WO2000032633A1 - Nouvelle molecule d'adhesion et procedes d'utilisation - Google Patents

Nouvelle molecule d'adhesion et procedes d'utilisation Download PDF

Info

Publication number
WO2000032633A1
WO2000032633A1 PCT/US1999/028878 US9928878W WO0032633A1 WO 2000032633 A1 WO2000032633 A1 WO 2000032633A1 US 9928878 W US9928878 W US 9928878W WO 0032633 A1 WO0032633 A1 WO 0032633A1
Authority
WO
WIPO (PCT)
Prior art keywords
acam
ofthe
polypeptide
binding
polynucleotide
Prior art date
Application number
PCT/US1999/028878
Other languages
English (en)
Inventor
Denise M. Hoekstra
Kate Loughney
Donald E. Stauton
Rosemay Vazeux
Original Assignee
Icos Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icos Corporation filed Critical Icos Corporation
Priority to AU25880/00A priority Critical patent/AU2588000A/en
Publication of WO2000032633A1 publication Critical patent/WO2000032633A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3

Definitions

  • the present invention relates generally to cellular adhesion molecules. More particularly, the invention relates to the cloning and expression of DNA encoding a novel human polypeptide designated "ACAM' which possesses structural relatedness to the immunoglobulin superfamily and to proteins involved in cell-cell adhesion and cell activation and proliferation
  • immunoglobulin gene superfamily comprises several subfamilies of adhesion molecules, all of which have the basic function of supporting cell-cell recognition through homophilic or heterophilic interactions Several of these molecules are especially important in the functionality ofthe immune system See Springer, Nature 346 425-434 (1990) These include the ICAMs (Intercellular
  • VCAMs Vascular CAMs
  • PEC AM- 1 Platinum/Endothelial CAM-1
  • MAdCAM-1 Mecosal Addressin CAM-1
  • ⁇ 2 integrins a group of heterodimeric molecules expressed by leukocytes and having a common ⁇ 2 (CD 18) subunit.
  • the ⁇ 2 integrins include LFA-1, Mac-1, and pl50,95 (referred to in WHO nomenclature as CD11 a/CD 18, CD1 lb/CD 18, and CD1 lc/CD18, respectively), as well as the more recently characterized ⁇ d /CD18.
  • the ⁇ 2 -integrins are expressed on the cell surfaces of various hematopoietic lineages, including B-lymphocytes, T lymphocytes, monocytes, and granulocytes. See, e.g., Table 1 of Springer, supra, at page 429. It is presently believed that prior to the leukocyte extravasation that characterizes inflammatory processes, activation of integrins constitutively expressed on leukocytes occurs and is followed by a tight ligand/receptor interaction between the integrins (e.g., LFA-1) and
  • IAMs intercellular adhesion molecules
  • ICAM-1 and ICAM-2 which are expressed on blood vessel endothelial cell surfaces and on leukocytes.
  • IgSF cellular adhesion molecules have been implicated in a variety of other functions. For example, in the brain, neuronal cellular adhesion molecules
  • NCAMs NCAMs
  • LI adhesion molecule another IgSF protein, LI adhesion molecule, plays an important role in neurogenesis, nerve growth, and fasciculation. See Chothia et al., Ann Rev
  • IgSF members are also responsible for diseases when used as receptors by infectious agents and especially by viruses.
  • the human poliovirus uses an IgSF protein to replicate in the central nervous system and produce a neurological disease. Rhinoviruses adhere to ICAM-1, resulting in the
  • the human immunodeficiency virus uses the IgSF protein CD4 to infect leukocytes and produce immunodeficiency.
  • IgSF molecules include a family of cytokine receptors, including receptors for the interferons, the two IL-1 receptors, and macrophage colony-stimulating factor (M-CSF).
  • IgSF family of proteins are characterized by containing at least one immunoglobulin homology region. These regions of homology occur as domains of about 100 amino acid residues in length that contain conserved sequence patterns.
  • the domains are defined by a core structure consisting of two ⁇ -sheets that are packed face-to-face and anchored together by an internal disulfide bridge, thereby forming a loop structure.
  • the IgSF molecules comprise from two to seven of these
  • ICAM-1 has five Ig-like domains, ICAM-2 and LW-IC AM-4, which differ from ICAM- 1 in terms of cell distribution, include two such domains, VCAM-1 occurs as splice variants comprising either six or seven domains, and so on.
  • a comparison ofthe primary structure ofthe IgSF Ig-like domains allows a clustering ofthe proteins into four related sets: V, Cl, C2 (the predominant type in the IgSF family; also known as H), and I.
  • the IgSF proteins like
  • intercellular adhesion molecules are also typically glycosylated, and
  • CAMs typically include a carboxy terminal "cytoplasmic" region that may participate in intracellular signaling
  • graphic models ofthe operative disposition of CAMs generally show the molecule anchored in the cell membrane at the transmembrane region with the cytoplasmic "tail" extending into the cell cytoplasm and one or more immunoglobulin-like loops extending outward from the cell surface.
  • the IgSF cell adhesion molecules have been the subjects of pharmaceutical research and development having as its goal to intervene in the processes of leukocyte extravasation to pathological tissues, leukocyte movement, and cellular activation during inflammation.
  • the isolation and characterization of cellular adhesion molecules, the cloning and expression of DNA sequences encoding such molecules, and the development of therapeutic and diagnostic agents relevant to inflammation processes, viral infection, and cancer metastasis have also been the subjects of numerous U.S. and
  • ICAM-R an ICAM-related protein
  • ICAM-R an ICAM-related protein
  • a number of neuronal cells express surface receptors with extracellular Ig-like domains and having structural similarity to the ICAMs See, for example, Yoshihara et al , Neuron 12 543-553 (1994), and Mizuno et al , J Biol Chem 272 1156-1163 (1997)
  • many adhesion molecules of the nervous system also contain tandemly repeated fibronectin-like sequences in the extracellular domain
  • LW-ICAM-4 Landsteiner- Wiener
  • Mori et al [Proc Natl Acad Sci USA 84 3921-3925 (1987)] have reported a telencephalon-specific antigen in rabbit brain that is
  • telencephalin telencephalin
  • IAM-5 telencephalin-5
  • ICAM-5 was described by Mizuno et al . supra A variety of therapeutic uses has been projected for intercellular adhesion molecules, including uses premised on the ability of ICAM-1 to bind human rhinovirus.
  • European Patent Application 468 257 A published January 29, 1992, addresses the development of multimeric configurations and forms of ICAM-1 (including full length and truncated molecular forms) proposed to have enhanced ligand/receptor binding activity, especially in binding to viruses, lymphocyte associated antigens and pathogens such as Plasmodium falciparum.
  • WO91/16928 published November 14, 1991, for example, addresses humanized chimeric anti-ICAM-1 antibodies and their use in treatment of specific and non-specific inflammation, viral infection and asthma.
  • Anti-ICAM-1 antibodies and fragments thereof are described as useful in treatment of endotoxic shock in WO92/04034, published March 19, 1992.
  • Inhibition of ICAM-1 -dependent inflammatory responses with anti-ICAM-1 anti-idiotypic antibodies and antibody fragments is addressed in WO92/06119, published April 16, 1992.
  • Identification of CAM proteins can permit identification and diagnosis of disease states that arise from aberrant ligand binding phenomena, as well as disease states that arise from aberrant expression ofthe protein itself. However, identification of CAM proteins can permit identification and diagnosis of disease states that arise from normal ligand binding phenomena, as well as disease states that arise from normal expression ofthe protein itself.
  • ACAM polypeptides according to the invention are exemplified by polypeptides comprising amino acids 1 to 408 defined by SEQ ID NO:2 or amino acids 1 to 374 defined by SEQ ID NO:4
  • the invention provides a purified and isolated polynucleotide encoding a human ACAM polypeptide, such as a polynucleotide encoding a polypeptide comprising an amino acid sequence defined by SEQ ID NO.2 or SEQ ID NO 4.
  • Exemplary polynucleotides according to the invention include polynucleotides defined by SEQ ID NO- 1 or SEQ ID NO 3
  • the polynucleotide may be a DNA molecule, such as a cDNA molecule or a genomic DNA molecule, and may be a wholly or partially chemically synthesized DNA molecule
  • the polynucleotide may be an antisense polynucleotide that hybridizes under moderately stringent conditions to the polynucleotide encoding an ACAM polypeptide
  • the polynucleotide may be an antisense polynucleotide that hybridizes under moderately stringent conditions to the polynucleotide encoding an ACAM polypeptide
  • polynucleotide ofthe invention may comprise a detectable label moiety
  • the polynucleotide can be operably linked to a heterologous promoter.
  • the invention further comprises an expression construct comprising the polynucleotide encoding an ACAM polypeptide, such as a polynucleotide comprising a nucleotide sequence defined by SEQ ID NO 1 or SEQ ID NO 3
  • the invention includes a prokaryotic or eukaryotic host cell transformed or transfected with the expression construct
  • the invention is a method for producing an ACAM polypeptide, comprising the steps of: a) growing the host cell, transformed or transfected with an ACAM-encoding expression construct, in a nutrient medium under conditions appropriate for expression ofthe ACAM polypeptide by the host cell; and b) isolating the ACAM polypeptide from the host cell or the medium of its growth.
  • the invention is an antibody specifically immunoreactive with a human ACAM polypeptide, such as a polypeptide having an amino acid sequence defined by SEQ ID NO:2 or SEQ LD NO:4.
  • the antibody may be a monoclonal antibody, or may be a chimeric, humanized, or human antibody or antibody fragment.
  • a cell line that produces such an antibody.
  • an anti-idiotype antibody specifically immunoreactive with the anti-ACAM antibody.
  • the invention is a method for identifying a specific substance
  • binding partner of a human ACAM polypeptide such as a polypeptide comprising an amino acid sequence defined by SEQ ID NO: 2 or SEQ ID NO: 4, comprising:
  • the invention is a method for screening a plurality of test compounds for binding with the ACAM polypeptide ofthe invention, wherein the method comprises a) contacting the ACAM polypeptide with each of a plurality of test compounds for a time sufficient to allow binding under suitable conditions, and c) detecting binding ofthe ACAM polypeptide to each ofthe plurality of test compounds, thereby identifying the test compound as a compound that binds the ACAM polypeptide
  • the invention is a method for identifying a specific binding partner of a human ACAM-encoding polynucleotide such as a polynucleotide comprising a nucleotide sequence defined by SEQ ID NO 1 or SEQ ID NO 3
  • the method comprises a) contacting the ACAM polynucleotide with a test compound under
  • ACAM polynucleotide The method enables identification of a specific binding partner that modulates, e.g.,
  • ACAM polypeptide encoded by the ACAM polynucleotide inhibits or enhances, expression of an ACAM polypeptide encoded by the ACAM polynucleotide.
  • the invention also includes a compound identified by the method, as well as a composition comprising the identified compound and a pharmaceutically acceptable carrier.
  • the invention is a method for screening a plurality of compounds for specific affinity with a human ACAM polypeptide such as a polypeptide comprising an amino acid sequence defined by SEQ ID NO:2 or SEQ LD NO:4.
  • the method comprises: a) providing a plurality of compounds; b) combining the ACAM polypeptide with each ofthe plurality of
  • the invention is a method for identifying a
  • modulator ofthe cell adhesion activity of an ACAM polypeptide ofthe invention comprising:
  • step b) incubating the admixture of step a) in the presence of a known binding partner ofthe ACAM polypeptide;
  • step c) measuring an amount of binding ofthe known binding partner with the ACAM polypeptide; and d) comparing the measured amount of binding in step c) with an amount of binding ofthe known binding partner with the ACAM polypeptide when incubated in the absence ofthe test compound, wherein a comparative difference in the amounts of binding in the presence and absence ofthe test compound indicates that the test compound is a modulator of cell adhesion activity ofthe ACAM polypeptide.
  • the invention is a method of identifying a modulator of ACAM binding to a binding partner thereof, comprising the steps of: a) measuring binding between ACAM and the binding partner in the
  • test compound a modulator of AC AM binding to the binding partner when a different level of ACAM binding to the binding partner is observed in the presence ofthe test compound than in the absence ofthe test compound.
  • the binding partner may, for example, be selected from the group consisting of ⁇ ,
  • integrins ⁇ 2 integrins, calcium/calmodulin dependent serine protein kinase (CASK), protein tyrosine phosphatase PTPL1, BDR-1, IGF-binding serine protease, aczonin,
  • transmembrane 4 superfamily member 2 neuronal nitric oxide synthetase (nNOS), and PDZ-domain containing polypeptides.
  • the invention is a method for modulating ACAM binding to a binding partner, comprising the step of contacting ACAM or the binding partner with a modulator of ACAM binding to the binding partner.
  • the binding partner may, for example, be selected from the group consisting of ⁇ j integrins, ⁇ 2
  • the invention is a method for ameliorating a disease state associated with ACAM binding to a binding partner, comprising the step of administering to an individual in need thereof an effective amount of a modulator of
  • the binding partner may, for example, be selected from the group consisting of ⁇ j integrins, ⁇ 2 integrins, calcium/calmodulin dependent serine protein kinase (CASK), protein tyrosine phosphatase PTPL1, BDR-1, IGF-binding serine protease, aczonin, transmembrane 4 superfamily member 2, neuronal nitric oxide synthetase (nNOS), and PDZ-domain containing polypeptides.
  • CASK calcium/calmodulin dependent serine protein kinase
  • PTPL1 protein tyrosine phosphatase
  • BDR-1 calcium/calmodulin dependent serine protein kinase
  • IGF-binding serine protease aczonin
  • transmembrane 4 superfamily member 2 transmembrane 4 superfamily member 2
  • nNOS neuronal nitric oxide synthetase
  • the disease state is preferably a disease of nervous tissue, for example, disease states such as dementias, epilepsies, psychiatric disorders such as schizophrenia, peripheral nerve injury due to trauma, and peripheral neuropathies such as diabetic neuropathy, and the like.
  • disease states such as dementias, epilepsies, psychiatric disorders such as schizophrenia, peripheral nerve injury due to trauma, and peripheral neuropathies such as diabetic neuropathy, and the like.
  • ACAM cellular adhesion molecules
  • nucleotide sequence information provided by the invention makes possible large-scale expression ofthe encoded ACAM polypeptide by techniques well known
  • the invention also permits identification and isolation of polynucleotides encoding related ACAM polypeptides by well-known techniques including Southern (DNA) and/or northern (mRNA) hybridization, and amplification techniques such as polymerase chain reaction (PCR), ligase chain reaction (LCR), and the like
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • related polynucleotides include human and non-human acam genomic sequences, including allelic variants, as well as polynucleotides encoding polypeptides homologous to ACAM and structurally related
  • polypeptides sharing one or more biological, immunological, and/or physical properties are polypeptides sharing one or more biological, immunological, and/or physical properties
  • the invention includes both naturally occurring and non-naturally occurring acam polynucleotides and polypeptide products thereof
  • Naturally occurring ACAM products include distinct polynucleotide and polypeptide ACAM species as they occur in humans
  • the invention includes other human acam polynucleotide and polypeptide species defined through the analysis of sequence homology The invention
  • polynucleotides that are expressed in cells of other animal species, preferably
  • mammalian homologs and more preferably primate homologs within each ACAM
  • Non-naturally occurring ACAM products include variants ofthe naturally occurring ACAM products such as polynucleotide and polypeptide analogs (i.e., wherein one or more nucleotides or amino acids are added, substituted, or deleted).
  • Non-naturally-occurring ACAM polypeptide products also include ACAM products that have been covalently modified, e.g., water-soluble polymer modifications, glycosylation variants, fusion proteins, and the like.
  • ACAM polypeptides and the nucleic acids that encode the polypeptides provide a basis for diagnostic methods for the precise and accurate detection and/or quantitation of ACAM expression and medical conditions associated with excessive or
  • nucleotide sequences disclosed herein may be used in the detection of aberrations, such as mutations and deletions, in the gene encoding ACAM.
  • the nucleotide sequences disclosed herein may be used to identify and isolate a genomic sequence for acam.
  • PCR primers can be designed from various portions ofthe introns and exons of a genomic acam nucleic
  • the invention further provides methods of using ACAM and genetically
  • engineered host cells that express recombinant ACAM to evaluate and screen for modulators ofthe biological activity ofthe enzyme.
  • screening methods may be used for the identification of allosteric agonists and antagonists of ACAM activity as
  • ACAM protein antagonists and inhibitors such as anti-ACAM antibodies and acam antisense molecules, will provide the basis for pharmaceutical compositions for the treatment and amelioration of symptoms associated with excessive ACAM activity.
  • Agonists of ACAM will provide the basis ofthe treatment and amelioration of symptoms associated with insufficient ACAM activity.
  • the present invention provides, inter alia, novel purified and isolated polynucleotides encoding human ACAM polypeptides.
  • the invention provides variant cDNAs that encode polypeptides having amino acid sequences defined by SEQ LD NO:2 (designated "ACAM#6") and SEQ ID NO:4 (designated
  • ACAM#4 The polynucleotides encoding the ACAM#6 and ACAM#4 polypeptides, and the mature forms thereof are discussed herein as representative of the ACAM polynucleotides embraced by the invention.
  • the invention provides polynucleotides comprising a nucleotide sequence defined by SEQ ID NO:l or 3.
  • the polynucleotides ofthe invention include DNA sequences and RNA transcripts, both sense and complementary antisense strands, and splice variants thereof.
  • DNA sequences ofthe invention include, without limitation, cDNA and genomic sequences.
  • lower case “acam” refers to an ACAM nucleic acid sequence whereas upper case “ACAM' refers to an ACAM amino acid sequence.
  • Nucleic acid refers to an oligonucleotide or polynucleotide
  • An exemplary double-stranded polynucleotide according to the invention can have a first strand (i.e., a coding strand) having a sequence encoding an ACAM polypeptide, along with a second strand (i.e., a "complementary" or "non-coding" strand) having a sequence deducible from the first strand (i.e., a coding strand) having a sequence encoding an ACAM polypeptide, along with a second strand (i.e., a "complementary" or "non-coding" strand) having a sequence deducible from the first
  • Double-stranded or “duplex" structures may be DNA:DNA, DNA:RNA, or RNA:RNA nucleic acids.
  • a preferred double-stranded polynucleotide is a cDNA having a nucleotide sequence defined by SEQ ID NO: 1.
  • An exemplary single-stranded polynucleotide according to the invention is a messenger RNA (mRNA) encoding an ACAM polypeptide.
  • Another exemplary single-stranded polynucleotide is an oligonucleotide probe or primer that hybridizes to the coding or non-coding strand of a polynucleotide defined by SEQ LD NO: 1 or SEQ ID NO:3.
  • Other alternative nucleic acid structures e.g., triplex structures, are also contemplated.
  • Genomic DNA ofthe invention comprises the protein-coding region for an ACAM polypeptide and includes allelic variants ofthe preferred polynucleotides ofthe invention, such as single nucleotide polymorphisms. Genomic DNA ofthe invention is distinguishable from genomic DNAs encoding polypeptides other than ACAM in that it includes the ACAM-coding region found in acam cDNA ofthe invention. Genomic
  • DNA can be transcribed into RNA, and the resulting RNA transcript may undergo one
  • RNA transcripts that can be spliced by alternative mechanisms and therefore be subjected to removal of different non-coding RNA sequences but still encode an ACAM polypeptide, are referred to in the art as "splice variants," and are embraced by the invention. Splice variants comprehended by
  • the invention are encoded by the same DNA sequences but give rise to
  • Such splice variants can comprise regions in which the amino acid sequences.
  • Allelic variants are known in the art to be modified forms ofthe wild-type (predominant) gene sequence Such modifications result from recombination during chromosomal segregation or exposure to conditions that give rise to genetic mutation Allelic variants, like wild-type genes, are naturally occurring sequences, as
  • the invention also comprehends cDNA, which is obtained through reverse transcription of an RNA polynucleotide encoding ACAM, followed by second strand synthesis of a complementary strand to provide a double stranded DNA
  • the invention provides cDNA sequences that encode polypeptides having the amino acid sequence defined by SEQ ED NO 2 or SEQ ID NO 4
  • the invention provides cDNA molecules consisting of a nucleotide sequence defined by
  • nucleic acid sequences according to the invention are defined by SEQ ID NO 1 and SEQ ID NO 3
  • the invention comprises the alternative (degenerate) nucleotide sequences that encode ACAM polypeptides ofthe invention and functional equivalents thereof
  • the invention includes polynucleotides comprising nucleotide sequences that are substantially homologous to the acam sequence of SEQ ID NO 1 or SEQ ID NO 3
  • the invention includes polynucleotides whose corresponding
  • nucleotide sequences have at least 90%, preferably at least 95%, more preferably at
  • Variant polynucleotides ofthe invention further include fragments ofthe nucleotide sequence defined in SEQ ID NO: l or SEQ ED NO: 3 and homologs thereof.
  • the disclosure of full-length polynucleotides encoding ACAM polypeptides makes readily available to the person having ordinary skill in the art every possible fragment ofthe full-length polynucleotides.
  • fragment polynucleotides ofthe invention comprise sequences unique to the ACAM-coding nucleotide sequence, and therefore hybridize under highly stringent or moderately stringent conditions only (i.e., specifically) to polynucleotides encoding ACAM or fragments thereof containing the unique sequence.
  • Polynucleotide fragments of genomic sequences ofthe invention comprise not only sequences unique to the coding region, but also include fragments of the full-length sequence derived from introns, regulatory regions, and/or other untranslated sequences. Sequences unique to polynucleotides ofthe invention are recognizable through sequence comparison to other known polynucleotides, and can be identified through use of computer software routinely used in the art, e.g., alignment programs available in public sequence databases.
  • the invention also provides fragment polynucleotides that are conserved in one
  • polypeptides encode members ofthe ACAM family of polypeptides.
  • Such fragments include sequences characteristic ofthe family of ACAM polypeptides,
  • signature sequences The conserved signature sequences are readily discernable following simple sequence comparison of polynucleotides encoding members ofthe ACAM family.
  • Polynucleotide fragments ofthe invention can be labeled in a manner that permits their detection, including radioactive and non-radioactive labeling.
  • Hybridization can be defined to include the process of forming partially or completely double-stranded nucleic acid molecules through sequence-specific association of complementary single-stranded nucleic molecules. The invention, therefore, further encompasses the use of nucleic acid species that hybridize to the coding or non-coding strands of a polynucleotide that encodes an ACAM protein.
  • hybridizing species hybridize to the coding or non-coding strand ofthe nucleotide sequence defined by SEQ ED NO: 1 or SEQ ID NO:3. Also encompassed
  • Hybridizing species include, for example, nucleic acid hybridization or amplification probes (oligonucleotides) that are capable of detecting nucleotide sequences (e.g., genomic sequences) encoding ACAM or closely related molecules,
  • Probes for the detection of related nucleotide sequences are selected from
  • oligonucleotide probes are provided.
  • non-conserved nucleotide region refers to a nucleotide region that is unique to acam disclosed herein and does not occur in related immunoglobulin superfamily members such as known CAMs
  • Specificity of hybridization is typically characterized in terms ofthe degree of stringency ofthe conditions under which the hybridization is performed
  • the degree of stringency of hybridization conditions can refer to the melting temperature (Tm) ofthe nucleic acid binding complex [see, e g , Berger and Kimmel, "Guide to Molecular
  • Maximal stringency typically occurs at about T m - 5°C (5°C below the T m ofthe probe), "high stringency” at about 5°C to 10°C below T m , “intermediate stringency” at about 10°C to 20 °C below T m , and "low stringency” at about 20 °C to
  • the stringency of hybridization can refer to the physicochemical conditions employed in the procedure To illustrate, exemplary moderately stringent
  • hybridization conditions are hybridization in 3X saline sodium citrate (SSC), 0 1% sarkosyl, and 20 mM sodium phosphate, pH 6 8, at 65 °C, and washing in 2X SSC with 0 1% sodium dodecyl sulfate (SDS), at 65 °C
  • Exemplary highly stringent hybridization conditions are hybridization in 50% formamide, 5X SSC, at 42°C overnight, and washing in 0 5X SSC and 0 1% SDS, at 50°C It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described Ausubel et al (Eds ),
  • Modifications in hybridization conditions can be determined empirically or calculated
  • guanosine/cytosine (GC) base pairing ofthe probe The hybridization conditions can be calculated as described in Sambrook et al., (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (1989), pp. 9.47-9.51.
  • hybridization under more stringent conditions enables the identification of species having a higher degree of homology or sequence identity with the target sequence.
  • hybridization under less stringent conditions enables identification of species having a lesser but still significant degree of homology or sequence identity with the target sequence.
  • nucleic acid species that are capable of hybridizing to the nucleotide sequence of SEQ ED NO: 1 or SEQ ID NO: 3 under conditions of intermediate (moderate) to maximal stringency.
  • the hybridizing species hybridize to the coding or non-coding strands of a polynucleotide defined by SEQ ED NO: 1 or SEQ ID NO: 3 under highly stringent conditions.
  • polynucleotides ofthe invention encompass oligonucleotides (i.e., nucleic acid oligomers typically about 10 to 60 nucleotides in length) that hybridize to either
  • the invention comprises oligonucleotides that hybridize to the coding or non-coding strand of a polynucleotide defined by SEQ ID NO: l or SEQ ID NO:
  • the length ofthe oligonucleotide is not critical, as long as it is capable of hybridizing to the target nucleic acid molecule. However, longer nucleic acid
  • the oligonucleotide should not be longer than necessary. Accordingly, the oligonucleotide should contain at least 10 nucleotides, preferably at least 15 nucleotides, and more preferably at least 20 nucleotides. Normally, the oligonucleotide will not contain a maximum of 60 nucleotides, preferably a maximum of 30 nucleotides, and more preferably a maximum of 25 nucleotides.
  • oligonucleotides may be used as described herein as primers for DNA synthesis (e.g., as primers in PCR; "amplimers"), as probes for detecting the presence of target DNA in a sample (e.g., northern or Southern blots and in situ hybridization), as therapeutic agents (e.g., in antisense therapy), or for other purposes. Oligonucleotides may be single- or double-stranded, with the double-stranded forms having one or both ends blunt or stepped.
  • oligonucleotides may be obtained or derived by known methods from
  • the oligonucleotides may be produced synthetically according to methods known in the art. Such methods include, for example, cloning and restriction of appropriate sequences or direct chemical synthesis by any suitable method, such as the phosphotriester method [see Narang et al., Methods Enzymol 68:90 (1979)]; the phosphodiester method [Brown et al., Methods Enzymol 68: 109 (1979)]; the diethylphosphoramidite method [Beaucage et al., Tetrahedron Lett
  • the acam polynucleotides ofthe invention include variants, which are
  • polynucleotides that encode ACAM or a functional equivalent thereof, and which can include deletions, insertions, or substitutions of nucleotide residues.
  • a “deletion” is a change in a nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues, respectively, are absent.
  • an “insertion” or “addition” is a change in a nucleotide or amino acid sequence that results in the addition of one or more nucleotides or amino acid residues, respectively. Deletion or insertion of nucleotides can introduce a downstream shift in the reading frame ofthe coding sequence, resulting in significant changes in the primary sequence ofthe protein.
  • substitution is a change in a nucleotide or amino acid sequence in which one or more nucleotides or amino acids are replaced by different nucleotides or amino acids, respectively.
  • Directed amino acid substitutions may be made based on well defined parameters of the canonical and other amino acids, e.g., polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic character ofthe residues.
  • Polynucleotide variants also within the scope ofthe present invention include alleles or alternative naturally occurring forms of acam. Alleles result from naturally occurring mutations, i.e., deletions, insertions or substitutions, in the genomic nucleotide sequence, which may or may not alter the structure or function or the expressed polypeptides. Each of these types of mutational changes may occur alone, or in combination with the others, one or more times in a given allelic sequence.
  • Single nucleotide polymorphisms may occur, in which a single base mutation
  • the invention further embraces natural homologs ofthe human ACAM DNA that occur in other animal species, such as other mammal species.
  • homologs include, for example, homologs in mouse, rat, guinea pig, and the like, and more preferably homologs in other primate species. Such species homologs, in
  • the invention encompasses polynucleotides that share at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% nucleotide identity with the protein-coding region of a polynucleotide encoding a human ACAM polypeptide, e.g., the polynucleotide defined by SEQ ED NO:l or SEQ ED NO:3.
  • Percent sequence "homology" with respect to polynucleotides ofthe invention can be defined as the percentage of nucleotide bases in a candidate sequence that are identical to nucleotides in the ACAM-encoding sequence after aligning the sequences and introducing gaps, if necessary, to achieve maximum percent sequence identity.
  • Computer software is available (from commercial and public domain sources) for calculating percent identity in an automated fashion (e.g., FASTA).
  • the invention includes polynucleotides that have been engineered to selectively modify the cloning, processing, and/or expression ofthe ACAM gene product.
  • Mutations may be introduced using techniques well known in the art, e.g., site-directed mutagenesis to insert new restriction sites, to alter glycosylation patterns, or to change codon preferences inherent in the use of certain expression systems, while simultaneously maintaining control ofthe amino acid sequence ofthe expressed polypeptide product.
  • codons preferred by a particular prokaryotic or eukaryotic host cell can be selected to increase the rate of ACAM expression or to produce recombinant RNA transcripts having desirable properties, such as longer half-lives.
  • acam polynucleotides can be synthesized, wholly or partly, using chemical methods well known in the art. "Chemically synthesized,” as used herein and is
  • DNA molecules may be modified to increase intracellular stability and half-life Possible modifications include, but are not limited to, the addition of flanking sequences ofthe 5' and/or 3' ends ofthe molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiester linkages within the backbone ofthe molecule
  • PNA ACAM peptide nucleic acid
  • ACAM PNAs are informational molecules that have a neutral "peptide-like" backbone with nucleobases that allow the molecules to hybridize to complementary ACAM-encoding DNA or RNA with higher affinity and specificity than corresponding oligonucleotides (PerSeptive Biosystems) Polypeptide Expression Systems
  • polynucleotide sequences ofthe invention may be engineered to selectively modify the cloning, processing, and/or expression ofthe gene product For example,
  • mutations may be introduced using techniques well known in the art, e g , site-directed
  • ACAM polynucleotides may be usefully engineered to overcome expression or processing problems inherent in the use of certain expression systems while maintaining control ofthe amino acid sequence ofthe expressed polypeptide product.
  • codons preferred by a particular prokaryotic or eukaryotic host cell can be selected to increase the rate of ACAM expression or to produce recombinant RNA transcripts having desirable properties, such as longer half-lives
  • ACAM-encoding DNA sequences enables the artisan to modify cells to permit or increase expression of ACAM Accordingly, host cells are provided, including prokaryotic or eukaryotic cells, which are either stably or transiently modified by introduction of a polynucleotide ofthe invention to permit expression of the encoded ACAM polypeptide Autonomously replicating recombinant expression constructs such as plasmid and viral DNA vectors incorporating ACAM-encoding
  • Expression constructs are also provided comprising ACAM-encoding polynucleotides operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator
  • Expression control DNA sequences include promoters, enhancers, and operators, and are generally selected based on the expression systems in which the expression construct is to be used
  • promoter and enhancer sequences are generally selected for the ability to increase gene expression
  • operator sequences are generally selected for the ability to regulate gene expression
  • Preferred constructs ofthe invention also include sequences necessary for replication in a host cell
  • Expression constructs are preferably used for production of an encoded ACAM polypeptide, but may also be used to amplify the
  • Polynucleotides ofthe invention may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a
  • Methods for introducing DNA in to a host cell include transformation, transfection, electroporation, nuclear injection, or fusion with carriers such as liposomes, micelles, ghost cells, and protoplasts.
  • Expression systems ofthe invention include, for example, bacteria, yeast, fungal, plant, insect, invertebrate, amphibian, and mammalian cell systems.
  • Some suitable prokaryotic host cells include, for example, E.coli strains SG-936, HB 101, W3110, XI 776, X2282, DHL, and MRC1, Pseudomonas sp., Bacillus sp. such as B. subtilis, and Streptomyces sp.
  • Suitable eukaryotic host cells include yeasts, such as Saccharomyces cerevisiae, S. pombe,
  • Pichia pastoris and other fungi insect cells such as sf9 or sf21 cells (Spodoptera frugiperda), animal cells such as Chinese hamster ovary (CHO) cells, COS (primate kidney) cells, human cells such as JY, 293, and NIH3T3 cells, and plant cells such as Arabidopsis thaliana cells.
  • the acam nucleotide sequence, or any portion of it, may be cloned into a vector for the production of an mRNA probe.
  • Such vectors are known in the art, are commercially available, and may be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6.
  • the type of host cell the form ofthe expressed ACAM product, the conditions
  • ACAM polypeptides are embraced.
  • the protein produced by a recombinant cell may be secreted or may be contained intracellulariy, depending on the sequence and/or the vector used.
  • expression vectors containing acam can be designed with signal sequences that direct secretion of ACAM through a particular prokaryotic or eukaryotic cell membrane.
  • Expression constructs may include sequences that facilitate, and preferably promote, homologous recombination in a host cell. This can be accomplished by replacing all or part ofthe naturally occurring acam promoter with all or part of a heterologous promoter so that the cells express ACAM at higher levels.
  • the heterologous promoter should be inserted so that it is operatively linked to ACAM-encoding sequences. See, for example, PCT International Publication Nos. WO94/12650, WO92/20808, and WO91/09955.
  • Host cells ofthe invention are useful in methods for large-scale production of
  • host cells ofthe invention are a valuable source of immunogen for development of antibodies that are immunoreactive with ACAM polypeptides.
  • recombinant ACAM can be produced and isolated from host cells for use in in vitro binding assays such as drug screening assays. In such methods, the host cells are grown in a suitable culture medium and the desired polypeptide product is isolated from the cells or from the medium in which the cells are grown.
  • polypeptide product can be isolated by purification methods known in the art, such as conventional chromatographic methods including immunoaffinity chromatography, receptor affinity chromatography, hydrophobic interaction
  • heterologous amino acid sequence Suitable heterologous sequences can include a specific tag, label, or chelating moiety that is recognized by a specific binding partner or agent.
  • a fusion protein may also be engineered to contain a cleavage site (e.g., a factor XA or enterokinase sensitive sequence) located between the ACAM sequence and the heterologous protein sequence, to permit the ACAM protein to be cleaved from the heterologous protein
  • Cleavage ofthe fusion component may produce a form of the desired protein having additional amino acid residues resulting from the cleavage
  • heterologous peptide domains include metal-chelating peptides such as
  • Protein Expr Purif 3:263-281 (1992)] and protein A domains that allow purification on immobilized immunoglobulin.
  • Another useful system is the divalent cation-binding domain and antibodies specific thereto used in the peptide extension/immunoaffinity purification system described in U.S. Patents Nos. 4,703,004, 4,782,137, 4,851,431, and 5,011,912. This system is commercially available as the FLAG® system from
  • GST glutathione S-transferase
  • expression constructs ofthe invention may also include sequences encoding one or more selectable markers that permit identification of host cells bearing the construct in operative condition.
  • amplifiable marker DNA e.g., ada, dhfr, and the multifunctional CAD gene that encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase
  • intron DNA may be inserted along with the heterologous promoter DNA. If linked to the ACAM-encoding sequence, amplification ofthe marker DNA by standard selection methods results in co-amplification ofthe ACAM-encoding sequences in the cells. Detection of expression ofthe marker gene in response to induction or selection usually indicates expression of ACAM as well.
  • recombinant cells containing acam can be identified by the absence of marker gene function.
  • hybridization and protein bioassay or immunoassay techniques that include membrane-based, solution-based, or chip-based technologies for the detection and/or quantification ofthe nucleic acid or protein.
  • the presence ofthe acam polynucleotide sequence can be detected by DNA-DNA or DNA-RNA hybridization or amplification using fragments of acam disclosed in SEQ ID NO: l as probes.
  • Nucleic acid amplification based assays involve the use of oligonucleotides based on the acam sequence to detect transformants containing acam DNA or RNA.
  • Labeled hybridization or PCR probes for detecting acam polynucleotide sequences can be made by various methods, including oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • ACAM or a variant thereof and/or a host cell line that expresses the ACAM or variant thereof may be used to screen for antibodies, peptides, or other molecules, such as organic or inorganic molecules, that
  • anti-ACAM antibodies capable of neutralizing the cellular adhesion activity of ACAM may be used to inhibit ACAM-mediated disease.
  • screening of peptide libraries or organic libraries made by combinatorial chemistry with recombinantly expressed ACAM or variants thereof or cell lines expressing ACAM or variants thereof may be useful for identification of therapeutic molecules that function by modulating a biological or immunological activity of ACAM.
  • Synthetic compounds, natural products, and other sources of potentially biologically active materials can be screened in a number of ways deemed routine by those of skill in the art. For example,
  • nucleotide sequences encoding a protein binding domain of ACAM may be expressed in a host cell, which can be used for screening of modulators, either agonists or antagonists, of ACAM activity.
  • the invention also provides purified and isolated mammalian ACAM
  • ACAM polypeptides are defined in SEQ ID NO:2 and 4. Mature forms of these polypeptides are preferred, i.e., polypeptides comprising amino acid residues 1 to 408 of SEQ ID NO:2 and amino acid residues 1 to 374 of SEQ ED NO:4.
  • ACAM polypeptides ofthe invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells ofthe invention.
  • ACAM products ofthe invention may be full-length polypeptides, or variant polypeptide products such as fragments, truncates, deletion mutants, and other variants thereof that retain specific ACAM biological activity.
  • biologically active refers to an ACAM polypeptide having structural, regulatory or biochemical functions ofthe naturally occurring ACAM protein.
  • the protein and fragments ofthe present invention may be prepared by methods known in the art. Such methods include isolating the protein directly from cells, isolating or synthesizing DNA encoding the protein and using the DNA to produce recombinant protein, and synthesizing the protein chemically from individual
  • the ACAM polypeptides can be isolated from a biological sample, such as a
  • solubilized cell fraction by standard methods. Some suitable methods include precipitation and liquid chromatographic protocols such as ion exchange, hydrophobic interaction, and gel filtration. See, for example, Deutscher (Ed.), Methods Enzymol (Guide to Protein Chemistry, Section VII) 182:309 (1990) and Scopes, Protein Purification, Springer- Verlag, New York (1987). Alternatively, purified material is
  • the detergent SDS is removed from the protein by known methods,
  • ACAM polypeptide ofthe invention may also be chemically synthesized, wholly or partly, by methods known in the art. Suitable methods for synthesizing the protein are described by Stuart and Young, Solid Phase Peptide Synthesis, 2d ed.,
  • peptides can be synthesized by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography (HPLC). See, e.g., Roberge et al., Science 269:202-204 (1995). Automated synthesis may be accomplished, for example, using the ABI 431 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer. The composition ofthe synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure).
  • Recombinant ACAM protein may be produced in and isolated from a host cell transformed with an expression vector containing an acam nucleotide sequence and grown in cell culture.
  • the host cells either prokaryotic or eukaryotic, are either stably or transiently transfected (eukaryotic) or transformed (prokaryotic) with an ACAM-encoding polynucleotide ofthe invention in manner that permits directed expression of an ACAM polypeptide.
  • the host cells are grown in a suitable culture medium and the desired polypeptide products are
  • isolated from the cells or from the medium in which the cells are grown Isolation of the polypeptides can be accomplished by, for example, immunoaffinity purification.
  • Isolation of the polypeptides can be accomplished by, for example, immunoaffinity purification.
  • the use of transformed host cells is preferred for large-scale production of ACAM polypeptides.
  • the invention includes polypeptides comprising amino acid sequences that are substantially homologous to the sequences of ACAM polypeptides described herein.
  • the invention includes polypeptides whose corresponding amino acid sequences have at least 90%, preferably at least 95%, more preferably at least 98%, and still more preferably at least 99% identity with the polypeptide sequence defined in SEQ ID NO:2 or SEQ ID NO:4.
  • Percent sequence "identity” with respect to a preferred polypeptide ofthe invention can be defined as the percentage of amino acid residues in a candidate sequence that are identical to amino acid residues in the reference ACAM sequence after aligning the sequences and introducing gaps, if necessary, to achieve maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Percent sequence "homology” with respect to a preferred polypeptide ofthe invention can be defined as the percentage of amino acid residues in a candidate sequence that are identical to amino acid residues in the reference ACAM sequence after aligning the sequences and introducing gaps, if necessary, to achieve maximum percent sequence identity, and also considering any conservative substitutions as part
  • homologous can also be based on FASTA searches in accordance with Pearson et al.,
  • percent homology is calculated as the percentage of amino acid residues in the smaller ofthe two sequences that align with identical amino acid residues in the sequence being compared, when four gaps in a length of 100 amino acids may be introduced to maximize alignment. See Dayhoff, in Atlas of Protein Sequence and Structure, Vol. 5, p. 124, National Biochemical Research Foundation, Washington, D.C. (1972).
  • a polypeptide may be considered homologous to an ACAM polypeptide ofthe invention if polynucleotides encoding the two polypeptides hybridize with one another. A higher degree of homology is shown if the hybridization occurs under hybridization conditions of greater stringency.
  • a homologous polypeptide may be a polypeptide that is encoded by a polynucleotide that hybridizes with a polynucleotide encoding a polypeptide ofthe invention under hybridization conditions having a specified degree of stringency. It may be desirable that such structurally homologous polypeptides will also exhibit functional homology, insofar as the homologous polypeptide has substantially the same function as the polypeptide ofthe invention.
  • structurally homologous polypeptides may be considered functionally homologous if they exhibit similar binding of a ligand, or similar immune reactivity, etc.
  • two polypeptides or two polynucleotides may be considered to be substantially homologous in structure, and yet differ substantially in function.
  • single nucleotide polymorphisms (SNPs) among alleles may be SNPs
  • polypeptides having substantial differences in function along one or more measurable parameters such as antibody- or ligand-binding affinity or enzymatic substrate specificity, and the like.
  • Other structural differences such as substitutions, deletions, splicing variants, and the like, may affect the function of otherwise
  • the ACAM polypeptides ofthe invention include functional derivatives ofthe ACAM polypeptide defined in SEQ ID NO:2 or SEQ ED NO:4. Such functional derivatives include polypeptide products that possesses a structural feature or a biological activity that is substantially similar to a structural feature or a biological activity ofthe ACAM protein. Accordingly, functional derivatives include variants, fragments, and chemical derivatives ofthe parent ACAM protein.
  • variant refers to a molecule that is substantially similar in structure and function to an ACAM molecule or a fragment thereof. A molecule is said to be "substantially similar" to another molecule if both molecules have substantially similar structures or if both molecules possess a similar biological activity. Thus, provided that two molecules possess a similar activity, they are considered variants, as that term is used herein, even if one ofthe molecules possesses a structure not found in the other molecule, or if the sequence of amino acid residues is not
  • variant polypeptides provided under the invention are variants that comprise one or more changes in the amino acid sequence ofthe ACAM polypeptide.
  • sequence-based changes include deletions, substitutions, or insertions in the
  • ACAM sequence as well as combinations thereof.
  • Deletion variants ofthe ACAM polypeptides are polypeptides in which at least one amino acid residue ofthe sequence is removed. Deletions can be effected at one or both termini ofthe protein, or with removal of one or more residues within the
  • ACAM amino acid sequence includes, for example, all incomplete
  • fragments ofthe ACAM polypeptides ofthe invention refers to any polypeptide subset of the ACAM protein.
  • a soluble fragment is preferably generated by deleting any membrane-spanning region(s) ofthe parent molecule or by deleting or substituting hydrophilic amino acid residues for hydrophobic residues. Identification of such residues is well known in the art.
  • substitution variants including polypeptides in which at least one amino acid residue of an ACAM polypeptide is replaced by an alternative residue. Any substitution can be made, with conservative substitutions being preferred. Directed
  • amino acid substitutions may be made based on well defined physico chemical parameters ofthe canonical and other amino acids (e.g., the size, shape, polarity, charge, hydrogen-bonding capacity, solubility, chemical reactivity, hydrophobicity, hydrophilicity, or the amphipathic character ofthe residues.) as well as their contribution to secondary and tertiary protein structure.
  • substitution variants can be made based on well defined physico chemical parameters ofthe canonical and other amino acids (e.g., the size, shape, polarity, charge, hydrogen-bonding capacity, solubility, chemical reactivity, hydrophobicity, hydrophilicity, or the amphipathic character ofthe residues.) as well as their contribution to secondary and tertiary protein structure.
  • substitution variants can be made based on well defined physico chemical parameters ofthe canonical and other amino acids (e.g., the size, shape, polarity, charge, hydrogen-bonding capacity, solubility, chemical
  • polypeptides comprising one or more conservative amino acid substitutions, i.e., a substitution of one amino acid by another having similar physicochemical character as desired.
  • conservative amino acid substitutions i.e., a substitution of one amino acid by another having similar physicochemical character as desired.
  • canonical amino acids can be grouped according to the following categories:
  • substitutions that are in general more progressive are those in which: (a) glycine and/or proline is substituted by another amino acid or is deleted or inserted; (b) a hydrophilic residue is substituted for a hydrophobic residue; (c) a cysteine residue is substituted for (or by) any other residue; (d) a residue having
  • an electropositive side chain is substituted for (or by) a residue having an electronegative charge, or (e) a residue having a bulky side chain is substituted for (or by) one not having such a side chain.
  • amino acid substitutions that affect the solubility of ACAM These are most preferably generated by substituting
  • substitution variants can include non-canonical or non-naturally occurring amino acid residues substituted for amino acid residues in the principal sequence
  • substitution variants include those polypeptides in which amino acid substitutions have been introduced by modification of polynucleotides encoding an ACAM polypeptide Insertion variants are provided, in which at least one amino acid residue is present in addition to an ACAM amino acid sequence Insertions may be located at
  • Insertional variants also include fusion proteins in which the amino or carboxy terminus ofthe ACAM polypeptide is fused to another polypeptide
  • fusion proteins include immunogenic polypeptides, proteins with long circulating half-life (e g , immunoglobulin constant regions), marker proteins (e g , green fluorescent protein) and proteins or polypeptides that facilitate purification
  • ACAM polypeptide e g , FLAG® tags or polyhistidine sequences
  • Another example of a terminal insertion is a fusion of a signal sequence, whether
  • Intrasequence insertions may range generally from about 1 to 10 residues, more preferably 1 to 5
  • Polypeptide variants ofthe invention also include mature ACAM products, i.e., ACAM products wherein leader or signal sequences are removed, as well as products having additional amino terminal residues.
  • ACAM products having an additional methionine residue at position -1 are contemplated, as are ACAM products having additional methionine and lysine residues at positions -2 and -1, respectively (Met-2-Lys-l-ACAM).
  • Other such variants are particularly useful for recombinant protein production in bacterial host cells.
  • the invention also encompasses ACAM variants having additional amino acid residues resulting from use of specific expression systems.
  • GST glutathione-S-transferase
  • use of commercially available vectors that express a desired polypeptide as a glutathione-S-transferase (GST) fusion product yields the desired polypeptide having an additional glycine residue at position -1 (Gly- 1 -ACAM) upon cleavage ofthe GST component from the desired polypeptide.
  • variantants that result from expression in other vector systems are also contemplated.
  • the invention further provides ACAM polypeptide products that are chemical derivatives ofthe ACAM polypeptide defined in SEQ ID NO:2 or SEQ ED NO:4.
  • the term "chemical derivative” refers to molecules that contain additional chemical moieties that are not normally a part ofthe naturally occurring molecule. Such moieties may impart desirable properties to the derivative molecule, such as
  • chemical derivatives of ACAM polypeptides include polypeptides bearing modifications other than (or in addition to) insertion, deletion or substitution of amino acid residues.
  • the modifications are covalent in nature, and include, for example, chemical bonding with polymers, lipids, non-naturally occurring amino acids, and other organic and inorganic moieties.
  • Derivatives ofthe invention may be prepared to increase circulating half-life of an ACAM polypeptide, or may be designed to improve targeting capacity for the
  • polypeptide to desired cells, tissues, or organs.
  • a polypeptide to include one or more water-soluble polymer attachments such as polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol.
  • water-soluble polymers that have been covalently modified with polyethylene glycol (PEG) subunits.
  • PEG polyethylene glycol
  • Water-soluble polymers may be bonded at specific positions, for example at the amino terminus ofthe ACAM products, or randomly attached to one or more side chains of the polypeptide.
  • Additional derivatives include ACAM species immobilized on a solid support, pin microparticle, or chromatographic resin, as well as ACAM species modified to include one or more detectable labels, tags, chelating agents, and the like.
  • Derivatization with bifunctional agents can be used to cross-link ACAM to a
  • ACAM variants can be expected to have utility in investigating a biological activity characteristic of a wild-type ACAM polypeptide.
  • ACAM or to specifically disable one or more particular biological or immunological
  • fragments and truncates may be designed to delete a domain associated with a particular property, or substitutions and deletions may be designed to inactivate a property associated with a particular domain.
  • Forced expression (overexpression) of such variants ("dominant negative" mutants) can be employed to study the function ofthe protein in vivo by observing the phenotype associated with the mutant.
  • Characteristic variants ofthe ACAM polypeptide can be expected to have utility in modulating ACAM activity in vivo, e.g., inhibiting ACAM binding activity, and phenomena associated therewith.
  • ACAM having up to about 100 residues may be conveniently prepared by in vitro synthesis. If desired, such fragments may be modified using methods known in the art by reacting targeted amino acid residues of the purified or crude protein with an organic derivatizing agent that is capable of reacting with selected side chains or terminal residues. The resulting covalent
  • derivatives may be used to identify residues important for biological activity.
  • Functional derivatives of ACAM having altered amino acid sequences can also be prepared by mutating the DNA encoding ACAM. Any combination of amino acid deletion, insertion, and substitution may be employed to generate the final construct, provided that the final construct possesses the desired activity. Obviously, the mutations that will be made in the DNA encoding the functional derivative must not
  • the mutation per se need not be predetermined.
  • random mutagenesis such as linker scanning mutagenesis
  • site-directed mutagenesis or other well-known technique may be employed to make mutations at predetermined sites in a DNA known sequence
  • mutagenesis allows the production of ACAM functional derivatives through use of specific oligonucleotide sequences that encode the DNA sequence ofthe desired mutation
  • Site-directed mutagenesis methods and materials are commercially available, e g , the QuikChangeTM kit available from Stratagene (La Jolla CA)
  • Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably 1 to 10 residues, and typically are contiguous
  • the most preferred deletions are those that are performed to generate regulatory or binding domains of ACAM
  • mutant ACAM molecules that lack residues of a functional domain, e g , an extracellular binding domain, may be prepared to create a dominant negative protein
  • a derivative typically is made by linker scanning site-directed mutagenesis ofthe DNA encoding the native ACAM molecule.
  • the derivative is then expressed in a recombinant host, and, optionally, purified from the cell culture, for example, by immunoaffinity chromatography.
  • the activity ofthe cell lysate or the purified derivative is then screened in a suitable screening assay for the desired characteristic.
  • a change in the immunological character ofthe functional derivative such as affinity for a given antibody, is measured by a competitive type immunoassay. Changes in other parameters ofthe expressed product may be measured by the appropriate assay.
  • the present invention provides antibodies that bind with specificity to an ACAM polypeptide.
  • An "antibody” as used herein is defined broadly as a protein that characteristically immunoreacts with an epitope (antigenic determinant) that is characteristic ofthe ACAM polypeptide. As used herein, an antibody is said to
  • immunosorbent with an antigen such as a polypeptide if the antibody specifically
  • CDRs complementarity determining regions
  • An antibody that is immunoreactive with a given polypeptide may exhibit cross-reactivity to another polypeptide if the two polypeptides each comprise a
  • cross-reactivity can correlate to common structural features such as sequence identity, homology, or similarity found among the related polypeptides. Accordingly, families of polypeptides can often be identified by a cross-reactive antibody, i e , an antibody that immunoreacts with some or all ofthe members ofthe polypeptide family sharing the common epitope
  • a cross-reactive antibody i e
  • the invention encompasses antibodies that immunoreact with a particular member ofthe ACAM family of polypeptides, e g , a polypeptide comprising the amino acid sequence defined by SEQ
  • the invention further encompasses antibodies that immunoreact with some or all members ofthe ACAM family of polypeptides. Screening assays to determine the binding specificity of an antibody are well known and routinely practiced in the art For a comprehensive discussion of such assays, see Harlow et al (Eds ), Antibodies- A Laboratory Manual, Ch 6, Cold Spring Harbor
  • variable regions in particular the constant regions of the antibody
  • Antibodies include, for example, monoclonal antibodies, polyclonal antibodies, single chain antibodies (scFv antibodies), chimeric antibodies, multifunctional/multispecific (e.g., bifunctional or bispecific) antibodies, humanized antibodies
  • Antibodies according to the invention also include antibody fragments, so long as they exhibit the desired biological activity "Antibody fragments" comprise a
  • portion of a full-length antibody generally the antigen binding or variable region
  • antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
  • Antibodies ofthe invention can be produced by any method known in the art.
  • polyclonal antibodies are isolated from mammals that have been immunized against the protein or a functional analog in accordance with methods known in the art.
  • polyclonal antibodies may be produced by injecting an immunogenic ACAM polypeptide (immunogen) into a host mammal (e.g., rabbit, mouse, rat, or goat).
  • Adjuvants may be employed to increase the immune response.
  • Sera from the host mammal are extracted and screened to obtain polyclonal antibodies that are specific for (immunoreact with) the ACAM polypeptide.
  • Monoclonal antibodies are preferred.
  • “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.
  • Monoclonal antibodies are highly specific (“monospecific"), being directed against a single antigenic site. Furthermore, in contrast to conventional
  • polyclonal antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against
  • Monoclonal antibodies may be prepared using any suitable technique capable of yielding a continuous cell line producing a homogeneous antibody.
  • Antibodies can be engineered using genetic techniques to produce chimeric antibodies including protein components from two or more species For use in in vivo
  • the antibody can be "humanized,” i e , modified to contain an antigen binding region from one species, e g , a rodent, with the bulk ofthe antibody replaced with sequences derived from human immunoglobulin
  • the non-human CDRs of one species e g , a mouse or rabbit are inserted into a framework sequence of another species, e g . a human, or into a consensus framework sequence Further changes can then be introduced into the antibody framework to modulate affinity or immunogenicity ofthe engineered antibody.
  • Methods are also known for inducing expression of engineered antibodies in various cell types, such as mammalian and microbial cell types. Numerous techniques for preparing engineered antibodies are described, e.g., in Owens and Young, J Immunol Meth 168:149-165 (1994).
  • Antibodies further include recombinant polyclonal or monoclonal Fab fragments prepared in accordance with the method of Huse et al., Science 246:1275-1281 (1989).
  • techniques described for the production of single chain antibodies e.g., U.S. Patent No. 4,946,778 can be adapted to produce ACAM-specific single chain antibodies (e.g., single chain Fv fragments; abbreviated
  • Fully human antibodies are especially preferred for therapeutic use in humans, but they are typically difficult to produce. For example, when the immunogen is a human self-antigen, a human will typically not produce any immune response to the antigen. Methods for making fully human antibodies have been developed and are known in the art. Accordingly, fully human antibodies can be produced by using an immunogenic ACAM polypeptide to immunize an animal (e.g., mouse) that has been transgenically modified to express at least a significant fraction ofthe human repertoire
  • an ACAM peptide fragment must contain sufficient amino acid residues to define an immunogenic epitope. If the fragment is too short to be immunogenic per se, it may be conjugated to a carrier molecule. Suitable carrier molecules include, for example, keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Conjugation may be carried out by methods known in the art. One such method is to combine a cysteine residue ofthe fragment with a cysteine residue on the carrier molecule.
  • Antibodies ofthe invention are useful for therapeutic methods, e.g., by
  • antibodies that stimulate or inhibit a biological activity of ACAM are contemplated.
  • Antibodies ofthe invention are also useful in diagnostic methods (by detecting ACAM in a sample), as well as purification of ACAM.
  • the antibodies are particularly useful for detecting and/or quantitating
  • Kits comprising an antibody ofthe invention for any ofthe purposes described herein are also contemplated.
  • a kit ofthe invention also includes a control antigen with which the antibody
  • immunoreacts may further include other reagents, containers (typically having
  • Functional equivalents further include fragments of antibodies that have the same binding characteristics as, or that have binding characteristics comparable to, those ofthe whole antibody.
  • Such fragments may contain one or both Fab fragments or the F(ab')2 fragment.
  • the antibody fragments Preferably, contain all six complement determining regions ("CDRs") ofthe whole antibody, although fragments containing
  • Fragments may be prepared, such as by methods described by Lamoyi et al., J Immunol Meth 56:235-243 (1983) and by Parham, J Immunol 131 :2895-2902
  • binding proteins can be developed using isolated or recombinant ACAM products, ACAM variants, or cells expressing such products. Binding proteins are useful for purifying ACAM products and detection or quantification of ACAM products in fluid and tissue samples using known
  • binding proteins are also manifestly useful in modulating (i.e., blocking, inhibiting, or stimulating) biological activities of ACAM polypeptides, especially those activities involved in signal transduction.
  • the invention includes neutralizing antibodies, i.e., antibodies that significantly inhibit or impair a biological activity ofthe proteins or functional analogs ofthe invention.
  • neutralizing antibodies inhibit or impair the cellular adhesion activity of ACAM.
  • Neutralizing antibodies may be especially desirable for therapeutic and diagnostic
  • Anti-idiotypic antibodies specific for anti-ACAM antibodies are also contemplated.
  • the present invention further provides a method of detecting the presence of an ACAM-encoding polynucleotide or an ACAM polypeptide in a sample.
  • the method involves use of a labeled probe that recognizes the presence of a defined target in the sample.
  • the probe may be an antibody that recognizes an ACAM polypeptide, or an oligonucleotide that recognizes a polynucleotide encoding ACAM polypeptide.
  • the probes ofthe invention can be detectably labeled in accordance with methods known in the art.
  • the probe can be modified by attachment of a detectable label (reporter) moiety to the probe, or a detectable probe can be manufactured with a detectable label moiety incorporated therein.
  • the detectable label moiety can be any detectable moiety, many of which are known in the art, including radioactive atoms, electron dense atoms, enzymes, chromogens and colored compounds, fluorogens and fluorescent compounds, members of specific binding pairs, and the like.
  • non-radioactive labels include enzymes, chromogens, atoms and molecules detectable by electron microscopy, and metal ions detectable by their magnetic properties.
  • Some useful enzymatic labels include enzymes that cause a detectable change in a substrate.
  • Some useful enzymes include, for example, horseradish peroxidase (pyrogallol and o-phenylenediamine), beta-galactosidase (fluorescein beta-D-galactopyranoside), and alkaline phosphatase (5 -bromo-4-chloro-3 -indolyl phosphate/nitro blue tetrazolium).
  • horseradish peroxidase pyrogallol and o-phenylenediamine
  • beta-galactosidase fluorescein beta-D-galactopyranoside
  • alkaline phosphatase 5 -bromo-4-chloro-3 -indolyl phosphate/nitro blue tetrazolium.
  • Useful reporter moieties include, for example, fluorescent, phosphorescent, chemiluminescent, and bioluminescent molecules, as well as dyes.
  • Some specific colored or fluorescent compounds useful in the present invention include, for example,
  • Chromogens or fluorogens i.e., molecules that can be modified (e.g., oxidized) to become colored or fluorescent or to change their color or emission spectra, are also capable of being incorporated into probes to act as reporter moieties under particular conditions.
  • the label moieties may be conjugated to the probe by methods that are well known in the art.
  • the label moieties may be directly attached through a functional group on the probe.
  • the probe either contains or can be caused to contain such a
  • label moieties such as enzymes and chromogens may be conjugated to antibodies or nucleotides by means of coupling agents, such as dialdehydes, carbodiimides, dimaleimides, and the like
  • the label moiety may also be conjugated to the probe by means of a ligand attached to the probe by a method described above and a receptor for that ligand attached to the label moiety Any ofthe known ligand-receptor binding pair combinations is suitable Some suitable ligand-receptor pairs include, for example, biotin-avidin or -streptavidin, and antibody-antigen The biotin-streptavidin combination may be preferred
  • DNAs encoding allelic variants of ACAM Similarly, non-human species genes
  • encoding proteins homologous to ACAM can also be identified by Southern and/or
  • ACAM Oligonucleotides ofthe invention are also useful in hybridization assays to detect the capacity of cells to express ACAM Polynucleotides ofthe invention may also be the basis for diagnostic methods useful for identifying a genetic alteration in the acam locus that underlies a disease state.
  • Oligonucleotides ofthe invention may be used in methods to amplify DNA for various purposes.
  • "Amplification” refers to any molecular biology technique for detection or manipulation of trace levels of a specific nucleic acid sequence by exponentially amplifying a template nucleic acid sequence.
  • suitable amplification techniques include such techniques as PCR, ligase chain reaction (LCR), and variants thereof.
  • PCR is known to be a highly sensitive technique, and is in wide use. PCR is described, for example, in Innis et al, PCR Protocols: A Guide to Methods and Applications, Academic Press,
  • LCR is more recently developed and is described in Landegren et al, Science 241 : 1077 (1988) and Barany et al, PCR Methods and Applications 1:5 (1991).
  • An LCR kit is available from Stratagene. LCR is known to be highly specific, and is capable of detecting point mutations. In certain circumstances, it is desirable to couple the PCR and LCR techniques to improve precision of detection. Other amplification techniques may be employed in accordance
  • Oligonucleotide amplification primers are often provided as matched pairs of single-stranded oligonucleotides; one with sense orientation (5' ® 3') and one with antisense (3' - 1 5') orientation. Such specific primer pairs can be employed under
  • the same primer pair, nested sets of oligomers, or even a degenerate pool of oligomers may be employed under less stringent conditions for detection and/or quantitation of closely related DNA or RNA sequences.
  • oligonucleotides can be used in various methods known in the art to extend the specified nucleotide sequences. These methods permit use of a known sequence to determine unknown adjacent sequence, thereby enabling detection and
  • upstream sequences such as promoters and regulatory elements. Exemplary methods are described in Gobinda et al, PCR Methods Applic 2:318-322 (1993)); Triglia et al, Nucleic Acids Res 16:8186 (1988); Lagerstrom et al, PCR Methods Applic 1 : 111-119 (1991); Parker et al, Nucleic Acids Res 19:3055-3060 (1991).
  • Commercial kits are also available, e.g., the PromoterFinderTM kit available
  • restriction-site PCR is a direct method that uses universal primers
  • genomic DNA is first amplified in the presence of primer to a linker sequence and a primer specific to the
  • the primers may be designed using Oligo 4.0 (National Biosciences, Inc., Plymouth MN), or another appropriate program, to be 22-30 nucleotides in length, to have a GC
  • This method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intermolecular ligation and used as a PCR template.
  • Capture PCR is a method for PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome (YAC) DNA (Lagerstrom et al, PCR Methods Applic 1 : 111-119 (1991)). Capture PCR also requires multiple restriction enzyme digestions and ligations to place an engineered double-stranded sequence into an unknown portion ofthe DNA molecule before PCR. Parker et al, Nucleic Acids Res 19:3055-3060 (1991), teaches walking PCR, a method for targeted
  • PromoterFinderTM is a kit available from Clontech (Palo Alto CA) that uses PCR, nested primers, and special libraries to "walk in” genomic DNA. This process avoids the need to screen libraries
  • Preferred libraries for screening for full-length cDNAs are ones that have been size-selected to include
  • the oligonucleotide probes may also be used for mapping the endogenous genomic sequence.
  • the sequence may be mapped to a particular chromosome or to a specific region ofthe chromosome using well known techniques. These include in situ hybridization to chromosomal spreads [Venna et al, Human Chromosomes: A Manual of Basic Technique, Pergamon Press, New York NY (1988)], flow-sorted chromosomal preparations, or artificial chromosome constructions such as YACs, bacterial artificial chromosomes (BACs), bacterial PI constructions, or single chromosome cDNA libraries.
  • Hybridization of chromosomal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers are invaluable in extending genetic maps. Examples of genetic maps can be found in Science 270:410f (1995) and 265: 198 If (1994). Often the placement of a gene on the chromosome of
  • Another mammalian species may reveal associated markers even if the number or arm of a particular human chromosome is not known.
  • sequences can be assigned to particular structural features of chromosomes by physical mapping. This provides valuable information to investigators searching for disease genes using positional cloning or other gene discovery techniques. Once a disease or syndrome has been crudely localized by genetic linkage to a particular genomic region, any sequences mapping to that area may represent associated or regulatory genes for further investigation. See, e.g., Gatti et al, Nature 336:577-580 (1988).
  • the ofthe invention may also be used to detect differences in the chromosomal location due to translocation, inversion, etc., between normal, carrier, or affected individuals.
  • the DNA sequence information provided by the present invention also makes
  • the invention provides antisense nucleic acid sequences that recognize and hybridize to polynucleotides encoding ACAM. Modifications of gene expression can be obtained by designing antisense sequences to the control regions ofthe acam gene, such as the promoters, enhancers, and introns. Oligonucleotides derived from the transcription initiation site, e.g., between -10 and +10 regions ofthe leader sequence, are preferred. Antisense RNA and DNA molecules may also be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
  • antisense molecules ofthe invention include those that specifically recognize and hybridize to acam DNA (as determined by sequence comparison of acam DNA to DNA encoding other known molecules).
  • the antisense molecules ofthe invention also include those that recognize and hybridize to DNA encoding other members ofthe
  • ACAM family of proteins Antisense polynucleotides that hybridize to multiple DNAs encoding other members ofthe ACAM family of proteins are also identifiable through
  • antisense molecules preferably have at least 95%, more preferably at least 98%, and still more preferably at least 99% identity to the target acam sequence.
  • Antisense polynucleotides are particularly relevant to regulating expression of
  • Antisense polynucleotides preferably 10 to 20 bp oligonucleotides capable of specifically binding to acam expression
  • control sequences or acam RNA are introduced into cells, e.g., by a viral vector or a colloidal dispersion system such as a liposome.
  • the antisense oligonucleotide binds to
  • the acam target nucleotide sequence in the cell prevents transcription or translation
  • oligonucleotides are specifically contemplated for therapeutic use under the invention.
  • the antisense oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5' ends.
  • the invention further comprises methods to modulate ACAM expression by means of ribozyme technology
  • ribozyme technology See Gibson and Shillitoe, Mol
  • Ribozyme technology can be used to inhibit translation of acam mRNA in a sequence specific manner through (i) the hybridization of a complementary RNA to a target mRNA and (ii) cleavage ofthe hybridized mRNA through endonuclease activity inherent to the complementary RNA Ribozymes can be identified by empirical methods such as using complementary oligonucleotides in ribonuclease protection assays, but more preferably are specifically designed based on scanning the target molecule for accessible ribozyme cleavage sites [Bramlage et al ,
  • Exogenous can include use of targeting liposomes or direct local injection
  • Endogenous methods include use of viral vectors and non-viral plasmids
  • Ribozymes can specifically modulate expression of ACAM when designed to be complementary to regions unique to a polynucleotide encoding ACAM
  • ribozymes can be designed to modulate expression of all or some ofthe ACAM family of proteins Ribozymes of this type are designed to recognize nucleotide sequences conserved all or some ofthe polynucleotides encoding the ACAM family members
  • the invention further embraces methods to modulate transcription of acam through use of oligonucleotide-directed triple helix formation (also known as Hogeboom base-pairing methodology). For a review, see Lavrovsky et al, Biochem Mol Med 62: 11-22 (1997).
  • Triple helix formation is accomplished using sequence-specific oligonucleotides that hybridize to double stranded DNA in the major groove as defined in the Watson-Crick model. This triple helix hybridization compromises the ability ofthe original double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules. Preferred target sequences for hybridization include promoter and enhancer regions to permit transcriptional regulation of ACAM expression. Oligonucleotides that are capable of triple helix formation can alternatively be coupled to DNA damaging agents, which can then be used for site-specific covalent modification of target DNA sequences. See Lavrovsky et al, supra.
  • RNA molecules be prepared by any method known in the art for the synthesis of RNA molecules.
  • RNA molecules may be any organic compound that can be used as a starting material.
  • RNA molecules may be any organic compound that can be used as a starting material.
  • RNA molecules may be any organic compound that can be used as a starting material.
  • RNA molecule Such DNA sequences may be incorporated into a variety of vectors with suitable RNA polymerase promoters such as T7 or SP6.
  • RNA polymerase promoters such as T7 or SP6.
  • antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly can be introduced into cell lines, cells, or tissues.
  • the invention comprehends gene therapy to restore ACAM activity as indicated in treating those disease states characterized by a deficiency or absence of ACAM activity associated with the ACAM enzyme.
  • Delivery of functional acam gene to appropriate cells is effected ex vivo, in situ, or in vivo by use of vectors, and more particularly viral vectors (e.g., adenovirus, adeno-associated virus, or retro virus), or ex vivo by use of physical DNA transfer methods (e.g., liposomes or chemical treatments). See, for example, Anderson, Nature 392(6679 Suppl):25-30 (1998). Alternatively, it is contemplated that in other disease
  • Antisense therapy or gene therapy can be applied to negatively regulate the expression of ACAM.
  • DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis ofthe structure and function of ACAM proteins.
  • DNA and amino acid sequence information for ACAM also permits identification of molecules with which an ACAM polypeptide will interact.
  • Agents that modulate (i.e., increase, decrease, or block) ACAM activity may be identified by incubating a putative modulator with ACAM and determining the effect ofthe putative modulator on ACAM activity. The selectivity of a compound that modulates the
  • ACAM polypeptide activity can be evaluated by comparing its activity on the ACAM to its activity on other proteins. Numerous methods are amenable to modification by including ACAM
  • polypeptides or acam polynucleotides ofthe invention including cell-based methods such as dihybrid and trihybrid screens to detect binding partners and split hybrid screens to detect compounds that disrupt complexing of binding partners.
  • cell-based methods such as dihybrid and trihybrid screens to detect binding partners and split hybrid screens to detect compounds that disrupt complexing of binding partners.
  • methods include in vitro methods, such as assays in which an ACAM polypeptide, acam polynucleotide, or a binding partner thereof is immobilized, as well as solution assays, are contemplated under the invention. These methods are exemplified by a general approach that includes the steps of contacting an ACAM polypeptide with a
  • putative binding partner compound detecting or measuring binding ofthe ACAM polypeptide with the compound, and optionally isolating and/or identifying the binding partner compound.
  • Cell-based assays include methods of screening genomic DNA or cDNA libraries to identify binding partners of ACAM polypeptides. Exemplary methods include the dihybrid or two-hybrid screen described by Fields and Song, Nature 340:245-246 (1989); Fields, Methods: A Companion to Methods in Enzymology
  • Cell -based methods ofthe invention preferably identify components in biological pathways that are mediated by ACAM biological activity.
  • the method is carried out in a host cell containing a soluble ACAM polypeptide and a soluble form of its binding partner and wherein decreased of increased binding is
  • cell-based assays to identify inhibitors of ACAM polypeptide interaction with a known binding partner may be based on methods such as the split
  • In vitro methods comprise the steps of (a) contacting an immobilized ACAM polypeptide with a candidate binding partner compound, and (b) detecting binding of the candidate compound to the ACAM polypeptide.
  • the candidate binding partner compound is immobilized and binding ofthe ACAM polypeptide is detected. Immobilization may be accomplished using any ofthe methods well known in the art, including bonding to a support, beads, or a chromatographic resin, as well as high affinity interactions such as antibody binding or use of an avidimbiotin type system.
  • Detection of binding ofthe ligands can be accomplished, for example, by (i) using a detectable (e.g., radioactive or fluorescent) label on the ligand that is not immobilized, (ii) using an antibody immunospecific for the non-immobilized ligand, (iii) using a label on the non-immobilized ligand that promotes excitation of a fluorescent support to which the immobilized ligand is bound, as well as other techniques routinely practiced in the art.
  • a detectable label on the ligand that is not immobilized e.g., an antibody immunospecific for the non-immobilized ligand
  • a label on the non-immobilized ligand that promotes excitation of a fluorescent support to which the immobilized ligand is bound, as well as other techniques routinely practiced in the art.
  • methods ofthe invention comprise the steps of (a) contacting an ACAM polypeptide with one or more candidate binding partner compounds, and (b) identifying the compounds that bind to the ACAM polypeptide. Identification ofthe compounds that bind ACAM can be achieved by isolating the
  • ACAM:binding partner complex and separating the ACAM polypeptide from the binding partner compound.
  • An additional step of characterizing the physical, biological, or biochemical properties ofthe binding partner compound is also
  • the ACAM:binding partner complex is isolated using a second binding partner compound (e.g., an antibody or
  • Selective modulators may include, for example, antibodies and other proteins or peptides that specifically bind to an ACAM polypeptide or an ACAM-encoding polynucleotide, oligonucleotides that specifically bind to ACAM polypeptides or ACAM-encoding polynucleotides, and other non-peptide compounds (e g , isolated or synthetic organic molecules) that specifically react with ACAM polypeptides or
  • ACAM-encoding polynucleotides Modulators also include compounds as described above but which interact with a specific binding partner of ACAM polypeptides Mutant forms of ACAM, such as those that affect the biological activity or cellular location ofthe wild-type ACAM, are also contemplated under the invention
  • Presently preferred targets for the development of selective modulators include, for example
  • cytoplasmic or transmembrane regions of ACAM polypeptides that contact other proteins and/or localize ACAM within a cell , e g , to the cell surface or specific regions thereof,
  • Still other selective modulators include those that recognize specific regulatory or ACAM-encoding nucleotide sequences
  • Modulators of ACAM activity may be therapeutically useful in treatment of a wide range of diseases and physiological conditions in which aberrant ACAM activity is involved
  • An ACAM-encoding polynucleotide sequence may be used for the diagnosis of diseases resulting from or associated with ACAM expression or activity
  • diseases resulting from or associated with ACAM expression or activity For example,
  • polynucleotide sequences encoding ACAM may be used in hybridization or PCR assays of biological samples, e g , samples or extracts of fluids or tissues from biopsies or autopsies, to detect abnormalities in ACAM expression
  • Such qualitative or quantitative methods may include Southern or northern analysis, dot blot, or other membrane-based technologies, PCR technologies, dipstick, pin or chip technologies, and ELISA or other multiple-sample format technologies
  • Such assays may be tailored to evaluate the efficacy of a particular therapeutic treatment regimen and may be used in animal studies, in clinical trials, or in monitoring the treatment of an individual patient
  • a normal or standard profile for ACAM expression must be established This is accomplished by combining a biological sample taken from a normal subject with an
  • ACAM polynucleotide, under conditions suitable for hybridization or amplification Standard hybridization may be quantified by comparing the values obtained for normal subjects with a dilution series of positive controls run in the same experiment where a known amount of a purified acam polynucleotide is used Standard values obtained from normal samples may be compared with values obtained from samples from
  • Deviation between standard and subject values establishes the presence ofthe disease
  • Treatment profile or values may be generated The assay may be repeated on a regular basis to evaluate whether the values progress toward or return to the normal or standard pattern Successive treatment profiles may be used to show the efficacy of treatment over a period of several days or several months
  • Anti-ACAM antibodies are useful for the diagnosis of conditions, disorders, or diseases characterized by or associated with cell-cell interactions or leukocyte
  • polypeptides include methods that employ a labeled antibody to detect an ACAM polypeptide in a biological sample such as a body fluid, cells, tissues, sections, or extracts of such materials.
  • the polypeptides and antibodies ofthe present invention may be used with or without modification.
  • the polypeptide or the antibody will be labeled by linking them, either covalently or non-covalently, with a detectable label moiety as described herein.
  • Antibody-based methods for detecting the presence of ACAM polypeptides in biological samples are enabled by virtue ofthe present invention.
  • Assays for detecting the presence of proteins with antibodies have been previously described, and follow known formats, such as enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS) and flow cytometry, western blots, sandwich assays, and the like. These formats are normally based on incubating an antibody with a sample suspected of containing the ACAM protein and detecting the presence of a complex between the antibody and the protein. The antibody is labeled either before, during, or after the incubation step.
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • a first antibody specific for the protein is immobilized on a solid
  • Immobilization may be accomplished by directly binding the antibody to a solid surface, such as a microtiter well. Then the immobilized first antibody is incubated with a sample suspected of containing the protein. If present in the sample, the protein binds to the first antibody. A second antibody, also specific for the protein, is added and binds to the immobilized protein. The second antibody may be labeled by methods known in the art. Non-immobilized materials are washed away, and the presence of immobilized label indicates the presence ofthe protein. This assay method and variants thereof, as well as other types of immunoassays are described U.S. Patent Nos. 3,867,517, 4,012,294, 4,098,876, and 4,376,110. The sample containing antigen, solid phase immunoabsorbent with immobilized antibody, and labeled soluble antibody are incubated under conditions and for a period of time sufficient to allow antigen to
  • the specific concentrations of antibodies, the temperature and time of incubation, as well as other such assay conditions can be varied, depending upon various factors including the concentration of antigen in the sample, the nature of the sample, etc. In general, it is desirable to provide incubation conditions sufficient to bind as much antigen as possible, since this maximizes the binding of labeled antibody to the solid phase, thereby increasing the signal.
  • ACAM polypeptide expression To provide a basis for the quantitation of ACAM protein in a sample or for the diagnosis of disease, normal or standard values of ACAM polypeptide expression must be established. This is accomplished by combining body fluids or cell extracts taken from a normal sample or from normal subjects, either animal or human, with antibody
  • the amount of standard complex formation may be any suitable amount of standard complex formation.
  • standard values obtained from normal samples may be compared with values obtained from samples from test sample, e g , subjects potentially affected by a disorder or disease related to an ACAM expression Deviation between standard
  • the ACAM protein, as well as fragments thereof possessing biological activity can be used for screening putative modulator compounds in any of a variety of drug screening techniques
  • modulator refers to a compound that acts as an agonist or as an antagonist of ACAM activity
  • Modulators according to the invention include allosteric modulators of activity as well as inhibitors of activity An
  • agonist of ACAM is a compound that enhances or increases the ability of ACAM to carry out any of its biological functions
  • An example of such an agonist is an agent that increases the ability of ACAM to bind to a binding partner such as another cellular adhesion molecule
  • An "antagonist” of ACAM is a compound that diminishes or abolishes the ability of ACAM to carry out any of its biological functions
  • the invention provides a method for screening a plurality of test
  • the present invention also provides a method of identifying a modulator of a biological activity of an ACAM polypeptide, comprising the steps of a) contacting the compound with an ACAM polypeptide, b) incubating the mixture of step a) with a substrate under conditions suitable for the biological activity, c) measuring the amount ofthe biological activity; and d) comparing the amount of biological activity of step c) with the amount of biological activity obtained with the ACAM polypeptide, incubated without the compound, thereby determining whether the compound stimulates or inhibits the biological activity.
  • the ACAM polypeptide is a fragment from the intracellular or membrane spanning regions
  • the ACAM polypeptide is a fragment from the extracellular region of ACAM and provides a method to identify inhibitors of interaction with other cellular
  • the polypeptide employed in such methods may be free in solution, affixed to a solid support, displayed on a cell surface, or located intracellulariy.
  • the modulation of activity or the formation of binding complexes between the ACAM polypeptide and the agent being tested may be measured.
  • ACAM polypeptides are amenable to biochemical or cell-based high throughput screening
  • melanophore assay systems to investigate receptor-ligand interactions
  • yeast-based assay systems to investigate receptor-ligand interactions
  • mammalian cell expression systems for a review, see
  • HTS assays are also comprehended as described, for example, in Houston and Banks, Curr Opin Biotechnol 8:734-740 (1997). Such HTS assays are used to screen libraries of compounds to identify particular compounds that exhibit a desired property. Any library of compounds may be used, including chemical libraries, natural product libraries, combinatorial libraries comprising random or designed oligopeptides, oligonucleotides, or other organic compounds.
  • Chemical libraries may contain known compounds, proprietary structural analogs of known compounds, or compounds that are identified from natural product screening.
  • Natural product libraries are collections of materials isolated from naturals sources, typically, microorganisms, animals, plants, or marine organisms. Natural products are isolated from their sources by fermentation of microorganisms followed by isolation and extraction ofthe fermentation broths or by direct extraction from the microorganisms or tissues (plants or animal) themselves. Natural product libraries include polyketides, non-ribosomal peptides, and variants (including non-naturally
  • Combinatorial libraries are composed of large numbers of related compounds, such as peptides, oligonucleotides, or other organic compounds as a mixture. Such compounds are relatively straightforward to design and prepare by traditional automated synthesis protocols, PCR, cloning or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries.
  • Still other libraries of interest include peptide, protein, peptidomimetic,
  • SAR typically involves of iterative series of selective modifications of compound structures and their correlation to biochemical or biological activity.
  • Families of related compounds can be designed that all exhibit the desired activity, with certain members ofthe family potentially qualifying as therapeutic candidates.
  • the invention also encompasses the use of competitive drug screening assays in which neutralizing antibodies capable of binding an ACAM polypeptide specifically compete with a test compound for binding to the ACAM polypeptide.
  • the antibodies can be used to detect the presence of any compound, e.g., another peptide that shares one or more antigenic determinants with the ACAM polypeptide.
  • ACAM-Encoding Polynucleotides and ACAM Polypeptides The invention provides a method for modulating the expression or activity of
  • the method comprises administering an
  • the invention thus provides a method for treating diseases or disorders mediated by or characterized by ACAM expression or activity.
  • This invention provides also a method for either treating diseases or disorders mediated by or characterized by lack of ACAM activity as well as treating diseases or disorders by increasing ACAM activity.
  • This method may be employed in treating animals that are or may be subject to any condition whose symptoms or pathology is mediated by ACAM expression or activity.
  • the method may further involve administering an antagonist of another CAM activity, such as activity associated with ICAM-1, ICAM-R, and the like.
  • exemplary CAM antagonists suitable for use in this embodiment include, for example, the soluble forms of intercellular adhesion molecule- 1 described in the prevention of diabetes in animal model [Martin et al, Diabetologia 41(11):1298-303 (1998)].
  • the ACAM inhibitory method may entail use of a compound that antagonizes both ACAM and another enzyme having CAM activity. Inhibitors of compounds that bind to CAMs may also be desirable for use in treating ACAM mediated disorders.
  • inhibitors ofthe activity of ⁇ j integrins and ⁇ 2 integrins may be employed.
  • Treating refers to preventing a disorder from occurring in an animal that may be predisposed to the disorder, but has not yet been diagnosed as having it; inhibiting the disorder, i.e., arresting its development; relieving the disorder, i.e., causing its regression, or ameliorating the disorder, i.e., reducing the severity of symptoms associated with the disorder.
  • disorder is intended to encompass medical
  • Disease states or disorders characterized by or mediated by ACAM expression or activity, either directly or indirectly, include without limitation disorders involving
  • Types of nervous tissue disorders amenable to the invention may include, for example, dementias, palsies and tremors, epilepsies, psychiatric disorders, central (e.g., spinal cord) or peripheral nerve injury due to trauma, surgery, ischemia, infectious disease, autoimmune disease, metabolism (e.g., diabetes) or toxic compounds, ataxias, aphasias, peripheral neuropathies, etc.
  • Exemplary diseases include, for example, Alzheimer's disease, optic nerve degenerative disorders, Pick's disease, Parkinson's disease, striatonigral degeneration, Shy-Drager syndrome, Hallervorden-Spatz syndrome, progressive supranuclear palsy, olivopontocerebellar atrophy, Friedreich's ataxia, ataxia-telangiectasia, amyotrophic lateral sclerosis, primary lateral sclerosis, progressive muscular atrophy, progressive bulbar palsy, pseudobulbar palsy, Werdnig-Hoffman disease, Kugelberg-Welander syndrome, multiple sclerosis, perivenous encephalomyelitides, schizophrenia, grand mal epilepsy, petit mal epilepsy, diabetic neuropathy, compressive neuropathy, AEDS-related neuropathy, stroke and
  • the method may further include coordinated administration of another type of compound having therapeutic efficacy in the treatment of nervous tissue disorders, for example, agents that promote neural regeneration such as growth factors, e.g., nerve growth factor and morphogenetic proteins; neurotransmitter agonists or antagonists; neurotransmitter reuptake antagonists; antibodies; psychotropic agents, etc.
  • agents that promote neural regeneration such as growth factors, e.g., nerve growth factor and morphogenetic proteins; neurotransmitter agonists or antagonists; neurotransmitter reuptake antagonists; antibodies; psychotropic agents, etc.
  • adjuvant agents can promote specific therapeutic results as desired in particular indications.
  • adjuvant surgical techniques may also be employed, including implantation of neural progenitor cells.
  • Disease states or disorders characterized by or mediated by ACAM expression of activity, either directly or indirectly, include without limitation disorders involving
  • Types of disorders amenable to the invention may include, for example pituitary tumors or disorder related to excess or
  • ACAM insufficiency of hormonal release by the pituitary cells.
  • ACAM could also be used to modulate a normal pituitary function.
  • Disease states or disorders characterized by or mediated by ACAM expression include, without limitation, tumors that could result from abnormal expression of ACAM or one of its ligands. Tumors or neoplasms include new growths of tissue in which the multiplication of cells is uncontrolled and progressive. Some such growths are benign, but others are termed "malignant,” leading to death ofthe organism. Malignant neoplasms or “cancers" are distinguished from benign growths in that, in addition to exhibiting aggressive cellular proliferation, cancers invade surrounding tissues and metastasize. Moreover, malignant neoplasms are characterized in that they show a greater loss of differentiation (greater "dedifferentiation"), and of their organization relative to one another and their surrounding tissues. This property is also called “anaplasia.”
  • Neoplasms treatable by the present invention include solid tumors, i.e., carcinomas and sarcomas.
  • Carcinomas include those malignant neoplasms derived from epithelial cells which tend to infiltrate (invade) the surrounding tissues and give rise to metastases.
  • Adenocarcinomas are carcinomas derived from glandular tissue or
  • cancers in which the tumor cells form recognizable glandular structures.
  • sarcomas which are tumors whose cells are embedded in a fibrillar or homogeneous substance like embryonic connective tissue.
  • the invention also enables treatment of cancers ofthe myeloid or lymphoid systems, including leukemias, lymphomas and other cancers that typically do not present as a tumor mass, but are distributed in the vascular or lymphoreticular systems.
  • inventions include, for example, ACTH-producing tumor, acute lymphocytic leukemia,
  • acute nonlymphocytic leukemia cancer of he adrenal cortex, bladder cancer, brain cancer, breast cancer, cervical cancer, chronic lymphocytic leukemia, chronic myelocytic leukemia, colorectal cancer, cutaneous T-cell lymphoma, endometrial cancer, esophageal cancer, Ewing's sarcoma, gallbladder cancer, hairy cell leukemia,
  • Hodgkin's lymphoma Kaposi's sarcoma
  • kidney cancer liver cancer
  • lung cancer small and non-small cell
  • malignant peritoneal effusion malignant pleural effusion
  • melanoma mesothelioma, multiple myeloma, neuroblastoma, glioma, non-Hodgkin's lymphoma, osteosarcoma, ovarian cancer, ovarian (germ cell) cancer
  • pancreatic cancer penile cancer, prostate cancer, retinoblastoma, skin cancer, soft tissue sarcoma, squamous cell carcinomas, stomach cancer, testicular cancer, thyroid cancer, trophoblastic neoplasms, uterine cancer, vaginal cancer, cancer ofthe vulva, and Wilm's tumor.
  • the methods ofthe invention embrace various modes of treating an animal, preferably a mammal, more preferably a primate, and still more preferably a human.
  • Mammals that may be treated include, for example, companion animals (pets) such as dogs and cats; farm animals such as cattle, horses, sheep, pigs, and goats; laboratory animals such as rats, mice, rabbits, guinea pigs, and primates.
  • companion animals such as dogs and cats
  • farm animals such as cattle, horses, sheep, pigs, and goats
  • laboratory animals such as rats, mice, rabbits, guinea pigs, and primates.
  • Non-mammalian animals include, for example, companion animals (pets) such as dogs and cats; farm animals such as cattle, horses, sheep, pigs, and goats; laboratory animals such as rats, mice, rabbits, guinea pigs, and primates.
  • acam polynucleotides provided by the invention also enable therapeutically and/orally.
  • an acam antisense molecule may provide the basis for treatment of various abnormal conditions related to excessive or undesirable levels of ACAM activity.
  • polynucleotide sequences encoding ACAM may provide the basis for the treatment of various abnormal conditions related to deficiency of ACAM activity.
  • Expression vectors derived from retroviruses, adenovirus, herpes, or vaccinia viruses, or from various bacterial plasmids, may be used for delivery of recombinant acam sense or antisense molecules to the targeted cell population.
  • recombinant vectors containing acam can be constructed using Methods that are well known to those skilled in the art. See, for example, the techniques described in Sambrook et al, supra, and Ausubel et al, supra.
  • recombinant acam polynucleotides can be delivered to target cells in liposomes.
  • cDNA sequence and/or its regulatory elements, enables researchers to use an acam polynucleotide as a tool in sense [Youssoufian and Lodish, Mol Cell Biol 13:98-104 (1993)] or antisense [Eguchi et al, Annu Rev Biochem 60:631-652 (1991)] investigations of gene function.
  • Oligonucleotides designed from the cDNA or control sequences obtained from the genomic DNA, can be used in vitro or in vivo to inhibit expression. Such technology is now well known in the art, and sense or antisense oligonucleotides or larger fragments can be designed from various locations along the coding or control regions.
  • ACAM expression can be modulated by transfecting a cell or
  • ACAM ACAM
  • Such constructs can flood cells with untranslatable sense or antisense sequences. Even in the absence of integration into the DNA, such vectors may continue to transcribe RNA molecules until all copies ofthe vector are disabled by endogenous nucleases.
  • Such transient expression may be accomplished using a non-replicating vector or a vector incorporating appropriate replication elements. Methods for introducing vectors into cells or tissue include those methods discussed herein. In addition, several of these transformation or transfection methods are equally suitable for ex vivo therapy.
  • acam polynucleotide sequences disclosed herein may be used in molecular biology techniques that have not yet been developed, provided the new techniques rely on properties of nucleotide sequences that are currently known, including but not limited to such properties as the triplet genetic code and specific base pair interactions.
  • compositions that comprise a chemical or biological compound (“agent") that is active as a modulator of
  • ACAM expression or activity and a biocompatible pharmaceutical carrier, adjuvant, or vehicle may be selected from among all or portions of acam polynucleotide sequences, acam antisense molecules, ACAM polypeptides, protein, peptide, or organic modulators of ACAM bioactivity,
  • the agent is active in treating a medical condition that is mediated by or characterized by ACAM expression or activity.
  • the composition can include the agent as the only active moiety or in combination with other nucleotide sequences, polypeptides, drugs, or hormones mixed with excipient(s) or other pharmaceutically acceptable carriers. Techniques for formulation and administration of pharmaceutical compositions
  • compositions ofthe present invention may be any pharmaceutical compositions ofthe present invention.
  • compositions manufactured using any conventional method, e.g., mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, melt-spinning, spray-drying, or lyophilizing processes.
  • optimal pharmaceutical formulation will be determined by one of skill in the art depending on the route of administration and the desired dosage. Such formulations may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance ofthe administered agent.
  • these pharmaceutical compositions may be formulated and administered systemically or locally.
  • compositions may be administered to the subject by any conventional method, including parenteral and enteral techniques.
  • Parenteral administration modalities include those in which the composition is administered by a route other than through the gastrointestinal tract, for example, intravenous, intraarterial, intraperitoneal, intramedullary, intramuscular, intraarticular, intrathecal,
  • Enteral administration modalities include, for example, oral (including buccal and sublingual) and rectal administration.
  • Transepithelial administration modalities include, for example, transmucosal administration and transdermal administration.
  • Transmucosal administration includes, for example, enteral administration as well as nasal, inhalation, and deep lung administration; vaginal administration; and rectal administration.
  • Transdermal administration includes passive
  • Surgical techniques include implantation of depot (reservoir) compositions, osmotic pumps, and the like.
  • compositions are formulated to contain suitable pharmaceutically acceptable carriers, and may optionally comprise excipients and auxiliaries that facilitate processing ofthe active compounds into preparations that can be used pharmaceutically.
  • the administration modality will generally determine the nature ofthe carrier.
  • formulations for parenteral administration may comprise aqueous solutions ofthe active compounds in water-soluble form.
  • Carriers suitable for parenteral administration can be selected from among saline, buffered saline, dextrose, water, and other physiologically compatible solutions.
  • Preferred carriers for parenteral administration are physiologically compatible buffers such as Hank's solution, Ringer's solutions, or physiologically buffered saline.
  • physiologically compatible buffers such as Hank's solution, Ringer's solutions, or physiologically buffered saline.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the formulation may include stabilizing materials, such as polyols (e.g., sucrose) and/or surfactants (e.g., nonionic surfactants), and the like.
  • formulations for parenteral use may comprise suspensions ofthe
  • Suitable lipophilic solvents or vehicles include fatty oils, such as sesame oil, and synthetic fatty acids
  • acid esters such as ethyl oleate or triglycerides, or liposomes.
  • suspensions may contain substances that increase the viscosity ofthe suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents that increase the solubility ofthe compounds to allow for the preparation of highly concentrated solutions.
  • Emulsions e.g., oil-in-water and water-in-oil dispersions, can also be used, optionally stabilized by an emulsifying agent or dispersant (surface-active materials; surfactants). Liposomes containing the active agent may also be employed for parenteral administration.
  • the pharmaceutical compositions comprising the agent in dosages suitable for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art.
  • the preparations formulated for oral administration may be in the form of tablets, pills, capsules, cachets, dragees, lozenges, liquids, gels, syrups, slurries, suspensions, or powders.
  • pharmaceutical preparations for oral use can be obtained by combining the active compounds with a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • oral formulations may employ liquid carriers similar in type to those described for parenteral use, e.g., buffered aqueous solutions, suspensions, and the like.
  • Preferred oral formulations include tablets, dragees, and gelatin capsules. These preparations may contain one or excipients, which include, without limitation: a) diluents such as sugars, including lactose, dextrose, sucrose, mannitol, or sorbitol; b) binders such as magnesium aluminum silicate, starch from corn, wheat,
  • cellulose materials such as methyl cellulose, hydroxypropylmethyl cellulose, and sodium carboxymethyl cellulose, polyvinyl pyrrolidone, gums such as gum arabic and gum tragacanth, and proteins such as gelatin and collagen; d) disintegrating or solubilizing agents such as cross-linked polyvinyl
  • pyrrolidone starches, agar, alginic acid or a salt thereof such as sodium alginate, or effervescent compositions
  • e) lubricants such as silica, talc, stearic acid or its magnesium or calcium salt, and polyethylene glycol
  • flavorants and sweeteners
  • g) colorants or pigments e.g., to identify the product or to characterize
  • the quantity (dosage) of active compound h
  • other ingredients such as preservatives, stabilizers, swelling agents, emulsifying agents, solution promoters, salts for regulating osmotic pressure, and buffers.
  • Gelatin capsules include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol Push-fit
  • capsules can contain the active ingredient(s) mixed with fillers, binders, lubricants,
  • the active compounds may be dissolved or suspended in suitable fluids, such as fatty oils, liquid paraffin, or liquid polyethylene
  • Dragee cores can be provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • the pharmaceutical composition may be provided as a salt ofthe active agent
  • the agents used in the methods ofthe invention should readily penetrate the blood brain barrier when peripherally administered. Compounds that cannot penetrate the blood brain barrier, however, can still be effectively administered by an intravenous route. Alternatively, the compound may be administered directly into the cerebrospinal
  • a therapeutically effective dose can be estimated initially from biochemical and/or cell-based assays. Then, dosage can be formulated in animal models to achieve a desirable circulating concentration range that modulates ACAM expression or activity. As human studies are conducted, further information will emerge regarding the appropriate dosage levels and duration of
  • Toxicity and therapeutic efficacy of such compounds can be determined by
  • LD50 the dose lethal to 50% ofthe population
  • ED 50 the dose therapeutically effective in 50% ofthe population.
  • the dose ratio between toxic and therapeutic effects is the "therapeutic index,” which is typically expressed as the ratio LD 50 /ED 50 . Compounds that exhibit large therapeutic indices are preferred.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • any effective administration regimen regulating the timing and sequence of doses may be used.
  • Doses ofthe agent preferably include pharmaceutical dosage units comprising an effective amount ofthe agent.
  • effective amount refers to an amount sufficient to modulate ACAM expression or activity and/or derive a measurable change in a physiological
  • Exemplary dosage levels for a human subject are ofthe order of from about
  • dosage units of the active agent comprise from about 0.01 mg to about 10,000 mg, preferably from about 0.1 mg to about 1,000 mg, depending upon the indication, route of administration, etc. Depending on the route of administration,
  • a suitable dose may be calculated according to body weight, body surface area, or
  • drugs e.g., the agent's specific activity, the severity ofthe disease state, the responsiveness ofthe patient, the age, condition, body weight, sex, and diet ofthe patient, the severity of any infection, etc. Additional factors that may be taken into account include time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Further refinement ofthe dosage appropriate for treatment involving any ofthe formulations mentioned herein is done
  • the pharmaceutical compositions can be administered in a single dose, multiple discrete doses, continuous infusion, sustained release depots, or combinations thereof, as required to maintain desired minimum level ofthe agent.
  • Short-acting pharmaceutical compositions i.e., short half-life
  • can be administered once a day or more than once a day e.g., two, three, or four times a day).
  • compositions might be administered every 3 to 4 days, every week, or once every two weeks.
  • Pumps such as subcutaneous, intraperitoneal, or subdural pumps, may be preferred for continuous infusion.
  • compositions comprising a compound ofthe invention formulated in a pharmaceutical acceptable carrier may be prepared, placed in an appropriate container,
  • Conditions indicated on the label may include treatment of inflammatory disorders, cancer, nervous tissue injury, etc.
  • Kits are also contemplated, wherein the kit comprises a dosage form of a pharmaceutical composition and a package insert containing instructions for use ofthe
  • Example 1 describes a search of an EST database to identify novel CAM cDNA sequences.
  • Example 2 describes use of RACE
  • Example 3 describes screening of a human brain library to identify a full-length ACAM cDNA.
  • Example 4 describes a northern analysis to define tissue distribution of human ACAM expression.
  • Example 5
  • Example 6 describes construction of a host cell expressing an ACAM
  • Example 7 describes an adhesion assay for assessing cellular interactions with ACAM polypeptides.
  • Example 8 describes further confirmatory adhesion assays to identify ligands of ACAM.
  • Example 9 describes the preparation of monoclonal antibodies that are reactive with ACAM polypeptides.
  • Example 10 describes a series of two-hybrid assays to determine interactions ACAM and other cellular protein components.
  • Example 11 describes computerized characterization ofthe structure ofthe ACAM gene.
  • Example 12 describes immunohistochemical experiments to characterize ACAM tissue expression.
  • Example 13 describes western blot and immunoprecipitation experiments to characterize ACAM expression.
  • EST database contains DNA sequences representing one or both ends of cDNAs collected from a variety of tissue sources.
  • THCs Tentative Human Consensus sequences
  • contigs are consensus sequences that are assembled from two or more ESTs that overlap (are contiguous) for at least 40 bases with at least 95% sequence identity.
  • THCs have been generated by automatic assembly of ESTs from worldwide EST projects into virtual transcripts. At the time the searches described
  • the TIGR database contained 72,333 THCs.
  • the search for novel CAMs included four steps First, the BLASTN program (Basic Local Alignment Search Tool, computer software available through NCBI) was used to identify ESTs with homology to cDNA sequences encoding known CAMs The program compares a query nucleotide sequence against all nucleotide sequences in the database In the present search, cDN As encoding human ICAM-1, ICAM-2,
  • a TBLASTN search was carried out using as query sequences the amino acid sequences for the known human and mouse CAM genes discussed above
  • polynucleotides in the EST database are translated in six reading frames and the resultant amino acid sequences are compared to the query sequences
  • Sequences identified as homologous at the amino acid level were examiner, and any
  • This search tool permits use of a protein query sequence against protein database sequences Using human ICAM-3 as
  • THC 127645 contained conserved cysteines and extracellular domain structure typically found in cell adhesion molecules
  • An EST identified in the TBLASTN search described above (N45515) was a member ofthe THC 127645 contig.
  • THC127645 1.145kb DNA clone (THC127645; SEQ ID NO: 5) included a correctly processed transcript with at least three extracellular domains typical of immunoglobulin supergene family members.
  • the cDNA sequence was incomplete, lacking initial methionine, lacking signal sequence, and having a truncated first domain.
  • adhesion molecules are typically surface proteins with a transmembrane region and a cytoplasmic tail, a stop codon terminated the protein at the end ofthe third domain. Therefore, the 5' end ofthe molecule was missing and the cDNA probably contained sequencing errors determining a premature stop codon.
  • the ESTs included in the contig from the GenBank® database were
  • RACE PCR was carried out on brain, liver, prostate, skeletal muscle, spleen, testis, and aorta Marathon-ReadyTM cDNA libraries (Clontech, Palo Alto CA).
  • the cDNAs had been prepared from these selected RNA samples and ligated to MarathonTM cDNA adapters; the MarathonTM adapters permit PCR using complementary primers AP-1 and AP-2 supplied with the
  • the ACAM-003 primer corresponded to the 5' end ofthe THC 127645 sequence
  • ACAM-001 primer corresponded to the end ofthe coding region, 129 nucleotides downstream from the transmembrane sequence.
  • the 3 ' primer erroneously contained a mismatched guanidine at position 8 (in boldface). The four primers were used in two rounds of PCR.
  • Cloning® vector pCR®2.1 (Invitrogen, Carlsbad CA) and transformed in Topi OF' competent cells (Invitrogen) according to the manufacturer's protocol.
  • RaceACAM SEQ ED NO: 10
  • Example 3 Isolation of a Full-Length ACAM Clone Because the human ESTs assembled in the THC 127645 contig were identified in the GenBank® database as being derived from brain and aorta cDNA, a human fetal brain library (Stratagene, La Jolla CA) was screened in an attempt to isolate a full-length cDNA encoding ACAM.
  • plaque forming units Approximately 500,000 plaque forming units (pfu) from the brain library were
  • ACAM DNA probe labeled with 32 P was excised from the plasmid RaceACAM with EcoRI and gel purified using a QIAquickTM Gel Extraction kit (QIAGEN, Chatsworth GA) that contained the ACAM insert
  • Library phage were transferred to nylon membranes by standard methods and the filters were hybridized at 42°C overnight in 40% formamide, 5X SSC, 1% SDS, and 5X Denhardt's with 1 x 10 6 cpm/mL of labeled ACAM probe. The next day the filters were washed twice for 30min at room temperature in 2XSSC, 0.1%SDS, then twice for 30min at 50°C in 0.5XSSC, 0.1%SDS. Filters were exposed to film overnight. One hundred twenty-one (121) positive clones on duplicate filters were obtained. Twenty positive clones were picked, excised, and sequenced. Two of these clones, designated ACAM#6 and ACAM#4, were full-length ACAM cDNA clones.
  • ACAM#6 (SEQ ED NO: l) was about 2.3kb in length, and included a correctly processed transcript encoding a polypeptide consisting of 432 amino acid residues (SEQ ID NO:2). This polypeptide was determined to comprise a signal peptide and three immunoglobulin-like domains, followed by a transmembrane region and a cytoplasmic tail. The most likely signal peptide cleavage site is located between the 24th and 25th residues from the initial methionine: GGA-NL (Nielsen et al, Protein Engineering, 10: 1-6 (1997)), defining a mature
  • Clone ACAM#4 (SEQ ED NO:3) is about 2.8 kb long and encodes a polypeptide 398 amino acid residues in length (SEQ ID NO:4). This polypeptide is 100%) homologous to the ACAM#6 polypeptide except that it contains a 34 amino acid deletion (consisting of residues G 6 through Q 39 ofthe mature ACAM#6 protein). It is believed to correspond to an alternative form of ACAM.
  • the putative mature form ofthe ACAM#4 is 374 residues in length (residues +1 to 374 of SEQ ED NO:4).
  • the ACAM#6 and ACAM#4 proteins both contain two potential N-linked glycosylation sites at positions N +1 and N 300 (as defined for ACAM#6), and four potential O-glycosylation sites at positions S 202 , S 330 , S 334 , and S 336 (as defined for ACAM#6) (NetOGlyc, O-glycosylation site prediction software; Hansen et al, GlycoconjugateJ 15: 115-130 (1998)). This molecule contains sequence tagged sites
  • a homology search ofthe ACAM domains indicated that the first two extracellular domains very likely have an I-like immunoglobulin domain structure, and the third domain has a C2-like immunoglobulin domain structure. All three extracellular domains are related to molecules involved in cell activation, proliferation or adhesion. In addition, the extracellular domains are related to the human poliovirus receptor (HPVR).
  • HPVR human poliovirus receptor
  • the cytoplasmic tail is 40% homologous to the cytoplasmic tail of glycophorinC, a sialoglycoprotein regulating the stability of red cells. Therefore, this
  • new ACAM polypeptide is a novel surface molecule that can be expected to play a role in cell adhesion and may play additional roles such as regulating cell structure or cell activation.
  • the northern blots contained polyA mRNA from various tissues and cell lines.
  • a 1.7 kb EcoRI-Hindlll ACAM#6 fragment corresponding to nucleotides 499 to 2224 of ACAM#6 was labeled with 32P by means ofthe Random PrimeTM kit (Boehringer Mannheim), and then purified as described in Example 3. Hybridization was performed in 50%) formamide, 5XSSC, 1XPE, 0.8%SDS, at 42°C overnight. Washing was performed using 2XSSC, 0.2%SDS, at room temperature, twice for 15 min, followed by 0.2XSSC, 0.2%SDS, at 50°C, twice for 15 min. Blots were exposed to film overnight and for three days.
  • a 2.0kb mRNA was detected in addition to the 2.4kb, 4.4kb, and 7.5kb transcripts. These multiple transcripts probably correspond to splice variants ofthe ACAM molecule. Alternatively, especially for the weak 7.5kb, band these transcripts could correspond to incomplete spliced forms or to cross-hybridization with another
  • ACAM#6 expression appeared to be in the brain, especially in the cerebellum, and in the melanoma cell line.
  • ACAM#6 and ACAM#4 as fusion proteins with IgG4, as well as ICAM-l/IgG4 , VCAM-1/IgGl, and ACAM#4/IgGl to be used as controls in adhesion experiments.
  • the resulting plasmid (designated pDEF2S/ACAM#6.Ig4) comprises a cDNA fragment of ACAM#6, encoding the signal peptide and the three extracellular domains of ACAM#6, in association with a cDNA sequence encoding the human gamma 4 heavy chain hinge, CH2, and CH3 regions together with 328 bp of 3' flanking sequence derived from a genomic clone ofthe human gamma 4 gene.
  • Such cDNA encoding the human gamma 4 heavy chain sequence can be obtained using standard cloning techniques [Sambrook et al, supra], commercially available spleen cDNA libraries (Stratagene or Clontech), and synthetic oligonucleotide probes derived from known gamma 4 sequences [Ellison et al, DNA 1 :11 (1981)].
  • genomic sequence containing the human gamma 4 gene and 3 ' flanking sequence can be cloned using standard cloning techniques [Sambrook et al, supra], commercially available human genomic libraries (Stratagene or Clontech), and probes derived from known gamma 4 sequences [Ellison et al, supra]. Fusion of
  • protein encoding DNA sequences can be performed using a combination of PCR and
  • the ACAM#6 coding region was generated by PCR using the a 5' primer ACAM-009 and a 3' primer ACAM-010: ACAM-009 CCCAAGCTTACCGCCACCATGGGGGCCCCAGCC (SEQ LD).
  • ACAM-010 CCGCTCGAGGGCGTGGTAGGTGCTGGAGGGCAC (SEQ LD NO: 12)
  • Plasmid ACAM#6 was used as a template, samples were denatured at 94°C for 5 min, followed by thirty cycles of 94°C for 30 sec; 55 °C for 30 sec; and 72°C for 30 sec in a GeneAmpTM PCR System 9700 (Perkin Elmer).
  • ACAM6/pDEF2S-IgG4 clone was digested with Notl and Xbal, the resulting fragment encoding for the fusion protein purified and ligated to pDEF24, and transformed into DH5a competent cells (Gibco BRL). The complete
  • DNA sequence encoding the fusion protein is defined in SEQ ED NO: 16, with the resulting protein having the sequence defined in SEQ LD NO: 17, wherein amino acids 1-365 constitutes the ACAM#6 component, and the remainder constitutes the Fc component.
  • ACAM#4 In order to analyze the function of ACAM#4, expression constructs were generated in pDEF24 using pDEF2S/IgGl and pDEF2S/IgG4 as intermediary plasmids.
  • the pDEF2S plasmid constructs encoded the signal peptide and the three extracellular domains of ACAM#4 in association with the hinge and the constant CH2-CH3 domains of IgGl or EgG4.
  • the ACAM#4 coding region was generated by PCR from ACAM#4 plasmid using a 5' primer ACAM-021 and a 3' primer ACAM-022:
  • ACAM-021 CCCAAGCTTGCCGCCACCATGGGGGCCCCAGCC (SEQ ID NO:18)
  • ACAM-022 ACCGTCGACGGCGTGGTAGGTGCTGGA (SEQ ID NO:19)
  • the plasmids were generated using the same procedure as described above, except that a Sail site was incorporated to the 3' primer (underlined above).
  • a PCR product of approximately 1000 bp was digested with Hindlll and Sail, purified and ligated to Hindlll, Xhol site in pDEF2S/IgGl or pDEF2S/IgG4.
  • Transformants were screened by PCR using ACAM-021 and ACAM-022 primers and positive clones were verified by sequencing.
  • ACAM4/pDEF2S/IgG4 plasmids were digested with Notl and Xbal and the resulting fragment transferred to pDEF24 and transformed into DH5a competent cells.
  • the complete DNA encoding the ACAM#4/IgGl protein is set forth in SEQ ED NO:20, and the amino acid sequence ofthe ACAM#4 region ofthe encoded fusion protein is set forth in SEQ ID NO:21.
  • the complete DNA encoding the ACAM#4/IgG4 protein is set forth in SEQ ID NO:22, and the encoded protein sequence is set forth in SEQ ED NO:23, wherein the ACAM#4 portion consists of amino acids 1-330.
  • ICAM-l/IgG4 fusion protein was generated in pDEF24 as described above, for use as a control in the adhesion experiments (Examples 7 and 8, below).
  • DNA encoding ICAM-1 signal peptide and five extracellular domains were purified from ICAM- 1/IgGl in PDC 1 by digestion with Hindlll and Sal 1. The resulting fragment was purified and ligated to pDEF2S/IgG4. Then the plasmid was digested with Notl and Xbal and the resulting fragment was ligated to pDEF24, and transformed into DH5a competent cells (Gibco BRL).
  • the final plasmid insert encoded a fusion protein (SEQ ED NO: 24), wherein the signal peptide and the five extracellular domains of ICAM-1 (amino acids 1-480) are in frame with the hinge and constant CH2-CH3 domains of EgG4.
  • the portion ofthe plasmid insert encoding the ICAM-1 region is set forth in (SEQ ID NO:25).
  • the VCAM-1/IgGl fusion was generated using a DNA
  • the pDEF24 constructs were transfected into DG44 CHO cells.
  • DG44 cells are deficient in dihydrofolate reductase (DHFR) and therefore require hypoxanthine and thymidine in the culture media to grow. Because the dhfr gene is present in the pDEF24 vector, DG44 cells that contain pDEF24 chimeras will grow in selective culture media that does not contain either hypoxanthine or thymidine, whereas DG44 cells that do not contain the plasmid will die in the same media.
  • DHFR dihydrofolate reductase
  • the DG44 CHO cells were transfected by electroporation as described below. Briefly, 50 ⁇ g of linearized ACAM#6/Fc/pDEF24, ACAM#4/Fc/pDEF24, or ICAM-l/Fc/pDEF24 plasmid DNA was resuspended in 800 ⁇ L HBS buffer (20mM
  • the cells were incubated for lOmin at room temperature, pelleted, resuspended, and grown in non-selective media (lOmL DMEM/F12, 10% dialyzed FBS, 2mM L-glutamine, 1 OOU/mL penicillin, lOO ⁇ g/mL streptomycin with lOO ⁇ M sodium hypoxanthine, and 16 ⁇ M thymidine) for two days.
  • non-selective media lOmL DMEM/F12, 10% dialyzed FBS, 2mM L-glutamine, 1 OOU/mL penicillin, lOO ⁇ g/mL streptomycin with lOO ⁇ M sodium hypoxanthine, and 16 ⁇ M thymidine
  • the non-selective media was replaced by selective media without hypoxanthine or thymidine, and cells were cultured until selection
  • the immunoglobulin fusion proteins prepared herein are secreted proteins. Accordingly, culture supernatants were harvested, filtered through a 0.2 ⁇ m filter, and stored at 4°C until protein purification. The proteins were then recovered from supernatant using a Prosep® Protein A column (BioProcessing LTD). The column was equilibrated with at least lOOmL of 1M glycine, 0.15M NaCl, pH8.6 buffer using an Econo® System (Biorad). Then CHO supernatant was loaded on the column at a rate of lmL/min.
  • the column was washed with at least lOOmL ofthe same buffer as above and the protein was eluted using lOOmM citric acid pH3.0 directly into neutralizing 1M Tris pH9.0.
  • the eluted protein was dialyzed against calcium- and magnesium-free phosphate buffered saline (CMF-PBS) for at least 24 hr with at least three changes of buffer using 10,000 MW cut off SnakeSkinTM dialysis tubing (Pierce). Dialyzed protein was concentrated when necessary using a
  • VLA-4 VLA-4
  • ICAM-1 and VCAM-1 respectively.
  • the adhesion assay was earned out simultaneously on immobilized ICAM-1/Fc (IgG4) and VCAM-1/Fc (IgGl) chimeras, prepared as described in Example 5 Immobilized LgG4 was used as a negative control
  • Adhesion assays were performed in 96-well Easy Wash plates (Corning) using
  • VCAM-1/Fc, and purified IgG4 (Sigma), all from stock solutions at 5 ⁇ g/mL in 50mM bicarbonate buffer (pH 9 6)
  • Some wells were coated with anti-human CD49d (72A1H, ATCC# HBl 1523, ICOS Corp , Bothell WA) to quantitate binding of 100% of input cells, or BSA to determine the background binding Plates were blocked with 1%) BSA in phosphate buffered saline (PBS) for one hour at room temperature, rinsed
  • PBS phosphate buffered saline
  • adhesion buffer 5% FBS in RPMI
  • PMA phorbol myristate acetate
  • ACAM#6 is indeed an adhesion molecule and that it is capable of binding T-cell line Jurkat J77 mainly through a CD49d/CD29 adhesion pathway.
  • adhesion assays were performed using immobilized ACAM-6/IgG4 and ACAM-4/IgG4 or ACAM-4/IgGl chimeras as described in Example 7.
  • Cells tested for adhesion included hematopoietic human
  • adhesion assays were performed on ACAM#4/IgG4 or ACAM#4/IgGl coated plates that showed no difference in cell binding.
  • CD49d mAb 72A1H, ICOS Corp., ATCC# HBl 15283 when Jurkat, JY, and HL60 were assayed, or with human CD29 mAb (3 S3, John Wilkins) when Hela, CHO or 293 T were tested.
  • Adhesion assays were carried out in 96-well plates as described before. To determine whether the cell binding was cation dependant, assays were performed with or without 10 mM EDTA and in order to check the specificity of cell binding, blocking antibodies were added to the adhesion buffer at 20 ⁇ g/mL when used alone or 10 ⁇ g/mL each when used in combination. In addition, the monoclonal ACAM antibodies were tested for a putative blocking function in the adhesion assays. Binding experiments confirmed that ACAM functions as an adhesion molecule:
  • ACAM#6 splice variant conferred different adhesion properties relative to ACAM#4
  • adhesion assays were performed using either ACAM#4/IgG4 or ACAM#6/IgG4 with the various cell types. Levels of adhesion were identical for both chimeras with all cell lines except CHO cells. After addition of EDTA to the adhesion media, levels of binding of CHO cells to ACAM#6/IgG4 were lower than observed for ACAM#4/IgG4. This result indicated that the extra domain might confer additional integrin binding properties to ACAM#6 in relation to ACAM#4.
  • CD29 ( ⁇ j ), CD18 ( ⁇ 2 ), CD61
  • the JY B cells express high levels of CD 11 a /CD 18 (LFA- 1 ) and
  • CD49d/CD80 ( ⁇ 4 / ⁇ 7 ), a lower level of CD61, but no CD29 integrins. Basal levels of JY cell adhesion were high on ACAM chimeras and increased after phorbol-ester stimulation. Both were completely blocked by addition of EDTA. The adhesion of JY stimulated by PMA was partially blocked (-40%) with human CD 18 mAbs (23F2G, ATCC# HBl 1081; 22F12C, ICOS Corp.) and human CD1 la antibodies (TS1/22,
  • JY cells bind to ACAM through a cation-dependent mechanism that involves several integrins, at least CD 18 and CD61 and blocking might be achieved by adding other integrin antibodies.
  • the mAbs used in the assays were shown to block integrin/ICAM-1 or integrin/VCAM-1 interaction and may not be able to block a different integrin binding site to ACAM.
  • HL60 cells express CD49d/CD29 ( 4 / ⁇ j , VLA-4), CDl la/CD18 (LFA-1), and CD1 lb/CD18 (Mac-1) but not CD61 or CD80.
  • Levels of HL60 binding to ACAM were lower with or without PMA stimulation than that observed with other cell types. Adhesion was almost completely inhibited with human CD29 (3 S3, John Wilkins) and CD 18 mAbs (23F2G, ATCC# HBl 1081) and partially inhibited with human CD49d (72A1H, ICOS Corporation) and CD l ib mAbs (44AACB, ATCC). Therefore, binding of HL60 to ACAM is mediated through an integrin dependant pathway and by more than one beta chain.
  • Hela cells were the third cell type that showed evidence of integrin dependent binding. Hela cells express high levels of CD29, lower levels of CD61 but not CD 18
  • CD80 Amongst the possible alpha chains that associate with CD29, Hela cells express CD49b/CD29 ( 2 / ⁇ VLA-2) and CD49e/CD29 ( 5 / ⁇ 1; VLA-5). PMA stimulation did not enhance Hela cell binding to ACAM. Adhesion of resting Hela cells to ACAM was cation-dependent and completely blocked by human CD29 mAb
  • ACAM binds to Hela cells mostly through CD49e/CD29 but also to a lower extent through a CD49b/29 pathway while after PMA stimulation additional adhesive interactions are activated. Therefore, ACAM binds to cells through an integrin dependant pathway that involves at least ⁇ j and ⁇ 2 integrins. This broad specificity suggests a binding motif on ACAM that is broadly recognized by various integrins.
  • the second type of adhesion that we observed with Jurkat and 293 T was not inhibited by EDTA.
  • the strong binding of Jurkat to ACAM was not affected by PMA stimulation and although Jurkat cells express CD 11 a/CD 18 (LF A- 1 ) and CD49d/CD29 binding could not be blocked by CD49d (72A1H, ICOS Corp.), CD18 (23F2G, ATCC# HBl 1081), CD29 mAb (3S3, John Wilkins) and CD1 lb mAbs (TS1/22, ATCC).
  • CD49d 72A1H, ICOS Corp.
  • CD18 23F2G, ATCC# HBl 1081
  • CD29 mAb 3S3, John Wilkins
  • CD1 lb mAbs TS1/22, ATCC
  • the erythroleukemia cell line K562 did not bind ACAM chimera with or without EDTA. Interestingly, when the adhesion experiment was performed in the
  • ACAM mAbs 339V and 339T cell binding to ACAM was observed, whereas in contrast, no cell binding was triggered by 339R and 339P.
  • Integrins are widely expressed in the central and peripheral nervous systems by the neurons themselves and by glial or infiltrating cells. For example, ⁇ ; integrins are expressed by neurons and promote adhesion and growth cone motility and therefore very likely to modulate axon guidance and proper synapse formation during development. Moreover, integrins are expressed by Schwann cells, and could mediate myelination and speed of nerve conduction in peripheral nerves. Both axon guidance and myelination could lead to a therapeutic use of modulators of ACAM function or expression during nerve regeneration. Recent findings indicate that integrin play a critical role in the synaptic plasticity that underlay learning and memory.
  • Beta-1 integrin is highly enriched in post-synaptic fractions and is a potential ligand for ACAM. Therefore, ACAM could play also a role in memory by stabilizing synapses.
  • ACAM present at the surface of neurons can bind a large variety of cell types within both the central and peripheral nervous system through at least its integrin pathway and presumably its cation independent pathway. Both interactions could also mediate functional relations between neurons and peripheral tissues or inflammatory cells.
  • Antibodies to ACAM may be produced by any method known in the art typically including, for example, the immunization of laboratory animals with preparations of purified native ACAM, purified recombinant ACAM, purified
  • regions ofthe polypeptide may be selected for use as an immunogen based upon differences in those regions between ACAM and other members ofthe immunoglobulin superfamily. These regions can be expressed as truncated polypeptides in an appropriate expression system for use as immunogen or to test polyclonal or monoclonal antibody preparations. Similar approaches can be applied to other regions ofthe ACAM polypeptide. Likewise, synthetic peptides can be made to correspond to various regions of differences and such peptides can be utilized to generated specific polyclonal or monoclonal antibodies by methods known in the art. For examples and details of conventional methods, see discussions in Harlow et al (Eds.), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor NY (1988).
  • mice were prebled on day 0 and immunized by subcutaneous injection with 50 ⁇ g per mouse of acam#4/IgG4 (SEQ ID NO:21) in complete Freund's adjuvant. On Days 21 and 42, each mouse was boosted with 25 ⁇ g of protein in incomplete Freund's adjuvant. Test bleeds were drawn on day 51 and reactivity determined by ELISA against individual chimeras. Serum from all ofthe mice showed a good reactivity to ACAM#4 protein. A pre-fusion boost was
  • the spleen of mouse 3320 was removed aseptically and a single-cell suspension of splenocytes was fused to NS-1 cells in a ratio of 5:1 by standard methods using polyethylene glycol 1500 (Boehringer Mannheim).
  • the fused cells were resuspended in 200 mL RPMI containing 15% FBS, 100 mM sodium hypoxanthine,
  • ACAM#4 chimeras by ELISA as follows. Immulon® 4 plates (Dynex, Cambridge MA) were coated at 4°C with 50 ⁇ L/well ACAM#4/IgG4 at 2 ⁇ g/mL in 50 M carbonate buffer, pH 9.6. Control wells were coated with an irrelevant IgG4 protein. Plates were washed three times in PBS with 0.05% TWEEN® 20 (PBST) and 50 ⁇ L culture supernatant was added.
  • PBST 0.05% TWEEN® 20
  • HRP horseradish peroxidase
  • Fc goat anti-mouse IgG
  • mice were immunized with ACAM#6/IgG4 (Fusion # 339) following the same procedure described above for the generation of antibodies to ACAM#4.
  • Mice were immunized with the ACAM#6/IgG4 fusion protein (SEQ ID NO: 17) at day 0, and then boosted at days 21, 45, and 133.
  • An ELISA against individual chimeras showed a good reactivity against ACAM#6/IgG4 on a test bleed taken on day 161.
  • Mice were boosted again intraperitoneally on day 174 and day 175, then the spleen of mouse 3403 was removed on day 178, and a fusion performed following the procedure described above.
  • the ELISA procedure was identical to the one described above except that plates were coated with Acam#6/IgG4.
  • Four additional monoclonal antibodies were isolated and designated 339P, 339R, 339V, and 339T. All ofthe antibodies were identified as IgGl isotype. All monoclonal antibodies from Fusions 321 and 339 were tested by ELISA and recognized equally both ACAM#4 and ACAM#6 chimeras.
  • the first motif, R/KYxxRxK/EGxYxxE, is found in the N-terminal portion of the cytoplasmic domain. This peptide sequence is responsible for binding to the NF2 (neurofibromatosis type 2, Merlin) /ERM (ezrin, radixin, moesin) /protein 4.1 family of membrane-cytoskeleton linkers. These proteins contain a homologous 300 amino-acid domain, the FERM domain, and anchor the cytoskeleton at the surface ofthe cell. Glycophorin C and Neurexin bind to protein 4.1 and its Drosophila homolog Coracle 4.1 protein.
  • a second conserved peptide motif is present at the C-terminal end ofthe
  • ACAM cytoplasmic tail i.e., amino acids 421-432 of SEQ ED NO:2, that binds PDZ (PSD95/Discs large/ZO-1) domains.
  • PDZ domains are modular motif of about 90 amino acid responsible for protein/protein interaction. They are present in multi-domain proteins, used to cross-link cytoskeletal and signaling networks and organize microdomains at sites like synapses and intercellular tight junctions. The majority ofthe proteins carrying PDZ domains are involved in some aspect of signal transduction.
  • PDZ domains are one ofthe characteristics of a family of membrane-associated guanylate kinase homologs (MAGUKs). The MAGUK can be divided in several class depending on the number of PDZ and other modular domains
  • Glycophorin C binds to the p55 protein characteristic of the third
  • Glycophorin C and Neurexin IV cytoplasmic tail association with these intra-cellular ligands is to maintain cell shape and plasticity and promote communication between the cells.
  • Glycophorin C is known to regulate erythrocyte shape
  • Neurexin IV is an adhesion molecule implicated in the formation of Drosophila septate junctions, the formation of blood/nerve brain barrier, and axonal protection.
  • two types of two-hybrid assays were performed.
  • the GAL4-based two-hybrid system used ACAM cytoplasmic tail and a random brain cDNA library. Because ACAM is potentially expressed in synapses and because nNOS is particularly important as a potential therapeutic target, the second assay was between ACAM cytoplasmic tail and the PDZ domains of either neuronal nitric oxide synthetase (nNOS) or the post-synaptic density protein PSD95 using the lexA-based two-hybrid system.
  • nNOS neuronal nitric oxide synthetase
  • PSD95 post-synaptic density protein
  • the plasmids carrying each fusion protein sequence were transfected into two Saccharomyces cerevisiae strains PJ69-2A and Y187 and the plasmids brought together by mating.
  • the yeast strain cannot synthesize tryptophan and leucine, whereas these genes are carried respectively by the PAS2.1 and PACT2 vectors.
  • the yeast containing the plasmids were selected on agar plates deficient in
  • the PJ69-2A strain contained two nutritional reporter genes FLTS3 and ADE2 with unrelated promoters while the Y187 yeast strain contained a third reporter gene (lacZ) that had the same promoter as HIS3. All three promoters included an identical binding site for the GAL4 binding protein. Therefore, a successful interaction between ACAM
  • yeast clone induced a transcriptional activation and allowed the yeast clone to grow on histidine- and adenine-deficient agar plates and to activate the lacZ promoter.
  • ACAM-043 SEQ ID NO: 28
  • ACAM-045 SEQ ID NO:29
  • the 5' primer including a sequence downstream ofthe stop codon at the 3' end.
  • ACAM#6 cDNA (SEQ ID NO: 1) was used as a template in the PCR reaction.
  • ACAM-043 ATTAGGATCCTCGGCCACTACTTGATCC (SEQ ID NO28)
  • ACAM-045 TTAAGTCGACGGTACCCTGCGGTTGCTCTGTAC
  • the amplification product was digested with BamHl and Sail and cloned into the pAS2-l vector in frame with the Gal4 DNA binding domain.
  • the target library was prepared from the whole brain of a 37 year old Caucasian male, Xhol-(dT) 15 -primed and directionally cloned into pACT2 as a fusion with the Gal4
  • Brain cDNAs amplified by PCR were then purified using Wizard PCR purification kit (Promega) and the 5' and 3' ends sequenced using the PACT- AD 1 and PACT-AD2
  • E. coli KC8 electrocompetent cells (Clontech) according to the manufacturer's protocol.
  • the KC8 bacteria are leucine- and tryptophan-deficient and therefore were used to select the brain cDNAs in PACT2 plasmid by growth on agarose ampicillin plates that did not contain leucine.
  • the strength of interaction as predicted by the two-hybrid approach generally correlates with that determined in vitro. This allowed a discrimination of high and low affinity interaction between ACAM cytoplasmic tail and the fusion protein isolated by the two-hybrid assay.
  • High affinity interaction with strong activation ofthe reporter gene promoters was defined by strong growth on selective plates and by the intensity and speed (less than 60 min ) of coloration change in the filter-lift assay.
  • the first group of proteins included clones designated 9ar, 8b, 11a, and 8a, which formed large colonies and gave an intense blue coloration in the filter-lift assay
  • CASK calcium/calmodulin-dependent serine protein kinase
  • clone 9ar was 100 % homologous to the human calcium/calmodulin-dependent serine protein kinase CASK/LEN-2.
  • CASK is the human homolog of C. elegans protein lin-2, of Drosophila CAMguk, and rat CASK (Accession No: 4502567). This protein is a very likely ligand in vivo for ACAM for
  • CASK belongs to the MAGUK family, it has calcium/calmodulin, SH3, and
  • CASK binds protein 4.1 -like protein p55. Protein 4.1 binds the cytoplasmic
  • N4.1 neuronal form of protein 4.1
  • ACAM cytoplasmic tail
  • CASK CASK
  • Human CASK belongs to class
  • CASK is highly enriched in neurons in pre-synaptic membranes, associated with Mintl, a vesicular trafficking protein and veli, another PDZ carrying molecule. All three molecules form a tight protein complex that uses its PDZ domains to recruit cell surface and signaling molecules.
  • One cell surface receptor that is recruited by the complex is a neuronal calcium channel that binds the PDZ domain of Mintl and to the SH3 domain of CASK leaving the PDZ domain of CASK available for binding. Therefore, ACAM could stabilize and localize this complex at the cell membrane and improve the efficiency of synaptic transmission [Butz et al, Cell 94(6):773-82 (1998)].
  • CASK is also a binding partner for syndecans 1-4 that are developmentally regulated and distributed in synapses and axons. Therefore, ACAM could be involved in the synaptic and in the non-synaptic localization of these molecules and subsequently in the regulation of synaptic plasticity [Hsueh et al, J Neurosci 19(17):7415-25 (1999)].
  • a second strongly interacting target sequence, clone 8b (SEQ ED NO:33), is a novel molecule 40% homologous to a human protein tyrosine phosphatase, PTPL1 (Accession No. 515030). PTPL1 has homologies with protein 4.1, contains five PDZ
  • PTPL1 can bind Fas and may be involved in cellular apoptosis.
  • a third strongly interacting target, clone 1 la (SEQ ID NO:43), is 100%
  • a fourth strongly interacting target, clone 8a (SEQ ID NO:34), is 100 % homologous to a serine protease that contains an insulin growth factor binding motif (Accession No. 4506141).
  • the fifth target clone la (SEQ ID NO:35) had some homology (-30%) to a fragment of human aczonin (Accession No. CAB60727), a large protein that contains a PDZ domain and is also a synaptic scaffolding protein.
  • a sixth target, clone 13a corresponds to the transmembrane 4 superfamily member 2 (Accession No. 4759236), a marker of T-cell acute lymphoblastic leukemia antigen and neuroblastoma without known function [Emi et al,
  • nNOS nitric oxide synthetase
  • nNOS has a unique N-terminus PDZ domain and binds PSD95, "scaffolding"
  • PSD95 proteins expressed in neurons.
  • PSD95 localizes nNOS to the NMDA receptor at the synapse and that disruption of this interaction protects neurons from injury in rat models of
  • a two-hybrid assay was carried out between the PDZ domains of nNOS and PSD95 and the cytoplasmic domain of ACAM. The two-hybrid assay was carried out according to published procedure
  • ACAM cytoplasmic tail was generated by PCR using the same technique as described before with primers ACAM-043 (SEQ ID NO:28) and ACAM-045 (SEQ ID NO:29).
  • the amplification product was digested with BamHl and Sail or Asp718 and cloned into vectors PBTM1 and PVP16 in order to express
  • ACAM as a fusion protein with respectively the lexA DNA binding and activating domains. These constructs were used in combination with the PDZ domain of nNOS
  • nNOS PDZ domain was generated by PCR using the 5 ' nNOS primer
  • nNOS 5' primer ACGCGTCGACCTATGGAGGATCACATGTTC
  • PSD95 domain was generated by PCR also using the 5' PSD95 primer (SEQ ID NO: 1
  • PSD95 5' primer ATAAGAATGCGGCCGCTAAGCGATGATCGTGACCGT
  • S. cerevisiae yeast strain L40 was transformed with the plasmids in several combinations: i) nNOS/PBMTl with ACAM/PVP16;
  • ACAM/PBTM1 with PSD95/PVP16 ii) ACAM/PBTM1 with PSD95/PVP16; iii) nNOS/PBTMl and PSD95/PVP16 as a positive control; and iiii) ACAM/PVP16 with PBTM1 vector or ACAM/PBTMl with PVP 16 vector negative controls.
  • a positive interaction between the fusion proteins was evaluated by selection of the transformed yeast on agar plates deficient in histidine, leucine and tryptophan (triple drop-out) while selection on plates deficient in leucine and tryptophan was carried out as a control of transformation efficacy.
  • the presence of colonies on the triple drop-out plates indicated a positive interaction between nNOS and ACAM cytoplasmic tail while no interaction was found between PSD95 and ACAM. Therefore, ACAM bound to the PDZ domain of nNOS in this two-hybrid experiment.
  • ACAM cytoplasmic tail binds to essential elements of neurons: ACAM could be binding the CASK/Mintl/Veli complex and calcium channels to the cell surface, to stabilize synaptic structure and insure the speed and efficacy of synaptic transmission. Therefore, ACAM may be expected to be useful as a therapeutic target for diseases of the nervous system as varied as: epilepsies, by stabilizing synaptic transmission;
  • CASK is located at chromosome Xpl 1 4, a locus related to X-linked optic atrophy Therefore, ACAM may play an indirect role in this disease and modulators of ACAM expression or activity could be used as therapeutic agent [Dimitratos et al , Genomics 51(2) 308-9 (1998)]
  • ACAM binds to the cytoskeleton and to signaling molecules and therefore is very likely involved in the regulation of motion within the neurons axons and synapses, that is neuronal polarity and nervous system development Therefore, it could be also
  • peripheral neuropathies like diabetes
  • ACAM binds to nNOS in vitro and subsequently could regulate the interaction between nNOS and another PDZ carrying protein PSD95
  • PSD95/nNOS is bound to the cell surface NMDA receptor, that trigger intracellular signaling pathways responsible for neuronal development, spasticity, senescence, and neurotoxicity
  • ACAM indeed regulates PSD95/nNOS binding, ACAM or agonists of ACAM expression or activity could be used as a therapeutic agent in diseases like stroke to protect the neurons.
  • phase 1 and phase 2 clones are both unfinished and may include gaps, but while in phase 1 the contigs may be unordered and unoriented, in phase 2 the contigs are ordered and oriented. Phase 3 sequences are finished, without gaps (with or without annotations).
  • the HS134P22 human clone is in phase 1 of sequencing, it is 119,916 bp long, and is constituted by 3 contigs: Contig # 01539 (41718 bp), followed by Contig # 01210 (19743 bp), then by Contig # 00604 (56855 bp).
  • ACAM exons present in HS134P22 were identified in the second and third
  • the HS134P22 DNA sequence was used as a query in a search of potential exons using several gene prediction computer programs created by the Computational Genomic group at the Sanger Center. The various programs available from the Sanger
  • exons have a higher likelihood of being accurate if two or more different programs agree in their prediction.
  • One ofthe programs FGENESH (based on Hidden Markov Model) was able to predict accurately ten exons corresponding to the known ACAM#4 and ACAM#6 sequences, and was further able to identify four potential additional exons.
  • Exon 1 encodes for the leader sequence and is followed by four potential exons, numbered 2 to 5, and then by exon 6, which encodes the extra domain present in domain 1 of
  • Each ofthe three subsequent immunoglobulin-like domain results from the splicing of two exons, each encoding approximately half of the domain: exons 7 and 8 for the first domain, exons 9 and 10 for the second domain, and exons 11 and 12 for the third domain.
  • Exon 13 encodes the transmembrane region
  • exon 14 encodes the cytoplasmic tail.
  • the HS134P22 clone is constituted of three contigs separated by gaps of
  • the first six ACAM exons plus exons 15 and 16 are located on
  • ACAM#4 and ACAM#6 Two ACAM cDNAs have been cloned, designated herein ACAM#4 and ACAM#6, that result from the splicing of respectively nine and ten exons ofthe
  • ACAM gene The identification of additional potential exons supports the hypothesis that other ACAM variants are possible
  • ACAM mAbs were used to analyze ACAM expression in human and non-human tissues Frozen human tissues were obtained from the National Disease Research Interchange (NDRI, Philadelphia, PA) Human paraffin-embedded tissue were obtained from Novagen and included samples of brain (cortex, thalamus, corpus callosum, cerebellum, mesencephalon, pons, medulla, spinal cord, and peripheral
  • lymph node lymph node
  • thymus tonsil
  • appendix endocrine
  • endocrine pancreas, ovary, testis, prostate, adrenal, pituitary, and thyroid
  • muscle heart and skeletal muscle
  • Frozen tissues were embedded in OCT (Tissue-Tek), sectioned, layered onto Superfrost microslides (Erie Scientific, West Chester PA) and fixed in acetone Formalin-fixed tissue sections were prepared and deparaffinized tissue using standard procedures. Sections were incubated in 0.33 % H 2 O 2 (Sigma), 0.1% NaN 3 (Sigma) in Tris buffered saline (TBS) for 15 min to remove endogenous peroxidase activity. When labeled with ACAM mAbs, formalin-fixed tissue sections were placed in 98 °C 10 mM Citrate buffer pH 6.0, microwaved (Energy Beam) twice for 5 min each at
  • DAB tetrahydrochloride
  • ACAM mAbs strongly labeled the nerve processes ofthe molecular layer; staining was less intense in the granular layer, and was least intense in the cerebellar white matter.
  • the Purkinje cell cytoplasm did not stain with ACAM mAb.
  • the optic nerve and the nerve processes of the ganglion cell layer, outer plexiform layer, and inner plexiform layer ofthe retina stained strongly with ACAM mAbs.
  • ACAM mAbs strongly labeled the axons of peripheral nerves and nerve fibers within all normal tissue examined including spleen, tonsil, stomach, intestine, pancreas,
  • liver testis, ovary, heart, skeletal muscle, skin, lung, aorta, artery, and kidney.
  • the staining pattern observed with the ACAM mAbs were compared with the synaptic and neuronal staining obtained with synaptophysin and Neu N mAbs.
  • the expression patterns of ACAM and synaptophysin were strikingly similar in the gray
  • synaptophysin labeling observed in the gray matter was very similar to ACAM staining.
  • synaptophysin mAbs did not label neurons in the white matter or nerve roots.
  • synaptophysin staining was seen at the periphery of some Schwann cells and did not overlap with
  • ACAM staining In addition, analysis of ACAM expression using FITC-labeled secondary antibody and confocal microscopy demonstrated that ACAM is localized to the outer membrane ofthe peripheral nerve axon. In contrast, the staining pattern with the neuron marker Neu N, which labels the neuron cytoplasm, did not overlap with that ofthe anti-ACAM antibodies. These results suggest that ACAM is expressed at the synapse as well as on the surface of axons, but is not expressed within the cytoplasm of neurons.
  • both antibodies strongly labeled the neurohypophysis and, interestingly, labeled the cytoplasm of a subset of cells in the adenohypophysis that
  • mAbs recognized ACAM expressed in rabbit, dog, and monkey but do not cross into rodents.
  • ACAM expression was also detected by both antibodies in a few additional cells.
  • ACAM staining was found in Hassel's corpuscles ofthe thymus, in rare cells ofthe lamina basement and in some areas ofthe mucosal and glandular epithelium ofthe digestive tract, and in some endothelial cells in the thymus and the appendix. This inconsistent punctate perinuclear staining of endothelial and epithelial cells in a variety of tissues suggests that ACAM may also be expressed in these cell types.
  • antibody 32 ID occasionally exhibited a staining pattern different from that of 32 IE, with some punctate staining in several areas ofthe nervous system, placenta, urinary bladder, prostate, and spermatozoa. These different staining patterns between 32 ID and 32 IE could be due to a number of reasons including different affinity ofthe antibodies for ACAM epitopes, differential expression ofthe epitopes recognized by each antibody, or cross-reactivity to non- AC AM epitopes.
  • ACAM expression is predominant in neurons and widespread in the central and peripheral nervous system. Comparison with synaptophysin staining and confocal analysis suggest that ACAM expression within the neurons is concentrated at
  • peripheral nerves demonstrates that the molecule is in contact with a wide range of cells and extracellular matrix components. This expression pattern is consistent with a role of ACAM in modulating synaptic plasticity, axonal polarity, and neuronal protection. Of particular interest is the ACAM expression in adenohypophysis,
  • ACAM and human cerebellum are ACAM and human cerebellum.
  • cDNAs containing the complete coding region of ACAM#4 or ACAM#6 were inserted into the pDEFlO vector and transfected into DG44 CHO cells generally as described above. Stable transfectants were selected in media without hypoxanthine/thymidine and cell expression verified by FACS staining using ACAM mAbs. A western blot was carried out on cell lysates using standard procedures. ACAM#4, ACAM#6, and vector-control CHO transfectants were lysed in cold lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl,
  • Triton® X-100 1% Triton® X-100, 5 mM EDTA, and protease inhibitors.
  • About 20 ⁇ L of lysate (-2 x 10 5 cells) was mixed 1 : 1 with 2X SDS-PAGE sample reducing buffer (0.5 M Tris-HCl, pH 6.8, 20% glycerol, 10% SDS, 0.5% bromophenol blue, and 2.5% beta-mercaptoethanol for reducing conditions), boiled for 5 min then loaded onto a 12% Novex gel. After SDS-PAGE, a Western blot was performed by sequential incubation with either ACAM 32 IE or control mAb and peroxidase-conjugated goat anti-mouse antibody. The blot was developed with ECL reagents (Pierce) according to the manufacturer's protocol.
  • ACAM mAbs and normal human cerebellum was carried out according to standard procedures. Frozen human brain cerebellum (-0.5 g) was lysed in the same buffer as described above. Tissue lysate (1.5 mL) was precleared by incubation for 3 hr with rabbit anti-mouse Ig (Calbiochem) coupled to Protein G Sepharose® (Pharmacia). The precleared lysate was incubated overnight with either ACAM 32 IE mAb or with isotype-matched control MOP-C mAb (Sigma), 10 ⁇ g each. The following day, rabbit anti-mouse Protein G Sepharose® beads were added to the samples for 1 hr. All

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne une nouvelle molécule d'adhésion, appelée ACAM, et ses procédés d'utilisation. L'invention concerne également le polypeptide ACAM, les polynucléotides codant ACAM, ainsi que des procédés d'utilisation de ces polynucléotides permettant de transformer des cellules hôtes afin qu'elles expriment le polypeptide, et des procédés de sélection de modulateurs putatifs de l'activité ou de l'expression ACAM. Cette invention permet en outre d'obtenir des anticorps spécifiquement immunoréactifs au polypeptide ACAM et des lignées cellulaires produisant de tels anticorps.
PCT/US1999/028878 1998-12-02 1999-12-02 Nouvelle molecule d'adhesion et procedes d'utilisation WO2000032633A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU25880/00A AU2588000A (en) 1998-12-02 1999-12-02 Novel adhesion molecule and methods of use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US20346298A 1998-12-02 1998-12-02
US09/203,462 1998-12-02

Publications (1)

Publication Number Publication Date
WO2000032633A1 true WO2000032633A1 (fr) 2000-06-08

Family

ID=22754116

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/028878 WO2000032633A1 (fr) 1998-12-02 1999-12-02 Nouvelle molecule d'adhesion et procedes d'utilisation

Country Status (2)

Country Link
AU (1) AU2588000A (fr)
WO (1) WO2000032633A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001079498A2 (fr) * 2000-04-18 2001-10-25 Millennium Pharmaceuticals, Inc. 16051a and 16051b codant pour des membres de la famille pdz humains et leurs utilisations
EP1222205A1 (fr) * 1999-10-18 2002-07-17 Texas Biotechnology Corporation Polynucleotides codant pour des proteines humaines et murines (bigr)
US6512095B2 (en) 1998-08-07 2003-01-28 Immunex Corp. Molecules designated B7L-1
WO2007146188A2 (fr) 2006-06-07 2007-12-21 The Board Of Trustees Of The Leland Stanford Junior University Thérapie de recrutement anti-leucocytaire pour le traitement de crises épileptiques et de l'épilepsie
EP1918299A1 (fr) * 2006-11-03 2008-05-07 Universite De Geneve Modulateurs de molécules d'adhésion cellulaire et leur utilisation

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998044113A1 (fr) * 1997-03-28 1998-10-08 Genetics Institute, Inc. Proteines secretees et polynucleotides les codant
WO1999014328A2 (fr) * 1997-09-17 1999-03-25 Genentech, Inc. Polypeptides secretes et transmembranaires et acides nucleiques les codant
EP0939124A2 (fr) * 1998-02-24 1999-09-01 Smithkline Beecham Plc Séquences de la MBGP1
WO2000008057A2 (fr) * 1998-08-07 2000-02-17 Immunex Corporation Molecules designees b7l-1
WO2000008158A2 (fr) * 1998-08-07 2000-02-17 Immunex Corporation Molecules designees ldcam
WO2000015796A2 (fr) * 1998-09-16 2000-03-23 Genentech, Inc. Polypeptides secretes et transmembranaires et acides nucleiques codant pour ces polypeptides

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998044113A1 (fr) * 1997-03-28 1998-10-08 Genetics Institute, Inc. Proteines secretees et polynucleotides les codant
WO1999014328A2 (fr) * 1997-09-17 1999-03-25 Genentech, Inc. Polypeptides secretes et transmembranaires et acides nucleiques les codant
EP0939124A2 (fr) * 1998-02-24 1999-09-01 Smithkline Beecham Plc Séquences de la MBGP1
WO2000008057A2 (fr) * 1998-08-07 2000-02-17 Immunex Corporation Molecules designees b7l-1
WO2000008158A2 (fr) * 1998-08-07 2000-02-17 Immunex Corporation Molecules designees ldcam
WO2000015796A2 (fr) * 1998-09-16 2000-03-23 Genentech, Inc. Polypeptides secretes et transmembranaires et acides nucleiques codant pour ces polypeptides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PERERA I.Y. ET AL.: "Structure and expression of the Arabidopsis CaM-3 calmodulin gene", PLANT MOLECULAR BIOLOGY, vol. 19, July 1992 (1992-07-01), pages 649 - 664, XP000891846 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7939640B2 (en) 1998-08-07 2011-05-10 Immunex Corporation Antibodies that bind B7L-1
US6512095B2 (en) 1998-08-07 2003-01-28 Immunex Corp. Molecules designated B7L-1
EP1222205A1 (fr) * 1999-10-18 2002-07-17 Texas Biotechnology Corporation Polynucleotides codant pour des proteines humaines et murines (bigr)
EP1222205A4 (fr) * 1999-10-18 2004-03-31 Texas Biotechnology Corp Polynucleotides codant pour des proteines humaines et murines (bigr)
WO2001079498A3 (fr) * 2000-04-18 2002-05-30 Millennium Pharm Inc 16051a and 16051b codant pour des membres de la famille pdz humains et leurs utilisations
WO2001079498A2 (fr) * 2000-04-18 2001-10-25 Millennium Pharmaceuticals, Inc. 16051a and 16051b codant pour des membres de la famille pdz humains et leurs utilisations
EP2029164B1 (fr) * 2006-06-07 2015-12-23 The Board of Trustees of the Leland Stanford Junior University Thérapie de recrutement anti-leucocytaire pour le traitement de crises épileptiques et de l'épilepsie
WO2007146188A2 (fr) 2006-06-07 2007-12-21 The Board Of Trustees Of The Leland Stanford Junior University Thérapie de recrutement anti-leucocytaire pour le traitement de crises épileptiques et de l'épilepsie
EP3042668A1 (fr) * 2006-06-07 2016-07-13 The Board of Trustees of the Leland Stanford Junior University Thérapie de recrutement anti-leucocytaire pour le traitement de crises épileptiques et de l'épilepsie
US9480741B2 (en) 2006-06-07 2016-11-01 The Board Of Trustees Of The Leland Stanford Junior University Anti-leukocyte recruitment therapy for the treatment of seizures and epilepsy
EP3461499A1 (fr) * 2006-06-07 2019-04-03 The Board of Trustees of The Leland Stanford Junior University Thérapie de recrutement anti-leucocytaire pour le traitement de la récurrence de crises épileptiques
WO2008053049A1 (fr) * 2006-11-03 2008-05-08 Universite De Geneve Modulateurs de molécules d'adhésion cellulaire et leur utilisation
EP1918299A1 (fr) * 2006-11-03 2008-05-07 Universite De Geneve Modulateurs de molécules d'adhésion cellulaire et leur utilisation

Also Published As

Publication number Publication date
AU2588000A (en) 2000-06-19

Similar Documents

Publication Publication Date Title
US6372899B1 (en) Purified genes encoding mammalian cell surface antigens; proteins and antibodies
EP0577752B1 (fr) Receptor humain pf4a et leur utilisation
CA2143491C (fr) Nouveau peptide lie a l'apoptose humaine et adn codant ledit peptide
CA2118309C (fr) Antigene hb15 d'activation lymphocytaire appartenant a la superfamille des immunoglobulines
US5710262A (en) Nucleic acid encoding HB15 polypeptides
JPH10512453A (ja) ヒト インターロイキン−１ レセプター アクセサリータンパク質
US20070065875A1 (en) NTB-A, a surface molecule involved in natural killer cells activity
US20090005304A1 (en) Human KCNQ5 potassium channel, methods and compositions thereof
WO1995029236A9 (fr) Antigenes d'activation de lymphocytes et anticorps correspondants
JP2001512017A (ja) 哺乳動物細胞膜タンパク質；関連試薬
US5753502A (en) Neuron-specific ICAM-4 promoter
AU2002325333A1 (en) NTB-A, a surface molecule involved in natural killer cells activity
CA2565524A1 (fr) Variante d'epissage de unc5h2
US6238875B1 (en) Diagnostic methods useful in the characterization of lymphoproliferative disease characterized by increased EPR-1
WO2000032633A1 (fr) Nouvelle molecule d'adhesion et procedes d'utilisation
US6989260B2 (en) Human poly(ADP-ribose) polymerase 2 materials and methods
WO1996020206A1 (fr) Antigene du fas secrete par l'homme
WO1996020206A9 (fr) Antigene du fas secrete par l'homme
EP0789763B1 (fr) Materiaux icam-4 et procedes
JP2003524600A (ja) 免疫関連疾患治療のための組成物及び方法
US6399065B1 (en) Methods for modulating SLAM-expressing T cells
AU3765000A (en) Dna molecules encoding human clax proteins and their soluble fusion proteins
WO1999045111A1 (fr) Materiaux de lectomedines et procedes associes
EP0956508B1 (fr) Icam-4 et ses utilisations diagnostiques
AU1117099A (en) ICAM-6 materials and methods

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase