe.
  • the probe was a gel purified 1.4 kb PstllSacl DNA fragment from MT-3 that extended from the middle of domain 2 through the cytoplasmic tail of ICAM-6.
  • the probe was labeled by random-priming using 32 P-dCTP and 32 P-TTP with a Random-priming Kit (Boehringer-Mannheim, Indianapolis, IN). Hybridization was carried out according to the manufacturer's suggested protocol.
  • Results identified a 3 kb transcript in testis, while RNA from normal heart, brain, spleen, lung, skeletal muscle, and kidney did not hybridize.
  • RACE PCR was carried out on a mouse testis Marathon-readyTM cDNA library
  • the cDNA had been prepared from a mouse testis
  • RNA sample and ligated to marathon cDNA adaptors permit PCR using complementary primers AP-1 (SEQ ID NO: 13) and AP-2
  • I6MO40 SEQ ID NO: 15
  • I6MO39 SEQ ID NO: 16
  • Primer I6MO40 corresponded to MT-3 domain 3 sequences and I6MO39 corresponded to sequences in MT-3 domain 2.
  • the four primers were used in two rounds of PCR. In the first round, a 25 ⁇ l reaction was carried out with IX Klen Tag buffer, 2 mM dNTPs, 0.2 ⁇ M AP-1, 2 ⁇ g/ml I6M040, 0.5 ⁇ l Klen Taq polymerase solution, and 2.5 ⁇ l mouse testis cDNA library using an Advantage cDNA PCR kit
  • PCR was repeated using primers AP-1 and I6MO40 but with annealing/extension temperatures that were 2°C lower for each cycle. Under these conditions, an amplification product of approximately 900 bp was detected on an agarose gel.
  • the amplification products from both PCRs were separately diluted 1:50 in water and used as template DNA for another PCR.
  • Amplification was carried out using either primers pairs AP-1 and I6MO40 or AP-2 and I6MO39. Reactions were performed in 50 ⁇ l volumes with the same makeup as described above and at the lowest temperatures (70° C, 68 °C, and
  • the resulting PCR products were analyzed using agarose gel electrophoresis which showed a DNA smear in addition to two bands that migrated at the expected size; a band of approximately 900 bp was detected from the reaction using primer pair AP-1 and I6MO40 and a band of about 700 bp was detected from the reaction using primer pair AP-2 and I6MO39.
  • the 900 bp fragment was consistent with the size of a DNA expected to encode the leader and more than two domains from an ICAM.
  • the smaller 700 bp fragment was consistent with the size of a DNA predicted from use of the I6MO39 primer based on the location of complementary sequences in MT-3 compared to complementary sequences for primer I6MO40.
  • the fragment was directly sequenced by PCR using primers AP-2 and I6MO37 (SEQ ID NO: 17) to permit deduction of a full length mouse ICAM-6 cDNA.
  • the 900 bp amplification product was ligated into vector pCR2.1 using a TA cloning kit (Invitrogen, San Diego, CA) according to manufacturer's suggested protocol. Bacteria were transformed and plated. Plasmid DNA was recovered from selected colonies and screened by PCR using primer I6MO36 (SEQ ID NO: 18), corresponding to domain 2 sequences, and T7.1.
  • IMM-6 mouse 5 'RACE clone #6 One clone, designated "ICAM-6 mouse 5 'RACE clone #6," with the insert in the correct orientation to produce an antisense riboprobe (described below) were selected and the insert sequences again determined.
  • mouse ICAM-6 DNA to generate a complete cDNA encoding mouse ICAM-6.
  • sequence comparison was carried out with the amino acid sequences for known mouse ICAMs. Comparison indicated that mouse ICAM-6 is a novel ICAM molecule having five extracellular immunoglobulin domains and having sequence homology to other mouse ICAM polypeptides. The amino acid comparison results are set out in Table 2.
  • ICAM-6 ICAM-1 ICAM-2 ICA -5 ICAW-l ICAM-2 ICAM-R LW- 1CAM-5 ICAM-4
  • an expression construct was generated using plasmid pDCl. This construct encoded the extracellular domains 1 through 5 (D1-D5) of ICAM-6 as a chimeric polypeptide in association with the hinge CH2-CH3 domain sequences from IgGl .
  • the 3 ' end of the ICAM-6 coding region corresponding to domain 3 through 5 sequences from MT-3, was generated by PCR using the primer pair I6MO43 (SEQ ID NO: 34) and I6MO44 (SEQ ID NO: 19).
  • I6MO43 ATGCCCTCGAGCAGGCCTTGGAC SEQ ID NO: 34
  • I6MO44 TCACGGCAGCTCAGCCACCAAGC SEQ ID NO: 19
  • I6MO43 primer (underlined above).
  • the DNA fragment encoding the 5' end of ICAM-6 polypeptide was derived from HindmiBgl ⁇ . digestion of the "5' RACE mouse ICAM-6 clone #6" clone described in the previous example.
  • the Hin miBgUI fragment encoding the 5 ' end of the ICAM-6 sequences, the BgWXhol fragment encoding the 3 ' end of the ICAM-6 sequences, and the SaRIXbal fragment encoding the IgGl hinged-CH2-CH3 were ligated together and inserted into pDCl previously digested with Hin ⁇ m and Xbal.
  • the resulting plasmid was transformed into XL2 Blue Competent Cells
  • the mutation which may be a polymorphism or, alternatively may have arisen from the amplification process, was located between domains 2 and 3, outside of the immunoglobulin-like domains bounded by cysteine residues, and was thought to be inconsequential to the binding function of the extracellular domain.
  • COS cells were transfected with 20 ⁇ g of the above pDCl construct encoding ICAM-6/Ig using the DEAE-dextran method. Briefly, 20 ml of serum-free Dulbecco's Modified Eagle Medium (DMEM) containing 0.3 mg/ml of DEAE-dextran (Pharmacia, Uppsala, Sweden) and 0.1 mM chloroquine (Sigma, St. Louis, MO) was added to 50-80% confluent COS cells in 15 cm plates.
  • DMEM serum-free Dulbecco's Modified Eagle Medium
  • DEAE-dextran Pharmaacia, Uppsala, Sweden
  • chloroquine Sigma, St. Louis, MO
  • the cells were incubated for 1 minute in DMEM containing 10% dimethyl sulfoxide (DMSO) and incubated overnight in DMEM supplemented with 10% FBS, 1 mM sodium pyruvate, 100 u/ml penicillin, 100 ⁇ g/ml streptomycin, and 2 mM L-glutamine. The following day the media was replaced with fresh media but with only 5% FBS. Supernatant was collected every two to five days, filtered through
  • DMSO dimethyl sulfoxide
  • ICAM-6/Ig protein concentration in the supernatant showed no significant decline for at least 3 weeks post-transfection.
  • ICAM-6/Ig protein was recovered from the COS supernatant using a
  • HiTrap Protein A column (Pharmacia). The column was initially equilibrated with at least 100 ml of calcium-free, magnesium-free phosphate buffered saline (CMF-PBS). Column loading was conducted using a Biorad Econo System. COS supernatant was loaded on the column at a rate of 1 to 2 ml/minute. After loading the supernatant, the column was washed with at least 100 ml of CMF-PBS. Protein was eluted using 100 mM citric acid, pH 3.0, directly into neutralizing buffer containing 1 M Tris, pH 9.0. The eluted protein was dialyzed against CMF-PBS for at least 24 hours with at least three changes of buffer using a Slide-a-Lyzer cassette (Pierce, Rockford, IL).
  • CMF-PBS calcium-free, magnesium-free phosphate buffered saline
  • Dialyzed protein was concentrated, when necessary, using a BIOMAX 30 K centrifugal filter (Millipore, Bedford, MA) and protein concentrations were determined by capture EIISA as follows. Immulon 4 plates (Dynatech) were coated with 3 ⁇ g/ml of goat anti-human immunoglobulin (Jackson ImmunoResearch, West Grove, PA.) diluted in 0.1 M Na-carbonate/bicarbonate buffer, pH 9.6, for 1.5 to 2.5 hours at 37°C. Plates were washed three times with CMF-PBS containing 0.05 % Tween. Protein samples (diluted in DMEM with 5 % FBS) were added and incubated at 37 °C for 30 minutes. Plates were washed three times.
  • Captured protein was detected with horse radish peroxidase (HRP) conjugated goat anti-human immunoglobulin (Jackson ImmunoResearch) diluted 1 :2000 in DMEM with 5 % FBS and incubated on plates for 30 minutes at 37° C. Plates were washed three times, developed with o-phenylenediamine (OPD) (Sigma) and read on a Dynatech MR5000 plate reader. Protein concentrations were estimated by comparison to an ICAM-1/Ig control. Protein purity was assessed by Coomassie staining of an SDS-PAGE gel containing 2 ⁇ g of purified protein. All ICAM-6/Ig preparations were found to be 50% to 90% pure with only bovine immunoglobulin as an obvious contaminant.
  • HRP horse radish peroxidase
  • Jackson ImmunoResearch horse radish peroxidase conjugated goat anti-human immunoglobulin
  • an ICAM-6/Ig construct was made in vector pDEF14 for expression in CHO cells.
  • the pDEF14 vector includes the Chinese hamster EF-l ⁇ promoter which has previously been shown to permit high levels of expression in CHO cells.
  • the ICAM-6/Ig sequence was removed from the pDC-1 construct by digestion with Hindm and Xbal. The fragment was gel purified and ligated with the 738 bp NotllHindlD. fragment and the 19,723 bp NotllXbal fragment from pDEF14.
  • the pDEF14/ICAM-6/Ig plasmid was transformed into XL-2 Blue competent cells (Stratagene) and colonies were screened by PCR. The resulting clone pDEF-14/ICAM-6/Ig was used to stably transfect CHO cells.
  • cells were recovered from a 50% confluent CHO culture using 0.05% trypsin/0.53 mM EDTA and quenched with DMEM/F12 media containing 10% FBS, 1 mM sodium pyruvate, 100 u/ml penicillin, 100 ⁇ g/ml streptomycin, 2 mM L-glutamine, 0.1 mM sodium hypoxanthine, and 1.5 mM thymidine (HT plus DMEM/F12). Recovered cells were washed with CMF-PBS.
  • Approximately 20 x 10 6 cells were transfected with 50 ⁇ g of DNA, previously ethanol precipitated and resuspended in 800 ⁇ l HBS buffer containing 20 mM HEPES-NaOH, pH 7, 137 mM NaCl, 5 mM KC1, 0.7 mM Na 2 HPO 4 and 6 mM dextrose, using a Biorad GenePulser electroporator with capacitance set at 960 ⁇ F and voltage at 290V. Following electroporation, cells were allowed to recover at room temperature for ten minutes.
  • Colonies were recovered using trypsin/EDTA as above, and used to seed well plates at a calculated single cell/well. Eighteen days later, 120 single colony wells were screened by ELISA as above with the COS produced protein. Eighteen of these clones were expanded and rescreened three days later by EliSA. Four clones were chosen for further expansion which producing an estimated 3.7 ⁇ g of ICAM-6/Ig/ml of supernatant in three days.
  • the probe was labeled using two rounds of PCR and hybridization was carried out as described in Example 2.
  • MT2-36 Eleven clones were identified and only one, designated MT2-36, appeared to encode full length ICAM-6.
  • the clone contained two inserts, a 0.8 kb insert that encoded a phosphatase and a 2.8 kb insert encoding mouse ICAM-6.
  • the 2.8 kb mouse ICAM-6 insert was analyzed. Sequence analysis indicated that the MT2-36 sequence was identical to the ICAM-6 sequence deduced from the MT-3 sequence and the RACE amplification product discussed in Example 4.
  • the nucleotide sequence of the MT2-36 clone (ICAM-6) is set out in SEQ ID NO: 1 and the amino acid sequence deduced therefrom is set out in SEQ ID NO: 2
  • a plasmid MT2.36 encoding MT2-36 was deposited under the terms of the Budapest Treaty in a bacterial host with the American Type Culture Collection, 12301 Rockville MD, 20852 on October 16, 1997 and assigned Accession No: 98557.
  • an expression construct was generated encoding ICAM-6 domains 1-5 /IgGl in the pCI-neo vector (Promega, Madison, WI).
  • a second expression construct was also generated that contained a glutamate (Glu)-to-alanine (Ala) mutation at position 38.
  • This Glu 38 is part of a conserved motif in the domain 1 (Ile-Glu-Thr-Phe) of ICAM-6 that has been shown in ICAM-1 and ICAM-3 to be essential for binding LFA-1. Therefore, by analogy with the other ICAMs, this change in amino acid sequence was expected to eliminate a putative LFA-1 binding site in domain 1.
  • ICAM-6 Domains 1-5/IgGl in pCI-neo for Functional Analysis To make this construct, the ICAM-6 leader region through domain 3 was amplified by PCR using the MT2-36 clone as a template. Two primers were designed; I6MO55 (SEQ ID NO: 28) was complementary to the 5' end of mouse ICAM-6 and I6MO56 (SEQ ID NO: 29) was based on sequences in domain 3.
  • the I6MO55 primer contained a short Kozak sequence (in italics) previously shown to induce high levels of ICAM expression in other constructs, and two cloning site (Nhel and Hindm, underlined).
  • the PCR reaction was carried out using the MT2-36 DNA as a template, primers I6MO55 and I6MO56, and "proof-reading" Pwo DNA polymerase (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's protocol. Samples were held at 95 °C for one minute and then run through 30 cycles of 94 °C for 15 seconds, 50 °C for 30 seconds, and 72 °C for 45 seconds in a Gene
  • the ICAM-6 domain 1-5/IgG chimera was carried out in two steps.
  • the ICAM-6 NhellBglll fragment (encoding the leader to domain 3) was ligated to a ICAM-6 BgMlXhol fragment (encoding domains 3 to 5) described in Example 5, and inserted into the vector pCI-neo that had been previously cleaved with Nhel and Xhol.
  • the resultant plasmid was transformed into XL1 Blue Ultracompetent cells (Stratagene, La Jolla, CA) and colonies were examined for the presence of a plasmid with the correct insert by PCR using T3.1 (SEQ ID NO: 4) and T7.1 (SEQ ID NO: 3) primers.
  • the resultant plasmid from step one was digested with T3.1 (SEQ ID NO: 4) and T7.1 (SEQ ID NO: 3) primers.
  • the resultant plasmid from step one was digested with T3.1 (SEQ ID NO: 4)
  • Xliol and Xbal and gel purified.
  • the 903 bp SaWXbal human IgGl hinge CH2-CH3 fragment described in Example 5 was ligated to the ICAM-6 and vector sequences.
  • the resulting plasmid was transformed into E. coli XL1 Blue cells as described above and the bacteria were screened by PCR for the presence of a plasmid with the correct size of insert. Clones were analyzed by sequencing to verify the presence of a correct insert and the absence of the Phe 180 mutation.
  • Glu 38 was replaced with an alanine in order to eliminate the putative LFA-1 binding site.
  • Three primers were designed to create the mutation.
  • the first primer, I6MO57 (SEQ ID NO: 30) was a sense primer in which the glutamate codon GAG was replaced by an alanine codon GCG (underlined).
  • the second primer, I6MO58 (SEQ ID NO: 31) was an anti-sense primer in which the antisense glutamate codon CTC was replaced by an antisense alanine codon CGC (underlined).
  • the third primer, I6MO59 (SEQ ID NO: 36) was identical to the 5' end of I6MO55 but smaller.
  • I6MO58 TAAGAAGGTC-3-CGATTCCACTGGGCCCAGG SEQ ID NO: 31
  • the mutation was created using two rounds of PCR. In the first round, two fragments were created containing the alanine mutation; one 217 bp 5' fragment was created with primers I6MO55 and I6MO58 and one 728 bp 3' fragment created with primers I6MO57 and I6MO56.
  • the first round of PCR was performed using MT2-36 DNA as a template and Pwo DNA polymerase as described above. Both fragments generated in the PCR reactions were gel purified and then diluted 1/50 to be used as templates in a second round of PCR. In order to generate a single DNA fragment containing the ICAM-6 leader to domain 3 region and the Glu 38 / Ala 38 mutation, a second round of PCR was performed.
  • Primers I6MO59 and I6MO56 were employed and the template was a mixture of the 217 bp and 728 bp fragments generated in the first round of PCR. The two DNA fragments overlapped by 30 bp and therefore annealed to each other during the annealing step of the PCR reaction. Extension of the single stranded regions yielded a 915 bp fragment that contained a region from the ICAM-6 leader to domain 3 and included the Ala 38 mutation.
  • the PCR reaction was carried out with Pwo DNA polymerase as described above.
  • the resulting 915 bp ICAM-6 fragment was digested with Nhel and BgB and gel purified. The fragment was combined with the BgMlXhol ICAM-6 fragment (domain 3 to 5) described above and ligated into the vector pCI-neo previously digested with Nhel and Xhol to yield the pCI-neo ICAM-6 (leader-domain 5, Ala 38 ) plasmid.
  • the pBAR8a plasmid encodes a FLAG tag sequence (SEQ ID NO: 35) and a HIS tag sequence (SEQ IS NO: 32) in the cloning site which allow the detection and
  • the first three domains of mouse ICAM-6 were chosen for two reasons. First, antibodies were desired that were immunoreactive with the N-terminal portion of the ICAM-6 molecule that could block ICAM-6 function and also detect the molecule on tissue sections. Secondly, based on experience with other ICAM proteins, it was thought to be likely that expression of the first three domains would yield a soluble protein in E. coli.
  • the first three domains of the mouse ICAM-6 were inserted into ® pBAR8a in frame with the FLAG and HIS tag sequences. DNA encoding the ICAM-
  • SEQ ID NO: 33 was designed to be complementary to the 5' end of domain 1 and including a Kpnl (underlined) site to allow positioning of domain 1 in frame with the ® FLAG and HIS tag sequences.
  • Another primer was designed to be complementary to the 3' end of the domain 3, 16M054 (SEQ ID NO: 37), and to contain a Spel site
  • PCR amplification was carried out using the mouse ICAM-6 clone MT2-36 as a template, the I6MO52 and I6MO54 as primers, and "proof-reading" Pwo DNA Polymerase (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's protocol. The reaction was denatured for four minutes at 94° C, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and
  • the ICAM-6/pBAR8a plasmid was transformed into an E. coli strain which was deficient in arabinose catabohsm.
  • a transformed colony was grown at 30° C and arabinose added to a final concentration of 0.5% in order to induce protein expression.
  • the ICAM-6 fusion protein is purified using a nickel purification column (Ni-
  • ICAM-6 Domains 1 to 5 in pCI-neo Another soluble ICAM-6 construct was generated by fusing the 5
  • the FLAG tag was incorporated onto the 3' end of ICAM-6 by PCR using the primers I6MO44 (SEQ ID NO: 19) and I6MO45 (SEQ ID NO: 39).
  • the primers were used in two 50 ⁇ l PCR reactions with MT-3 DNA as a template. Samples were held at 94 °C for five minutes and then run through 30 cycles of 94 °C for 30 seconds, 55 °C for 30 seconds, and 72 °C for 30 seconds.
  • the PCR product (about 850 bp) was gel purified, digested with Xhol and BgM, and again gel purified (QIAquick Gel Extraction Kit, QIAGEN, Chatsworth, GA).
  • the 5 ' end of the ICAM- 6 was isolated by digesting the "5' RACE ICAM-6 clone #6" described in Example 4 with Spel and BgM and gel purifying the 720 bp DNA fragment.
  • the DNA fragments containing the 5'- and 3 '-ends of the ICAM-6 were ligated into pCI-neo previously digested with Nhel and Xhol.
  • the ligation mix was transformed into XL2 Blue competent cells and transformants were screened by PCR.
  • ICAM-6 sequences of the plasmid were confirmed by sequencing as described above. Three clones with the correct sequence were transfected into COS cells as previously described for the
  • Anti-mouse ICAM-6 monoclonal antibodies can be generated by different approaches.
  • mice Two mice were pre-bled and immunized on day 0 by intrasplenic injection with 5 ⁇ g of ICAM-6/IgGl chimeric protein in PBS. Immunization was carried out by a previously reported method [Spitz, Meth. Exnzymol. 121:33-41 (1986)]. On day 11 , the mice were bled and serum assayed by EHISA for reactivity to immobilized antigen. Briefly, Immulon 4 plates (Dynatech, Cambridge, MA) were coated with goat anti-human antibody that had been preadsorbed to bovine and mouse serum proteins (Jackson Immunoresearch). Plates were washed and COS supernatant containing ICAM-6 IgGl was added.
  • ICAM-1/IgGl fusion protein As a negative control, ICAM-1/IgGl fusion protein, diluted to 2 ⁇ g/ml in RPMI with 10% FBS, was similarly immobilized. After the plates were incubated and washed, pre-immune or immune mouse sera were added. A goat anti-mouse IgGl(fc) horseradish peroxidase-(HRP) conjugated antibody (Jackson) was used to detect any mouse anti-ICAM-6 antibody.
  • mice immune sera showed no reactivity to either immobilized ICAM-6 or ICAM-1 fusion protein as compared to pre-immune sera, so no further immunization by this procedure was pursued.
  • Results showed weak reactivity of the serum with immobilized ICAM-6 as compared to ICAM-3.
  • the hamster was again injected intrasplenically with the same antigen described above. Because the hamster died during anesthesia, the spleen was immediately removed and cultured as a single cell suspension in the presence of the ICAM-6/IgGl antigen as described in a previously reported technique [Boss, Meth. Enzymol. 121:27-33 (1986)]. After four days, the splenocytes were harvested and fused with NS-1 cells using standard procedures. After eleven days, hybridoma culture supernatants were screened by ELISA against immobilized ICAM-6/IgGl or ICAM- 3/IgGl as described above.
  • Immulon 4 plates (Dynatech, Cambridge, MA) were coated with goat anti-human antibody that had been pre-adsorbed to bovine and mouse serum proteins (Jackson Immunoresearch, West Grove, PA).
  • ICAM-6/IgGl fusion protein was captured from supernatant of COS transfected cells (described in Example 5).
  • ICAM- 1/IgGl fusion protein was diluted to 2 ⁇ g/ml in RPIvfl with 10% FBS and captured in separate wells as a negative control.
  • Pre-immune and immune sera from the hamsters were diluted and added to separate wells after ICAM-6/IgGl capture.
  • a goat anti- hamster horseradish peroxidase (HRP) conjugated antibody was used to detect the hamster antibody.
  • HRP horseradish peroxidase
  • Immune sera from both hamsters showed reactivity over the preimmune sera at the highest dilution tested (1:1,600) in both the ICAM-6/IgGl and ICAM- 1/IgGl wells.
  • another ELISA was performed wherein ICAM-1/IgGl was added to the diluted hamster serum, thereby absorbing the reactivity to the IgGl portion of both fusion proteins. Specific reactivity to captured ICAM-6/IgGl was not detected.
  • boosters are administered periodically over a four week period using ICAM-6/IgGl in IFA.
  • the hamsters are boosted one final time by intraperitoneal injection with ICAM-6/IgGl in phosphate buffered saline (PBS) and the spleen is sterilely removed four days later.
  • PBS phosphate buffered saline
  • the splenocytes are fused to NS-1 myeloma cells (A.T.C.C , Rockville, MD) at a ratio of 2:1 according to standard methods.
  • Culture supernatants are screen by ELISA as described above using captured ICAM-6/IgGl and ICAM-1/IgGl .
  • New Zealand white rabbits are each injected sub-cutaneously with 50 to ® 150 mg of the ICAM-6/FLAG -HIS fusion protein in complete Freund's adjuvant. Subsequent injections with a similar amount of immunogen but in incomplete Freund's adjuvant are administered at three to four week intervals. Rabbits are bled seven to fourteen days after a third and each subsequent injection and serum assayed by ELISA for specific reactivity to ICAM-6/IgG fusion protein. When specific reactivity is detected, Western analysis and immunocytochemistry are carried out using standard techniques.
  • a first adhesion assay was carried out using immobilized ICAM-6/IgGl and a mouse T-cell line, PLP, known to express CDlla/CD18 and no other CD18 integrins.
  • PLP mouse T-cell line
  • the mouse pre-B myeloma cell line, NS-1 which does not express CD18 integrins, was also assayed.
  • Adhesion assays were performed in 96-well Easy Wash plates (Coming) using a modification of a previously reported procedure [Morla et al. , Nature 367: 193- 196 (1994)]. Each well was coated with 50 ⁇ l of 5 ⁇ g/ml mouse ICAM-6/Ig fusion protein or 5 ⁇ g/ml human ICAM-1/Ig protein, both from stock solutions in 50 mM bicarbonate buffer (pH 9.6). Control wells to quantitate binding 100% of input cells were coated with anti-CD18 monoclonal antibodies, anti-CD18 antibodies M17 or 22F12C for human cells, or anti CDlla antibodyM17 and anti-CD3 antibody 145-2C11 for mouse cells.
  • BSA bovine serum albumin
  • Cells 100 ⁇ l of 5 x lOVml were then added to each well and plates were incubated at 37°C, in 5% CO 2 for 30 minutes.
  • Adherent cells were fixed with the addition of 50 ⁇ l of glutaraldehyde solution, washed and stained with 0.5% crystal violet (Sigma) solution. After washing and the addition of 70% ethanol, adherent cells were quantitated by determining absorbance at 570 nm using a SPECTRAmaxTM 250 microplate Spectrophotometer system (Molecular Devices). Percent adherent cells was determined using the formula: A 5 -, 0 (binding to ICAM-1 or ICAM-6) - A 570 (binding to BSA) A 570 (binding to positive control antibody) X 100
  • mouse monocyte cell line RAW 264.7 which expresses both integrins
  • human HL-60 cell line which expresses CDllb/CD18
  • Specificity of binding was determined using an anti-mouse CDllb antibody (Ml/70), an anti-mouse CDllc antibody (N418), an anti-mouse CD 18 antibody (2E6), an anti-human CDl lb antibody (44AACB), or an anti-human CD18 antibody (22F12C).
  • specificity of antibody blocking was determined using a non-blocking mouse CD18 antibody (M18).
  • Adhesion of ⁇ d to ICAM-6 was tested with Chinese hamster ovary (CHO) cells stably transfected with cDNA encoding rat ⁇ d and human CD18.
  • the ⁇ d /huCD18 CHO cells were tested for adhesion to either immobilized mouse ICAM- 6/IgGl, human ICAM-1/IgGl, or human VCAM-1/IgGl fusion protein as described above.
  • Specificity of binding for ⁇ d was determined using an anti-rat d monoclonal antibody (205C) and an anti-human CD18 monoclonal (22F12C).
  • a non-binding antibody was used as a negative control for the binding of human VCAM-l/IgGl to d .
  • ICAM-6 In order to identify cells in which ICAM-6 is expressed, in situ hybridization was performed with mouse ICAM-6 riboprobes on mouse testis tissue sections. ICAM-6 domain 1 and 2 anti-sense riboprobes were used to detect ICAM-6 mRNA in mouse testis tissue sections. ICAM-6 sense probes that could not hybridize to ICAM-6 mRNA were used as a negative control.
  • the probes were labeled by RNA transcription with ⁇ - 35 S UTP according to manufacturer's protocol (Stratagene). Frozen tissue sections were deposited on coated slides (Superfrost Plus VWR, Seattle, WA), fixed in paraformaldehyde, denatured, dehydrated through a series of ethanol washes, and dried. The tissue sections were hybridized overnight at 50° C in 50% formamide, 0.3
  • tissue sections were dehydrated, air dried, coated with photographic emulsion (Kodak NTB2 Nuclear Emulsion, International Biotechnologies, Hartford, CT), and exposed. After development, tissue sections were counterstained with hematoxylin-eosin and silver grains visualized by darkfield microscopy. A strong hybridization signal was detected on primary spermatocytes within the tubules of mouse testis after a four day exposure with the mouse ICAM-6 antisense probe. In sharp contrast, the testis tissue section hybridized with the control ICAM-6 sense riboprobe did not show any hybridization.
  • the mouse AA065987 sequence was used as the query sequence in a second BLASTN search in order to determine that the sequence was not identical to any
  • J03071 a human genomic sequence of approximately 66.5 kb designated J03071 was identified that contained regions having approximately 70% nucleotide homology to the corresponding sequence in AA065987 and approximately 61 % homology at the amino acid level. In addition to the sequences homologous to AA065987, J03071 includes the complete protein coding region for human growth hormone (GH1 and GH2) and chorionic somatotropin polypeptide hormones 1 , 2, and 5. The chromosomal location of J03071 (17q22-24) was determined to be in the vicinity of genes encoding PECAM (17q23) and ICAM-2 (17q23-17q25).
  • exons 2 through 6 The first region, exon 2, (nucleotides 66,422 to 66,495) with homology to a portion of domain 1 in ICAMs. The sequence extended to the end of the J03071 DNA and therefore most likely represented only a portion of exon 2.
  • the amino acid sequences included conserved cysteines residues along with amino acid sequences around the cysteine that are characteristic of ICAMs.
  • the amino acid sequences of the various domains encoded by J03071 were compared to the known ICAMs, the percent identity calculated was typical for a comparison of any two given ICAM sequences; the results of the comparison analysis are set out in Table 3.
  • the polypeptide encoded by J03071 was designated ICAM-6. While the frameshift in domain 3 and the stop codon(s) in domains 4 and 5 may reflect sequencing errors, it is also possible that the putative ICAM-6 coding region of J03071 may be a pseudogene and not encode a functional polypeptide.
  • J03071 The portion of J03071 that included the five regions of homology to known ICAMs was used in a BLASTN search of the EST database. Two ESTs, H79158 and H54052, were identified. The two ESTs were identified as having been isolated from a fetal liver and spleen library and included exons and adjacent intron nucleotides indicating that they were unspliced cDNAs.
  • J03071 genomic sequences encodes an animo acid sequence with 48 % homology to the transmembrane region and cytoplasmic tail of the mouse ICAM-6 and thus probably represented the corresponding human sequence.
  • the sequences encoding this putative transmembrane/cytoplasmic tail are contiguous which is consistent with what is seen for other ICAM genes when they are found within the same exon.
  • the transmembrane/cytoplasmic region in J03017 corresponds to nucleotides 60,912 to 61,135.
  • domain 3 of ICAM-6 was cloned by PCR and used as a probe for Northern blot analysis of human RNA samples.
  • PCR conditions needed to be determined under which domain 3 from ICAM-6 would be amplified as a means to detect the presence of ICAM-6 cDNA and to clone the ICAM-6 domain for use as a Northern analysis probe.
  • Primers 1601 , 1602, 1603, and 1606 were designed based on sequences located in domain 3 as determined from the J03071 sequence. Primers 1603 and 1606 were also designed to created EcoRI and Xhol restriction sites, respectively, (underlined in sequences set out below) to facilitate the subsequent cloning process.
  • PCR amplification was first performed using genomic DNA purified from peripheral blood lymphocytes as a template. PCR reactions were performed with the same buffers as described in Example 2. In order to optimize production of the amplification product, reaction conditions were varied with respect to MgCl 2 concentration (1.5 mM,
  • Resulting amplification products were analyzed using agarose gel electrophoresis and under all tested PCR conditions, fragments migrating at the expected size, a 210 bp fragment using primer pair I6O3/I6O6 and a smaller fragment using primer pair I6O1/I6O2, were detected.
  • the products from all reactions were pooled and precipitated with 30 ⁇ g of carrier yeast RNA in 0.3 M sodium acetate and two volumes of ethanol.
  • the amplification products and BSE SK+ vector (Stratagene) were digested with Eco ⁇ I and Xhol, both the fragment and the linearized vector gel purified (QIAGEN kit), the two DNAs ligated together, and the resulting plasmid transformed into XL1 Blue Ultracompetent cells (Stratagene, La Jolla, CA) according to the manufacturer's suggested protocol.
  • Single colonies were selected and screened by PCR for the presence of the ICAM-6 domain 3 by two series of PCR amplification using the bacterial DNA as templates.
  • the presence of a correct 330 bp insert was checked using the T3.1 and T7.1 primers.
  • the presence of ICAM-6 domain 3 in the same bacteria was checked by combining ICAM-6 and vector primers as follows. Using T3.1 and primer I6O8, a 259 bp PCR product was expected and using primer T7.1 and I6O7, a 215 bp amplification product was expected.
  • PCR was used to screen several cDNA libraries to determine if any contained human ICAM-6 cDNAs. Screening was focused mostly on hematopoietic and endothelial cells because ICAMs are characteristically expressed in these cell types.
  • screening samples encompassed cDNAs prepared from unstimulated human umbilical vascular endothelial cells (HUNECs) in addition to cD ⁇ A from HUVECs stimulated with EL-1 and/or IL-4, cD ⁇ A from the promyelocytic cell line HL-60, and cD ⁇ A from lung, appendix, and colon.
  • PCR was also carried out on several human cD ⁇ A hbraries which included cD ⁇ A libraries prepared from HUNECs, Jurkat cells (human T cell line), peripheral blood mononuclear cells (PBMC), synovium, and Hela cells (epithelial cervical tumor cell line).
  • PCR reactions were carried out as described above with 2 mM MgCl 2 and at 60 °C annealing temperature.
  • Primers I6O1 (SEQ ID NO: 38) and I6O2 (SEQ ID NO: 20) were used in the PCR.
  • RNA isolated from HUVECs cell lines including A549, HeLa, HL60, Jurkat, Ramos, and U937, and tissue types including spleen, thymus, peripheral blood leukocytes, testis, prostate, ovary, colon and small intestines.
  • the hybridization probe comprised the sequence corresponding to ICAM-6 domain 3 cloned as described above.
  • the human ICAM-6 domain 3 plasmid was linearized with EcoKI and gel purified using a Qiagen kit, and anti-sense ICAM-3 RNA probe was labeled by in vitro transcription using 32 P labeled UTP according to manufacturer's protocol (RNA transcription kit, Stratagene).
  • Membranes were hybridized overnight at 65° C in 50% formamide, 5X SSC, 50 mM Tris-HCl, pH 7.6, 0.1 % sodium pyrophosphate, 0.2% polyvinylpyrrolidone, 0.2% ficoll, 5 mM EDTA, 2% SDS, and 150 mg/ml denatured salmon sperm. Membranes were washed at 65 °C, twice in 2X SSC containing 0.1 % SDS and twice in 0. IX SSC with 0.1 % SDS for 15 minutes each wash.
  • PBL a 1 kb fragment was identified; in colon and small intestines, a 7.5 kb transcript was positive; and in HUVECs and the various cell lines, high level hybridization was detected with a 4.4 kb RNA, consistent in size with 28S ribosomal RNA. It is unclear if the probe cross reacted with rRNA or there exists a specific 4.4 kb transcript in these cell types.
  • HUVEC and PBMC cDNA libraries include DNA corresponding to ICAM-6 domain 3
  • the ICAM-6 domain 3 PCR probe was used to screen cDNA libraries from the two cell types in an attempt to isolate a full length
  • ICAM-6 cDNA ICAM-6 cDNA.
  • a human testis library (Stratagene) was also screened. The libraries were screened with a human ICAM-6 domain 3 probe labeled by PCR as described in Example 2. The unlabeled template was generated by PCR using the
  • ICAM-6 domain 3 plasmid as a template and primers I6O1 (SEQ ID NO: 38) and I6O2
  • results from the testis library provided thirteen positive clones, eight of which were sequenced to reveal four sphced (clones 13A, 20C, 5A, and 13B) and four unspliced ICAM-6 clones. Among the four sphced clones, two, 20C and 13A, were found to include leader and domain 1 sequences. In the PBMC library, only one unspliced clone was identified. In the HUVEC library, no clones were identified.
  • the coding region for human ICAM-6 that encoded the leader and part of domain 1 was utilized as a query sequence in a BLASTN search which revealed four EST sequences that appeared to represent three human ICAM-6 clones.
  • Two ESTs, AA421394 (SEQ ID NO: 49) and AA421290 (SEQ ID NO: 50) corresponded to the 5 ' and 3 ' ends of another clone, 731071 that had been isolated from a human testis library and encoded the ICAM-6 leader and domains 1 to 3.
  • Example 14 RACE PCR Identify a Spliced 5' Human ICAM-6 cDNA
  • RACE PCR was carried out using a human testis Marathon-readyTM cDNA (Clontech).
  • the cDNA was prepared from testes pooled from four Caucasians ranging in age from 22 to 31. The pooled source was different from that used to prepare the testis cDNA library (Stratagene) previously described.
  • the human testis cDNA was ligated to Marathon adaptors that contained sites for AP-1 and AP-2 primers (SEQ ID NOs: 13 and 14) described in Example 4.
  • PCR was carried out using the AP-1 and 1608 (SEQ ID NO: 24) primer pair, the 1608 primer specific for DNA encoding domain 3. Two rounds of PCR were carried out as described in Example 4. In both PCRs, the reaction mixture was denatured for one minute, followed by five cycles of denaturation at 94 °C for five seconds and annealing/extension at 72 °C for two minutes, an additional five cycles of denaturation at 94 °C for five seconds and annealing/extension at 70 °C for two minutes, and finally 25 cycles of denaturation at 94 °C for five seconds and annealing/extension at 68 C C for two minutes.
  • the expected size of a correctly sphced fragment encoding the ICAM-6 leader through domain 3 was about 0.8 to 1 kb.
  • the PCR products were size selected for a range of 0.8 to 1 kb using gel electrophoresis. Fragments in this range were purified from the gel and hgated into vector BSU SK+ (Stratagene) previously digested with NotI and S ⁇ cl. The resulting plasmids were transformed into Ultracompetent XL-blue MRF ' cells according to manufacturer's suggested protocol.
  • hybridization was carried out using 32 P-labeled oligonucleotide probes to identify ICAM-6 cD ⁇ As that contained all of domain 1.
  • Ohgonucleotides 16047 (SEQ ID NO: 26) and 16048 (SEQ ID NO: 27) were designed to be complementary to both extremities of DNA encoding domain 1.
  • Primer 16047 corresponded to the 5 ' end of domain 1 while 16048 corresponded to the junction between domains 1 and 2.
  • the ohgonucleotides were end-labeled with 32 P- ⁇ ATP using T4 polynucleotide kinase (New England Biolabs, Beverly MA) and purified using Centrispin 10 columns (Princeton Separations, Adelphia, NJ).
  • the human ICAM-6 sequence including the region encoding the stop codon in domain 4, is set out in SEQ ID NO: 40.
  • the deduced amino acid sequence up to the stop codon for the polynucleotide is set out in SEQ ID NO: 41.
  • Comparison of the amino acid sequence of the human ICAM-6 extracellular domains with the corresponding region of other mouse and human ICAMs is shown in Table 5.
  • Table 5 Amino Acid sequence comparison of HUMAN ICAM-6 with known mouse and human ICAMs
  • ICAM-6 In view of the observed expression of ICAM-6 mRNA in testis, a possible relationship between ICAM-6 and fertility was examined.
  • One hypothesis to explain why the ICAM-6 gene includes stop codons in domains 4 and 5 is that the presence of one or two copies of functional ICAM-6 in the human chromosome may render a male carrier unfertile. It is possible that expression of ICAM-6 leads to either an abnormahty in spermatogenesis and/or spermatozoid function, or to destruction of spermatozoids or spermatocytes.
  • domain-4 and domain-5 of ICAM-6 were cloned from genomic DNA obtained from selected patients and the polynucleotide structure examined to determine if these domain contained stop codons or full open reading frames.
  • DNA was obtained from blood samples from twenty male patients with primary testicular failure and five control blood samples using DNAzolRBD reagent (Molecular Research Center, Inc, Cincinnati, OH) according to the manufacturer's suggested protocol.
  • PCR was performed to amplify a genomic fragment spanning either domain 4 or 5 of human ICAM-6 using two pairs of primers which were designed based on the human ICAM-6 sequence.
  • the second pair of primers, I6O75 (SEQ ID NO: 53) and I6O77 (SEQ ID NO: 54 ) corresponded to the 5' and 3' ends of ICAM-6 domain 4 and domain 5, respectively.
  • PCR reactions were carried out with lx KlenTaq buffer, 2 mM dNTPs, 100 ⁇ g/ml of either domain-4 primer pair I6O70 and I6O73 or domain-5 primer pair I6O75 and I6O77, 1 ⁇ l KlenTaq polymerase solution, and 6 to 12 ng of genomic DNA using an Advantage cDNA PCR kit (Clontech, Palo Alto, CA) according to the manufacturer's suggested protocol.
  • a "touchdown" PCR reaction was performed using a Gene AmpR PCR system 9700 (Perkin Elmer).
  • the reaction was carried out with an initial thirty second denaturation step followed by five cycles of denaturation at 94 °C for five seconds and annealing/extension at 72 °C for thirty seconds, five cycles of denaturation at 94 °C for five seconds and annealing/extension at 70 °C for thirty seconds, and twenty-five cycles of denaturation at 94 °C for five seconds and annealing/extension at 68 °C for thirty seconds.
  • the resulting PCR products were separated using agarose gel electrophoresis and two bands were detected that migrated at the expected sizes.
  • the fragments were purified using a PCR product purification kit (Promega, Madison, WI) according to the manufacturer's suggested protocol and sequenced directly using the corresponding pair of primers. Controls included genomic DNA from gorilla or macaque nemestrina.
  • ICAM-6 is highly conserved between species
  • blood from macaque and gorilla was used as controls.
  • the genomic DNA was extracted as described before and used in PCR under the same conditions as described above for the human samples.
  • Sequence analysis demonstrated that ICAM-6 domains 4 and 5 of macaque were 95 % and 97 % identical to their human homologs but encoded complete open reading frames. ICAM-6 including domain 4 and 5 is therefore likely to be functional in macaques.
  • ICAM-6 domains 4 and 5 were found to be highly homologous to the human molecule (domain 4, 91 % and domain 5, 94 %), and while a stop codon was detected in the gorilla domain 4 as in the human sequence, domain 5 encoded a complete open reading frame.
  • ICAM-6 intracellular protein having five extracellular immunoglobulin domains.
  • ICAM-6 could exist in a soluble form and the stop codon in domain 4 would indicate the 3 ' end of a protein lacking a transmembrane region and a cytoplasmic tail.
  • domain 4 could be spliced out and a four domain protein could be expressed as a surface molecule in those patients who are heterozygous for genomic DNA having the stop codon in domain 5.
  • a two domain form of ICAM-6 may exist that is membrane bound and includes only domains 1 and 2.
  • an expression construct was generated to express extracellular domains 1 and 2 (D1-D2) of human ICAM-6 as a chimeric polypeptide in association with the hinge-CH2-CH3 domain sequences from IgG4. Construction of the expression plasmid was carried out as described below.
  • the ICAM-6 coding region for the leader sequence through domain 2 was amplified by PCR using the primer pair I6O78 (SEQ ID NO: 55) and I6O79 (SEQ ID NO: 56)
  • I6O78 primer and a Xhol site was included in the 3 ' I6O79 primer (underlined above).
  • the human RACE clone Bib plasmid described in Example 14 was digested with NotI and S ⁇ cl and a
  • ICAM-6 was hgated into the vector pDEF2S/IgG4 previously digested with the same two enzymes.
  • the pDEF2S/IgG4 plasmid was constructed as described below.
  • the approximately 1 kb XhollXbal IgG4 fragment fused to ICAM-6 sequences contained cD ⁇ A sequence encoding the human gamma 4 heavy chain hinge,
  • the cD ⁇ A encoding the heavy chain sequence was obtained from a commercially available spleen cD ⁇ A library and synthetic oligonucleotide probes derived from known human gamma 4 sequences
  • flanking sequences were obtained from a commerciaUy available genomic hbrary using the human gamma 4 probes and the same cloning techniques. Fusion of the cDNA sequences to the flanking sequence was carried out using PCR with appropriate primers that introduce compatible restriction sites, followed by restriction digestion and ligation by procedures well known and routinely practiced in the art.
  • the resulting plasmid, ICAM-6(Dl-D2)/Ig/pDEF2S was transformed into XL2 Blue Competent Cells (Stratagene, La Jolla, CA) and transformants were screened by PCR using the I6O78 (SEQ ID NO: 55 ) and I6O79 (SEQ ID NO: 56) primers. Positive clones as detected by PCR were verified by sequencing.
  • DG44 CHO cells transfected with the ICAM-6 (Dl-D2)/Ig/pDEF2S.
  • DG44 CHO cells are deficient in dihydrofolate reductase (DHFR) and require hypoxanthine and thymidine in the culture media to grow. Because a marker DHFR gene is present in the pDEF2S vector, DG44 CHO cells transformed with ICAM-6 (Dl-D2)/Ig/pDEF2S grow in selective culture media. Cells were transfected by electroporation as described below.
  • DHFR dihydrofolate reductase
  • ICAM-6 Dl-D2
  • Ig/pDEF2S suspended in 800 ⁇ l HBS buffer (20 mM HEPES-NaOH, pH 7.0, 137 mM NaCl, 5 mM KC1, 0.7 mM Na 2 HPO 4 , 6 mM dextrose) and electroporation carried out using a BioRad GenePulser electroporator with capacitance set at 960 ⁇ F and voltage at 290V.
  • cells were allowed to recover at room temperature for ten minutes and washed with 10 ml of media containing 10% FBS, 1 mM MEM sodium pyruvate, 100 u/ml penicillin, 100 ⁇ g/ml streptomycin, 2 mM L-glutamine, 0.1 mM sodium hypoxanthine, and 1.6 mM thymidine (HT plus DMEM/F12).
  • media containing 10% FBS, 1 mM MEM sodium pyruvate, 100 u/ml penicillin, 100 ⁇ g/ml streptomycin, 2 mM L-glutamine, 0.1 mM sodium hypoxanthine, and 1.6 mM thymidine (HT plus DMEM/F12).
  • transfected cells Two days after electroporation, transfected cells were transferred into selective media (DMEM/F12 without hypoxanthine or thymidine) and approximately twelve days after transfection, surviving colonies were harvested and pooled. Half of the cellular pool was stored in liquid nitrogen and the other half was cultured for protein purification.
  • ICAM-6 (Dl-D2)/Ig protein was recovered from CHO supernatant using a Prosep Protein A column (BioProcessing LTD). The column was initially equilibrated with at least 100 ml of buffer containing 1 M glycine plus 0.15 M NaCl, pH 8.6, using a BioRad Econo System.
  • Dialyzed protein was concentrated using a Centriprep-30 centrifugal filter (Amicon, Beverly, MA) and protein concentration was determined by BCA Protein Assay (Pierce). Protein purity was assessed by Coomassie staining of an SDS-PAGE gel containing 2 ⁇ g of purified protein.
  • ICAM-6 (Dl-D2)/Ig preparations were 50-90% pure with only bovine Ig as an obvious contaminant.
  • the purified protein is used to study the function of human ICAM-6 and generate monoclonal antibodies.
  • a soluble mouse ICAM-6 protein consisting of domains 1 through 3 fused to a FLAG/HIS tag was produced as described in Examples 7 and 8 and used as an immunogen to inject New Zealand White rabbit. Briefly, two New Zealand White rabbit were pre-bled to obtain pre-immune serum and then injected sub-cutaneously on day 0 with approximately 100 ⁇ g of the ICAM-6/ FLAG-EHS tag protein in complete Freund's adjuvant (CFA). Animals were immunized thereafter an additional four times at three to four weeks intervals with the same amount of protein in incomplete Freund's adjuvant. Sera were tested for specific reactivity by immunocytochemistry (described below) on rodent testis tissue sections seven to fourteen days after injections. Polyclonal antibodies from the sera were purified on a protein A column using well- known procedures routinely practiced in the art. A strong specific ICAM-6 staining was detected on mouse testis after the fourth antigen injection.
  • CFA complete Freund's adjuvant
  • DAB diaminobenzidine-tetrahydrochloride
  • mice testis protein was separated on SDS-PAGE and electroblotted onto Immobilon-P membranes (Millipore, Bedford, MA). Blots were incubated overnight at 4° C in 3% bovine serum albumin diluted in Tris buffered saline containing 0.2% Tween-20 (TBS-Tween). After washing, the membranes were incubated with 2 ⁇ g/ml mouse ICAM-6 polyclonal rabbit antisera or with the control pre-immune sera in TBS-Tween for one hour at room temperature. Membranes were then washed and incubated with goat anti-rabbit HRP-conjugated tight chain specific secondary antibody (Accurate, Westbury, NY) at room temperature for one hour.
  • TBS-Tween Tris buffered saline containing 0.2% Tween-20
  • ECL enhanced cheiniluminescence
  • the width of the band migrating between 60 and 100 kDa suggests that several glycosylated forms of ICAM-6 may exist in vivo.
  • the larger band of approximately 250 kDa suggests that a very heavily O-glycosylated form ICAM-6 may also exist.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention se rapporte à des polynucleotides codant ICAM-6, des produits recombinés d'expression codant les polynucléotides, des cellules hôtes transformées ou transfectées avec les produits recombinés d'expression, des procédés de production des polypeptides ICAM-6, les polypeptides ICAM-6, des anticorps immunospécifiques pour les polypeptides, et enfin, des anticorps anti-idiotypiques reconnaissant les anticorps anti-ICAM-6.
PCT/US1998/022442 1997-10-22 1998-10-22 Substances icam-6 et procedes correspondants WO1999020762A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP52464099A JP2001506139A (ja) 1997-10-22 1998-10-22 Ｉｃａｍ−６物質及び方法
AU11170/99A AU1117099A (en) 1997-10-22 1998-10-22 ICAM-6 materials and methods
EP98953918A EP0968289A1 (fr) 1997-10-22 1998-10-22 Substances icam-6 et procedes correspondants

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US95566197A 1997-10-22 1997-10-22
US08/955,661 1997-10-22
CA002274880A CA2274880A1 (fr) 1997-10-22 1999-07-08 Materiaux icam-6 et methodes

Publications (1)

Publication Number Publication Date
WO1999020762A1 true WO1999020762A1 (fr) 1999-04-29

Family

ID=25681011

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/022442 WO1999020762A1 (fr) 1997-10-22 1998-10-22 Substances icam-6 et procedes correspondants

Country Status (5)

Country Link
EP (1) EP0968289A1 (fr)
JP (1) JP2001506139A (fr)
AU (1) AU1117099A (fr)
CA (1) CA2274880A1 (fr)
WO (1) WO1999020762A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993014776A1 (fr) * 1992-01-27 1993-08-05 Icos Corporation Proteine apparentee a icam
WO1996040916A1 (fr) * 1995-06-07 1996-12-19 Icos Corporation Materiaux icam-4 et procedes

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993014776A1 (fr) * 1992-01-27 1993-08-05 Icos Corporation Proteine apparentee a icam
WO1996040916A1 (fr) * 1995-06-07 1996-12-19 Icos Corporation Materiaux icam-4 et procedes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Database EMBL, Entry HS1219414 Accession number AA421290 19 May 1997 99% identity with Seq.ID:40 nt.37-510 *
Database EMBL, Entry HS1219518 Accession number AA421394 19 May 1997 99% identity with Seq.ID:40 nt.676-955 reverse orientation *
Database EMBL, Entry MMA65978 Accession number AA065978 26 September 1996 95% identity with Seq.ID:1 nt.1246-1494 *
HAYFLICK J.S. ET AL.: "The intercellular adhesion molecule (ICAM) family of proteins", IMMUNOLOGIC RESEARCH, vol. 17, no. 3, 1998, pages 313 - 327, XP002092417 *

Also Published As

Publication number Publication date
CA2274880A1 (fr) 2001-01-08
AU1117099A (en) 1999-05-10
JP2001506139A (ja) 2001-05-15
EP0968289A1 (fr) 2000-01-05

Similar Documents

Publication Publication Date Title
US7083966B2 (en) Cytidine deaminase
MXPA04010674A (es) Moleculas de reconocimiento en superficie de celula que contienen dominio de inmunoglobulina.
US5753502A (en) Neuron-specific ICAM-4 promoter
CA2714357A1 (fr) Mutations dans le gene neuronal codant pour la sous-unite alpha-1 du canal sodique, polypeptides associes et traitement du syndrome d'epilepsie generalisee avec crises febriles plus
US20170164591A1 (en) Sperm-Specific Cation Channel, Catsper2, and Uses Therefor
US6710171B1 (en) Physiologically active protein originating in mammals
US5773293A (en) Anti-ICAM-4 antibodies and hybridomas
WO2000052039A2 (fr) Materiaux de lectomedine et procedes
RU2155345C2 (ru) Способ скрининга невропатологии
AU2002364939A1 (en) Sperm-specific cation channel, catsper2, and uses therefor
JP4537507B2 (ja) 結合組織増殖因子に対するモノクローナル抗体及びその医薬用途
WO1999020762A1 (fr) Substances icam-6 et procedes correspondants
WO2000032633A1 (fr) Nouvelle molecule d'adhesion et procedes d'utilisation
WO1999045111A1 (fr) Materiaux de lectomedines et procedes associes
AU5775300A (en) Tankyrase2 materials and methods
US5852170A (en) ICAM-4 materials and methods
EP0956508B1 (fr) Icam-4 et ses utilisations diagnostiques
CA2300476A1 (fr) Proteine d'absorption de type recepteur
US20020028773A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
US20030170778A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
JP2004290198A (ja) Ｆａｓリガンドおよびその一部、およびそれをコードするＤＮＡ
JP2003116564A (ja) 新規タンパク質およびそれをコードするｄｎａ
CA2388032A1 (fr) Polynucleotides codant pour des proteines humaines et murines (bigr)
JP2003325185A (ja) Ｉｔｉｍモチーフを持つ新規な免疫機能抑制分子

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CN JP MX

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1999 524640

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 11170/99

Country of ref document: AU

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1998953918

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1998953918

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998953918

Country of ref document: EP