WO1999016892A1 - Bovine herpesvirus 2 (bhv-2) based vector and its uses - Google Patents

Bovine herpesvirus 2 (bhv-2) based vector and its uses Download PDF

Info

Publication number
WO1999016892A1
WO1999016892A1 PCT/GB1998/002927 GB9802927W WO9916892A1 WO 1999016892 A1 WO1999016892 A1 WO 1999016892A1 GB 9802927 W GB9802927 W GB 9802927W WO 9916892 A1 WO9916892 A1 WO 9916892A1
Authority
WO
WIPO (PCT)
Prior art keywords
bhv
based vector
vector according
cell
expression
Prior art date
Application number
PCT/GB1998/002927
Other languages
French (fr)
Inventor
Andrew J. Bradley
W. P. H. Duffas
Original Assignee
University Of Bristol
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Bristol filed Critical University Of Bristol
Priority to AU92725/98A priority Critical patent/AU9272598A/en
Publication of WO1999016892A1 publication Critical patent/WO1999016892A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/085—Staphylococcus
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/305—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
    • C07K14/31—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/555—Interferons [IFN]
    • C07K14/57—IFN-gamma
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1267—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria
    • C07K16/1271—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria from Micrococcaceae (F), e.g. Staphylococcus
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/249—Interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16411—Rhadinovirus, e.g. human herpesvirus 8
    • C12N2710/16441—Use of virus, viral particle or viral elements as a vector
    • C12N2710/16443—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/108—Plasmid DNA episomal vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • This invention relates to a bovine herpesvirus 2 vector (bovine mammilitus virus; BHV-2)-based delivery system. More particularly, the present invention relates to a viral vector usable as a delivery system, a method for the construction of the vector and to use of the vector in a method of treatment. In particular, the invention relates to a vector for use in or as a vaccine against mastitis.
  • BHV-2 vector bovine mammilitus virus
  • Mastitis remains the most important infectious disease of the modern dairy cow, with an annual loss to the worldwide dairy industry of several billion dollars per year.
  • various estimates have been made of the cost of a case of mastitis. Calculations based on the current UK milk price (Bradley, 1998) and estimates made in the Daisy Report of 1996 would suggest a cost of between £66 and £1758 for a mild and fatal case respectively.
  • Both Gram positive and Gram negative bacteria are recognised causes of bovine mastitis.
  • Classically these organisms have been classified as either 'contagious' or 'environmental' organisms.
  • the contagious pathogens can be considered as organisms adapted to survive within the host, in particular within the mammary gland; they are capable of establishing sub-clinical infections which typically manifest as an elevation in the somatic cell count (white blood cell count) of the milk from the affected udder quarter.
  • the environmental pathogens are best described as opportunistic invaders of the mammary gland, not adapted to survival within the host; typically they will 'invade', multiply, engender a host immune response and will be rapidly eliminated.
  • the major contagious pathogens comprise Staphylococcus aureus, Streptococcus dysgalactiae and Streptococcus agalactiae, and the major environmental pathogens the Enterobacteriacae (particularly Esherichia coli) and Streptococcus uberis.
  • S. aureus is currently the most intractable, with significant numbers of quarters subclinically infected with the pathogen.
  • the disease has been controlled by a combination of two procedures aimed at the organisms within the host, the use of antibiotics and vaccines, and many procedures aimed at controlling the organisms outside the host.
  • the mammary gland is essentially a highly specialised apocrine sweat gland, of ectodermal origin and immunologically should be considered along with other mucosal surfaces.
  • the bovine mammary gland has two levels of defence; innate (non-specific) immunity and specific (aquired) immunity.
  • the innate immunity of the mammary gland is the primary defence, relied upon in the early stages of challenge and directed non-specifically at any invading pathogen. If 'overwhelmed' this defence is supplemented by specific immune mechanisms directed against individual organisms (and, in fact, against individual components of those organisms).
  • the innate immunity of the mammary gland comprises the physical barrier of the teat canal, macrophages, neutrophils, natural killer (NK) like-cells and other soluble anti-microbial substances (e.g. lactoferrin).
  • the specific mammary immunity is mediated via antibodies which by linking with the F c receptors of neutophils and macrophages can result in the phagocytosis and destruction of microbes.
  • This phagocytosis is often augmented by a similar link between complement coating the microbe and the C3 receptors on the leucocytes.
  • the ability of certain lymphocytes to 'memorise' pathogenic antigens allows the augmentation of this specific response following repeated exposure to the antigen (therein lies the theory behind vaccination).
  • the Cellular Defenses The cellular component of the mammary defence provides both innate and specific protection against infection.
  • the somatic cell count (SCC) of milk is made up of neutrophils, macrophages, lymphocytes and some epithelial cells; the 'consumer' is placing downward pressure on the SCC levels in milk which will inevitably place the innate immune system under strain, artificially increasing the importance of the specific immune response.
  • SCC somatic cell count
  • Macrophages are the main leukocytes found in the healthy mammary gland (Lee et ah, 1980; Jensen and Eberhart, 1981; Harmon and Heald, 1982; Sordillo and Nickerson, 1988).
  • Neutrophils are the main leukocytes present in the mammary gland at times of inflammation and can constitute >90% of the total cells (Paape et al. , 1981; Sordillo et al. , 1989; Sordillo et al. , 1998).
  • the specific soluble defenses (humoral response) of the mammmary gland comprise the immunoglobulins (Igs). These specific immunoglobulins interact with other non-specific soluble and cellular components of the immune system along a series of complex pathways yet to be fully elucidated.
  • IgGi, IgG 2 , IgA and IgM all have a role in the mammary immune defence.
  • concentrations of these different classes of Ig varies through the lactation with all peaking around calving - coinciding with colostrum production (Sordillo et al. , 1998).
  • IgGi is the predominant Ig in milk however there is evidence for the transport of IgG 2 by neutrophils to sites of inflammation which may make this Ig relatively more important (Musoke, Rurangirwa and Nantulya, 1987).
  • IgGi, IgG 2 and IgM have been shown to act as bacterial opsonins, increasing the efficiency of phagocytosis, and also fix complement (Howard et ah, 1980).
  • IgA in the bovine mammary gland is a subject of much debate. It may interfere with IgG or IgM mediated complement fixation and may actually enhance the binding of bacteria to fat globules (Hibbit, Craven and Batten, 1992).
  • IgA in conjunction with complement and lysosyme has been shown to have bactericidal activity against E. coli (Sordillo et al. , 1997); there is no evidence for this activity in cattle.
  • Macrophages are involved in the processing and presentation of antigen in association with major histocompatability complex (MHC) class ⁇ , a process required for the recognition of foreign antigens by lymphocytes.
  • MHC-class II major histocompatability complex
  • the lymphocytes are the cells responsible for specific recognition and 'memory' of microbial antigens. They can be divided into two groups, T-cells and B-cells. T-cells can be further subdivided into ⁇ (CD4+ and CD8+) and ⁇ lymphocytes.
  • CD4+ (T-helper) cells are primarily involved in regulating the other immune cells (e.g. lymphocytes, macrophages); a regulatory control mediated mainly via cytokines.
  • CD4+ cells are activated by recognition of antigen-MHC complexes on antigen presenting cells.
  • the ratio of CD4+ to CD8+ cells is reversed in the mammary gland as compared to the peripheral circulation (Park et ah, 1992).
  • the exact role of CD8+ cells in the mammary gland has yet to be resolved. These cells can act as 'suppressor' or 'cytotoxic' cells, and it appears the relative importance of these two phenotypes varies through the lactation cycle (Sordillo et ah, 1997).
  • Mid-lactation secretion contains a higher proportion of cytotoxic type cells and peri-parturient secretions an increased proportion of suppressor type, immunomodulatory cells (Sordillo et /.,1997).
  • CD8+ cells may also have a 'housekeeper' type function in scavenging and removing old and damaged secretory cells (Taylor et ah, 1994).
  • ⁇ lymphocytes have been the subject of much debate. They are expressed at higher levels, compared to blood, in the mammary secretions and the fact that they are found at the lowest levels when the mammary gland is at its most susceptible to disease might suggest that they play a pivotal role in the mammary immune defence.
  • Natural Killer (NK)-like cells are large, granular, non-immune lymphocytes which possess cytotoxic ability in the absence of MHC. However they can mediate antibody-dependant cell-mediated cytotoxicity (ADCC) via F c receptors.
  • ADCC antibody-dependant cell-mediated cytotoxicity
  • the importance of NK cells in protecting the mammary gland from bacterial invasion has not been fully established.
  • work by Sordillo et al (1991, 1996) demonstrated an as yet unexplained enhanced ability of lymphocytes to kill S. aureus when stimulated with IL-2, suggesting an important role in mammary defence.
  • ⁇ -lymphocytes are present in the mammary gland at relatively constant levels (Duncan et ah, 1987). Their role is to produce antibody in response to presented antigen. They can, in addition to the more classical antigen presenting cells, process and present antigen in conjunction with MHC-class II to T-cells which subsequently secrete IL-2 which in turn stimulates the B cell to divide and differentiate into antibody producing plasma cells and memory cells.
  • the cytokines are a group of biologically active peptides involved in the regulation of the immune response. They are produced by a large number of cells including lymphocytes, monocytes and macrophages. Any individual cytokine can interact with a large number of cells and other cytokines in a complex series of pathways yet to be fully understood.
  • IL-2 has been shown to increase bacteriocidal potential of lymphocytes (Sordillo et ⁇ Z.,1991), increase plasma cell numbers (Nickerson et /.,1989), enhance mammary mononuclear cell proliferation (Torre et ah, 1992) and has been shown to be an effective vaccine adjuvant (Pighetti and Sordillo, 1994).
  • TNF- ⁇ has been implicated in the mediation of endotoxic shock concomitant with coliform mastitis (Sordillo and Peel, 1992); higher levels of production of this cytokine around the time of calving may explain the increased severity of the disease at this time.
  • DFNs - ⁇ and - ⁇ are derived from leukocytes and fibroblasts whereas IFN- ⁇ is derived from activated T-lymphocytes.
  • IFN- ⁇ has a wide range of effects within the mammary gland, and has been shown to enhance neutrophil phagocytosis and bactericidal activity (Sordillo and Babiuk, 1991) as well as being demonstrated as an effective mastitis vaccine adjuvant (Sordillo et /.,1991).
  • Recombinant (r) bovine IFN- ⁇ has also been shown to up-regulate the expression of MHC-class II expression in the mammary gland from its constituitively low levels (Fitzpatrick et /.,1994).
  • rIFN- ⁇ has also been shown to reverse the suppressive effects of mammary gland secretions by significantly increasing the ability of mammary neutrophils to combat S. aureus (Sordillo and Babiuk, 1991).
  • rIFN- ⁇ has been shown to have a broad therapeutic index in the bovine mammary gland with doses as high as 10 5 U per quarter not adversely affecting milk quality or mammary gland function (Fox et ah, 1990).
  • lymphocytes immune cells
  • mucosal surfaces in particular the mammary gland
  • lymphocytes from the supramammary lymph nodes recirculate via the prescapular lymph node (Kenny, Bastida-Corcvera and Norcross, 1992).
  • Evidence from sheep suggests the existence of two discrete groups of circulating lymphocytes - a peripheral and an intestinal pool (Kenny, Bastida-Corcvera and Norcross, 1992).
  • oral administration of antigen will result in IgGi production and subsequent increases in serum and lacteal IgG levels.
  • Vaccination in the region of the supra-mammary lymphnode will stimulate both local and systemic responses by virtue of lymphocyte recirculation (Kenny, Bastida-Corcvera and Norcross, 1992), and may hold promise as a route of choice.
  • the J-5 E. coli bacterin was designed to produce neutralising activity to the toxic portion of the bacterial lipopolysaccharide (Gonzalez et ⁇ /.,1989) and is derived from the rough E. coli mutant Ol l:B4.
  • This strain is a uridine diphosphogalactose 4-epimerase deficiet mutant that has an LPS devoid of O antigen; this allows the generation of antibodies to the core region, which then show a degree of cross protection for other Gram negative organisms (Hogan et ⁇ Z.,1992).
  • a S. aureus vaccine has also been developed, and is again designed to neutralise toxin activity (Tyler et /.,1993). It is commercially available in the US but appears to be of limited value, and has yet to be subjected to widespread independant clinical trials (Tyler et ah, 1993).
  • a number of other S. aureus vaccines have been proposed in an attempt to control 'Staph' mastitis (Yoshida et ⁇ /.,1984; Frost and Mattila, 1988), and it has been postulated that capsular antigens may be of importance (Yoshida et /.,1984).
  • FnBP S. aureus fibronectin binding protein
  • herpes viridae have been recognised as potential viral vectors for some time and extensive research has been directed towards their use both as vaccines and as delivery vectors for gene therapy (Efstathiou and Minson, 1995).
  • BHN-1 has been extensively investigated and developed as a recombinant vector (Bello et al.,1992), and has been specifically investigated as a potential approach to Foot and Mouth Disease vaccination (EP-A-0471457 ⁇ ovagene, Inc. et ⁇ /., 1998; WO94/24296 University of Saskatchewan; EP 0663403 Akzo Novel N.V.).
  • IFN- ⁇ is the major cytokine inducing this effect after immunisation with the vaccinia/IL-2 recombinant (Karupiah et ah, 1990). Studies have also demonstrated the efficacy of recombinant viridae in the face of pre-existing immunity to either the vector or the heterologously expressed antigen (Flexner et ah, 1988).
  • BHV-2 is a member of the dsDNA herpesviridae family and is quite distinct from BHV-1. It is the second of five known members of the family of herpes viridae affecting cattle. BHV-2 is not the cause of any major clinical problem in cattle and there is no evidence for transmission to man in the field situation, though in vitro infection of a human respiratory cell line has been reported (May and Orders, 1993).
  • BHV-2 is one of the few non-human herpesviruses that show substantial nucleotide homology with human HSV- 1 ; the conserved regions in the HS V-2 tk (thymidine kinase) gene are more closely related to the HSV- 1, HSV-2 and VZV genes than to BHV-1 (Sheppard and May, 1989).
  • HS V-2 tk thymidine kinase
  • BHV-2 is useful as a vector on the basis of its proclivity for the mammary gland (Karupiah et ah, 1990), the relatively mild/non-existant clinical signs associated with infection (cf. BHV-1) (Turner et ah, 1976), its high prevalence in the bovine population and its narrow host range (Cilli and Castrucci, 1976) and its potential ability to carry large amounts of exogenous DNA (Efstathiou and Minson, 1995).
  • herpesvirus tendency to become latent within the host (Martin and Scott, 1979), leading to the possible scenario of re-vaccination at times of stress by reactivation of the latent virus - which would likely occur in the freshly calved cow, correlating neatly with the period of greatest risk from mastitis infection (Bradley and Green (1998).
  • the BHV-2 gene can be modified by insertion of novel restriction sites, these restriction sites will not only facilitate insertion of the heterologous DNA of interest but will also serve to insert a 'frame-shift' into the tk region further decreasing the risk of reversion of the recombinant virus to the wild-type.
  • the present invention provides a bovine herpesvirus-2 (BHV-2) based vector, that is to say a vector comprising sequences derived from BHV-2, and comprising at least one cytokine-encoding DNA sequence.
  • the vector may also comprise the entire BHV-2 genome.
  • BHV-2 is a DNA virus with a phase of post-infective latency which can be used to advantage in the vector of the present invention since reactivation will occur in times of stress by reactivation of the latent virus - which would likely occur in the freshly calved cow, correlating neatly with the period of greatest risk from mastitis infection (Bradley and Green (1998)).
  • the invention also provides delivery systems comprising BHV-2 based vectors.
  • a preferred cytokine is bovine ⁇ interferon (IFN- ⁇ ) on the basis of its ability to upregulate the low constitutive MHC Class ⁇ expression of bovine mammary gland epithelial cells which are believed to play a major role in the processing and presentation of antigen to T-cells in the mammary gland (Fitzpatrick et al.,1994), and its broad therapeutic index in the bovine mammary gland (Fox et ⁇ Z.,1990).
  • IFN-8 has also been demonstrated to be a potentially effective adjuvant in bovine mastitis vaccination (Sordillo et ⁇ Z.,1991).
  • IFN- ⁇ has also been shown to have beneficial effects against bacterial challenge, protecting against systemic manifestations of coliform mastitis in vivo (Sordillo and Babiuk, 1991).
  • Wild-type BHV-2 may be used to facilitate production of a viral vector; however, preferably only selected sequences of the BHV-2 genome are used.
  • the thymidine kinase sequence or glycoprotein sequences may be used.
  • at least a portion of the thymidine kinase (tk) sequence is used since it represents an essential virulence factor and, mutants lacking functional tk genes can be positively selected in vitro.
  • the selected gene sequence may be manipulated to allow insertion of recombinant DNA, most preferably an expression cassette expressing a cytokine gene and bacterial antigen gene. The position and sequence of the tk region of BHV-2 has been published (Sheppard and May, 1989).
  • a frame shift mutation is engineered into the vector gene sequence thereby decreasing the risk of a reversion of the vector to the wild-type.
  • the design and method of construction of the vector allows the insertion of a number of recombinant constructs which can be expressed within the host cell.
  • predetermined restriction endonuclease sites may be positioned in the DNA sequence of the vector to allow further manipulation of the vector. Most preferably, a combination of restriction endonuclease sites and frame shift mutations are engineered into the DNA sequence of the vector.
  • Genes encoding deactivation of the virus may also be introduced into the DNA sequence of the vector in order that their activation or inactivation will render the vector unviable. Examples of such genes are disclosed in Martin LA, Vile R 1997 Lancet 350 1793; Wallach, D. 1997 Nature 388 123; Hengardtner, M. Nature 1997 388 714; Jost CA Marin MC et al 1997 Nature 389 191;Franke, TF & Cantley, IC. Nature 1998 390 ,196
  • further genetic material can also be inserted into the vector in order that the vector can deliver said genetic material to the host cell.
  • genes encoding antigens or marker genes can be inserted into the vector.
  • xenobiotics such as drugs or hormones (including pro-drugs or pro-hormones) may be attached to the vector, for example by affinity binding or by chemical attachment. In this manner, the attachment of the vector to the target cells may be exploited to facilitate delivery of the xenobiotic.
  • such inserted genetic material or protein is expressed on expression of the vector in an infected host.
  • genetic material encoding proteins expressed by pathogenic bacteria may be inserted into the vector.
  • proteins include fibronectin binding protein from Staphylococcus aureus, or other core antigens or surface antigens from other pathogenic bacteria, for example Streptococcus agalactia, Streptococcus dysgalactia, Streptococcus uberis or Escherichia coli.
  • Fibronectin binding protein from Staphylococcus aureus may be used as an appropriate bacterial antigen as the gene from a human strain has been cloned, sequenced, expressed and used in pilot vaccination studies in mice which have shown production of protective antibodies (Mamo et al. , 1994).
  • the binding domains of FnBP have also been identified (Signas et ah, 1989) and it is intended to only amplify this region of the bacterial gene and then to attach this to the signal sequence of bovine ⁇ interferon in an attempt to achieve secretion of a prokaryotic protein by a eukaryotic system.
  • Such genetic material encoding antigens may be inserted singly, doubly, or as a polyvalent construct.
  • IRES Internal Ribosomal Entry Sites
  • an IRES can be used to drive expression of one or more, preferably all the antigen, marker, cytokine and viral deactivation genes from the same viral promoter.
  • Gene 'switches' may be used to control the expression of genes by the recombinant viridae, and as a potential way of re-activating latent virus. For example, if it was found to be advantageous to express two cytokines consecutively rather than contemporaneously, then the ability to vaccinate with a recombinant virus expressing one cytokine constituitively and another under the control of a switchable promoter could prove useful.
  • One such switchable promoter would be the Tet On Off system (Gossen, M. and Bujard, H. (1992). 9, 5547;Gossen, M. (1995). Science, 268, 1766). Other gene switching systems may be used. The other application for this type of system would be the re-activation of latent virus by the 'switching on' of genes responsible for recrudescence of latent virus.
  • the present invention also provides a method of manipulating a mammalian cell to express a bacterial protein. Hence, it is possible to obtain expression of prokaryotic protein in eukaryotic host.
  • the invention provides a method of expressing prokaryotic proteins in eukaryotic hosts, the method comprising inserting bacterial genetic material into viral DNA and inserting the viral DNA with bacterial genetic material therein into a eukaryotic host, such that the bacterial protein is expressed in the eukaryotic host.
  • the host may be an isolated cell, a cell culture or even a whole animal.
  • the host is a mammal, most preferably ruminants, especially cattle, sheep, goats, horses, pigs, dogs, cats and humans.
  • the invention also provides methods of treatment using BHV-2 based vectors.
  • the invention also provides recombinant viruses formed using the BHV-2 based vectors of the invention.
  • the BHV-2 based vectors of the invention may be used in the prevention or treatment of diseases in animals, particularly cattle or ruminants or other animals susceptible to infection by the wild-type pathogens such as sheep or goats.
  • the vectors of the invention may be used in the treatment or prevention of all mucosal diseases, especially, mammary diseases of mammals, more preferably ruminants especially cattle, sheep, goats, & horses; pigs, dogs, cats and humans.
  • a vaccine comprising a vector or recombinant virus according to the invention.
  • wild-type BHV-2 has been engineered to facilitate its use as a recombinant vaccine vector.
  • the thymidine kinase (tk) gene has been engineered to allow the insertion of recombinant constructs.
  • Novel restriction endonuclease sites together with frame shifts have been engineered into the tk gene thereby allowing manipulation of the genome and decreasing the risk of reversion of the recombinant strain to the wild-type.
  • the present inventors have constructed expression cassettes for insertion into BHV-2.
  • cassettes allow the production of ⁇ -interferon (by insertion of ⁇ -interferon gene) under the control of a cytomegalovirus (CMV) promoter/enhancer.
  • CMV cytomegalovirus
  • the fibronectin binding protein from Staphylococcus aureus under the control of a Rous Sarcoma virus (RSV) promoter/enhancer and the ⁇ -interferon signal sequence can be inserted into the viral genome to produce an effective vaccine against bovine mastitis.
  • RSV Rous Sarcoma virus
  • the ⁇ -galactosidase marker gene (under the control of a SV40 promoter/enhancer) has also been introduced to facilitate selection of recombinant virus in vitro.
  • the present inventors have also constructed expression vectors, both eukaryotic and prokaryotic, to enable stable, high copy number, episomal expression thus facilitating the construction of recombinant viridae usable as vectors. It is also possible to design such constructs to prevent the incorporation of antibiotic resistant genes into the recombinant virus. Recombinant viral vectors have the useful capability to carry large amounts of foreign DNA facilitating the possibility of polyvalent vaccination.
  • cytokines for example interleukin-2 (IL-2) or interleukin-4 (B -4) can be inserted into the vector for production of vaccines.
  • genes encoding for different antigens from different mastitis pathogens can be used for example Lipopolysaccharide (LPS), J5 core antigen, and other bacterial surface antigens may be used.
  • LPS Lipopolysaccharide
  • J5 core antigen J5 core antigen
  • other bacterial surface antigens may be used.
  • a combination of the BHV-2 thymidine kinase sequences and glycoprotein sequences may be used to construct a polyvalent vaccine, that is a vaccine which vaccinates against more than one pathogen.
  • a vaccine may also include sequences encoding ⁇ -interferon, as an adjuvant, and fibronectin binding protein from, for example, Staphylococcus aureus, together with promoters, for example from CMV, RSV or SV40.
  • combinations of promoters and enhancers may be varied in order to control the levels of expression of the encoded proteins.
  • a preselected combination of promoter and enhancer may provide high levels of expression.
  • the present invention provides a universal viral vector for delivering both cytokine and bacterial genes to mammals such as cattle.
  • the vector comprises BHV-2 in a replicating recombinant form which may show post-infective latency within the host animal and also has the ability of upregulating an immune response.
  • the ability of the virally infected eukaryotic host cells to produce both cytokines for example, ⁇ -interferon, interleukin-2, or interleukin-4, which up-regulate immune responses to particular immunogens, for example, fibronectin binding protein from Staphylococcus aureus, pauA of S. uberis or LPS or K85 from E.coli.
  • Such a vaccine may lead to a putatively increased immune response to a pre-selected antigen epitope.
  • the vectors of the present invention may be used in the treatment of mammary diseases, particularly breast cancers, in other mammals.
  • BHV-2 has a similar aetiology to herpes simplex viruses in humans and therefore use of this vector may extend to treatment of breast cancers in humans.
  • Methods of introducing the delivery system into a host animal include topical application, for example by excoriation, intravenous injection, mucosal application (for example oral, nasal, vaginal), subcutaneous injection, intramuscular application, supramammary application, or intramammary application.
  • topical application for example by excoriation, intravenous injection, mucosal application (for example oral, nasal, vaginal), subcutaneous injection, intramuscular application, supramammary application, or intramammary application.
  • a DNA gun may allow application of recombinant viral DNA or expression vector DNA into a host cell or animal.
  • internal ribosomal entry site sequences can be used to allow more than one recombinant protein to be expressed under the control of one promoter or enhancer.
  • variation in the combinations of promoter or enhancer may be used to vary levels of expression of the recombinant protein.
  • constitutive BHV-2 promoter sequences to control expression of recombinant proteins.
  • the recombinant virus used as the vector of the invention incorporates a marker gene, for example that encoding ⁇ -galactosidase, lucciferase or green fluorescent protein, whereby presence of the virus in the cells of the host animal can be determined by removing cells from the host animal and assessing expression of the marker gene. For example, cells expressing the ⁇ -gal gene will stain blue with ⁇ -galactosidase and can therefore be identified.
  • a marker gene for example that encoding ⁇ -galactosidase, lucciferase or green fluorescent protein
  • the invention further provides a method of determining the level of uptake of the vector by a host animal.
  • this can be used to give an indication of the efficacy of the vector system.
  • Figure 1 is a flow diagram of the steps taken in constructing the vector.
  • Figure 2 is a schematic illustration of the construction of a vector of the present invention.
  • Figure 3 is a schematic illustration of a vector constructed according to Fig. 2.
  • Figure 4 shows a sequence alignment
  • Figure 5 shows a peptide sequence alignment
  • Figure 6 shows a sequence alignment
  • Figure 7 shows a sequence alignment
  • Figure 8 shows a sequence alignment
  • Figure 9 shows a sequence alignment
  • Figure 10 shows a sequence alignment
  • Figure 11 shows a sequence alignment
  • Figure 12 shows an SDS-PAGE of products of prokaryotic over-expression
  • Figure 13 shows an SDS PAGE of purified products of prokaryotic over-expression
  • Figure 14 shows an SDS PAGE of 'wash through' prior to elution of purified products
  • Figure 15 is a graph showing the binding of bovine fibronectin to recombinant fibronectin binding protein (binding domains).
  • Figure 16 shows a western blot
  • Figure 17 shows dot blots of Mabs against recombinant protein
  • Figure 18 is a schematic illustration of the construction of recombinant pEGFP-HH-IFN.
  • Figure 19 is a schematic illustration of the recombinant pEGFP-HH-IFN.
  • Figure 20 is a schematic illlustration of the construction of the recombinant pEGFP-HH-FnBP.
  • Figure 21 is a schematic illustration of the recombinant pEGFP-HH-FnBP.
  • Figure 22 is a schematic illustration of the construction of the recombinant pIRES-IFN.
  • Figure 23 is a schematic illustration of the construction of the double recombinant pEGFP-HH-FnBP-FN.
  • Figure 24 is a schematic illustration of the recombninant pEGFP-HH-FnBP-IFN.
  • Figure 25 shows the fluorescence of Cos7 cells transfected with the plasmid pEGFP-HH-IFN.
  • Figure 26 shows the fluorescence of Cos7 cells transfected with the plasmid pEGFP-HH-FnBP.
  • Figure 27 shows the fluorescence of Cos7 cells transfected with the plasmid pEGFP-HH-FnBP-IFN;
  • Figure 28 shows a western blot
  • Figure 29 shows a western blot
  • Figure 30 shows a western blot
  • Figure 31 shows a western blot
  • Figure 32 shows a simplified plasmid map of the vectors to be used in construction of recombinant viridae
  • Figure 33 shows a simplified plasmid map of the vector to be used in construction of recombinant viridae.
  • thymidine kinase gene of bovine herpesvirus-2 (BHV-2) strain New York 1 from ATCC was cloned and sequenced with a frame shift mutation in the thymidine kinase region; such a frame shift decreases the risk of reversion to the wild-type. Restriction sites are then added to the construct. The thymidine kinase (tk) region is then opened at the Sma I restriction site. Bgl II and Sal I sites are then added to the construct. Both ends of the tk construct are then provided with Not I sites.
  • BHV-2 bovine herpesvirus-2
  • the bovine ⁇ -interferon gene is cloned using pUC 18.
  • the restriction sites Eco Rl and Hind UJ are added to either end of the ⁇ -interferon gene.
  • ⁇ -interferon is then overexpressed and monoclonal antibodies are raised against it.
  • the construct is cloned into vector pCI neo (supplied by Promega) and amplified out by a polymerase chain reaction. This produces a ⁇ - interferon cassette usable in construction of vectors.
  • the high affinity binding domain of fibronectin binding protein from Staphylococcus aureus is cloned adding the novel restriction sites Eco Rl and Xba I at either end.
  • the binding domains are then cloned into a prokaryotic expression vector were overexpressed and were used to raise monoclonal antibodies.
  • the region encoding the binding domain is then attached to the signal sequence of bovine ⁇ -interferon using the Bam HI and Eco Rl restriction sites. This construct is then cloned into an expression cassette from pRc or RSV and is already cloned into pUC18.
  • the vector can then be used to infect a host animal; for example a cow may be vaccinated against mastitis caused by Staphylococcus aureus using the vector produced above. Immunisation against the organism will be provided by the inserted fibronectin binding protein gene product, together with the regulation of the immune response provided by the bovine ⁇ interferon.
  • pUC18 contains part of the lacZ gene within which lies a multiple cloning site (MCS) into which fragments of DNA can be inserted. Insertion of a DNA fragment at the MCS disrupts the lacZ gene thereby allowing blue-white selection of colonies. E. coli clones carrying insert-containing pUC18 will appear white and E.coli clones with no inserts appear as blue colonies.
  • the pUC18 plasmid also encodes ampicillin resistance, thus only transformed E.coli cells will survive in the presence of a penicillin type antibiotic in the growth media.
  • the ColEl origin of replication ensures that the plasmid is replicated to a high copy number in E. coli making it ideal for the propagation of large amounts of insert / vector DNA.
  • the thymidine kinase gene was selected as a suitable region of the BHV-2 genome to facilitate homologous recombination of wild-type virus with the genetic material encoding the proteins of interest to be expressed by the recombinant viridae.
  • Synthetic oligonucleotides were designed, designated tkfor and tkrev, and the polymerase chain reaction (PCR) used to amplify a 1128bp fragment of the BHV-2 thymidine kinase gene. These primers were 100% homologous to the published thymidine kinase gene sequence (Sheppard, M. and May, J.T. (1989). Journal of General Virology, 70, 3067).
  • Oligonucleotides were synthesised on a PerSeptive Biosystems Expedite DNA synthesiser using standard phosphoramidite chemistry, by the Department of Biochemistry's DNA synthesis and Sequencing Facility within the University of Bristol.
  • DNA sequences were amplified by PCR (Saiki et al. , 1988) in a Perkin-Elmer Cetus DNA thermal cycler using either Taq DNA polymerase (Boehringer Mannheim / Qiagen) or the ExpandTM High Fidelity PCR System (Boehringer Mannheim). Reactions were carried out in the enzyme supplier's buffer, with 0.2mM dNTPs (Boehringer). Priming oligonucleotides* were used at a working concentration of approximately 0.5 ⁇ molar). The amount of template DNA used varied from 0.001 - l ⁇ g according to the template used. Negative controls were generated by replacing the genomic DNA with an equal volume of milliQ H 2 O. The mixture was overlaid with mineral oil (Sigma), before cycling according to the following conditions;
  • the annealing temperature was governed by the estimated melting temperature of the primers used in the reaction, using the equation outlined below:
  • T m (( ⁇ G + ⁇ C) x 4) + (( ⁇ A + ⁇ T) x 2) °C
  • G, C, A, T are the base constituents of the primer.
  • An initial annealing temperature was set some 4 °C below the predicted T m to minimise the risk of non-specific annealing of primers and subsequent generation of non-specific products.
  • the thymidine kinase gene fragments were amplified from BHV-2 genomic DNA using 35 cycles of PCR.
  • Genomic viral DNA was extracted from viral particles using the Micro-Turbogen (Invitrogen) genomic DNA purification kit, using the method outlined in the manufacturer's handbook.
  • the resulting DNA pellet was resuspended in milliQ H 2 O (Elgastat), before storage at -20°C.
  • the PCR products were purified on a LMP (low melting point) agarose gel.
  • Agarose gels containing 0.8% - 3.0% (w/v) agarose were prepared by boiling in 1 x TAE buffer (40mM Tris-acetate, ImM EDTA, pH8.5) Following cooling (to below 60°C), ethidium bromide was added to a final concentration of 0.5 ⁇ g/ml prior to casting in a BRL minigel apparatus.
  • DNA samples were diluted in loading buffer (50% (v/v) glycerol, 0.2M EDTA, pH8, 0.05% (w/v) bromophenol blue).
  • Electrophoresis was carried out in 1 x TAE buffer at 5 - 8 V/cm. Gels were visualised under UV light and photographed or digitally captured using a gel documentation system (GS2000, UVP).
  • the resulting pellet was resuspended in H 2 O and phosphorylated using T4 polynucleotide kinase (Stratagene) according to the manufacurer's instructions, prior to ligation into the Sm ⁇ l site of a commercially prepared pUC vector (pUC 18 / Smal - BAP).
  • T4 polynucleotide kinase (Stratagene) according to the manufacurer's instructions, prior to ligation into the Sm ⁇ l site of a commercially prepared pUC vector (pUC 18 / Smal - BAP).
  • Ligations were performed using a commercially available Rapid DNA Ligation Kit (Boehringer). This kit allows ligation of complementary or blunt ended fragments in 5 minutes at room temperature. The speed of ligation is enhanced by the addition of PEG (poly-ethylene glycol) to the reaction mix which has the effect of concentrating the DNA fragments thus improving the kinetics of the reaction. All reagents necessary were supplied with the kit and reactions were performed according to the manufacturer's recommendations. Reaction volumes were typically 20 ⁇ l.
  • the ligated recombinant plasmid was transformed into E. coli, strain XLl-blue by electroporation, and plated out onto ampicillin selective plates containing X-gal and IPTG. Electroporation was carried out as described by Dower et al (Dower, W.J., Miller, J.F. and Ragsdale, C.W. (1988). Nucleic Acid Research, 16, 6127) using a Bio-Rad Gene Pulser II (settings 2.5kV, 25 ⁇ FD, 200 ⁇ ), and a 0.2cm gap electroporation cuvette.
  • DNA solution Plasmid / ligation reaction
  • 50 ⁇ l aliquot of freshly thawed (on ice/water) electro-competent cells The resulting cell/DNA suspension was placed in an ice cold electroporation cuvette (Bio-Rad) and subjected to the electrical pulse.
  • Plasmid DNA was isolated from selected recombinants using the method of Birnboim and Doly (1979) and modified by Kaiser (1984) or an adaption of the Wizard TM, Promega Method. Minipreparation of plasmid DNA by adaptation of a commercially available kit (Wizard, Promega) was done both for economy of time, but more importantly the quality of sequencing data obtained was much higher when sequencing from DNA purified by this means as opposed to that previously used.
  • the resulting suspension was centrifuged at >10,000g for 10 minutes, the supernatant was transferred to a fresh tube and 0.5ml of Celite slurry (66.84g ultrapure guanidine hydrochloride (Sigma) in 33.33 ml solution P3, pH 5.5 to 100ml with ddH 2 O plus 1.5g Celite (NBS Biologicals)) added. The contents were then transferred to a minicolumn (Promega) and washed with 4ml wash buffer (200mM NaCl, 20 mM Tris.HCl pH 7.5, 5mM EDTA, 50% ethanol). The column was centrifuged at > 2000g for 30 seconds to dry the resin. 50 ⁇ l of milliQ H 2 O was added, the column incubated at room temperature for 1 minute, before the resulting DNA solution was eluted by centrifugation at > 2000g for 1 minute.
  • Celite slurry 66.84g ultrapure guanidine hydrochloride (Sigma) in
  • the additional residue at position 48 is unlikely to be of any consequence as it lies well outside the open reading frame (ORF) of the thymidine kinase protein.
  • ORF open reading frame
  • base substitution at position 727 changes codon number 199 from GTG to ATG, thus substituting a methionine for a valine. This substitution is unlikely to be significant as the methionine and valine amino acids are both hydrophobic.
  • region of interest could be amplified successfully from a small aliquot of unpurified tissue culture medium taken from a flask in which virus was being propagated.
  • the virus was propagated as described below.
  • BHV-2, NY-1 strain was obtained from ATCC (Maryland, USA). 1 ml of reconstituted virus ( ⁇ 1.12xl0 5 TCED 50 /ml) was inoculated onto 80% confluent cultures of MDBK cells (Gibco T75 flasks). Virus was adsorbed at 32°C for 1 hour, subsequently 20 ml GM was added. Flasks were then incubated at 32 °C until the cytopathic effect (CPE, Syncytial formation) involved >90% of the culture. Virus was released from the cells by repeated freeze-thawing (3X).
  • CPE cytopathic effect
  • the resulting medium was centrifuged (2500rpm, Sorvall RC3 - lOmin) to pellet cell debris, and the supernatant was harvested. A small volume of this supernatant was then used to inoculate further flasks; remaining supernatant was stored at -70 °C.
  • Initial problems were encountered with propagation of viral stocks; CPE would appear within 24 hours of inoculation but this would subsequently be overgrown by the MDBK cell line.
  • Various techniques were attempted to overcome this problem including heat inactivation of foetal calf serum, variation in concentration, or absence of foetal calf serum from growth medium, inoculation at lower levels of confluence, splitting cells 1:3, 24 hours after infection.
  • RNA from which cDNA could be synthesised and subsequently used in PCR The presence of introns in the coding sequence of the gamma interferon gene made it necessary to produce workable quantities of RNA from which cDNA could be synthesised and subsequently used in PCR.
  • Lymphocytes are a well recognised source of gamma interferon and following Concanavalin A stimulation produce large quantities of active peptide by upregulation of transcription and translation. The increased transcription results in increased levels of mRNA encoding IFN- ⁇ which can subsequently be purified.
  • Synthetic oligonucleotides designated IFNfor and IFNrev, were designed to amplify the IFN- ⁇ coding sequence by PCR. These primers were 100% homologous to the published sequence (Cerretti et al. , 1986), but were engineered so that the amplified IFN- ⁇ coding fragment would be flanked by a 5' EcoRI and 3' Hind ⁇ R restriction endonuclease site. This was to facilitate future sub-cloning of the fragment. IFNfor- 5" C CTC GAATTC CTA ACT CTC TCCTAAACAATG 3'
  • Bovine lymphocytes were purified from wide bovine blood and total RNA was extracted as described below:
  • the pellet was then washed 6 x by the procedure outlined below in order to remove the platelets.
  • the pellet was resuspended in RMPI 1640 (Sigma) supplemented with EDTA (2mg/ml) and 0.5% gentamycin and centrifuged at 750g for 10 minutes at room temperature, the supernatants were checked for the presence of leucocytes and platelets (respun if excess leucocytes present), before being discarded. Following removal of the majority of the platelets the pellet was resuspended, to a cell concentration of 4.8 x 10 6 , in RMPI 1640 supplemented with 10% foetal calf serum, 0.5% gentamycin and Concanavalin A (7.5 ⁇ g/ml).
  • RNA was then further purified by ethanol precipitation, before resuspension in milliQ H 2 O and storage at -20°C.
  • cDNA was synthesised using a First-Strand cDNA synthesis kit (Pharmacia Biotech). 20 ⁇ l of the RNA solution (see above) was placed in a sterile microcentrifuge tube, heated to 65°C for 10 minutes and subsequently chilled on ice. 1 l ⁇ l of the Bulk First-Strand cDNA Reaction Mix, l ⁇ l of 200mM DTT solution and l ⁇ l of Not I-d(T) ]8 oligonucieotide (0.5 ⁇ g / ⁇ l) were added and the resulting mixture incubated for 1 hour at 37°C. Following heat inactivation for 10 minutes at 68°C the cDNA containing solution was stored at -20°C.
  • a First-Strand cDNA synthesis kit Pharmacia Biotech. 20 ⁇ l of the RNA solution (see above) was placed in a sterile microcentrifuge tube, heated to 65°C for 10 minutes and subsequently chilled on ice. 1 l ⁇ l of the Bul
  • Second-Strand cDNA Reaction Mix contains cloned, FPLCpure® Murine Leukaemia Virus Reverse Transcriptase, RNAguard, Rnase/Dnase-Free BSA, dATP, dCTP, dGTP and dTTP in aqueous buffer.
  • the bovine IFN- ⁇ gene (coding sequence) was amplified using 35 cycles of PCR using the same PCR conditions as previously described.
  • the PCR products were purified on a LMP (low melting point) agarose gel, electro-eluted and phosphorylated (as previously described) prior to ligation into the Sm ⁇ l site of a commercially prepared pUC vector (pUC 18 / Sm ⁇ l - BAP).
  • the ligated vector was transformed by electroporation into E. coli, strain XL 1 -blue, and plated out onto ampicillin selective plates containing X-gal and IPTG. Plasmid DNA was isolated from selected recombinants as previously described. The presence of an insert was confirmed by EcoRI / Hind ⁇ l digestion and the resulting clone sequenced by automated sequenceing techniques. The resulting plasmid was denoted pUCglFN.
  • Synthetic oligonucleotides were designed to amplify the region encoding the binding domains of the FnBP S.aureus gene.
  • the two primers were denoted FnBPfor and FnBPrev and were designed so that the PCR-amplified FnBP fragment would be flanked by a 5' EcoRI and 3' Xbal restriction endonuclease site; this was to facilitate future sub-cloning of the fragment into other vectors.
  • the sequence encoding the S. aureus fibronectin binding domains was amplified using 25 cycles of PCR and using PCR conditions as previously described.
  • the PCR products were purified on a LMP (low melting point) agarose gel, gel-purified using a commercially available kit (WizardTM Promega).
  • the PCR product was digested using EcoRI and Xbal restriction enzymes prior to ligation into a similarly cut pUC vector; the need to dephosphorylate the vector and phosphorylate the insert was removed by the use of incompatible cohesive ends which ensured 'directional' insertion of the PCR fragment.
  • the ligated recombinant plasmid was transformed by electroporation into E.
  • Plasmid DNA was isolated from selected recombinants (using WizardTM, Promega). The presence of an insert was confirmed by EcoRI / Xbal digestion and the resulting clone sequenced using automated sequencing techniques. The resulting plasmid was denoted pUCFnBP.
  • the FnBP (binding domains) sequence obtained in this study showed 97.8% identity when compared to both of the previously published sequences encoding the two separate genes FnBA and FnBB. However the sequence obtained in this study was less homologous when compared to each of the sequences individually. The sequence obtained appears to contain components of both of the previously published sequences, a phenomenon which could be due to strain variations between S. aureus, or could be due to adaptation of the strain in this study to the bovine environment (the published sequences arise from a human strain originating from Scandinavia). These differences, and apparent combination of the two genes, could have arisen as a result of recombination events arising during the normal replication of S. aureus.
  • Alignment of the four individual binding domains shows 100% identity between the FnB AB and the published sequences in domains D 1 and D4 and only one amino acid difference in the binding domain D3 which has previously been shown to have the highest affinity (when compared to Dl and D2) when studies were undertaken using synthetically prepared peptides.
  • This alignment also serves to illustrate the high degree of identity both between the three sequences and within the three sequences when aligned along the putative functional domains.
  • the IFN- ⁇ gene signal sequence was required as part of the synthetic FnBP 'minigene' to direct secretion of the FnBP binding domains.
  • the absence of introns in the region encoding the signal sequence made it possible to amplify this part of the IFN- ⁇ gene using bovine genomic DNA as a template, in PCR, without the need to isolate RNA and produce cDNA.
  • Bovine genomic DNA was extracted as follows:
  • primers were designed so that the amplified IFN- ⁇ fragment would be flanked by a 5' BamHl and 3' EcoRI restriction endonuclease site; this was to facilitate future sub-cloning of the fragment into other vectors, and also to allow the attachment, 'in frame', of the IFN- ⁇ signal sequence to the sequence encoding the FnBP binding domains.
  • the six additional bases beyond the restriction sites were present to allow restriction digestion of the PCR product if desired.
  • the primers used to amplify the IFN- ⁇ signal sequence were deliberately designed to include areas of the genome upstream of the start of the coding sequence in an attempt to include naturally occurring Kozak recognition sequences (Kozak, M. (1986). Cell, 44, 283; Kozak, M. (1987). Journal of Molecular Biology, 196, 947) and to optimise the chances of correct 'interpretation' of the signal sequence in the eukaryotic environment.
  • the sequence encoding the IFN- ⁇ signal sequence was amplified using 25 cycles of PCR using the same PCR conditions as previously described.
  • the PCR products were purified on a LMP (low melting point) agarose gel and gel-purified using a commercially available kit.
  • Commercially available kits were employed for speed and the enhanced recovery rate of purified DNA.
  • Two silica based purification kits were used (Gelex, Stratech Scientific / HYBATD RECOVERYTM DNA Purification Kit ⁇ , Hybaid). In both cases the kits were used according to the manufacturer's recommendations with the exception that gel chips were melted at room temperature (rather that at 55°C).
  • kits follow a similar principle of melting the chip in a chaotropic salt prior to binding to silica; the silica is then either pelleted or separated from residual solutions using a filter and washed in 70% (v/v) ethanol prior to elution in milliQ H 2 O.
  • the PCR product was ligated into the T-A cloning vector pGEM-T; the need to dephosphorylate the vector and 5' phosphorylate the insert was removed as the cloning vector ends are incompatible and therefore can be left with their 5' terminal phosphates.
  • the ligated recombinant plasmid was transformed into E. coli, strain XLl-blue, and plated out onto ampicillin selective plates containing X-gal and IPTG. Plasmid DNA was isolated from selected recombinants as detailed in section 2.25 (Method B). The presence of an insert was confirmed by EcoRI / Z ⁇ mHI digestion and the resulting clone sequenced. The resulting plasmid was denoted pG ⁇ MalFN.
  • each codon in the amplified fragment was matched by a similar codon in at least one of the other published sequences as illustrated in figure 11. Most of the changes present, within the coding sequence, are 'silent' base substitutions. When the sequence is translated and amino acid alignments performed the sequence obtained matches that of Velan et al (Ace Ml 0955) exactly.
  • Binding Protein (Binding Domains) in Escherichia coli
  • prokaryotic expression vectors are commercially available, and here, the inventors used a commercial expression system (QIAexpress, QIAGEN), with two different expression plasmids (pQE 30, QIAGEN; pET32, Novogen) both of which allow his-tagged purification of the recombinant proteins, the pET32 system expressing the protein of interest as a fusion with thioredoxin.
  • QIAexpress QIAGEN
  • pQE 30, QIAGEN pET32, Novogen
  • the pQE-30 vector was selected for expression of both the FnBP binding domains and the IFN- ⁇ .
  • the recombinant proteins are expressed with an N-terminal his-tag, as an aid to later purification.
  • the plasmid contains an optimised, regulatable promoter / operator element consisting of the E. coli phage T5 promoter and two lac operator sequences and a synthetic ribosome binding site.
  • An MCS facilitates the insertion of sequences of interest and stop codons in all three frames ensure termination of translation.
  • the origin of replication and ampicillin resistance are provided by genes from the plasmid pBR322.
  • the E. coli host stain encoding the lac repressor is used for the expressions the need for the pREP4 plasmid is removed; in this situation the expression will be less tightly controlled but will still be strongly induced by the addition of IPTG.
  • the E. coli host strain XLl-Blue was used for all expression experiments. This strain possesses the lacl q gene thus controlling expression using both of the plasmids detailed above. It is a useful general purpose strain and was used both for cloning and DNA multiplication and for over-expression.
  • Vectors were constructed to allow the over-expression of bovine interferon- ⁇ (mature peptide without the signal sequence) as both a C-terminal fusion to thioredoxin (pET32a, Novogen) and as a peptide with an N-terminal 'his tag' (pQE 30, QIAGEN). This required the PCR amplification of the sequence of the IFN- ⁇ mature peptide and it's subsequent cloning, sequencing and sub-cloning into the two expression vectors.
  • a synthetic oligonucieotide, denoted IFNgMATfor, was designed, which when used, in the PCR, with the primer IFNgrev would amplify the region encoding the IFN- ⁇ mature peptide.
  • This primer was designed so that the amplified IFN- ⁇ fragment would be flanked by a 5' BamHl restriction endonuclease site; this along with the 3' HindHL site of primer IFNgrev facilitated the sub-cloning of the fragment 'in frame' into both of the expression vectors to be used.
  • the IFN- ⁇ fragment was amplified from the plasmid pUCglFN using 10 cycles of PCR using the PCR conditions previously described. Using the techniques outlined above, the IFN- ⁇ mature peptide PCR fragment was T-A cloned into pGEM-T and transformed into E. coli strain XLI-blue. The presence of the fragment was confirmed in the resulting clones by restriction digestion with B ⁇ mHI, and HindlR. The sequence of the amplified fragment was confirmed by automated sequencing (ABI PRISM Model 377). The resulting plasmid was denoted pGEMglFNmat.
  • the sequence encoding the IFN- ⁇ mature peptide was sub-cloned into pQE 30 and pET32a using the 5' £? ⁇ mHI and 3' HindlR restriction sites, and transformed into E. coli host strain XLI-blue. The presence of the insert in the construct was confirmed by restriction digestion.
  • a vector was constructed to allow the over-expression of the binding domains of S. aureus fibronectin binding protein as a peptide with an N-terminal 'his tag' (pQE 30, QIAGEN). This required the amplification of the sequence of the FnBP fragment with different restriction sites and it's subsequent cloning, sequencing and sub-cloning into the expression vector.
  • Synthetic oligonucleotides were designed to amplify the region encoding the FnBP binding domains. These primers, denoted FnBPforl and FnBPrevl were designed so that the PCR amplified FnBP fragment would be flanked by 5' BamHl and 3' HinaTR restriction endonuclease sites, thus facilitating the sub-cloning of the fragment 'in frame' into the expression vector.
  • the FnBP fragment was amplified from the plasmid pUCFnBP using 10 cycles of PCR using the PCR conditions previously described.
  • the FnBP PCR fragment was T-A cloned into pGEM-T using T4 polynucleotide kinase (Stratagene) according to the manufacturer's instructions, to add 5' terminal phosphates, before ligating into PGEM-T using the Rapid DNA ligation kit (Beohringer) according to the manufacturer's instructions.
  • the resulting construct was transformed into E. coli strain XLI-blue and the presence of the fragment was confirmed, in the resulting clones, by restriction digestion with BamHl and HindRl. The sequence of the amplified fragment was confirmed (ABI PRISM Model 377).
  • the resulting plasmid was denoted pG ⁇ MFnBPexp.
  • the sequence encoding the FnBP binding domains was then sub-cloned into pQ ⁇ 30 using the 5' BamHl and 3' HindRl restriction sites, and transformed into E. coli host strain XLI-blue. The presence of the insert in the construct was confirmed by restriction digestion.
  • the cell cultures were harvested by centrifugation at >4000g for 10 minutes (Sorvall, RC5).
  • the resulting cell pellets were each resuspended in 10ml of sonication buffer (50mM Na-phosphate pH 7.8, 300mM NaCl) including 1% v/v Tween 20, and were frozen overnight at -20°C.
  • SDS-PAGE SDS Polyacrylamide gel electrophoresis
  • Protein separation was performed using SDS-PAG ⁇ gels as described by Laemmli (1970) using the Bio-Rad Mini-Protean DTM system. 12-15% acrylamide resolving gels (30:0.8 acrylamide:bis-acrylamide ratio) were prepared in 375mM Tris HCl (pH8.8), 0.1% (w/v) SDS, 0.1% (w/v) ammonium persulphate and 0.08% T ⁇ M ⁇ D (N',N',N',N'-tetramethylenediamine).
  • Stacking gels were 6% (w/v) acrylamide, 125mM Tris/HCl (pH6.8), 0.1% (w/v) SDS, 0.1% (w/v) ammonium persulphate and 0.08% T ⁇ M ⁇ D.
  • the protocol followed was as outlined by the manufacturer.
  • the Ni-NTA resin was 'bulked out' using Sepharose 30 (Sigma) and equilibrated with sonication buffer before loading into the column supplied.
  • the cell lysate supernatant was subsequently applied to the column at a rate of 3-4 column volumes per hour (the flow through was collected and analysed by SDS-PAG ⁇ to ensure negligible loss of recombinant protein which had not bound to the column).
  • the column was then washed (Wash buffer - 50mM Na-phosphate, 300mM NaCl, 10% glycerol, pH 6.0) until the A ⁇ oof the flow through was ⁇ 0.01.
  • the protein was then eluted from the column, in 1ml aliquots, using 10ml wash buffer, pH 4.5; aliquots with an A 28 o> 0.8 were pooled. 20 ⁇ l of each pooled sample was then examined using SDS-PAG ⁇ .
  • Protein samples were prepared by addition of an equal volume of SDS loading buffer ((2X) 5mM DTT (dithiothreitol), 4% (w/v) SDS, 240mM Tris/HCl (pH6.8), 20% (v/v) glycerol) followed by boiling for 5 minutes prior to loading.
  • SDS loading buffer ((2X) 5mM DTT (dithiothreitol), 4% (w/v) SDS, 240mM Tris/HCl (pH6.8), 20% (v/v) glycerol) followed by boiling for 5 minutes prior to loading.
  • SDS loading buffer ((2X) 5mM DTT (dithiothreitol), 4% (w/v) SDS, 240mM Tris/HCl (pH6.8), 20% (v/v) glycerol) followed by boiling for 5 minutes prior to loading.
  • Gels were electrophoresed at 150-200V for approximately 1 hour in S
  • the his-tag purification system yielded recombinant proteins of a high level of purity when they were expressed from the vector pQE-30.
  • the level of purity of the product from the thioredoxin fusion protein was less and there was significant 'carry over' of host E. coli proteins. This was felt to be most likely as a result of the quantities of protein involved (i.e. there was significantly more of the thioredoxin fusion protein as compared to the other recombinant proteins) and that this may have 'trapped' other proteins within the column. This problem could probably have been overcome by the use of a greater number of more stringent washes of the column prior to elution of the product.
  • Both of the vectors encoding the recombinant, his-tagged IFN- ⁇ and IFN- ⁇ thioredoxin fusions generated proteins of the expected size (as estimated by SDS-PAGE); however over-expression of the his-tagged FnBP 'mini-gene' resulted in a recombinant protein of almost twice the size of that predicted, from sequencing data, when examined by SDS-PAGE. As described earlier, factors other than size can effect the migration properties of proteins on SDS-PAGE; however in this case it was felt that the amino-acid composition of the protein would be highly unlikely to result in such an anomolous migration pattern.
  • the BIAcore apparatus comprises a surface plasmon resonance (SPR) biosensor controlled by a Pentium class personal computer, (Schuck, P. (1997). Annual Reviews in Biophysics of Biomolecular Structure, 26, 541).
  • SPR surface plasmon resonance
  • the SPR biosensor consists of a prism coated with a thin metal film (usually gold).
  • a plasmon is a wave of oscillating surface charge.
  • These plasmons are only excited by light at a fixed angle of incidence (resonance angle), and it is the energy loss from the reflected light that is measured in relative units (RU).
  • the resonance angle is dramatically affected by the refractive index close to the surface which is in turn affected by the local concentrations of macromolecules, thus providing a measure not only of the amount of primary molecule bound but also of interactions between that primary molecule and others in its vicinity.
  • the basic experimental strategy involves the immobilisation of one of the macromolecules of interest on the biosensor surface; the second macromolecule, at a known concentration, is then passed, at a fixed rate, over the surface of the immobilised reactant; surface complex formation is then monitored. Following binding, a dissociation stage is monitored as complex dissociation is recorded in the absence of further mobile reactant. Following the study time course, the remaining macromolecular complexes can be disrupted (e.g. using buffer of low pH) and the study repeated using different concentrations of the mobile reactant. It is thus possible to calculate dissociation constants and the kinetics of the macromolecular interaction.
  • the BIAcore 1000 apparatus described in this study uses a sensor surface on a removable chip over which solutions of interest can be passed. Flow cell dimensions are 2.1mm (1) x 0.55mm (w) x 0.05mm (h) and interactions are detected on a 0.2mm 2 surface.
  • the protocol followed was as outlined in the manufacturer's handbook. Initially the NTA surface (covalently immobilised on a carboxymethylated dextran matrix) was washed with regeneration solution (lOmM HEPES, 0.15M NaCl, 0.35M EDTA, 0.005% surfactant P20, pH8.3) to remove any metal ions already present within the apparatus. 20 ⁇ l of nickel solution (500 ⁇ M NiCl 2 in eluent buffer (lOmM HEPES, 0.15M NaCl, 50 ⁇ M EDTA, 0.005% surfactant P20, pH7.4)) was passed across the chip surface at a rate of 20 ⁇ l/minute, saturating the NTA surface with nickel.
  • regeneration solution lOmM HEPES, 0.15M NaCl, 0.35M EDTA, 0.005% surfactant P20, pH8.3
  • 20 ⁇ l of nickel solution 500 ⁇ M NiCl 2 in eluent buffer (lOmM HEPES, 0.15
  • the flow cell chamber was then washed with eluent buffer. Following dilution in eluent buffer, the recombinant protein of interest was then immobilised on the chip surface. Following a further wash with eluent buffer, bovine fibronectin was passed through the flow chamber, at a rate of lO ⁇ l/min for three minutes, and the binding of fibronectin to the immobilsed recombinant protein monitored. After completion of one set of experiments the nickel was stripped from the surface of the NTA chip using regeneration solution (EDTA disrupting the nickel NTA interaction) before the above process was repeated under a different set of conditions.
  • regeneration solution EDTA disrupting the nickel NTA interaction
  • the decreasing value (RU) for the IFN- ⁇ binding is due to the gradual dissociation (leaching) of the histidine tag from the Ni-NTA surface. This dissociation would also have been occurring between the histidine tagged FnBP and the Ni-NTA surface, however this would have been masked by the more significant change in RU arising as a result of the interaction between FnBP and the bovine fibronectin.
  • the direct enzyme linked immunosorbant assay was selected as a suitable screening assay due to its speed, convenience and as it was most likely to be the method used for screening in later in vivo studies. Extensive use of Western Blotting was also envisaged; however it was decided that it would be more appropriate to screen Mabs, at a later date, for their suitability for use in this technique.
  • the appropriate recombinant protein was to be used in the assay to screen for hybridomas producing the appropriate antibody.
  • the main aim of this study was to determine the optimum concentration of recombinant protein to be used in coating microtitre plates, by titration against serum from the immunized mice which would later be used in hybridoma production.
  • mice Two groups of five mice were immunised, intra-peritoneally with either 5 ⁇ g rIFN- ⁇ or 3 ⁇ g rFnBP in lOO ⁇ l PBS mixed with an equal volume of adjuvant (MPL + TDM Adjuvant system, Sigma). 14 days later both groups were vaccinated, in the same manner, for a second time. Two mice (one from each group) were selected (on the basis of results obtained in development of the screening assay) and inoculated for a third time 49 days later. Fusions were carried out 4 days later.
  • the feeder cells used in this study were mouse splenocytes.
  • a Balb/c mouse was sacrificed by chloroform anaesthesia and cervical dislocation. Following immersion in 70% alcohol the spleen was removed. The spleen was then forced through a cell strainer. The cells were then washed twice in RPMI 1640 (no FCS) before dilution to 5xl0 5 cells/ml, in complete medium (RPMI 1640 supplemented with 1% glutamine, 1% pyruvate, 0.5% gentamicin, 0.1% fungizone and 15% FCS). These cells were then dispensed into 96 well, flat bottomed plates into which the hybridomas were to be cloned.
  • Conditioned media was also prepared using the above method except the splenocytes were placed in a 75 cm 2 tissue culture flask and incubated for 5 days before collection of the medium; aliquots of this medium were then frozen for later use.
  • Myeloma cells (revived from liquid nitrogen 4 days earlier) were harvested using a cell scraper (Falcon) and diluted in 20ml RPMI 1640, to 1.2xl0 6 cells/ml.
  • mice An immunised mouse was then sacrificed, the spleen harvested and antibody producing cells from that animal fused to a Balb-c derived myeloma cell line. Following immersion in 70% alcohol the spleen was removed via a midline abdominal incision. The surrounding fascia was removed and the spleen was forced through a cell strainer (Falcon) using a Pasteur pipette and approximately 10ml RPMI 1640 medium. The splenocytes were then mixed with the myelomas, at a ratio of approximately 5:1, and washed 2X in RPMI.
  • the myeloma cell line used in the fusions are deficient in the DNA salvage pathway which allows for selection of the hybridomas formed in the fusion process (by blocking the normal pathway with aminopterin) as only these will possess this salvage pathway.
  • Stocks of the Mab in question can also be generated by inoculation of the hybridoma back into pristane (tetramethylpentadecane) treated mice which subsequently develop ascites; this ascitic fluid contains high concentrations of the Mab of interest which can be harvested following sacrifice of the animal.
  • the cells were pelleted and all media removed.
  • the cell pellet was then slowly resuspended, over 90 seconds, in 0.5ml polyethylene glycol (PEG). 9 ml of complete medium was then added; 3ml over 3 minutes followed by 3ml in 1 minute followed by 4ml in 1 minute.
  • the cells were pelleted by centrifugation (300g, 5 minutes) and fresh complete media added (the cells were not mixed).
  • the cells were resuspended to a total volume of 120 ml including 2.4ml HAT (ie complete medium plus aminopterine 4xlO "7 M, hypoxanthine lxlO ⁇ M and thymidine 1.6xl0 "5 M), before plating out at 200 ⁇ l/well in 96 well plates. Plates were incubated at 37°C, 5% CO 2 in a humidified incubator. The cells were 'fed' twice at 4 day intervals using HAT on the first occasion and HT on the second. Primary antibody screening and cloning was done 4 days later. Cloning of Hybridoma Cell Lines
  • 50 ⁇ l of serum was diluted 1:2 with wash buffer before serial doubling dilutions were made across the plate. After incubation for 1 hour at room temperature, the plate was washed 3X with wash buffer. 50 ⁇ l of conjugate (Anti-mouse IgG (whole molecule) alkaline phosphatase conjugate, Sigma) was then added at a dilution of 1:2000. Following a further 1 hour incubation the plate was again washed 3X in wash buffer. 50 ⁇ l of substrate (paranitrophenol phosphate, Sigma) at a concentration of 1 mg/ml (in coating buffer) was added; the reaction was allowed to progress for 30 minutes before reading at 405nm using an ELISA reader (Anthos 2001).
  • conjugate Anti-mouse IgG (whole molecule) alkaline phosphatase conjugate, Sigma
  • the 96 well 1 st cloning plates were 'fed' with conditioned media on days 2, 4 and 8. A second round of screening and cloning was performed 14 days after the first round. Positive wells were selected visually on the basis of a cell colony which apparently only came from one cell. Two positive wells were cloned from each plate.
  • the hybridomas were split (up to 1:10) and fresh flasks inoculated.
  • the hybridomas in these freshly inoculated flasks were regularily fed with complete medium, until approximately 300ml of media was present in the flask; the cells were allowed to grow, and continue to secrete Mab until approximately 50% of the cells had died.
  • the supernatant was then harvested by centrifugation (300g, 10 minutes), and stored at -20°C in 100ml aliquots.
  • pristane tetramethylpentadecane
  • Cells can be 'revived' by rapid thawing at 37°C and seeding into 25cm 2 flasks in complete medium (containing 50% conditioned medium).
  • the membrane was then 'blocked' for 30 minutes using blocking solution (10% Marvel, PBS, 0.5% Tween 20).
  • the appropriate Mab supernatant (diluted 1: 1 in blocking solution) was then applied and incubated at room temperature for 2 hours.
  • wash solution PBS 0.5% Tween 20
  • the second antibody was applied (horseradish peroxidase rabbit anti-mouse IgG (whole molecule), Sigma) at a dilution of 1:5000 in blocking solution, for 1 hour.
  • the blot was then washed 3 X, for 20 minutes each, in wash solution before rinsing twice in PBS.
  • the blot was then developed using di-amino-benzadine (0.6mg/ml di-amino-benzadine, l ⁇ l/ml H 2 O 2 in PBS) and dried for storage.
  • Enhanced chemiluminescence (ECL) was used for developing western blots when enhanced sensitivity was required for detection of recombinant proteins.
  • Western blotting was performed as described above except for the different procedure used in development of the blot outlined below. Following the application of the MAbs and the second PBS wash the blot was developed using a commercially available chemiluminescence kit (ECL, Amersham). The method was followed as outlined in the manufacturer's handbook.
  • Exposure of film (Hyperfilm, Amersham); exposure times were varied according to the strength of the signal. Films were developed manually using standard film processing reagents (Kodak). Typically 25 ⁇ l of supernatant and cell extract were blotted on each occasion. MAbs used in the blots varied according to the proteins being detected. MAbs G3a (ascites) and F4a (ascites) and a commercially available egfp MAb were used as primary Ab at a dilution of 1:5000. The second antibody was anti-mouse IgG (whole molecule) conjugated to horseradish peroxidase (Sigma). One monoclonal was tested against its relevant recombinant protein using the other recombinant protein as a negative control (ie G3a, Fib).
  • the results of the western blotting are illustrated in figure 16.
  • the MAb G3a detected recombinant protein with a high degree of specificity, however the MAb Fib only generated a very weak signal with cross reactivity with recombinant IFN- ⁇ .
  • the mixing of FCS with the recombinant protein did not affect the recognition of FnBP which dissociated from the fibronectin in the FCS when resolved by SDS-PAGE.
  • F3a, F4a and F4b generated a specific positive signal.
  • the MAbs F3a, F4a and F2c when raised as ascites gave a stronger positive signal as compared to the same MAbs raised in vitro.
  • MAbs were successfully raised against the two recombinant proteins (7 against IFN- ⁇ and 9 against FnBP), of varying affinity.
  • Expression of recombinant protein in eukaryotic cells requires the cloning of the DNA encoding the protein of interest into an appropriate expression vector.
  • pEGFP-Nl (Clontech, CA USA) was selected as a suitable vector from which the expression vectors could be built.
  • pEGFP-Nl encodes a red-shifted variant (EGFP) of wild-type green fluorescent protein (GFP), and is designed such that the protein of interest can be expressed as an N-terminal fusion to EGFP.
  • Protein expression is driven by the 'strong' cytomegalovirus (CMV) immediate early promoter and the SV40 downstream polyadenylation signal ensures the correct processing of the 3' end of the transcribed mRNA.
  • CMV cytomegalovirus
  • the vector backbone also contains an SV40 origin for replication in eukaryotic cells expressing the SV40 T antigen (eg Cos7), a pUC origin of replication for propagation in E. coli and an fl origin for single-stranded DNA production.
  • Antibiotic resistance is encoded by the neomycin / kanamycin resistance gene; this is under the control of an S V40 early promoter with polyadenalation signals from the Herpes simplex virus thymidine kinase (HSV tk) gene allowing expression and selection using G418 in eukaryotes.
  • An upstream bacterial promoter allows kanamycin selection in E.coli.
  • the invention provides a recombinant viral vector expressing both antigens and cytokines.
  • the virus may also have to encode a marker gene of some description to allow for selection of recombinant viridae during the recombination process (see EGFP above).
  • the requirement for expression of these three proteins can be met in a variety of ways.
  • One option would be to express each of the proteins from their own expression cassette (ie with their own promoter and poly A tail); however this approach, whilst possible, may be technically very demanding as the size of the vectors involved would be large (>20kb) and would contain significant regions of homology which may make them susceptible to recombination events whilst propagating in E. coli.
  • the second possible approach to this problem is to construct a single expression cassette encoding expression of all of the proteins of interest.
  • This approach has been made possible by the discovery of internal ribosomal entry sites (IRES) which allow the recognition and binding of ribosomes internally on transcribed mRNA (Molla, A., Jang, S.K., Paul, AN., Reuer, Q. and Wimmer, E. (1992). Nature, 356, 255 j.
  • This second approach was used to express the bacterial antigen (FnBP) as a fusion to EGFP, with IF ⁇ - ⁇ expressed alone by insertion downstream of the IRES.
  • FnBP bacterial antigen
  • the pIRESl neo vector (Clontech, CA USA) was selected as a source of an internal ribosomal entry site.
  • This vector contains the IRES of encephalomyocarditis virus (ECMV) which permits the translation of two open reading frames from one mR ⁇ A.
  • ECMV encephalomyocarditis virus
  • a synthetic intron known to enhance the stability of mR ⁇ A is also included.
  • oligonucleotides His 1 and His 2 were designed to insert into the vector pEGFP- ⁇ l, 'in frame' with EGFP, between the 5' ⁇ mHI and 3' PinAl (Age ⁇ ) restriction sites.
  • the oligos also encoded a start codon and Kozak consensus translation initiation site engineered between the terminal 5' BamHl site and an internal 5 ⁇ mHI site prior to the histidine residues. This construction allowed the use of a his-tagged EGFP as a positive control whilst also allowing further cloning into the BamHl site in the formation of fusion proteins.
  • the oligonucleotides Hisl and His2 were diluted and annealed together, as shown below, prior to ligation into the pEGFP-Nl vector. Phosphorylation of the oligonucleotides was not necessary as cleavage of the vector yielded incompatible cohesive ends, thus also ensuring directional 'in frame' insertion of the fragment.
  • Linearisation of the vector pEGFP-Nl was achieved using the restriction enzymes BamHl and PinAI.
  • PinAI digestion of the pEGFP-Nl vector was performed prior to digestion with B ⁇ mHI due to the proximity of the two restriction sites and the known ability of 5 ⁇ mHI to cut very close (i.e. lbp) to the end of double stranded linearised vector (Moreira, R. and Noren, C. (1995). Biotechniques, 19, 56).
  • Insertion of the hexa-his oligo was confirmed by HindRl I PinAI restriction digestion and acrylamide gel electrophoresis and the newly formed vector was denoted pEGFP-HH.
  • GIFNBAMrev and were designed to flank the amplified region with a 5' EcoRI and 3' 'in frame' .B ⁇ mHI restriction endonuclease site.
  • the oligonucieotide GIFNBAMrev was engineered so that the stop codon was removed from the IFN- ⁇ sequence thus allowing
  • GIFNBAMrev - 5' AGC ATC GGA TCC CGTTGA TGC TCT CCG GCC TCG 3'
  • the IFN- ⁇ fragment was amplified using 10 cycles of PCR from the vector pUCglFN using the PCR conditions previously described.
  • the resulting fragments and the vector pEGFP-HH were cut with EcoRI and BamHl and ligated ( Figure 18).
  • colonies were screened by colony PCR, a positive clone was selected and test digested for the insert prior to selection for further use.
  • the newly formed recombinant was denoted p ⁇ GFP-HH-IFN ( Figure 19).
  • the FnBP 'mini-gene' had to be constructed prior to insertion into the expression vector. This was achieved by 'three way' ligation of the BamHl - EcoRI IFN- ⁇ signal sequence fragment along with the EcoRI - Xbal FnBP fragment into the vector pBluescript II KS (Stratagene) cut at BamHl and Xbal. Successful ligation was confirmed by BamHl - Xbal digestion of the resulting plasmid pBSaFnBP.
  • Oligonucleotides were designed to amplify the sequence encoding the FnBP 'mini-gene'. These primers were denoted AIFHHSTDfor and FnBPBAMrev and were designed to flank the amplified region with a 5' HindRl and 3' 'in frame' 5 ⁇ mHI restriction endonuclease site. The primer FnBPBAMrev was designed such that the synthetic 'stop' codon was lost from the end of the FnBP 'mini-gene', thus allowing 'read through' and formation of the FnBP / EGFP fusion protein.
  • the FnBP 'mini -gene' was amplified using 10 cycles of PCR from the vector ppBSaFnBP using the PCR conditions previously described.
  • the resulting fragments and the vector pEGFP-HH were cut with HindRl and BamHl and ligated (figure 20).
  • colonies were screened by colony PCR, a positive clone was selected and test digested for the insert prior to selection for further use.
  • the newly formed plasmid was denoted pEGFP-HH-FnBP ( Figure 21).
  • the double recombinant expression plasmid was constructed using a number of steps outlined below.
  • Synthetic oligonucleotides were designed to amplify the sequence encoding IFN- ⁇ , with a C-terminal hexa-his motif, from the vector pEGFP-HH-IFN. These oligonucleotides were denoted GIFNXMAfor and HHXBArev and were designed to flank the amplified region with a 5' Zm ⁇ l and 3' Xbal restriction endonuclease site, with a synthetic stop codon inserted upstream of the Xbal site.
  • the IFN- ⁇ hexa-his encoding region was amplified from the vector pEGFP-HH-IFN using 10 cycles of PCR using the PCR conditions previously stated. The resulting fragment was digested with Xm ⁇ l and Xbal.
  • the vector pIRESneo was digested with Sm ⁇ l and Xbal to remove the neomycin resistance cassette; the PCR fragment was then ligated into the Sm ⁇ l - Xbal cut pIRESneo. Following transformation, a positive clone was identified by test digestion and the plasmid was denoted pIRES-IFN (See Figure 22).
  • pIRES-IFN was then digested with EcZXI and EcZ136 ⁇ , releasing a fragment containing the internal ribosomal entry site, some of the MCS, the IFN- ⁇ hexa-his fragment and the SV40 polyA site.
  • the vector p ⁇ GFP-HH-FnBP was linearised by digesting with Notl and Hpal, and the pIR ⁇ S-IF ⁇ fragment was inserted by ligation ( Figure 23). Following transformation, a positive clone was identified by test digestion with Xhol, Xbal and EcoRI alone. The resulting plasmid was denoted p ⁇ GFP-HH-FnBP-IF ⁇ ( Figure 24).
  • the IF ⁇ - ⁇ protein prefferably encoded upstream of the IRES, and the FnBP / EGFP fusion downstream so that if expression of the downstream element is achieved, one can be guaranteed high levels of expression of the upstream element.
  • Cos 7 cells an African Green Monkey cell line expressing the large T antigen of SV40 , were used in these expression studies. This was to ensure a high copy number of the plasmid of interest so as to enhance the chances of detecting production of recombinant protein.
  • Madin Darby Bovine Kidney (MDBK) cells, and African Green Monkey Kidney (Cos 7) cells were propagated in Eagle's Minimal Essential Medium (MEM) (Sigma, Poole), supplemented with 5% foetal calf serum, 3% sodium bicarbonate, 1% glutamine, 1% non-essential amino acids, 0.5% lactalbumin hydrolysate, 0.5% gentamicin and 0.1% fungizone (Growth medium - GM). Cultures were maintained at 37°C in 5% CO 2 . Sub-culturing was by trypsinisation of cell sheets and ⁇ 1 in 10 dilution every 7 - 10 days.
  • MEM Eagle's Minimal Essential Medium
  • the host cell line was transfected using a commercially available highly-branched polycationic transfection reagent (SuperFect, Qiagen).
  • SuperFect assembles around the plasmid DNA in a spherical manner, optimising DNA entry into cells.
  • a net positive charge enables the complexes to bind to negatively charged receptors (eg sialylated glycoproteins) on the surface of the cell.
  • negatively charged receptors eg sialylated glycoproteins
  • the protocol used in the transfection was similar to that outlined in the manufacturer's handbook.
  • Cos7 cells were seeded into 30mm dishes in sufficient numbers to ensure 40-80% confluence at the time of transfection (typically by splitting 1:6 to 1:10), and incubated overnight at 37°C in 5% CO 2 .
  • growth medium Eagle's Minimal Essential Medium (MEM) (Sigma), supplemented with 3% sodium bicarbonate, 1% glutamine, 1% non-essential amino acids, 0.5% lactalbumin hydrolysate
  • lO ⁇ l of SuperFect reagent was then added and the resulting solution vortexed for 10 seconds.
  • the media was aspirated, the cells washed once with PBS and 0.5 ml of fresh growth medium added. The cells were then incubated for 48 - 72 hours before assessment of levels of over-expression.
  • the PBS was removed from the cell sheet and replaced with 0.5ml of cell lysis solution (PBS, 0.5% Triton X-100 (Sigma)), containing protease inhibitors (2mM phenyl methyl sulphonyl flouride (PMSF), 2 ⁇ g/ml pepstatin).
  • PMSF phenyl methyl sulphonyl flouride
  • pepstatin 2mM phenyl methyl sulphonyl flouride
  • the cell sheet was disrupted and the resulting suspension placed in a microcentrifuge tube. The cell suspension was vortexed to further release cell contents. The cell debris were then pelleted by centrifugation (>1000g) and the supernatant harvested for further use.
  • the EGFP monoclonal detected protein production, of both fused and unfused EGFP, in all cases.
  • the IFN- ⁇ MAb successfully detected IFN- ⁇ when fused to EGFP; however it was unable to detect IFN- ⁇ when expressed alone in the double recombinant.
  • the FnBP MAb was unable to detect FnBP production, under any circumstances. However it was safe to assume that FnBP was being expressed as a fusion because a band of appropriate size was detected when using the EGFP monoclonal.
  • the BHV-2 tk has been cloned and modified to allow insertion of heterologous DNA.
  • the cytokine, IFN- ⁇ , and the antigen, FnBP have been cloned, overexpressed and MAbs have been raised against them, thus enabling detection of their production by both eukaryotic expression vectors and recombinant viridae.
  • Eukaryotic expression plasmids have been constructed, and the ability to express and secrete both the FnBP and IFN- ⁇ has been demonstrated.
  • the expression cassettes in these plasmids can be easily modified so they are flanked by the BHV-2 tk, thus facillitating the process of homologous recombination.
  • the amplified BHV-2 tk region has already been engineered to contain the novel restriction sites Bgl R and Sal I. These sites will facilitate the insertion of the expression cassettes described in chapter 6 into the tk region.
  • These newly engineered plasmids, illustrated in figures 32 and 33 will then be used to construct the recombinant BHV-2 viridae by homologous recombination using standard molecular techniques.
  • the recombinant viridae can be evaluated by inoculation of Friesian heifer calves, S/C in the perineal region. Any clinical effect on the calves will be noted and regular serum samples assessed using ELISA for immunoglobulin isotype and subisotype activity against BHV-2 and FnBP using a panel of monoclonal antibodies against bovine IgGi, IgG 2 , IgA and IgM, as the immunoglobulin isotype/subisotype has been shown to be crucial to the level of opsonisation of bacteria for neutrophils and other leucocytes (Howard, C.J., Taylor, G. and Brownlie, J. (1980). Research in Veterinary Science, 29, 128).
  • the calves will be re-inoculated after 6 weeks to assess the amanestic response. After another 6 weeks the calves will be sacrificed and the draining lymph nodes, virgin mammary gland tissue and related CNS ganglia tested for the presence of the recombinant virus, initially by PCR, and later by in-situ hybridisation. These latter results would indicate if and where the BHV-2 has become established.
  • either the recombinant virus expressing FnBP alone or the virus expressing both FnBP and IFN- ⁇ will be selected for local infusion into the mammary glands of a group of barren cows in the late or dry (non-milking) phase of the lactation cycle. Regular and careful examination will assess any clinical effect of the BHV-2 on the cattle. Regular serum and mammary gland (lacteal) samples will be tested as above for isotype and sub-isotype activity against BHV-2 and FnBP. The cows will be re-inoculated after 6 weeks and sacrificed and analysed as described above.
  • BHV-2 / IFN- ⁇ Using primary and adapted cell lines from bovine mammary tissue (in collaboration with Dr. J. Fitzpatrick) the recombinant BHV-2 / IFN- ⁇ will be used to attempt the in vitro enhancement of MHC Class U expression on the bovine tissue culture cells utilising monoclonal antibodies against cattle MHC Class ⁇ (Fitzpatrick, J.L., Mayer, S.J., Vilela, C, Bland, P.W. and Stokes, CR. (1994). Journal of Dairy Science, 77, 2940).
  • Bovine IFN- ⁇ has been shown to increase the functional capability of mammary gland neutrophils against S.aureus (Sordillo, L.M., Sinder, M., Hughes, H., Afseth, G., Campos, M. and Babiuk, L.A. (1991). Journal of Dairy Science, 74, 4164).
  • the area of tissue specific expression has, and continues to generate, considerable interest as a tool in gene therapy and in the production of therapeutic agents for interspecies administration. This area holds great promise in the development of polyvalent recombinant vaccines directed against specific diseases in different target organs, resulting in a more appropriate local immune response to a systemically administered vaccine.
  • the mammary gland and mastitis form an ideal model for investigation of this principle as a long standing problem associated with vaccination against mastitis has been the generation of an appropriate immune response (Yancey, R.J. (1997). Proceedings of the British Mastitis Conference, 36).
  • LTR long terminal repeat
  • MMTV mouse mammary tumor virus
  • the D ⁇ A fragment encoding the MMTV mammary enhancer region (Mink, S., Hartig, E., Jennewein, P., Doppler, W. and Cato, A.C.B. (1992). Molecular and Cellular Biology, 12, 4906) will be engineered in front of a CMV promoter driving the expression of enhanced green fluorescent protein (EGFP) (in collaboration with Dr G. Banting) as an easily assessable marker of expression in primary and adapted cell lines of differing origin, including HCl 1 (in collaboration with Dr J. Fitzpatrick). This will confirm the specificity of this enhancer fragment in the bovine mammary environment. Recent studies by the author have demonstrated that EGFP will express in bovine cell lines.
  • EGFP enhanced green fluorescent protein
  • bovine ⁇ -lactalbumin Vilotte, J.L., Soulier, S., Mercier, J.C., Gaye, P., Hue-Delahaie, D. and Furet, J.P. (1987). Biochimie, 69, 609), ⁇ -lactoglobulin (Alexander, L.J. (1994). Bovine b-lactoglobulin gene. Unpublished data) or butyrophilin (Davey, H.W., Ogg, S.L., Husaini, Y., Snell, R.G., Korobko, I.V., Mather, LH. and Wilkins, R.J.
  • Bovine Herpesvirus 1 as a live virus vector for expression of foreign genes. Virology, 190, 666
  • Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.
  • a Mammary Cell-Specific Enhancer in Mouse Mammary Tumour Virus DNA is Composed of Multiple Regulatory Elements Including Binding Sites for CTF/NF1 and a Novel Transcription Factor, Mammary Cell-Activating Factor. Molecular and Cellular Biology, 12, 4906
  • Cardioviral Internal Ribosomal Entry Site is Functional in a Genetically Engineered Distronic Poliovirus. Nature, 356, 255 Moreira, R. and Noren, C. (1995). Biotechniques, 19, 56
  • Lactoferrin a component of nonspecific defense of the involuting bovine mammary gland, in: The Ruminant Immune System, ed. J.E. Butler Plenum Press, ew ork 535.
  • Bovine milk lymphocytes display the phenotype of memory T cells and are predominantly CD8+.
  • Bovine interferon alpha genes Structure and expression. Journal of Biological Chemistry, 260, 5498
  • Plasmid insertion vectors that facilitate construction of he ⁇ es simplex virus gene delivery vectors Gene, 154, 123

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A bovine herpesvirus 2 based vector, a method of construction thereof and method of treatment using such a vector are described.

Description

BOVINE HERPESVIRUS 2 (BHV-2) BASED VECTOR AND ITS USES
Technical Field
This invention relates to a bovine herpesvirus 2 vector (bovine mammilitus virus; BHV-2)-based delivery system. More particularly, the present invention relates to a viral vector usable as a delivery system, a method for the construction of the vector and to use of the vector in a method of treatment. In particular, the invention relates to a vector for use in or as a vaccine against mastitis.
Background Art
Mastitis remains the most important infectious disease of the modern dairy cow, with an annual loss to the worldwide dairy industry of several billion dollars per year. On an individual cow basis, various estimates have been made of the cost of a case of mastitis. Calculations based on the current UK milk price (Bradley, 1998) and estimates made in the Daisy Report of 1996 would suggest a cost of between £66 and £1758 for a mild and fatal case respectively. These figures illustrate the importance of mastitis to the industry.
Both Gram positive and Gram negative bacteria are recognised causes of bovine mastitis. Classically these organisms have been classified as either 'contagious' or 'environmental' organisms. In essence, the contagious pathogens can be considered as organisms adapted to survive within the host, in particular within the mammary gland; they are capable of establishing sub-clinical infections which typically manifest as an elevation in the somatic cell count (white blood cell count) of the milk from the affected udder quarter. In contrast the environmental pathogens are best described as opportunistic invaders of the mammary gland, not adapted to survival within the host; typically they will 'invade', multiply, engender a host immune response and will be rapidly eliminated. The major contagious pathogens comprise Staphylococcus aureus, Streptococcus dysgalactiae and Streptococcus agalactiae, and the major environmental pathogens the Enterobacteriacae (particularly Esherichia coli) and Streptococcus uberis. Of the contagious pathogens S. aureus is currently the most intractable, with significant numbers of quarters subclinically infected with the pathogen. Worldwide, to date, the disease has been controlled by a combination of two procedures aimed at the organisms within the host, the use of antibiotics and vaccines, and many procedures aimed at controlling the organisms outside the host. The control of the organisms in the environment, although useful, is difficult due to the increase in sophistication and intensification of husbandry techniques. Additionally, the resistance of bacterial species to antibiotics is an inevitable and undesirable consequence of their level of use. Improvements and the development of a successful vaccination strategy are now looked to for mastitis control. The immune system of a dairy cow is normally quite capable of dealing with both commensal and environmental bacteria, however, the stress of milking and husbandry breaks the balance between the organisms and an effective immune response. Therefore, techniques which increase the level of specific immunity are useful in prevention of mastitis.
The mammary gland is essentially a highly specialised apocrine sweat gland, of ectodermal origin and immunologically should be considered along with other mucosal surfaces. The bovine mammary gland has two levels of defence; innate (non-specific) immunity and specific (aquired) immunity. The innate immunity of the mammary gland is the primary defence, relied upon in the early stages of challenge and directed non-specifically at any invading pathogen. If 'overwhelmed' this defence is supplemented by specific immune mechanisms directed against individual organisms (and, in fact, against individual components of those organisms).
The innate immunity of the mammary gland comprises the physical barrier of the teat canal, macrophages, neutrophils, natural killer (NK) like-cells and other soluble anti-microbial substances (e.g. lactoferrin). The specific mammary immunity is mediated via antibodies which by linking with the Fc receptors of neutophils and macrophages can result in the phagocytosis and destruction of microbes. This phagocytosis is often augmented by a similar link between complement coating the microbe and the C3 receptors on the leucocytes. The ability of certain lymphocytes to 'memorise' pathogenic antigens allows the augmentation of this specific response following repeated exposure to the antigen (therein lies the theory behind vaccination).
The Cellular Defenses The cellular component of the mammary defence provides both innate and specific protection against infection. The somatic cell count (SCC) of milk is made up of neutrophils, macrophages, lymphocytes and some epithelial cells; the 'consumer' is placing downward pressure on the SCC levels in milk which will inevitably place the innate immune system under strain, artificially increasing the importance of the specific immune response. Evidence of this scenario is already arising; Schlam (Schlam et al, 1964) showed that a SCC in excess of 250,000/ml protected against E. coli mastitis and Miltenburg (Miltenburg et ah, 1996) showed an increasing incidence of mastitis associated with a decreasing SCC, suggesting that lowering of the innate immunity increases the risk of clinical mastitis. Another important factor influencing the outcome of an intramammary challenge is the speed of leukocyte migration into the mammary gland. Hill (1981) demonstrated an increased severity of disease following intramammary challenge with E. coli when the speed of leukocyte migration was decreased. However conflicting evidence has been provided by Shuster et al. (1996) which suggests that speed of migration is less important. The most likely explanation is that there is a 'trade off between SCC at the time of microbial invasion and the subsequent speed of leukocyte migration, coupled with an as yet unresolved contribution of the different leukocyte sub-populations. If this early migration of leukocytes successfully controls the bacterial invaders then the SCC rapidly returns to normal. However if the bacteria become established and prolonged periods of inflammation occur there are severe implications for the quality and quantity of milk produced (Harmon and Heald, 1982; Sordillo and Nickerson, 1988).
Macrophages are the main leukocytes found in the healthy mammary gland (Lee et ah, 1980; Jensen and Eberhart, 1981; Harmon and Heald, 1982; Sordillo and Nickerson, 1988). Neutrophils are the main leukocytes present in the mammary gland at times of inflammation and can constitute >90% of the total cells (Paape et al. , 1981; Sordillo et al. , 1989; Sordillo et al. , 1998). They are non-specific and migrate into the gland in response to the inflammatory mediators (Persson et a , 1993; Baumann and Graudie, 1994), and their action is primarily to phagocytose and destroy invading bacteria. Unfortunately these phagocytic cells will also non-specifically 'ingest' fat globules and other milk components (Sordillo and Nickerson, 1988); thus decreasing their efficiency when compared to blood leukocytes (Paape et al. , 1981 ; Weber et al. , 1983; Sordillo and Babiuk, 1991). The efficiency of neutrophils appears to be further compromised during the 'high risk' periparturient period (Paape et al. , 1981 ; Weber et al. , 1983).
Specific (Aquired) Immunity Soluble Defences
The specific soluble defenses (humoral response) of the mammmary gland comprise the immunoglobulins (Igs). These specific immunoglobulins interact with other non-specific soluble and cellular components of the immune system along a series of complex pathways yet to be fully elucidated.
IgGi, IgG2, IgA and IgM all have a role in the mammary immune defence. The concentrations of these different classes of Ig varies through the lactation with all peaking around calving - coinciding with colostrum production (Sordillo et al. , 1998). IgGi is the predominant Ig in milk however there is evidence for the transport of IgG2 by neutrophils to sites of inflammation which may make this Ig relatively more important (Musoke, Rurangirwa and Nantulya, 1987). IgGi, IgG2 and IgM have been shown to act as bacterial opsonins, increasing the efficiency of phagocytosis, and also fix complement (Howard et ah, 1980). In contrast the precise role of IgA in the bovine mammary gland is a subject of much debate. It may interfere with IgG or IgM mediated complement fixation and may actually enhance the binding of bacteria to fat globules (Hibbit, Craven and Batten, 1992). In porcine and human milk, IgA, in conjunction with complement and lysosyme has been shown to have bactericidal activity against E. coli (Sordillo et al. , 1997); there is no evidence for this activity in cattle.
Cellular Defences
A host of different cells play a part in the cellular arm of the specific mammary immunity. Macrophages are involved in the processing and presentation of antigen in association with major histocompatability complex (MHC) class π, a process required for the recognition of foreign antigens by lymphocytes. Levels of expression of MHC-class II are low in the bovine mammary gland (Fitzpatrick et al. , 1994). The lymphocytes are the cells responsible for specific recognition and 'memory' of microbial antigens. They can be divided into two groups, T-cells and B-cells. T-cells can be further subdivided into αβ (CD4+ and CD8+) and γδ lymphocytes.
CD4+ (T-helper) cells are primarily involved in regulating the other immune cells (e.g. lymphocytes, macrophages); a regulatory control mediated mainly via cytokines. CD4+ cells are activated by recognition of antigen-MHC complexes on antigen presenting cells. The ratio of CD4+ to CD8+ cells is reversed in the mammary gland as compared to the peripheral circulation (Park et ah, 1992). The exact role of CD8+ cells in the mammary gland has yet to be resolved. These cells can act as 'suppressor' or 'cytotoxic' cells, and it appears the relative importance of these two phenotypes varies through the lactation cycle (Sordillo et ah, 1997). Mid-lactation secretion contains a higher proportion of cytotoxic type cells and peri-parturient secretions an increased proportion of suppressor type, immunomodulatory cells (Sordillo et /.,1997). CD8+ cells may also have a 'housekeeper' type function in scavenging and removing old and damaged secretory cells (Taylor et ah, 1994).
γδ lymphocytes have been the subject of much debate. They are expressed at higher levels, compared to blood, in the mammary secretions and the fact that they are found at the lowest levels when the mammary gland is at its most susceptible to disease might suggest that they play a pivotal role in the mammary immune defence.
Natural Killer (NK)-like cells are large, granular, non-immune lymphocytes which possess cytotoxic ability in the absence of MHC. However they can mediate antibody-dependant cell-mediated cytotoxicity (ADCC) via Fc receptors. The importance of NK cells in protecting the mammary gland from bacterial invasion has not been fully established. However, work by Sordillo et al (1991, 1996) demonstrated an as yet unexplained enhanced ability of lymphocytes to kill S. aureus when stimulated with IL-2, suggesting an important role in mammary defence.
β-lymphocytes are present in the mammary gland at relatively constant levels (Duncan et ah, 1987). Their role is to produce antibody in response to presented antigen. They can, in addition to the more classical antigen presenting cells, process and present antigen in conjunction with MHC-class II to T-cells which subsequently secrete IL-2 which in turn stimulates the B cell to divide and differentiate into antibody producing plasma cells and memory cells.
Cytokines
The cytokines are a group of biologically active peptides involved in the regulation of the immune response. They are produced by a large number of cells including lymphocytes, monocytes and macrophages. Any individual cytokine can interact with a large number of cells and other cytokines in a complex series of pathways yet to be fully understood.
The majority of research to date has been directed at the interleukins (IL), colony stimulating factors (CSF), interferons (IFN) and tumour necrosis factors (TNF). IL-2 has been shown to increase bacteriocidal potential of lymphocytes (Sordillo et αZ.,1991), increase plasma cell numbers (Nickerson et /.,1989), enhance mammary mononuclear cell proliferation (Torre et ah, 1992) and has been shown to be an effective vaccine adjuvant (Pighetti and Sordillo, 1994). Its main disadvantage is that it has a narrow therapeutic index in the mammary gland (Sordillo et α/.,1991), though it is worthy of note that many of its actions are mediated via IFN-γ. Immunomodulatory functons of the colony stimulating factors have also been demonstrated in the mammary gland (Nickerson et /.,1989; Reddy et a/., 1990; Kehrli et α/.,1991; Sordillo, 1992; Sordillo et /.,1992). TNF-α has been implicated in the mediation of endotoxic shock concomitant with coliform mastitis (Sordillo and Peel, 1992); higher levels of production of this cytokine around the time of calving may explain the increased severity of the disease at this time.
There are a number of different immune interferons, namely α, β, and γ. DFNs -α and -β are derived from leukocytes and fibroblasts whereas IFN-γ is derived from activated T-lymphocytes. IFN-γ has a wide range of effects within the mammary gland, and has been shown to enhance neutrophil phagocytosis and bactericidal activity (Sordillo and Babiuk, 1991) as well as being demonstrated as an effective mastitis vaccine adjuvant (Sordillo et /.,1991). Recombinant (r) bovine IFN-γ has also been shown to up-regulate the expression of MHC-class II expression in the mammary gland from its constituitively low levels (Fitzpatrick et /.,1994). rIFN-γ has also been shown to reverse the suppressive effects of mammary gland secretions by significantly increasing the ability of mammary neutrophils to combat S. aureus (Sordillo and Babiuk, 1991). Finally, and probably most importantly, rIFN-γ has been shown to have a broad therapeutic index in the bovine mammary gland with doses as high as 105 U per quarter not adversely affecting milk quality or mammary gland function (Fox et ah, 1990).
The Mucosal Immune System
Unlike other species, there is no evidence for significant trafficking of immune cells (lymphocytes) between the gut and other mucosal surfaces (in particular the mammary gland) in the dairy cow. Studies have shown that lymphocytes from the supramammary lymph nodes recirculate via the prescapular lymph node (Kenny, Bastida-Corcvera and Norcross, 1992). Evidence from sheep suggests the existence of two discrete groups of circulating lymphocytes - a peripheral and an intestinal pool (Kenny, Bastida-Corcvera and Norcross, 1992). However oral administration of antigen will result in IgGi production and subsequent increases in serum and lacteal IgG levels.
To date, attempts at vaccination against mastitis have focused on the traditional approach of delivering the antigens of a particular microorganism either as a crude unfractionated preparation or in a variety of better defined preparations, optionally combined with an immunoadjuvant, either systemically or locally. In addition, there is now clear evidence that the active lactating gland of a dairy cow lacks the full immune system repertoire necessary for a truly effective immune response, for example it has been found that this gland lacks, MHC class 2 expression proteins.
Historically immunisation has had little to contribute to the control of bovine mastitis despite despite huge research efforts being directed toward achieving the efficient mastitis vaccination, but with rather disappointing results to date. The problem has centred around the ability of any candidate vaccine to engender a protective immune response at the mucosal surface. Any successful candidate vaccine will have to have the ability to prevent mastitis, intramammary infection (IMI) and eliminate pre-existing subclinical infections. To date no vaccine has yet managed to decrease the incidence of intra-mammary infection, though some benefit has been achieved in the control of the systemic signs of disease.
In considering developing any approach to mastitis vaccination, the immunological deficiencies of the bovine mammary gland must be considered. Other areas worthy of consideration are the 'stresses' the modern dairy cow is placed under; she almost certainly undergoes periods of decreased immune function, especially around calving, when proliferative responses to mitogen are suppressed (Kehrli et ah, 1989) which need to be addressed in the development of any vaccine, as do the huge volumes of milk produced by the high producing cow.
The route of administration of any potential vaccine is also a consideration. Systemic immunisation will result in the generation of serum antibodies, which will only come into play following establishment of an intramammary infection (BVH) (i.e. too late). Intra-mammary application of antigen will result in the production of a local secretory antibody response with production of IgGi and IgA (Kenny, Bastida-Corcvera and Norcross, 1992), but as discussed earlier, the importance of these latter Igs in the mammary gland is not fully established. It is interesting to note that such responses are most prolific when the dry, innvoluted gland is vaccinated. Vaccination in the region of the supra-mammary lymphnode will stimulate both local and systemic responses by virtue of lymphocyte recirculation (Kenny, Bastida-Corcvera and Norcross, 1992), and may hold promise as a route of choice.
One major perceived difficulty of effective mastitis immunisation has been the need to generate an immune response. The body's natural defence is to attack, engulf and destroy invading pathogens with phagocytic cells - a process which results in inflammation - and as mastitis is inflammation of the mammary gland vaccination would, in itself lead to mastitis'. This is an issue that has to be addressed as preventing mastitis with a conventional immune response is of no benefit, unless the 'cell counts' produced by that response are shorter lived and less deliterious on future milk production. This dilemma has probably been the main reason behind the research route taken thus far for mastitis vaccination, and has influenced the products which have reached the marketplace. Two vaccines against bovine mastitis have been developed in the US and are commercially available in other parts of the world where they are used with apparent commercial success. Both these vaccines are directed against toxic bacterial components and are directed against E. coli and S. aureus in particular and are discussed below.
The J-5 E. coli bacterin was designed to produce neutralising activity to the toxic portion of the bacterial lipopolysaccharide (Gonzalez et α/.,1989) and is derived from the rough E. coli mutant Ol l:B4. This strain is a uridine diphosphogalactose 4-epimerase deficiet mutant that has an LPS devoid of O antigen; this allows the generation of antibodies to the core region, which then show a degree of cross protection for other Gram negative organisms (Hogan et αZ.,1992). Use of this vaccine has been shown to decrease the incidence and clinical severity of coliform mastitis (Hogan et α/.,1992) but the prevalence of infected quarters at calving is not reduced following vaccination in the dry period (Hogan et al., 1992).
A S. aureus vaccine has also been developed, and is again designed to neutralise toxin activity (Tyler et /.,1993). It is commercially available in the US but appears to be of limited value, and has yet to be subjected to widespread independant clinical trials (Tyler et ah, 1993). A number of other S. aureus vaccines have been proposed in an attempt to control 'Staph' mastitis (Yoshida et α/.,1984; Frost and Mattila, 1988), and it has been postulated that capsular antigens may be of importance (Yoshida et /.,1984). Factors which allow staphylococci to adhere to mammalian tissue offer potential as vaccine components. Epitopes from S. aureus fibronectin binding protein (FnBP) have been shown to confer protection to experimental infection in mice (Mamo et α/.,1994) and apparently cattle. However the multifaceted 'attack' strategy of the staphylococci (e.g. adherence to fibronectin, fibrinogen and toxin production) probably means that a vaccine against any one antigen is unlikely to be fully protective.
The only other mastitis pathogen currently receiving significant research effort is Streptococcus uberis. Work at the Institute of Animal Health, Compton has investigated the use of a live S. uberis vaccine (Finch et /.,1997), and work in the US has focused on the role of the PauA antigen which has shown promise when used as a recombinant peptide (Yancey, 1997). Recombinant DNA technology has made it possible to retain the advantages inherent with live vaccines (capacity to replicate in the host and to engender an effective immune response) whilst avoiding the problems of reversion and/or pathogenicity, by inserting and expressing heterologous genes in a number of vector viruses. Several such expression vectors have been used in cattle, such as vaccinia virus, bovine herpesvirus 1 (BHV-1), bovine papillomavirus, retrovirus and adenovirus (Yilma, 1994). The herpes viridae have been recognised as potential viral vectors for some time and extensive research has been directed towards their use both as vaccines and as delivery vectors for gene therapy (Efstathiou and Minson, 1995).
BHN-1 has been extensively investigated and developed as a recombinant vector (Bello et al.,1992), and has been specifically investigated as a potential approach to Foot and Mouth Disease vaccination (EP-A-0471457 Νovagene, Inc. et α/., 1998; WO94/24296 University of Saskatchewan; EP 0663403 Akzo Novel N.V.).
A relatively new approach to recombinant vectors has been the insertion of cytokine genes into live, replication competent, recombinant viruses; the rationale behind this approach has been to allow enhancement and modulation of the immune response. This approach has been used to insert IL-2 into vaccinia. This recombinant virus was shown to protect athymic mice from progressive vaccinia infection (Flexner et αZ., 1987). Further experiments demonstrated that the insertion of an influenza haemaglutinin gene into this vaccinia/IL-2 recombinant produces a double recombinant vaccine which will also protect mice against influenza (Flexner et ah, 1988). Additional evidence has indicated that IFN-γ is the major cytokine inducing this effect after immunisation with the vaccinia/IL-2 recombinant (Karupiah et ah, 1990). Studies have also demonstrated the efficacy of recombinant viridae in the face of pre-existing immunity to either the vector or the heterologously expressed antigen (Flexner et ah, 1988).
BHV-2 is a member of the dsDNA herpesviridae family and is quite distinct from BHV-1. It is the second of five known members of the family of herpes viridae affecting cattle. BHV-2 is not the cause of any major clinical problem in cattle and there is no evidence for transmission to man in the field situation, though in vitro infection of a human respiratory cell line has been reported (May and Orders, 1993). This is interesting as BHV-2 is one of the few non-human herpesviruses that show substantial nucleotide homology with human HSV- 1 ; the conserved regions in the HS V-2 tk (thymidine kinase) gene are more closely related to the HSV- 1, HSV-2 and VZV genes than to BHV-1 (Sheppard and May, 1989). The use of BHV-2 in the prevention or treatment of herpes simplex infection in humans is claimed in US 5066492.
BHV-2 is useful as a vector on the basis of its proclivity for the mammary gland (Karupiah et ah, 1990), the relatively mild/non-existant clinical signs associated with infection (cf. BHV-1) (Turner et ah, 1976), its high prevalence in the bovine population and its narrow host range (Cilli and Castrucci, 1976) and its potential ability to carry large amounts of exogenous DNA (Efstathiou and Minson, 1995). One potential advantage of using a herpesvirus is their tendency to become latent within the host (Martin and Scott, 1979), leading to the possible scenario of re-vaccination at times of stress by reactivation of the latent virus - which would likely occur in the freshly calved cow, correlating neatly with the period of greatest risk from mastitis infection (Bradley and Green (1998).
The BHV-2 gene can be modified by insertion of novel restriction sites, these restriction sites will not only facilitate insertion of the heterologous DNA of interest but will also serve to insert a 'frame-shift' into the tk region further decreasing the risk of reversion of the recombinant virus to the wild-type.
It is known in the art that it is desirable to be able to target the delivery of xenobiotics to a predetermined site in order to minimize contra-indications or side-effects. It is also known that viruses attach to specific areas of their host organisms. Recently, therefore it has been proposed to exploit the method of viral binding to a host cell in order to be able to deliver and, more specifically, to target delivery of xenobiotics including drugs, hormones, genetic material, antibodies and the like into host cells.
Disclosure of Invention
The present invention provides a bovine herpesvirus-2 (BHV-2) based vector, that is to say a vector comprising sequences derived from BHV-2, and comprising at least one cytokine-encoding DNA sequence. The vector may also comprise the entire BHV-2 genome. BHV-2 is a DNA virus with a phase of post-infective latency which can be used to advantage in the vector of the present invention since reactivation will occur in times of stress by reactivation of the latent virus - which would likely occur in the freshly calved cow, correlating neatly with the period of greatest risk from mastitis infection (Bradley and Green (1998)).
The invention also provides delivery systems comprising BHV-2 based vectors.
A preferred cytokine is bovine γ interferon (IFN-γ) on the basis of its ability to upregulate the low constitutive MHC Class π expression of bovine mammary gland epithelial cells which are believed to play a major role in the processing and presentation of antigen to T-cells in the mammary gland (Fitzpatrick et al.,1994), and its broad therapeutic index in the bovine mammary gland (Fox et αZ.,1990). IFN-8 has also been demonstrated to be a potentially effective adjuvant in bovine mastitis vaccination (Sordillo et αZ.,1991). IFN-γ has also been shown to have beneficial effects against bacterial challenge, protecting against systemic manifestations of coliform mastitis in vivo (Sordillo and Babiuk, 1991).
Wild-type BHV-2 may be used to facilitate production of a viral vector; however, preferably only selected sequences of the BHV-2 genome are used. For example, the thymidine kinase sequence or glycoprotein sequences may be used. Advantageously, at least a portion of the thymidine kinase (tk) sequence is used since it represents an essential virulence factor and, mutants lacking functional tk genes can be positively selected in vitro. The selected gene sequence may be manipulated to allow insertion of recombinant DNA, most preferably an expression cassette expressing a cytokine gene and bacterial antigen gene. The position and sequence of the tk region of BHV-2 has been published (Sheppard and May, 1989).
Preferably, a frame shift mutation is engineered into the vector gene sequence thereby decreasing the risk of a reversion of the vector to the wild-type. Preferably, the design and method of construction of the vector allows the insertion of a number of recombinant constructs which can be expressed within the host cell.
Additionally, predetermined restriction endonuclease sites may be positioned in the DNA sequence of the vector to allow further manipulation of the vector. Most preferably, a combination of restriction endonuclease sites and frame shift mutations are engineered into the DNA sequence of the vector.
Genes encoding deactivation of the virus, for example so-called "suicide" genes may also be introduced into the DNA sequence of the vector in order that their activation or inactivation will render the vector unviable. Examples of such genes are disclosed in Martin LA, Vile R 1997 Lancet 350 1793; Wallach, D. 1997 Nature 388 123; Hengardtner, M. Nature 1997 388 714; Jost CA Marin MC et al 1997 Nature 389 191;Franke, TF & Cantley, IC. Nature 1998 390 ,196
Preferably, further genetic material can also be inserted into the vector in order that the vector can deliver said genetic material to the host cell. For example, genes encoding antigens or marker genes can be inserted into the vector.
Additionally, xenobiotics such as drugs or hormones (including pro-drugs or pro-hormones) may be attached to the vector, for example by affinity binding or by chemical attachment. In this manner, the attachment of the vector to the target cells may be exploited to facilitate delivery of the xenobiotic.
Advantageously, such inserted genetic material or protein is expressed on expression of the vector in an infected host. For example, genetic material encoding proteins expressed by pathogenic bacteria may be inserted into the vector. Such proteins include fibronectin binding protein from Staphylococcus aureus, or other core antigens or surface antigens from other pathogenic bacteria, for example Streptococcus agalactia, Streptococcus dysgalactia, Streptococcus uberis or Escherichia coli. Fibronectin binding protein (FnBP) from Staphylococcus aureus may be used as an appropriate bacterial antigen as the gene from a human strain has been cloned, sequenced, expressed and used in pilot vaccination studies in mice which have shown production of protective antibodies (Mamo et al. , 1994). The binding domains of FnBP have also been identified (Signas et ah, 1989) and it is intended to only amplify this region of the bacterial gene and then to attach this to the signal sequence of bovine α interferon in an attempt to achieve secretion of a prokaryotic protein by a eukaryotic system. Such genetic material encoding antigens may be inserted singly, doubly, or as a polyvalent construct. Substantial research has been directed towards the mechanisms utilised by RNA viruses to minimise their genome size. This research has identified short sequences (Internal Ribosomal Entry Sites (IRES)) directing initiation of translation by the ribosome which have been shown to function in both RNA and DNA viruses and plasmids (Molla et al. , 1992). Preferably, an IRES can be used to drive expression of one or more, preferably all the antigen, marker, cytokine and viral deactivation genes from the same viral promoter.
Gene 'switches' may be used to control the expression of genes by the recombinant viridae, and as a potential way of re-activating latent virus. For example, if it was found to be advantageous to express two cytokines consecutively rather than contemporaneously, then the ability to vaccinate with a recombinant virus expressing one cytokine constituitively and another under the control of a switchable promoter could prove useful. One such switchable promoter would be the Tet On Off system (Gossen, M. and Bujard, H. (1992). 9, 5547;Gossen, M. (1995). Science, 268, 1766). Other gene switching systems may be used. The other application for this type of system would be the re-activation of latent virus by the 'switching on' of genes responsible for recrudescence of latent virus.
The present invention also provides a method of manipulating a mammalian cell to express a bacterial protein. Hence, it is possible to obtain expression of prokaryotic protein in eukaryotic host.
Thus, the invention provides a method of expressing prokaryotic proteins in eukaryotic hosts, the method comprising inserting bacterial genetic material into viral DNA and inserting the viral DNA with bacterial genetic material therein into a eukaryotic host, such that the bacterial protein is expressed in the eukaryotic host. The host may be an isolated cell, a cell culture or even a whole animal. Preferably, the host is a mammal, most preferably ruminants, especially cattle, sheep, goats, horses, pigs, dogs, cats and humans.
In a further aspect, the invention also provides methods of treatment using BHV-2 based vectors. The invention also provides recombinant viruses formed using the BHV-2 based vectors of the invention.
The BHV-2 based vectors of the invention may be used in the prevention or treatment of diseases in animals, particularly cattle or ruminants or other animals susceptible to infection by the wild-type pathogens such as sheep or goats. Particularly, the vectors of the invention may be used in the treatment or prevention of all mucosal diseases, especially, mammary diseases of mammals, more preferably ruminants especially cattle, sheep, goats, & horses; pigs, dogs, cats and humans.
According to another aspect of the invention, there is provided a vaccine comprising a vector or recombinant virus according to the invention.
In order to construct such a vaccine against mastitis, wild-type BHV-2 has been engineered to facilitate its use as a recombinant vaccine vector. Particularly, the thymidine kinase (tk) gene has been engineered to allow the insertion of recombinant constructs. Novel restriction endonuclease sites together with frame shifts have been engineered into the tk gene thereby allowing manipulation of the genome and decreasing the risk of reversion of the recombinant strain to the wild-type. The present inventors have constructed expression cassettes for insertion into BHV-2. Such cassettes allow the production of γ-interferon (by insertion of γ-interferon gene) under the control of a cytomegalovirus (CMV) promoter/enhancer. Additionally, the fibronectin binding protein from Staphylococcus aureus under the control of a Rous Sarcoma virus (RSV) promoter/enhancer and the α-interferon signal sequence can be inserted into the viral genome to produce an effective vaccine against bovine mastitis. The β-galactosidase marker gene (under the control of a SV40 promoter/enhancer) has also been introduced to facilitate selection of recombinant virus in vitro.
The present inventors have also constructed expression vectors, both eukaryotic and prokaryotic, to enable stable, high copy number, episomal expression thus facilitating the construction of recombinant viridae usable as vectors. It is also possible to design such constructs to prevent the incorporation of antibiotic resistant genes into the recombinant virus. Recombinant viral vectors have the useful capability to carry large amounts of foreign DNA facilitating the possibility of polyvalent vaccination.
Preferably, additional cytokines for example interleukin-2 (IL-2) or interleukin-4 (B -4) can be inserted into the vector for production of vaccines. Alternatively, genes encoding for different antigens from different mastitis pathogens, either singly or in combination, can be used for example Lipopolysaccharide (LPS), J5 core antigen, and other bacterial surface antigens may be used.
Preferably, a combination of the BHV-2 thymidine kinase sequences and glycoprotein sequences may be used to construct a polyvalent vaccine, that is a vaccine which vaccinates against more than one pathogen. Such a vaccine may also include sequences encoding γ-interferon, as an adjuvant, and fibronectin binding protein from, for example, Staphylococcus aureus, together with promoters, for example from CMV, RSV or SV40.
Methods of producing recombinant viridae are well established (see for example Rixon F.J., McLauchlan J. Herpes Simplex Virus Vectors in Molecular Biology A Practical Approach. Eds. Davidson A.J. & Elliot R.M. Elsevier). However, it is preferred to produce recombinant viridae usable as the vector of the invention, with high efficiency using plasmids which will replicate to high copy number within an eukaryotic cell, for example using plasmids containing Epstein-Barr anti-nuclear antigen or large T antigen of SV40 virus.
Additionally, the combinations of promoters and enhancers may be varied in order to control the levels of expression of the encoded proteins. For example, a preselected combination of promoter and enhancer may provide high levels of expression.
Therefore, the present invention provides a universal viral vector for delivering both cytokine and bacterial genes to mammals such as cattle. Particularly, the vector comprises BHV-2 in a replicating recombinant form which may show post-infective latency within the host animal and also has the ability of upregulating an immune response. For example, the ability of the virally infected eukaryotic host cells to produce both cytokines for example, γ-interferon, interleukin-2, or interleukin-4, which up-regulate immune responses to particular immunogens, for example, fibronectin binding protein from Staphylococcus aureus, pauA of S. uberis or LPS or K85 from E.coli. Such a vaccine may lead to a putatively increased immune response to a pre-selected antigen epitope.
The vectors of the present invention may be used in the treatment of mammary diseases, particularly breast cancers, in other mammals. BHV-2 has a similar aetiology to herpes simplex viruses in humans and therefore use of this vector may extend to treatment of breast cancers in humans.
Methods of introducing the delivery system into a host animal include topical application, for example by excoriation, intravenous injection, mucosal application (for example oral, nasal, vaginal), subcutaneous injection, intramuscular application, supramammary application, or intramammary application. Additionally, the use of a DNA gun (Tang D C Devert MJ & Johnston SA Genetic Immunisation, 1992 Nature 356 152; Finer E.F. Webster R.G. 1993 Proc Natl Acad Sci. USA 90 11478; Prayaga SK, Ford MJ, Haynes R 1997 Vacines 15 1349) may allow application of recombinant viral DNA or expression vector DNA into a host cell or animal.
Preferably, in construction of the vector, internal ribosomal entry site sequences can be used to allow more than one recombinant protein to be expressed under the control of one promoter or enhancer. Optionally, variation in the combinations of promoter or enhancer may be used to vary levels of expression of the recombinant protein. Additionally, it is desirable to use constitutive BHV-2 promoter sequences to control expression of recombinant proteins.
Preferably, the recombinant virus used as the vector of the invention incorporates a marker gene, for example that encoding β-galactosidase, lucciferase or green fluorescent protein, whereby presence of the virus in the cells of the host animal can be determined by removing cells from the host animal and assessing expression of the marker gene. For example, cells expressing the β-gal gene will stain blue with β-galactosidase and can therefore be identified.
Therefore, the invention further provides a method of determining the level of uptake of the vector by a host animal. Advantageously, this can be used to give an indication of the efficacy of the vector system. Brief Description of the Drawings
Vectors and vaccines in accordance with the invention will now be described, by way of example only, with reference to the attached drawings Figures 1 to 3 in which:
Figure 1 is a flow diagram of the steps taken in constructing the vector; and
Figure 2 is a schematic illustration of the construction of a vector of the present invention; and
Figure 3 is a schematic illustration of a vector constructed according to Fig. 2; and
Figure 4 shows a sequence alignment; and
Figure 5 shows a peptide sequence alignment; and
Figure 6 shows a sequence alignment; and
Figure 7 shows a sequence alignment; and
Figure 8 shows a sequence alignment; and
Figure 9 shows a sequence alignment; and
Figure 10 shows a sequence alignment; and
Figure 11 shows a sequence alignment; and
Figure 12 shows an SDS-PAGE of products of prokaryotic over-expression; and
Figure 13 shows an SDS PAGE of purified products of prokaryotic over-expression; and
Figure 14 shows an SDS PAGE of 'wash through' prior to elution of purified products; and
Figure 15 is a graph showing the binding of bovine fibronectin to recombinant fibronectin binding protein (binding domains); and
Figure 16 shows a western blot; and Figure 17 shows dot blots of Mabs against recombinant protein; and
Figure 18 is a schematic illustration of the construction of recombinant pEGFP-HH-IFN; and
Figure 19 is a schematic illustration of the recombinant pEGFP-HH-IFN; and
Figure 20 is a schematic illlustration of the construction of the recombinant pEGFP-HH-FnBP; and
Figure 21 is a schematic illustration of the recombinant pEGFP-HH-FnBP; and
Figure 22 is a schematic illustration of the construction of the recombinant pIRES-IFN; and
Figure 23 is a schematic illustration of the construction of the double recombinant pEGFP-HH-FnBP-FN; and
Figure 24 is a schematic illustration of the recombninant pEGFP-HH-FnBP-IFN; and
Figure 25 shows the fluorescence of Cos7 cells transfected with the plasmid pEGFP-HH-IFN; and
Figure 26 shows the fluorescence of Cos7 cells transfected with the plasmid pEGFP-HH-FnBP; and
Figure 27 shows the fluorescence of Cos7 cells transfected with the plasmid pEGFP-HH-FnBP-IFN; and
Figure 28 shows a western blot; and
Figure 29 shows a western blot; and
Figure 30 shows a western blot; and
Figure 31 shows a western blot; and Figure 32 shows a simplified plasmid map of the vectors to be used in construction of recombinant viridae; and
Figure 33 shows a simplified plasmid map of the vector to be used in construction of recombinant viridae.
1. Modes of Carrying Out the Invention
Example 1
Using vector pUC18, a functional region of the thymidine kinase gene of bovine herpesvirus-2 (BHV-2) strain New York 1 from ATCC was cloned and sequenced with a frame shift mutation in the thymidine kinase region; such a frame shift decreases the risk of reversion to the wild-type. Restriction sites are then added to the construct. The thymidine kinase (tk) region is then opened at the Sma I restriction site. Bgl II and Sal I sites are then added to the construct. Both ends of the tk construct are then provided with Not I sites.
Construction of inserts for use as expression cassettes
γ-interferon cassette
(i) The bovine γ-interferon gene is cloned using pUC 18. The restriction sites Eco Rl and Hind UJ are added to either end of the γ-interferon gene. Using a prokaryotic expression vector γ-interferon is then overexpressed and monoclonal antibodies are raised against it. Ultimately, the construct is cloned into vector pCI neo (supplied by Promega) and amplified out by a polymerase chain reaction. This produces a γ- interferon cassette usable in construction of vectors.
Staphylococcus aureus fibronectin binding protein cassette
(ii) The high affinity binding domain of fibronectin binding protein from Staphylococcus aureus is cloned adding the novel restriction sites Eco Rl and Xba I at either end. The binding domains are then cloned into a prokaryotic expression vector were overexpressed and were used to raise monoclonal antibodies. The region encoding the binding domain is then attached to the signal sequence of bovine α-interferon using the Bam HI and Eco Rl restriction sites. This construct is then cloned into an expression cassette from pRc or RSV and is already cloned into pUC18.
It is further possible to insert a marker gene such as the pb gal control vector (supplied by Clontech).
It is then possible to combine the cassettes described above or combinations thereof into the tk region of the BHV-2 vector.
The vector can then be used to infect a host animal; for example a cow may be vaccinated against mastitis caused by Staphylococcus aureus using the vector produced above. Immunisation against the organism will be provided by the inserted fibronectin binding protein gene product, together with the regulation of the immune response provided by the bovine γ interferon.
Example 2
Cloning of the Bovine Herpes Virus 2 (BHV2) Thymidine Kinase Gene pUC18 (Boehringer Ingleheim) was used as a cloning vector. pUC18 contains part of the lacZ gene within which lies a multiple cloning site (MCS) into which fragments of DNA can be inserted. Insertion of a DNA fragment at the MCS disrupts the lacZ gene thereby allowing blue-white selection of colonies. E. coli clones carrying insert-containing pUC18 will appear white and E.coli clones with no inserts appear as blue colonies. The pUC18 plasmid also encodes ampicillin resistance, thus only transformed E.coli cells will survive in the presence of a penicillin type antibiotic in the growth media. The ColEl origin of replication ensures that the plasmid is replicated to a high copy number in E. coli making it ideal for the propagation of large amounts of insert / vector DNA.
The thymidine kinase gene was selected as a suitable region of the BHV-2 genome to facilitate homologous recombination of wild-type virus with the genetic material encoding the proteins of interest to be expressed by the recombinant viridae. Synthetic oligonucleotides were designed, designated tkfor and tkrev, and the polymerase chain reaction (PCR) used to amplify a 1128bp fragment of the BHV-2 thymidine kinase gene. These primers were 100% homologous to the published thymidine kinase gene sequence (Sheppard, M. and May, J.T. (1989). Journal of General Virology, 70, 3067).
Oligonucleotides were synthesised on a PerSeptive Biosystems Expedite DNA synthesiser using standard phosphoramidite chemistry, by the Department of Biochemistry's DNA synthesis and Sequencing Facility within the University of Bristol.
tkfor - 5' GCA TGC CAG CCA ATA GAA TGC TCC 3' tkrev - 5' TGC TTC TCG TTA GCG GTT TCG GGA 3'
DNA sequences were amplified by PCR (Saiki et al. , 1988) in a Perkin-Elmer Cetus DNA thermal cycler using either Taq DNA polymerase (Boehringer Mannheim / Qiagen) or the Expand™ High Fidelity PCR System (Boehringer Mannheim). Reactions were carried out in the enzyme supplier's buffer, with 0.2mM dNTPs (Boehringer). Priming oligonucleotides* were used at a working concentration of approximately 0.5μmolar). The amount of template DNA used varied from 0.001 - lμg according to the template used. Negative controls were generated by replacing the genomic DNA with an equal volume of milliQ H2O. The mixture was overlaid with mineral oil (Sigma), before cycling according to the following conditions;
94 °C - 1 minute 30 seconds (melting)
56-60 °C - 2 minutes (annealing)
72 °C - 2 minutes 30 seconds (extension) Following cycling a further soak of 10 minutes at 72 °C extended the final extension cycle ensuring generation of fully double stranded product.
The annealing temperature was governed by the estimated melting temperature of the primers used in the reaction, using the equation outlined below:
Melting Temperature (Tm) = ((ΣG + ΣC) x 4) + ((ΣA + ΣT) x 2) °C where G, C, A, T are the base constituents of the primer. An initial annealing temperature was set some 4 °C below the predicted Tm to minimise the risk of non-specific annealing of primers and subsequent generation of non-specific products.
The thymidine kinase gene fragments were amplified from BHV-2 genomic DNA using 35 cycles of PCR. Genomic viral DNA was extracted from viral particles using the Micro-Turbogen (Invitrogen) genomic DNA purification kit, using the method outlined in the manufacturer's handbook. The resulting DNA pellet was resuspended in milliQ H2O (Elgastat), before storage at -20°C. The PCR products were purified on a LMP (low melting point) agarose gel. Agarose gels containing 0.8% - 3.0% (w/v) agarose were prepared by boiling in 1 x TAE buffer (40mM Tris-acetate, ImM EDTA, pH8.5) Following cooling (to below 60°C), ethidium bromide was added to a final concentration of 0.5μg/ml prior to casting in a BRL minigel apparatus. DNA samples were diluted in loading buffer (50% (v/v) glycerol, 0.2M EDTA, pH8, 0.05% (w/v) bromophenol blue). Electrophoresis was carried out in 1 x TAE buffer at 5 - 8 V/cm. Gels were visualised under UV light and photographed or digitally captured using a gel documentation system (GS2000, UVP).
Following electrophoresis in low melting point (LMP) agarose gel and visualisation under UV light, a gel fragment, containing the DNA product of interest was excised using a clean scalpel blade. The DNA was then electro-eluted from the gel chip by placing the chip in pre-boiled dialysis tubing (clipped) with a small volume of 0.1 x TAE buffer; the DNA was then eluted from the gel chip by further electrophoresis. This latter solution was collected and further purified by phenol/chloroform extraction and two rounds of ethanol precipitation. The resulting pellet was resuspended in H2O and phosphorylated using T4 polynucleotide kinase (Stratagene) according to the manufacurer's instructions, prior to ligation into the Smαl site of a commercially prepared pUC vector (pUC 18 / Smal - BAP).
Ligations were performed using a commercially available Rapid DNA Ligation Kit (Boehringer). This kit allows ligation of complementary or blunt ended fragments in 5 minutes at room temperature. The speed of ligation is enhanced by the addition of PEG (poly-ethylene glycol) to the reaction mix which has the effect of concentrating the DNA fragments thus improving the kinetics of the reaction. All reagents necessary were supplied with the kit and reactions were performed according to the manufacturer's recommendations. Reaction volumes were typically 20μl.
In an attempt to improve the efficiency of ligation reactions a formula was used to calculate the molar ratio of insert to vector (see below); in most cases a molar ratio of 3: 1, insert to vector was selected in order to 'force' the ligation in the direction of acquisition of an insert.
Equation for Calculating the Molar Ratio of Fragments for Ligation: ng of vector x kb size of insert mols of insert insert X _ kb size of vector mols of vector (ng)
(Taken from the Promega: Protocols and Applications Guide, 2nd Edition)
The ligated recombinant plasmid was transformed into E. coli, strain XLl-blue by electroporation, and plated out onto ampicillin selective plates containing X-gal and IPTG. Electroporation was carried out as described by Dower et al (Dower, W.J., Miller, J.F. and Ragsdale, C.W. (1988). Nucleic Acid Research, 16, 6127) using a Bio-Rad Gene Pulser II (settings 2.5kV, 25μFD, 200Ω), and a 0.2cm gap electroporation cuvette. l-2μl of DNA solution (plasmid / ligation reaction) was mixed with a 50μl aliquot of freshly thawed (on ice/water) electro-competent cells. The resulting cell/DNA suspension was placed in an ice cold electroporation cuvette (Bio-Rad) and subjected to the electrical pulse.
Following the pulse, 0.5ml of pre-warmed S.O.C. medium (Gibco) was added to the cuvette, the cells were allowed to recover at 37°C for ~ 1 hour (to allow expression of antibiotic resistance) prior to plating out onto LB agar containing ampicillin (lOOμg/ml) (Sigma), isopropyl thiogalactoside (IPTG) (Sigma) and X-gal (5-Bromo-4-chloro-3-indolyl-β-D-galactoside)(Sigma). Plates were incubated overnight at 37°C. Plasmid DNA was isolated from selected recombinants using the method of Birnboim and Doly (1979) and modified by Kaiser (1984) or an adaption of the Wizard ™, Promega Method. Minipreparation of plasmid DNA by adaptation of a commercially available kit (Wizard, Promega) was done both for economy of time, but more importantly the quality of sequencing data obtained was much higher when sequencing from DNA purified by this means as opposed to that previously used.
3ml of overnight culture was pelleted in a sterile microcentrifuge tube and resuspended in 200μl solution PI (50mM Tris.HCl pH7.5, lOmM EDTA, O.lmg/ml RNase A). 200μl solution P2 (0.2M NaOH, 1% SDS) was then added, mixed by inversion (~6X) and incubated at room temperature for less than 2 minutes. 200μl solution P3 (61.35g potassium acetate, 35.7ml glacial acetic acid to 500ml with ddH2O) was then added, mixed by gentle inversion (~6X) and incubated on ice for approximately 10 minutes. The resulting suspension was centrifuged at >10,000g for 10 minutes, the supernatant was transferred to a fresh tube and 0.5ml of Celite slurry (66.84g ultrapure guanidine hydrochloride (Sigma) in 33.33 ml solution P3, pH 5.5 to 100ml with ddH2O plus 1.5g Celite (NBS Biologicals)) added. The contents were then transferred to a minicolumn (Promega) and washed with 4ml wash buffer (200mM NaCl, 20 mM Tris.HCl pH 7.5, 5mM EDTA, 50% ethanol). The column was centrifuged at > 2000g for 30 seconds to dry the resin. 50μl of milliQ H2O was added, the column incubated at room temperature for 1 minute, before the resulting DNA solution was eluted by centrifugation at > 2000g for 1 minute.
The presence of an insert was confirmed by EcoRI / HindlR digestion and the resulting clone sequenced using an automated sequencer (ABI PRISM Model 377) by the Department of Biochemistry's DNA synthesis and Sequencing Facility within the University of Bristol. The resulting plasmid was denoted pUCtk.
The sequence obtained, and its alignment to the published sequence and the oligonucieotide PCR primers, is illustrated in figure 4. The alignment of the translated regions of the two sequences is illustrated in figure 5. The sequence obtained was very similar to that published by Sheppard and May (Sheppard, M. and May, J.T. (1989). Journal of General Virology, 70, 3067). An additional cytosine residue is present at position 48 and an adenosine is substituted for a guanine at position 727. These changes are likely to be due to differences between strains of BHV-2; the sequence obtained by May was from an Australian strain compared to the US strain used in this study. The additional residue at position 48 is unlikely to be of any consequence as it lies well outside the open reading frame (ORF) of the thymidine kinase protein. However the base substitution at position 727 changes codon number 199 from GTG to ATG, thus substituting a methionine for a valine. This substitution is unlikely to be significant as the methionine and valine amino acids are both hydrophobic.
Assuming this single amino acid substitution is real (and not due to a Taq error) it is unlikely to affect tk function. Even if this substitution does effect tk function it will not compromise the efficiency of the process of homologous recombination, this being the primary reason for amplification of the tk region. In fact if this mutation does affect tk function it could confer an advantage in the design of the BHV-2 vector as it would decrease the risk of reversion of the recombinant virus to the wild-type.
Further studies demonstrated that the region of interest could be amplified successfully from a small aliquot of unpurified tissue culture medium taken from a flask in which virus was being propagated. The virus was propagated as described below.
BHV-2, NY-1 strain was obtained from ATCC (Maryland, USA). 1 ml of reconstituted virus (~1.12xl05 TCED50/ml) was inoculated onto 80% confluent cultures of MDBK cells (Gibco T75 flasks). Virus was adsorbed at 32°C for 1 hour, subsequently 20 ml GM was added. Flasks were then incubated at 32 °C until the cytopathic effect (CPE, Syncytial formation) involved >90% of the culture. Virus was released from the cells by repeated freeze-thawing (3X). The resulting medium was centrifuged (2500rpm, Sorvall RC3 - lOmin) to pellet cell debris, and the supernatant was harvested. A small volume of this supernatant was then used to inoculate further flasks; remaining supernatant was stored at -70 °C. Initial problems were encountered with propagation of viral stocks; CPE would appear within 24 hours of inoculation but this would subsequently be overgrown by the MDBK cell line. Various techniques were attempted to overcome this problem including heat inactivation of foetal calf serum, variation in concentration, or absence of foetal calf serum from growth medium, inoculation at lower levels of confluence, splitting cells 1:3, 24 hours after infection. Eventually it was found that lowering of the temperature of incubation to 32°C resulted in rapid spread of CPE without affecting MDBK cell viability (ie MDBK cells survive, but do not replicate as rapidly at 32°C (cf 37°C)).
Supernatants were batched and centrifuged (20,000rpm, Sorvall OTD-65, 2h, 4 °C). The resulting pellet was resuspended in 2ml distilled water and layered onto a discontinuous sucrose gradient (60%, 50%, 40%, 30%), which was then centrifuged (50,000rpm, Sorvall OTD-65, lh, 4 °C), before the virus was then collected at the 30/40% and 40/50% interfaces. Once harvested these fractions were diluted to lower the sucrose concentration below 30% and were once again centrifuged (50,000rpm, Sorvall OTD-65, lh, 4 °C) to obtain a viral pellet. The resulting pellets were stored at -70 °C.
Cloning and Sequencing of the Bovine Interferon gamma Gene (Coding sequence)
The presence of introns in the coding sequence of the gamma interferon gene made it necessary to produce workable quantities of RNA from which cDNA could be synthesised and subsequently used in PCR. Lymphocytes are a well recognised source of gamma interferon and following Concanavalin A stimulation produce large quantities of active peptide by upregulation of transcription and translation. The increased transcription results in increased levels of mRNA encoding IFN-γ which can subsequently be purified.
Synthetic oligonucleotides, designated IFNfor and IFNrev, were designed to amplify the IFN-γ coding sequence by PCR. These primers were 100% homologous to the published sequence (Cerretti et al. , 1986), but were engineered so that the amplified IFN-γ coding fragment would be flanked by a 5' EcoRI and 3' HindϊR restriction endonuclease site. This was to facilitate future sub-cloning of the fragment. IFNfor- 5" C CTC GAATTC CTA ACT CTC TCCTAAACAATG 3'
\ / \ /
EcoRI Region of homology
IFNrev - 5' A TAC AAG CTT AGG ACC ATT ACG TTG ATG CTC 3'
\ Λ /
Hindlll Region of homology
The four additional bases beyond the restriction sites were present to allow restriction digestion of the PCR product if desired; most restriction enzymes require the presence of ds (double stranded) DNA beyond the recognition site in order to bind and cleave DNA efficiently (Moreira, R. and Noren, C. (1995). Biotechniques, 19, 56).
Bovine lymphocytes were purified from wide bovine blood and total RNA was extracted as described below:
160ml of whole bovine blood was collected into EDTA (final concentration = 2mg/ml). The sample was placed in 50ml Falcon conical tubes and centrifuged at lOOOg for 20 minutes at room temperature. Following centrifugation the 'buffy coat' was removed and resuspended to 50ml in RMPI 1640 (Dutch modification) (Sigma) supplemented with EDTA (2mg ml) and 0.5% gentamycin. The resulting cell suspension was layered onto two 25ml Ficoll-Hypaque gradients (Ficoll 400 6.4 % (w/v), Pharmacia; 11% sodium hypaque, Winthrop) and centrifuged at 2000g for 15 minutes. Subsequently the 'buffy coat' was removed, resuspended to 50ml RMPI 1640 (Dutch modification) (Sigma), supplemented with EDTA (2mg/ml) and 0.5% gentamicin and centrifuged at 2000g for 15 minutes at room temperature. The supernatant was removed, checked for the absence of leucocytes and was subsequently discarded.
The pellet was then washed 6 x by the procedure outlined below in order to remove the platelets. The pellet was resuspended in RMPI 1640 (Sigma) supplemented with EDTA (2mg/ml) and 0.5% gentamycin and centrifuged at 750g for 10 minutes at room temperature, the supernatants were checked for the presence of leucocytes and platelets (respun if excess leucocytes present), before being discarded. Following removal of the majority of the platelets the pellet was resuspended, to a cell concentration of 4.8 x 106, in RMPI 1640 supplemented with 10% foetal calf serum, 0.5% gentamycin and Concanavalin A (7.5μg/ml). Four 25ml aliquots of the resulting cell suspension were placed in 50ml conical tubes and incubated overnight (~18h) at 37°C. After incubation the cells were centrifuged at 2000g for 2 minutes at room temperature, the supernatant removed and the cells snap frozen in liquid nitrogen and subsequently stored at -80 °C.
Total RNA was extracted using a commercially available extraction kit (Pharmacia Biotech). Approximately 108 cells were resuspended in 5ml of extraction buffer and vortexed immediately. A further 5ml of buffer was added and chromosomal DNA was sheared by repeatedly drawing (15x) through a 16G needle. Two 2ml aliquots were removed for further extraction (the remainder was frozen at -80 °C). The aliquots were placed in 5ml Kontron polyallomer tubes and centrifuged at 20,000rpm for 15 minutes at room temperature. The supernatant was layered onto a CsTFA gradient and centrifuged at 125,000g for 17 hours at 15°C. Following centrifugation the supernatant was removed, the bottom of the tube was cut off, to leave a small 'dish' containing the RNA pellet, and placed on ice. The pellet was dissolved in 250μl of TE buffer (lOmM Tris-HCl (pH7.5), ImM EDTA), placed in a microcentrifuge tube and vortexed before and after incubation for 5 minutes at 65°C. The resulting solution was centrifuged for 30 seconds at > 10,000g to pellet any undissolved debris and the resulting supernatant was placed in a fresh tube. The RNA was then further purified by ethanol precipitation, before resuspension in milliQ H2O and storage at -20°C.
cDNA was synthesised using a First-Strand cDNA synthesis kit (Pharmacia Biotech). 20μl of the RNA solution (see above) was placed in a sterile microcentrifuge tube, heated to 65°C for 10 minutes and subsequently chilled on ice. 1 lμl of the Bulk First-Strand cDNA Reaction Mix, lμl of 200mM DTT solution and lμl of Not I-d(T)]8 oligonucieotide (0.5μg /μl) were added and the resulting mixture incubated for 1 hour at 37°C. Following heat inactivation for 10 minutes at 68°C the cDNA containing solution was stored at -20°C. (Bulk First-Strand cDNA Reaction Mix contains cloned, FPLCpure® Murine Leukaemia Virus Reverse Transcriptase, RNAguard, Rnase/Dnase-Free BSA, dATP, dCTP, dGTP and dTTP in aqueous buffer.)
The bovine IFN-γ gene (coding sequence) was amplified using 35 cycles of PCR using the same PCR conditions as previously described. The PCR products were purified on a LMP (low melting point) agarose gel, electro-eluted and phosphorylated (as previously described) prior to ligation into the Smαl site of a commercially prepared pUC vector (pUC 18 / Smαl - BAP). The ligated vector was transformed by electroporation into E. coli, strain XL 1 -blue, and plated out onto ampicillin selective plates containing X-gal and IPTG. Plasmid DNA was isolated from selected recombinants as previously described. The presence of an insert was confirmed by EcoRI / HindΩl digestion and the resulting clone sequenced by automated sequenceing techniques. The resulting plasmid was denoted pUCglFN.
The sequence obtained, and its alignment to the published sequence (Cerretti, P.D., McKereghan, K., Larsen, A., Cosman, D., Gillis, S. and Baker, P.Ε. (1986). Journal of Immunology, 136, 4561) and the oligonucieotide PCR primers is illustrated in figure 6. As illustrated in figure 6 the sequence of the cloned fragment aligned exactly with that of the published sequence.
Cloning and Sequencing of the Staphylococcus aureus Fibronectin Binding Protein Gene (Binding Domains)
Design of a FnBP 'mini-gene' encoding only the S. aureus fibronectin binding domains, as previously defined (Signas, C, Raucci, G., Jonsson, K., Lingren, P., Anantharamaiah, G.M., Hook, M. and Lindberg, M. (1989). Proceedings of the National Academy of Sciences, 86, 699; Jonsson, K., Signas, C. and Lindberg, M. (1991). European Journal of Biocemistry, 202, 1041) necessitated the insertion of an artificial stop codon, and an upstream signal sequence to direct the translated peptide to the cell surface and beyond.
Synthetic oligonucleotides were designed to amplify the region encoding the binding domains of the FnBP S.aureus gene. The two primers were denoted FnBPfor and FnBPrev and were designed so that the PCR-amplified FnBP fragment would be flanked by a 5' EcoRI and 3' Xbal restriction endonuclease site; this was to facilitate future sub-cloning of the fragment into other vectors.
An 'in frame' stop codon was inserted just prior to the 3' Xbal restriction site. The six additional bases beyond the restriction sites were present to allow restriction digestion of the PCR product if desired, as most restriction enzymes require the presence of dsDNA beyond the recognition site in order to bind and cleave DNA efficiently.
FnBPfor - 5' CTA CCT GAA TTC GGC CAA AAT AGC GGT AAC CAG TC 3'
\ / \ /
EcoRI Region of homology
FnBPrev - 5' AGC ATC TCT AGA TTA TGG CAC GAT TGG AGG TGT TGT 3'
\ / \ /
Xbal Region of homology
To obtain template S. aureus DNA, cows with persistently high monthly somatic cell counts, infected with subclinical Staphylococcus aureus mastitis were identified by routine mastitis bacteriology (inoculation of lOμl of secretion onto each of, sheep blood agar, Edward's agar and MacConkey agar; cultured for 48h at 37°C). An S. aureus colony was identified using standard laboratory techniques (confirmed by colony morphology, gram stain, catalase and coagulase tests). Pure cultures were then ensured by two rounds of colony selection and purification on blood agar. Stocks of these purified strains are maintained on agar slopes and as bead stocks. DNA was extracted from cultures using standard techniques.
The sequence encoding the S. aureus fibronectin binding domains was amplified using 25 cycles of PCR and using PCR conditions as previously described. The PCR products were purified on a LMP (low melting point) agarose gel, gel-purified using a commercially available kit (Wizard™ Promega). Following purification, the PCR product was digested using EcoRI and Xbal restriction enzymes prior to ligation into a similarly cut pUC vector; the need to dephosphorylate the vector and phosphorylate the insert was removed by the use of incompatible cohesive ends which ensured 'directional' insertion of the PCR fragment. The ligated recombinant plasmid was transformed by electroporation into E. coli, strain XLl-blue, and plated out onto ampicillin selective plates containing X-gal and IPTG. Plasmid DNA was isolated from selected recombinants (using Wizard™, Promega). The presence of an insert was confirmed by EcoRI / Xbal digestion and the resulting clone sequenced using automated sequencing techniques. The resulting plasmid was denoted pUCFnBP.
Sequencing confirmed the successful amplification of an FnBP gene fragment. The sequence obtained, its alignment to the published sequences and the oligonucieotide PCR primers are illustrated in figure 7.
The FnBP (binding domains) sequence obtained in this study showed 97.8% identity when compared to both of the previously published sequences encoding the two separate genes FnBA and FnBB. However the sequence obtained in this study was less homologous when compared to each of the sequences individually. The sequence obtained appears to contain components of both of the previously published sequences, a phenomenon which could be due to strain variations between S. aureus, or could be due to adaptation of the strain in this study to the bovine environment (the published sequences arise from a human strain originating from Scandinavia). These differences, and apparent combination of the two genes, could have arisen as a result of recombination events arising during the normal replication of S. aureus.
When aligned at an amino acid level (figure 8) there is 96.3% identity between the sequence obtained and that previously published. It is impossible to speculate accurately about the likely effect of these changes on the structure and function of the binding domains. However there is only 97% identity between the two previously published sequences and in view of this it is probably fair to state that there is a high degree of conservation within this region and that the sequence obtained is likely to be functional.
Alignment of the four individual binding domains (figure 9) shows 100% identity between the FnB AB and the published sequences in domains D 1 and D4 and only one amino acid difference in the binding domain D3 which has previously been shown to have the highest affinity (when compared to Dl and D2) when studies were undertaken using synthetically prepared peptides. This alignment also serves to illustrate the high degree of identity both between the three sequences and within the three sequences when aligned along the putative functional domains.
Cloning and Sequencing of the Bovine Interferon alpha Gene (Signal sequence)
The IFN-α gene signal sequence was required as part of the synthetic FnBP 'minigene' to direct secretion of the FnBP binding domains. The absence of introns in the region encoding the signal sequence made it possible to amplify this part of the IFN-α gene using bovine genomic DNA as a template, in PCR, without the need to isolate RNA and produce cDNA.
Bovine genomic DNA was extracted as follows:
Whole blood, from an adult Friesian cow, was collected into EDTA, and stored in 1ml aliquots at -70°C. Storage at -70°C also served to lyse the red blood cells. Two 500μl aliquots were centrifuged at 10,000g for 2 minutes, to pellet leucocytes. 400μl of the supernatant was removed, 900μl of cell shocking solution added and the resulting cell suspension was mixed by inversion for 10 minutes. The mixture was recentrifuged at 10,000g for 1 minute and the supernatant discarded. 300μl of cell nuclear lysis buffer, 20μl 10% SDS and lOμl Proteinase K (20mg/ml) were added and the resulting mixture incubated for 15 hours at 56°C. Following incubation the solution was phenol / chloroform extracted and ethanol precipitated. The resulting pellet was resuspended in milliQ H2O, before storage at -20°C. Synthetic oligonucleotides were designed to amplify the region encoding the IFN-α signal sequence. The two primers were denoted alFNssfor and alFNssrev.
alFNssfor - 5' AGT CAT GGA TCC CAG AGT CAC CCA CCT CAC CAG 3'
\ Λ /
BamHl Region of homology
alFNssrev - 5' TGT ACT GAA TTC CAG GTG GCA ACC CAG AGA GCA 3'
\ Λ /
EcoRI Region of homology
These primers were designed so that the amplified IFN-α fragment would be flanked by a 5' BamHl and 3' EcoRI restriction endonuclease site; this was to facilitate future sub-cloning of the fragment into other vectors, and also to allow the attachment, 'in frame', of the IFN-α signal sequence to the sequence encoding the FnBP binding domains. The six additional bases beyond the restriction sites were present to allow restriction digestion of the PCR product if desired. The primers used to amplify the IFN-α signal sequence were deliberately designed to include areas of the genome upstream of the start of the coding sequence in an attempt to include naturally occurring Kozak recognition sequences (Kozak, M. (1986). Cell, 44, 283; Kozak, M. (1987). Journal of Molecular Biology, 196, 947) and to optimise the chances of correct 'interpretation' of the signal sequence in the eukaryotic environment.
The sequence encoding the IFN-α signal sequence was amplified using 25 cycles of PCR using the same PCR conditions as previously described. The PCR products were purified on a LMP (low melting point) agarose gel and gel-purified using a commercially available kit. Commercially available kits were employed for speed and the enhanced recovery rate of purified DNA. Two silica based purification kits were used (Gelex, Stratech Scientific / HYBATD RECOVERY™ DNA Purification Kit π, Hybaid). In both cases the kits were used according to the manufacturer's recommendations with the exception that gel chips were melted at room temperature (rather that at 55°C). Both kits follow a similar principle of melting the chip in a chaotropic salt prior to binding to silica; the silica is then either pelleted or separated from residual solutions using a filter and washed in 70% (v/v) ethanol prior to elution in milliQ H2O.
Following purification, the PCR product was ligated into the T-A cloning vector pGEM-T; the need to dephosphorylate the vector and 5' phosphorylate the insert was removed as the cloning vector ends are incompatible and therefore can be left with their 5' terminal phosphates. The ligated recombinant plasmid was transformed into E. coli, strain XLl-blue, and plated out onto ampicillin selective plates containing X-gal and IPTG. Plasmid DNA was isolated from selected recombinants as detailed in section 2.25 (Method B). The presence of an insert was confirmed by EcoRI / ZϊαmHI digestion and the resulting clone sequenced. The resulting plasmid was denoted pGΕMalFN.
Automated sequencing confirmed the successful PCR amplification of the IFN-α signal sequence. The sequence obtained, its alignment to the published sequences (Velan et al. , 1985) and the oligonucieotide PCR primers is illustrated in figure 10.
Though differences to the four published sequences are present at the base level, when compared in frame on a triplet basis, each codon in the amplified fragment was matched by a similar codon in at least one of the other published sequences as illustrated in figure 11. Most of the changes present, within the coding sequence, are 'silent' base substitutions. When the sequence is translated and amino acid alignments performed the sequence obtained matches that of Velan et al (Ace Ml 0955) exactly.
The base differences identified in the sequence obtained in this study were probably due to natural variation between breeds and pedigrees of cattle; the published sequences all originate from cattle of North American origin whereas the sequence obtained during this study came from a British Friesian.
Before constructing recombinant viridae, it was necessary to develop screening assays. EXAMPLE 3
Overexpression of Bovine Interferon-γ and Staphylococcus aureus Fibronectin
Binding Protein (Binding Domains) in Escherichia coli
In order to produce monoclonal antibodies for culture diagnostic use, it was first necessary to over express and purify the target proteins.
Various prokaryotic expression vectors are commercially available, and here, the inventors used a commercial expression system (QIAexpress, QIAGEN), with two different expression plasmids (pQE 30, QIAGEN; pET32, Novogen) both of which allow his-tagged purification of the recombinant proteins, the pET32 system expressing the protein of interest as a fusion with thioredoxin.
The pQE-30 vector was selected for expression of both the FnBP binding domains and the IFN-γ. The recombinant proteins are expressed with an N-terminal his-tag, as an aid to later purification. The plasmid contains an optimised, regulatable promoter / operator element consisting of the E. coli phage T5 promoter and two lac operator sequences and a synthetic ribosome binding site. An MCS facilitates the insertion of sequences of interest and stop codons in all three frames ensure termination of translation. The origin of replication and ampicillin resistance are provided by genes from the plasmid pBR322.
Expression from the promoter/ operator region is extremely efficient and can only be tightly controlled using a lac repressor. In the QIAexpress system this repressor is encoded on the pREP4 (Farabaugh, P.J. (1978). Sequence of the lad gene. Nature, 274, 765) plasmid which can be co-transfected into the host cell line, and selected for using kanamycin. This plasmid ensures tight regulation of expression until the addition of IPTG which inactivates the repressor and clears the promoter. However, if an E. coli host stain encoding the lac repressor is used for the expressions the need for the pREP4 plasmid is removed; in this situation the expression will be less tightly controlled but will still be strongly induced by the addition of IPTG. The E. coli host strain XLl-Blue was used for all expression experiments. This strain possesses the laclq gene thus controlling expression using both of the plasmids detailed above. It is a useful general purpose strain and was used both for cloning and DNA multiplication and for over-expression.
Construction of Prokaryotic Expression Vectors Interferon-γ Expression Vectors
Vectors were constructed to allow the over-expression of bovine interferon-γ (mature peptide without the signal sequence) as both a C-terminal fusion to thioredoxin (pET32a, Novogen) and as a peptide with an N-terminal 'his tag' (pQE 30, QIAGEN). This required the PCR amplification of the sequence of the IFN-γ mature peptide and it's subsequent cloning, sequencing and sub-cloning into the two expression vectors.
A synthetic oligonucieotide, denoted IFNgMATfor, was designed, which when used, in the PCR, with the primer IFNgrev would amplify the region encoding the IFN-γ mature peptide. This primer was designed so that the amplified IFN-γ fragment would be flanked by a 5' BamHl restriction endonuclease site; this along with the 3' HindHL site of primer IFNgrev facilitated the sub-cloning of the fragment 'in frame' into both of the expression vectors to be used.
5' GCAT GGATCC CAG GGC CAATTTTTTAGAGAAATAG 3'
\ Λ /
BamHl Region of homology
The IFN-γ fragment was amplified from the plasmid pUCglFN using 10 cycles of PCR using the PCR conditions previously described. Using the techniques outlined above, the IFN-γ mature peptide PCR fragment was T-A cloned into pGEM-T and transformed into E. coli strain XLI-blue. The presence of the fragment was confirmed in the resulting clones by restriction digestion with BαmHI, and HindlR. The sequence of the amplified fragment was confirmed by automated sequencing (ABI PRISM Model 377). The resulting plasmid was denoted pGEMglFNmat. The sequence encoding the IFN-γ mature peptide was sub-cloned into pQE 30 and pET32a using the 5' £?αmHI and 3' HindlR restriction sites, and transformed into E. coli host strain XLI-blue. The presence of the insert in the construct was confirmed by restriction digestion.
Expression Vector for S. aureus Fibronectin Binding Protein Binding Domains.
A vector was constructed to allow the over-expression of the binding domains of S. aureus fibronectin binding protein as a peptide with an N-terminal 'his tag' (pQE 30, QIAGEN). This required the amplification of the sequence of the FnBP fragment with different restriction sites and it's subsequent cloning, sequencing and sub-cloning into the expression vector.
Synthetic oligonucleotides were designed to amplify the region encoding the FnBP binding domains. These primers, denoted FnBPforl and FnBPrevl were designed so that the PCR amplified FnBP fragment would be flanked by 5' BamHl and 3' HinaTR restriction endonuclease sites, thus facilitating the sub-cloning of the fragment 'in frame' into the expression vector.
FnBPforl - 5' CTA CCT GGA TCC GGC CAA AAT AGC GGT AAC CAG TC 3'
\ Λ /
BamHl Region of homology
FnBPrevl - 5' AGC ATC AAG CTT TTA TGG CAC GAT TGG AGG TGT TGT 31
\ Λ /
Hindlll Region of homology
The FnBP fragment was amplified from the plasmid pUCFnBP using 10 cycles of PCR using the PCR conditions previously described. The FnBP PCR fragment was T-A cloned into pGEM-T using T4 polynucleotide kinase (Stratagene) according to the manufacturer's instructions, to add 5' terminal phosphates, before ligating into PGEM-T using the Rapid DNA ligation kit (Beohringer) according to the manufacturer's instructions. The resulting construct was transformed into E. coli strain XLI-blue and the presence of the fragment was confirmed, in the resulting clones, by restriction digestion with BamHl and HindRl. The sequence of the amplified fragment was confirmed (ABI PRISM Model 377). The resulting plasmid was denoted pGΕMFnBPexp.
The sequence encoding the FnBP binding domains was then sub-cloned into pQΕ 30 using the 5' BamHl and 3' HindRl restriction sites, and transformed into E. coli host strain XLI-blue. The presence of the insert in the construct was confirmed by restriction digestion.
Over-expression of Interferon-γ and the Fibronectin Binding Protein Binding Domains
Over-expressions were performed using the QIAexpressionist (QIAGEN) high level expression and protein purification system according to the manufacturer's instructions. Harvestable quantities of protein were produced, as outlined below.
Individual E. coli colonies, containing plasmids encoding one of each of the three recombinant proteins were picked off 'clonal' plates, and inoculated into 2ml of LB broth (in a 30ml universal, Sterilin), supplemented with lOOμg/ml ampicillin. The cultures were then incubated in a shaking incubator (37°C, 300rpm) for approximately 3 hours. The 2ml aliquot was then used to inoculate 250ml of LB broth (in a sterile 2 litre conical flask), supplemented with lOOμg/ml ampicillin; which was incubated at 37°C, 180rpm until the resulting culture reached an O.D. of approximately 0.6. At O.D 0.6, protein expression was induced using IPTG at a working concentration of lmM and the culture incubated for a further 3 hours.
Following induction, the cell cultures were harvested by centrifugation at >4000g for 10 minutes (Sorvall, RC5). The resulting cell pellets were each resuspended in 10ml of sonication buffer (50mM Na-phosphate pH 7.8, 300mM NaCl) including 1% v/v Tween 20, and were frozen overnight at -20°C.
Analysis of Products of Over-expression The products of over-expression of all three recombinant proteins were examined by SDS-PAGE (Figure 12). SDS-PAGE (SDS Polyacrylamide gel electrophoresis) allows rapid identification and crude quantification of production of recombinant proteins by E. coli, whilst also allowing an estimate to be made of protein size.
Protein separation was performed using SDS-PAGΕ gels as described by Laemmli (1970) using the Bio-Rad Mini-Protean D™ system. 12-15% acrylamide resolving gels (30:0.8 acrylamide:bis-acrylamide ratio) were prepared in 375mM Tris HCl (pH8.8), 0.1% (w/v) SDS, 0.1% (w/v) ammonium persulphate and 0.08% TΕMΕD (N',N',N',N'-tetramethylenediamine). Stacking gels were 6% (w/v) acrylamide, 125mM Tris/HCl (pH6.8), 0.1% (w/v) SDS, 0.1% (w/v) ammonium persulphate and 0.08% TΕMΕD.
Purification of Recombinant Interferon-γ and the Fibronectin Binding Protein Binding Domains
The protocol followed was as outlined by the manufacturer. The Ni-NTA resin was 'bulked out' using Sepharose 30 (Sigma) and equilibrated with sonication buffer before loading into the column supplied. The cell lysate supernatant was subsequently applied to the column at a rate of 3-4 column volumes per hour (the flow through was collected and analysed by SDS-PAGΕ to ensure negligible loss of recombinant protein which had not bound to the column).
The column was then washed (Wash buffer - 50mM Na-phosphate, 300mM NaCl, 10% glycerol, pH 6.0) until the A^oof the flow through was < 0.01. The protein was then eluted from the column, in 1ml aliquots, using 10ml wash buffer, pH 4.5; aliquots with an A28o> 0.8 were pooled. 20μl of each pooled sample was then examined using SDS-PAGΕ.
Protein samples were prepared by addition of an equal volume of SDS loading buffer ((2X) 5mM DTT (dithiothreitol), 4% (w/v) SDS, 240mM Tris/HCl (pH6.8), 20% (v/v) glycerol) followed by boiling for 5 minutes prior to loading. Gels were electrophoresed at 150-200V for approximately 1 hour in SDS-PAGΕ buffer (25mM Tris, 250mM glycine, 0.1% SDS). Gels were stained using Coomassie brilliant blue and destained using 30% methanol/ 10% acetic acid before visualisation using transmitted white light. Gels to be blotted were not stained but were instead equilibrated in blotting buffer (2mM Tris, 15mM glycine, 20% methanol) for 10 minutes. This revealed the successful over-expression of the recombinant proteins and that the majority of the over-expressed protein was present in the soluble fraction in all three cases.
Analysis of the Products of purification
SDS-PAGE revealed successful purification of the recombinant proteins (figure 13) with minimal loss of recombinant protein in the wash buffer (figure 14). Both recombinant proteins expressed from the pQE-30 plasmids were retrieved with a very high degree of purity; however the IFN-γ thioredoxin fusion expressed from pET32a co-purified with a small amount of native E.coli protein. The concentrations of recombinant protein were estimated at 30mg/ml of FnBP, 50mg/ml of IFN-γ and lOOmg ml of the IFN-γ / thioredoxin fusion.
The his-tag purification system yielded recombinant proteins of a high level of purity when they were expressed from the vector pQE-30. However the level of purity of the product from the thioredoxin fusion protein was less and there was significant 'carry over' of host E. coli proteins. This was felt to be most likely as a result of the quantities of protein involved (i.e. there was significantly more of the thioredoxin fusion protein as compared to the other recombinant proteins) and that this may have 'trapped' other proteins within the column. This problem could probably have been overcome by the use of a greater number of more stringent washes of the column prior to elution of the product.
Both of the vectors encoding the recombinant, his-tagged IFN-γ and IFN-γ thioredoxin fusions generated proteins of the expected size (as estimated by SDS-PAGE); however over-expression of the his-tagged FnBP 'mini-gene' resulted in a recombinant protein of almost twice the size of that predicted, from sequencing data, when examined by SDS-PAGE. As described earlier, factors other than size can effect the migration properties of proteins on SDS-PAGE; however in this case it was felt that the amino-acid composition of the protein would be highly unlikely to result in such an anomolous migration pattern. Other explanations for this phenomenon could be 'read through' of the stop codon engineered in to the expression construct, induction of expression of another unrelated host protein which happened to purify on the Ni-NTA column or a proclivity for the recombinant protein to form dimers which happen to be resistant to the denaturing conditions of SDS-PAGE. The first two explanations were thought unlikely as sequencing data had confirmed the integrity of the expression constructs and though some 'read through' was likely to occur it would usual only be in a small proportion of cases; the likelihood of induction of a host protein was also felt to be remote. In an attempt to confirm the production of the appropriate recombinant protein, binding studies were conducted.
Example 4
Demonstration of the Binding Activity of the Staphylococcus Aureus Fibronectin
Binding Protein 'Minigene'
As described previously, when expressed in E. coli, ran anomalously when analysed by SDS-PAGE. In order to confirm the structure and function of the binding domains of S. aureus fibronectin binding protein binding domains, binding studies were performed using the BIAcore 1000 (Uppsala, Sweden).
The BIAcore apparatus comprises a surface plasmon resonance (SPR) biosensor controlled by a Pentium class personal computer, (Schuck, P. (1997). Annual Reviews in Biophysics of Biomolecular Structure, 26, 541).
The SPR biosensor consists of a prism coated with a thin metal film (usually gold). The total internal reflection of light within the prism is used to excite nonradiative surface plasmons on the metal film (a plasmon is a wave of oscillating surface charge). These plasmons are only excited by light at a fixed angle of incidence (resonance angle), and it is the energy loss from the reflected light that is measured in relative units (RU). The resonance angle is dramatically affected by the refractive index close to the surface which is in turn affected by the local concentrations of macromolecules, thus providing a measure not only of the amount of primary molecule bound but also of interactions between that primary molecule and others in its vicinity. The basic experimental strategy involves the immobilisation of one of the macromolecules of interest on the biosensor surface; the second macromolecule, at a known concentration, is then passed, at a fixed rate, over the surface of the immobilised reactant; surface complex formation is then monitored. Following binding, a dissociation stage is monitored as complex dissociation is recorded in the absence of further mobile reactant. Following the study time course, the remaining macromolecular complexes can be disrupted (e.g. using buffer of low pH) and the study repeated using different concentrations of the mobile reactant. It is thus possible to calculate dissociation constants and the kinetics of the macromolecular interaction. The BIAcore 1000 apparatus described in this study uses a sensor surface on a removable chip over which solutions of interest can be passed. Flow cell dimensions are 2.1mm (1) x 0.55mm (w) x 0.05mm (h) and interactions are detected on a 0.2mm2 surface.
Various ways of immobilising the first reactant are available, such as dextran matrices (designed to inhibit non-specific binding). In an attempt to further decrease non-specific binding, other specific binding interactions have been developed; an example of which is the chelate linkage of polyhistidine tags outlined in this study. An additional advantage of the histidine tag method of immobilisation is that it results in orientation of the reactant molecules in a homogeneous manner, eliminating one possible artefact from the calculation of binding kinetics.
Interactions were measured between bovine fibronectin (Sigma) and the histidine tagged recombinant protein FnBP using the histidine tagged IFN-γ as a negative control. The proteins of interest were immobilised on the nickel charged NTA surface before bovine fibronectin was passed across the surface and changes in plasmon resonance measured.
The protocol followed was as outlined in the manufacturer's handbook. Initially the NTA surface (covalently immobilised on a carboxymethylated dextran matrix) was washed with regeneration solution (lOmM HEPES, 0.15M NaCl, 0.35M EDTA, 0.005% surfactant P20, pH8.3) to remove any metal ions already present within the apparatus. 20μl of nickel solution (500μM NiCl2 in eluent buffer (lOmM HEPES, 0.15M NaCl, 50μM EDTA, 0.005% surfactant P20, pH7.4)) was passed across the chip surface at a rate of 20μl/minute, saturating the NTA surface with nickel. The flow cell chamber was then washed with eluent buffer. Following dilution in eluent buffer, the recombinant protein of interest was then immobilised on the chip surface. Following a further wash with eluent buffer, bovine fibronectin was passed through the flow chamber, at a rate of lOμl/min for three minutes, and the binding of fibronectin to the immobilsed recombinant protein monitored. After completion of one set of experiments the nickel was stripped from the surface of the NTA chip using regeneration solution (EDTA disrupting the nickel NTA interaction) before the above process was repeated under a different set of conditions.
The results are shown in figure 15 and clearly illustrate the binding of bovine fibronectin to the recombinant FnBP binding domains. No demonstrable binding occurred to the surface of the Ni-NTA chip alone or in the presence of immobilised recombinant IFN-γ.
This demonstrates that the recombinant FnBP binding domains generated by over-expression in E. coli bind fibronectin specifically; thus confirming the structure and function of the recombinant protein.
The decreasing value (RU) for the IFN-γ binding is due to the gradual dissociation (leaching) of the histidine tag from the Ni-NTA surface. This dissociation would also have been occurring between the histidine tagged FnBP and the Ni-NTA surface, however this would have been masked by the more significant change in RU arising as a result of the interaction between FnBP and the bovine fibronectin.
Example 5
Production of Monoclonal Antibodies Against Bovine Interferon-γ and the Binding
Domains of Staphylococcus Aureus Fibronectin Binding Protein
The production of monoclonal antibodies (Mabs) against bovine IFN-γ and the binding domains of fibronectin binding protein was necessary for future detection of recombinant proteins produced - initially in-vitro, using eukaryotic expression vectors and recombinant viridae and ultimately in-vivo, when any recombinant viridae are tested in cattle. Development of Screening Assays
The direct enzyme linked immunosorbant assay (ELISA) was selected as a suitable screening assay due to its speed, convenience and as it was most likely to be the method used for screening in later in vivo studies. Extensive use of Western Blotting was also envisaged; however it was decided that it would be more appropriate to screen Mabs, at a later date, for their suitability for use in this technique.
The appropriate recombinant protein was to be used in the assay to screen for hybridomas producing the appropriate antibody. The main aim of this study was to determine the optimum concentration of recombinant protein to be used in coating microtitre plates, by titration against serum from the immunized mice which would later be used in hybridoma production.
Immunizations
Two groups of five mice were immunised, intra-peritoneally with either 5μg rIFN-γ or 3μg rFnBP in lOOμl PBS mixed with an equal volume of adjuvant (MPL + TDM Adjuvant system, Sigma). 14 days later both groups were vaccinated, in the same manner, for a second time. Two mice (one from each group) were selected (on the basis of results obtained in development of the screening assay) and inoculated for a third time 49 days later. Fusions were carried out 4 days later.
Preparation of Feeder Cells
The feeder cells used in this study were mouse splenocytes. A Balb/c mouse was sacrificed by chloroform anaesthesia and cervical dislocation. Following immersion in 70% alcohol the spleen was removed. The spleen was then forced through a cell strainer. The cells were then washed twice in RPMI 1640 (no FCS) before dilution to 5xl05 cells/ml, in complete medium (RPMI 1640 supplemented with 1% glutamine, 1% pyruvate, 0.5% gentamicin, 0.1% fungizone and 15% FCS). These cells were then dispensed into 96 well, flat bottomed plates into which the hybridomas were to be cloned. This procedure was used in both the cloning and recloning steps. Conditioned media was also prepared using the above method except the splenocytes were placed in a 75 cm2 tissue culture flask and incubated for 5 days before collection of the medium; aliquots of this medium were then frozen for later use.
Fusion of Spleen Cells to Myeloma Cells
Myeloma cells (revived from liquid nitrogen 4 days earlier) were harvested using a cell scraper (Falcon) and diluted in 20ml RPMI 1640, to 1.2xl06 cells/ml.
An immunised mouse was then sacrificed, the spleen harvested and antibody producing cells from that animal fused to a Balb-c derived myeloma cell line. Following immersion in 70% alcohol the spleen was removed via a midline abdominal incision. The surrounding fascia was removed and the spleen was forced through a cell strainer (Falcon) using a Pasteur pipette and approximately 10ml RPMI 1640 medium. The splenocytes were then mixed with the myelomas, at a ratio of approximately 5:1, and washed 2X in RPMI. The myeloma cell line used in the fusions are deficient in the DNA salvage pathway which allows for selection of the hybridomas formed in the fusion process (by blocking the normal pathway with aminopterin) as only these will possess this salvage pathway. Stocks of the Mab in question can also be generated by inoculation of the hybridoma back into pristane (tetramethylpentadecane) treated mice which subsequently develop ascites; this ascitic fluid contains high concentrations of the Mab of interest which can be harvested following sacrifice of the animal.
Following the second wash the cells were pelleted and all media removed. The cell pellet was then slowly resuspended, over 90 seconds, in 0.5ml polyethylene glycol (PEG). 9 ml of complete medium was then added; 3ml over 3 minutes followed by 3ml in 1 minute followed by 4ml in 1 minute. The cells were pelleted by centrifugation (300g, 5 minutes) and fresh complete media added (the cells were not mixed). Following resting for 30 minutes at 37°C, the cells were resuspended to a total volume of 120 ml including 2.4ml HAT (ie complete medium plus aminopterine 4xlO"7M, hypoxanthine lxlO^M and thymidine 1.6xl0"5M), before plating out at 200μl/well in 96 well plates. Plates were incubated at 37°C, 5% CO2 in a humidified incubator. The cells were 'fed' twice at 4 day intervals using HAT on the first occasion and HT on the second. Primary antibody screening and cloning was done 4 days later. Cloning of Hybridoma Cell Lines
After 12 days the 'fusion' plates were screened by ELISA The chequerboard ELISA technique (Campbell, A.M. (1986) Monoclonal Technology, in: Laboratory techniques in biochemistry and molecular biology, eds. R.H. Burdon and P.H. van Knippenberg Alsevier, Amsterdam) was used. 96 well, polyvinyl chloride, microtitre ELISA plates were coated overnight at 4°C, with V2 log dilutions down the plate, of the appropriate recombinant protein in coating buffer (1.59 g/1 Na2CO3, 2.93g/l NaHCO3 pH 9.6). The plates were washed 3X with wash buffer (PBS, 0.05% Tween 20) to remove unbound antigen. 50μl of serum was diluted 1:2 with wash buffer before serial doubling dilutions were made across the plate. After incubation for 1 hour at room temperature, the plate was washed 3X with wash buffer. 50 μl of conjugate (Anti-mouse IgG (whole molecule) alkaline phosphatase conjugate, Sigma) was then added at a dilution of 1:2000. Following a further 1 hour incubation the plate was again washed 3X in wash buffer. 50μl of substrate (paranitrophenol phosphate, Sigma) at a concentration of 1 mg/ml (in coating buffer) was added; the reaction was allowed to progress for 30 minutes before reading at 405nm using an ELISA reader (Anthos 2001). The appropriate concentrations for coating the plates with antigen were determined and subsequently used in the screening of hybridomas (rFnBP @ 0.15μg/ml; rIFN-γ @ O.lμg/ml). 50μl of medium was diluted 1: 1 with PBS before addition to the microtitre plate. The cells from the wells producing strong positive results were cloned as follows:
• seed flat bottomed 96 well plate with 50μl of suspension containing 5xl05 feeder cells/ml
• resuspend hybridoma cells from well to be cloned in 50μl RPMI
• doubling dilutions of the hybridoma cells were made down row 1 of the plate, care was taken to ensure adequate mixing of the cell suspension in each well
• a multi-channel pipette charged with 50μl feeder cells (@ 5xl05 cells/ml) in complete medium was then used to perform doubling dilutions across the plate
The 96 well 1st cloning plates were 'fed' with conditioned media on days 2, 4 and 8. A second round of screening and cloning was performed 14 days after the first round. Positive wells were selected visually on the basis of a cell colony which apparently only came from one cell. Two positive wells were cloned from each plate.
Fourteen days later a further round of screening was undertaken. Again two wells were selected from each plate on the basis of colony appearance. These wells were expanded (using conditioned media) initially into 24 well plates, then to 6 well plates before expansion into 25cm2, 75cm2 and ultimately 150cm2 tissue culture flasks. During the expansion process supernatants were monitored on a regular basis, by ELISA, to ensure the continued secretion of Mab.
Eventually seven IFN-γ and nine FnBP clones were identified and multiplied. Supernatants were harvested from all sixteen clones. A selection of ELISA results from the initial screening of fusions and subsequent clonings are illustrated below.
1 2 3 4 5 6 7 8 9 10 11 12
A 0.249 0.208 0.248 0.322 0.460 2.631 2.817 1.494 0.923 0.870 0.605 0.466
B 0.337 0.214 0.236 0.347 0.257 0.256 0.197 0.233 0.200 0.231 0.164 0.215
C 0.219 0.211 0.231 0.408 0.299 0.267 0.249 0.216 0.245 0.194 0.189 0.200
D 0.297 0.235 0.210 0.360 0.224 0.258 0.295 0.189 0.241 0.179 0.200 0.195
E 0.318 0.191 0.309 0.362 0.443 0.297 0.274 0.223 0.240 0.207 0.174 0.204
F 0.499 0.297 0.282 0.386 0.177 0.287 0.199 0.160 0.208 0.208 0.196 0.274
G 0.419 0.407 0.286 0.350 0.229 0.180 0.205 0.171 0.172 0.168 0.255 0.204
H 0.526 0.396 0.422 0.381 0.325 0.283 0.467 0.261 0.248 0.176 0.180 0.282
An example ELISA result from the primary screen of fusion plates (Plate No. G3). The well (A6) highlighted in bold and underlined was selected for cloning.
1 2 3 4 5 6 7 8 9 10 11 12
A 1.429 1.060 0.818 0.680 0.180 0.090 0.026 0.026 0.024 0.024 0.026 0.029 B 1.302 1.000 1.227 0.597 0.586 1.148 1.397 0.025 0.023 0.024 0.025 0.026
C 1.290 0.618 0.278 0.076 0.034 0.036 0.032 0.030 0.026 0.029 0.026 0.028
D 0.703 0.341 0.095 0.039 0.029 0.027 0.030 0.026 0.024 0.026 0.028 0.029
E 0.398 0.118 0.046 0.027 0.027 0.028 0.033 0.027 0.026 0.029 0.031 0.029
F 0.142 0.041 0.026 0.026 0.026 0.031 0.034 0.033 0.032 0.029 0.031 0.032
G 0.051 0.031 0.026 0.026 0.029 0.032 0.031 0.030 0.028 0.031 0.033 0.032
H 0.048 0.029 0.030 0.028 0.030 0.030 0.031 0.033 0.031 0.033 0.039 0.041
An example ELISA result from the primary screen of cloning plates (Plate No. F4 HI). Positive wells are highlighted in bold. The underlined well (B7) was selected for further cloning.
Production of Working Stocks of Mab In vitro
Once expanded to 150cm2 tissue culture flasks, the hybridomas were split (up to 1:10) and fresh flasks inoculated. The hybridomas in these freshly inoculated flasks were regularily fed with complete medium, until approximately 300ml of media was present in the flask; the cells were allowed to grow, and continue to secrete Mab until approximately 50% of the cells had died. The supernatant was then harvested by centrifugation (300g, 10 minutes), and stored at -20°C in 100ml aliquots.
In vivo
Mice treated 10 days previously with pristane (tetramethylpentadecane) (Sigma) were inoculated intra-peritoneally with 107 hybridoma cells. Ascites developed over the next 10 - 14 days. Following close monitoring the mice were sacrificed and the ascites harvested.
Storage of Hybridoma Cell Lines
Throughout the cloning process small aliquots of cells were frozen to safe-guard against the loss of a particular fusion. The technique used are as follows:
• grow cells up in 50 cm2 tissue culture flask
• resuspend cells, estimate numbers present using Neubauer counting slide
• harvest cells by centifugation (300g, 5 minutes) • resuspend cells in cryopreservant medium (FCS, 10% DMSO) to approximately 106 cells/ml
• place in cryovials in 0.5ml aliquots, wrap in tissue paper
• freeze overnight to -70°C
• transfer to liquid nitrogen for long-term storage
Cells can be 'revived' by rapid thawing at 37°C and seeding into 25cm2 flasks in complete medium (containing 50% conditioned medium).
Western Blotting
Western blotting using the Mabs was developed to allow size discrimination of recombinant FnBP and IFN-γ produced in vitro. Immobilon membrane (MiUipore) was 'wetted' with methanol, then rinsed in milli-Q H2O, and equilibrated in cold blotting buffer for 10 minutes. The acrylamide gel to be blotted was also equilibrated in cold blotting buffer for 10 minutes. Following equilibration, the blot was assembled in a sandwich between Whatman 3MM paper. Having ensured the elimination of all air bubbles the blot was subjected to 12 Vcm"1 for 2-3 hours (Mini-Transblot™, BioRad). Following blotting, membranes were stained using Ponceau S, markers highlighted, and destained using PBS.
The membrane was then 'blocked' for 30 minutes using blocking solution (10% Marvel, PBS, 0.5% Tween 20). The appropriate Mab supernatant (diluted 1: 1 in blocking solution) was then applied and incubated at room temperature for 2 hours. Following three 20 minute washes in wash solution (PBS 0.5% Tween 20) the second antibody was applied (horseradish peroxidase rabbit anti-mouse IgG (whole molecule), Sigma) at a dilution of 1:5000 in blocking solution, for 1 hour. The blot was then washed 3 X, for 20 minutes each, in wash solution before rinsing twice in PBS. The blot was then developed using di-amino-benzadine (0.6mg/ml di-amino-benzadine, lμl/ml H2O2 in PBS) and dried for storage. Enhanced chemiluminescence (ECL) was used for developing western blots when enhanced sensitivity was required for detection of recombinant proteins. Western blotting was performed as described above except for the different procedure used in development of the blot outlined below. Following the application of the MAbs and the second PBS wash the blot was developed using a commercially available chemiluminescence kit (ECL, Amersham). The method was followed as outlined in the manufacturer's handbook. Exposure of film (Hyperfilm, Amersham); exposure times were varied according to the strength of the signal. Films were developed manually using standard film processing reagents (Kodak). Typically 25μl of supernatant and cell extract were blotted on each occasion. MAbs used in the blots varied according to the proteins being detected. MAbs G3a (ascites) and F4a (ascites) and a commercially available egfp MAb were used as primary Ab at a dilution of 1:5000. The second antibody was anti-mouse IgG (whole molecule) conjugated to horseradish peroxidase (Sigma). One monoclonal was tested against its relevant recombinant protein using the other recombinant protein as a negative control (ie G3a, Fib).
Approximately 50ng of the recombinant proteins, pQE-30 FnBP, pQE-30 FnBP mixed with FCS and pET32 IFN-γ, were resolved, alongside molecular weight markers (T7, Sigma) by SDS-PAGE (gel concentration = 15%).
The results of the western blotting are illustrated in figure 16. The MAb G3a detected recombinant protein with a high degree of specificity, however the MAb Fib only generated a very weak signal with cross reactivity with recombinant IFN-γ. The mixing of FCS with the recombinant protein did not affect the recognition of FnBP which dissociated from the fibronectin in the FCS when resolved by SDS-PAGE.
All the Mab supernatants were tested against recombinant protein by dot blot. This technique is similar in principle to that described above except recombinant protein is blotted directly onto the membrane (size discrimination is therefore not possible). The opposing recombinant protein was used as a negative control. This was allowed screening a large number of supernatants for future use in western blotting. Supernatants were used at 1:1 in blocking solution; ascites fluid was used at 1:5000 in blocking solution.
The results of the dot blotting are illustrated in figure 17.
The IFN-γ MAbs Gla, Gib, Glc, G2a and G2b all either cross reacted with the FnBP recombinant protein or were negative. G3a and G4a were both positive with no cross reactivity against FnBP. The FnBP MAbs F2a, F2b and F2c generated a weak positive signal but cross reacted with IFN-γ. Fla, Fib and F3b generated specific weak positive signals. F3a, F4a and F4b generated a specific positive signal. The MAbs F3a, F4a and F2c when raised as ascites gave a stronger positive signal as compared to the same MAbs raised in vitro.
MAbs were successfully raised against the two recombinant proteins (7 against IFN-γ and 9 against FnBP), of varying affinity.
Initial fusions were lost due to overgrowth of hybridomas by residual myeloma cells; this was probably due to degradation of the aminopterin; a second round of fusions using fresh HAT medium resulted in the generation and recovery of thirty hybidomas from the two fusions.
Example 6
Construction of Eukaryotic Expression Vectors
Expression of recombinant protein in eukaryotic cells requires the cloning of the DNA encoding the protein of interest into an appropriate expression vector.
pEGFP-Nl (Clontech, CA USA) was selected as a suitable vector from which the expression vectors could be built. pEGFP-Nl encodes a red-shifted variant (EGFP) of wild-type green fluorescent protein (GFP), and is designed such that the protein of interest can be expressed as an N-terminal fusion to EGFP. Protein expression is driven by the 'strong' cytomegalovirus (CMV) immediate early promoter and the SV40 downstream polyadenylation signal ensures the correct processing of the 3' end of the transcribed mRNA. The vector backbone also contains an SV40 origin for replication in eukaryotic cells expressing the SV40 T antigen (eg Cos7), a pUC origin of replication for propagation in E. coli and an fl origin for single-stranded DNA production. Antibiotic resistance is encoded by the neomycin / kanamycin resistance gene; this is under the control of an S V40 early promoter with polyadenalation signals from the Herpes simplex virus thymidine kinase (HSV tk) gene allowing expression and selection using G418 in eukaryotes. An upstream bacterial promoter allows kanamycin selection in E.coli.
The invention provides a recombinant viral vector expressing both antigens and cytokines. However the virus may also have to encode a marker gene of some description to allow for selection of recombinant viridae during the recombination process (see EGFP above). The requirement for expression of these three proteins can be met in a variety of ways. One option would be to express each of the proteins from their own expression cassette (ie with their own promoter and poly A tail); however this approach, whilst possible, may be technically very demanding as the size of the vectors involved would be large (>20kb) and would contain significant regions of homology which may make them susceptible to recombination events whilst propagating in E. coli. The second possible approach to this problem is to construct a single expression cassette encoding expression of all of the proteins of interest. This approach has been made possible by the discovery of internal ribosomal entry sites (IRES) which allow the recognition and binding of ribosomes internally on transcribed mRNA (Molla, A., Jang, S.K., Paul, AN., Reuer, Q. and Wimmer, E. (1992). Nature, 356, 255 j. This second approach was used to express the bacterial antigen (FnBP) as a fusion to EGFP, with IFΝ-γ expressed alone by insertion downstream of the IRES.
The pIRESl neo vector (Clontech, CA USA) was selected as a source of an internal ribosomal entry site. This vector contains the IRES of encephalomyocarditis virus (ECMV) which permits the translation of two open reading frames from one mRΝA. A synthetic intron known to enhance the stability of mRΝA is also included.
Construction of His-tagged EGFP Vector
As an aid to identification and purification of recombinant proteins it was decided to engineer a hexa-his tag onto the Ν-terminal end of EGFP.
Two oligonucleotides, His 1 and His 2, were designed to insert into the vector pEGFP-Νl, 'in frame' with EGFP, between the 5' βαmHI and 3' PinAl (Ageϊ) restriction sites. As well as encoding the six histidine residues, the oligos also encoded a start codon and Kozak consensus translation initiation site engineered between the terminal 5' BamHl site and an internal 5αmHI site prior to the histidine residues. This construction allowed the use of a his-tagged EGFP as a positive control whilst also allowing further cloning into the BamHl site in the formation of fusion proteins.
Hisl - 5' GAT CCGACGAGATGG GATCCC ATC ACC ATC ACC ATC ACG GA 3'
His2- 5' CCG GTC CGT GAT GGT GAT GGT GAT GGG ATC CCATCTCGTCG 3'
The oligonucleotides Hisl and His2 were diluted and annealed together, as shown below, prior to ligation into the pEGFP-Nl vector. Phosphorylation of the oligonucleotides was not necessary as cleavage of the vector yielded incompatible cohesive ends, thus also ensuring directional 'in frame' insertion of the fragment.
GATCCGACGAGATGGGATCCCATCACCATCACCATCACGGA
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I GCTGCTCTACCCTAGGGTAGTGGTAGTGGTAGTGCCTGGCC Λ Λ Λ Λ / \
BamHl Kozak Start BamHl 6 x histidine PinAI
Linearisation of the vector pEGFP-Nl was achieved using the restriction enzymes BamHl and PinAI. PinAI digestion of the pEGFP-Nl vector was performed prior to digestion with BαmHI due to the proximity of the two restriction sites and the known ability of 5αmHI to cut very close (i.e. lbp) to the end of double stranded linearised vector (Moreira, R. and Noren, C. (1995). Biotechniques, 19, 56).
Insertion of the hexa-his oligo was confirmed by HindRl I PinAI restriction digestion and acrylamide gel electrophoresis and the newly formed vector was denoted pEGFP-HH.
Construction of His-Tagged EGFP IFN-γ Fusion Vector Oligonucleotides were designed to amplify the sequence encoding the IFN-γ fragment
(including the signal sequence). These primers were denoted GIFNECOfor and
GIFNBAMrev and were designed to flank the amplified region with a 5' EcoRI and 3' 'in frame' .BαmHI restriction endonuclease site. The oligonucieotide GIFNBAMrev was engineered so that the stop codon was removed from the IFN-γ sequence thus allowing
'read through' into the ΕGFP coding region and hence the formation of a fusion protein.
GIFNECOfor - 5' AGT CAT GAA TTC CTA ACT CTC TCC TAA ACA ATG 3'
\ Λ /
EcoRI Region of homology
GIFNBAMrev - 5' AGC ATC GGA TCC CGTTGA TGC TCT CCG GCC TCG 3'
\ / \ /
BαmHI Region of homology
The IFN-γ fragment was amplified using 10 cycles of PCR from the vector pUCglFN using the PCR conditions previously described. The resulting fragments and the vector pEGFP-HH were cut with EcoRI and BamHl and ligated (Figure 18). Following transformation, colonies were screened by colony PCR, a positive clone was selected and test digested for the insert prior to selection for further use. The newly formed recombinant was denoted pΕGFP-HH-IFN (Figure 19).
Construction of His-tagged ΕGFP FnBP Fusion Vector
The FnBP 'mini-gene' had to be constructed prior to insertion into the expression vector. This was achieved by 'three way' ligation of the BamHl - EcoRI IFN-α signal sequence fragment along with the EcoRI - Xbal FnBP fragment into the vector pBluescript II KS (Stratagene) cut at BamHl and Xbal. Successful ligation was confirmed by BamHl - Xbal digestion of the resulting plasmid pBSaFnBP.
Oligonucleotides were designed to amplify the sequence encoding the FnBP 'mini-gene'. These primers were denoted AIFHHSTDfor and FnBPBAMrev and were designed to flank the amplified region with a 5' HindRl and 3' 'in frame' 5αmHI restriction endonuclease site. The primer FnBPBAMrev was designed such that the synthetic 'stop' codon was lost from the end of the FnBP 'mini-gene', thus allowing 'read through' and formation of the FnBP / EGFP fusion protein.
AIFNHINDfor - 5' AGT CAT AAG CTT CAG AGT CAC CCA CCT CAC CAG 3'
\ Λ /
Hindlll Region of homology
FnBPBAMrev - 5' AGC ATC GGA TCC TGG CAC GAT TGG AGG TGT TGT 3'
\ Λ /
BαmHI Region of homology
The FnBP 'mini -gene' was amplified using 10 cycles of PCR from the vector ppBSaFnBP using the PCR conditions previously described. The resulting fragments and the vector pEGFP-HH were cut with HindRl and BamHl and ligated (figure 20). Following transformation, colonies were screened by colony PCR, a positive clone was selected and test digested for the insert prior to selection for further use. The newly formed plasmid was denoted pEGFP-HH-FnBP (Figure 21).
Construction of the Double Recombinant Plasmid
It was necessary to construct a double recombinant plasmid to investigate the feasibility of controlling the expression of both recombinant proteins from the same promoter sequence. The double recombinant expression plasmid was constructed using a number of steps outlined below.
Synthetic oligonucleotides were designed to amplify the sequence encoding IFN-γ, with a C-terminal hexa-his motif, from the vector pEGFP-HH-IFN. These oligonucleotides were denoted GIFNXMAfor and HHXBArev and were designed to flank the amplified region with a 5' Zmαl and 3' Xbal restriction endonuclease site, with a synthetic stop codon inserted upstream of the Xbal site.
GIFNXMAfor - 5' AGT CAT CCC GGG CTA ACT CTC TCC TAA ACA ATG 3'
\ Λ / Xmal Region of homology
HHXBArev - 5' AGC ATC TCT AGATTAGTG ATG GTG ATG GTG ATG 3'
\ Λ Λ /
Xbal STOP Region of homology
The IFN-γ hexa-his encoding region was amplified from the vector pEGFP-HH-IFN using 10 cycles of PCR using the PCR conditions previously stated. The resulting fragment was digested with Xmαl and Xbal. The vector pIRESneo was digested with Smαl and Xbal to remove the neomycin resistance cassette; the PCR fragment was then ligated into the Smαl - Xbal cut pIRESneo. Following transformation, a positive clone was identified by test digestion and the plasmid was denoted pIRES-IFN (See Figure 22).
pIRES-IFN was then digested with EcZXI and EcZ136 π, releasing a fragment containing the internal ribosomal entry site, some of the MCS, the IFN-γ hexa-his fragment and the SV40 polyA site.
The vector pΕGFP-HH-FnBP was linearised by digesting with Notl and Hpal, and the pIRΕS-IFΝ fragment was inserted by ligation (Figure 23). Following transformation, a positive clone was identified by test digestion with Xhol, Xbal and EcoRI alone. The resulting plasmid was denoted pΕGFP-HH-FnBP-IFΝ (Figure 24).
It would be preferable for the IFΝ-γ protein to be encoded upstream of the IRES, and the FnBP / EGFP fusion downstream so that if expression of the downstream element is achieved, one can be guaranteed high levels of expression of the upstream element.
The optimal level of expression for either the antigen or the cytokine is not yet known; for this reason it would be obvious to place the FnBP / EGFP fusion downstream of the IRES as detection of fluorescence could then be taken as a very good indicator of successful antigen and cytokine expression. However the double recombinant was not engineered in this way at this time because availability of suitable restriction sites was limited both by the need to insert the IRES sequence between the end of the EGFP region and the SV40 polyA tail; and also by the restriction sites acquired by the plasmids on addition of the fragments encoding the FnBP and IFN-γ.
Example 7
Expression of Recombinant Bovine Interferon-γ and the Binding Domains of
Staphylococcus Aureus Fibronectin Binding Protein in Eukaryotic Cells
Cos 7 cells, an African Green Monkey cell line expressing the large T antigen of SV40 , were used in these expression studies. This was to ensure a high copy number of the plasmid of interest so as to enhance the chances of detecting production of recombinant protein.
Madin Darby Bovine Kidney (MDBK) cells, and African Green Monkey Kidney (Cos 7) cells were propagated in Eagle's Minimal Essential Medium (MEM) (Sigma, Poole), supplemented with 5% foetal calf serum, 3% sodium bicarbonate, 1% glutamine, 1% non-essential amino acids, 0.5% lactalbumin hydrolysate, 0.5% gentamicin and 0.1% fungizone (Growth medium - GM). Cultures were maintained at 37°C in 5% CO2. Sub-culturing was by trypsinisation of cell sheets and ~1 in 10 dilution every 7 - 10 days.
Transfection of Host Cell Line
The host cell line was transfected using a commercially available highly-branched polycationic transfection reagent (SuperFect, Qiagen). SuperFect assembles around the plasmid DNA in a spherical manner, optimising DNA entry into cells. A net positive charge enables the complexes to bind to negatively charged receptors (eg sialylated glycoproteins) on the surface of the cell. Once internalised the buffering ability of the SuperFect leads to pH inhibition of lysosomal nucleases.
The protocol used in the transfection was similar to that outlined in the manufacturer's handbook. On the day prior to transfection, Cos7 cells were seeded into 30mm dishes in sufficient numbers to ensure 40-80% confluence at the time of transfection (typically by splitting 1:6 to 1:10), and incubated overnight at 37°C in 5% CO2. Prior to transfection, 2μg of plasmid DNA in water (concentration >0.1μg/μl) was mixed with growth medium (Eagle's Minimal Essential Medium (MEM) (Sigma), supplemented with 3% sodium bicarbonate, 1% glutamine, 1% non-essential amino acids, 0.5% lactalbumin hydrolysate) without antibiotics or FCS, to a volume of lOOμl. (Plasmid DNA had previously been prepared by purification using ion-exchange columns (Qiagen)). lOμl of SuperFect reagent was then added and the resulting solution vortexed for 10 seconds.
Following incubation at room temperature for 10 - 15 minutes (allowing complex formation) 600μl of growth medium was added and the resulting solution was transferred to the 30mm dishes containing the cell sheets which had previously been washed 3 X with PBS.
Following incubation for 2 hours at 37°C and 5% CO2 the media was aspirated, the cells washed once with PBS and 0.5 ml of fresh growth medium added. The cells were then incubated for 48 - 72 hours before assessment of levels of over-expression.
Transfection of Cos7 cells was successfully achieved using SuperFect transfection reagent. However the transfection efficiency was low, as assessed by UV microscopy, with approximately 10-15% of cells typically transfected. There was no apparent difference in the transfection efficiency between any of the different plasmids used.
Detection of Fluorescence
Seventy two hours post transfection fluorescence was detected using an inverted UV microscope with an excitation filter of 450-490 nm and an emission filter of 510 nm. Prior to visualisation, media was removed (and stored at -20°C), the cell sheet washed twice with PBS and then covered with a small quantity of fresh PBS.
Background fluorescence was assessed in the Cos7 cell line and was found to be negligible. UV microscopy confirmed the successful over-expression of EGFP in the Cos7 cell line. All the plasmid constructs tested resulted in fluorescence, though the intensity varied. Fluorescence, encoded by plasmids encoding the IFN-γ-EGFP fusion, the FnBP-EGFP fusion and the double recombinant IFN-γ / FnBP-EGFP are illustrated in figures 25, 26 and 27 respectively.
Harvesting of Cells Sheets
Following visualisation, the PBS was removed from the cell sheet and replaced with 0.5ml of cell lysis solution (PBS, 0.5% Triton X-100 (Sigma)), containing protease inhibitors (2mM phenyl methyl sulphonyl flouride (PMSF), 2μg/ml pepstatin). Following incubation at room temperature for 10 minutes, the cell sheet was disrupted and the resulting suspension placed in a microcentrifuge tube. The cell suspension was vortexed to further release cell contents. The cell debris were then pelleted by centrifugation (>1000g) and the supernatant harvested for further use.
Western Blotting
Western blotting was performed as previously described. 25μl of both the cell and supernatant fractions were resolved by SDS-PAGE on 12% polyacrylamide gels prior to blotting as previously described.
Western blotting and ECL successfully detected the over-expression of recombinant protein in both the EGFP fusion constructs and in the double recombinant. Results are illustrated in figures 28, 29, 30 and 31.
The EGFP monoclonal detected protein production, of both fused and unfused EGFP, in all cases. The IFN-γ MAb successfully detected IFN-γ when fused to EGFP; however it was unable to detect IFN-γ when expressed alone in the double recombinant. The FnBP MAb was unable to detect FnBP production, under any circumstances. However it was safe to assume that FnBP was being expressed as a fusion because a band of appropriate size was detected when using the EGFP monoclonal.
Discussion
The recombinant proteins of interest were successfully expressed and detected in eukaryotic cells demonstrating the utility of these expression cassettes, and their potential use once inserted into the candidate virus vector. General discussion
The BHV-2 tk has been cloned and modified to allow insertion of heterologous DNA. The cytokine, IFN-γ, and the antigen, FnBP, have been cloned, overexpressed and MAbs have been raised against them, thus enabling detection of their production by both eukaryotic expression vectors and recombinant viridae. Eukaryotic expression plasmids have been constructed, and the ability to express and secrete both the FnBP and IFN-γ has been demonstrated. The expression cassettes in these plasmids can be easily modified so they are flanked by the BHV-2 tk, thus facillitating the process of homologous recombination.
Construction of these eukaryotic expression plasmids allows the construction of recombinant viridae.
Construction of Recombinant viridae
The amplified BHV-2 tk region has already been engineered to contain the novel restriction sites Bgl R and Sal I. These sites will facilitate the insertion of the expression cassettes described in chapter 6 into the tk region. These newly engineered plasmids, illustrated in figures 32 and 33 will then be used to construct the recombinant BHV-2 viridae by homologous recombination using standard molecular techniques.
In vivo Evaluation of BHV-2 Recombinant Viridae
Initially the recombinant viridae can be evaluated by inoculation of Friesian heifer calves, S/C in the perineal region. Any clinical effect on the calves will be noted and regular serum samples assessed using ELISA for immunoglobulin isotype and subisotype activity against BHV-2 and FnBP using a panel of monoclonal antibodies against bovine IgGi, IgG2, IgA and IgM, as the immunoglobulin isotype/subisotype has been shown to be crucial to the level of opsonisation of bacteria for neutrophils and other leucocytes (Howard, C.J., Taylor, G. and Brownlie, J. (1980). Research in Veterinary Science, 29, 128). The calves will be re-inoculated after 6 weeks to assess the amanestic response. After another 6 weeks the calves will be sacrificed and the draining lymph nodes, virgin mammary gland tissue and related CNS ganglia tested for the presence of the recombinant virus, initially by PCR, and later by in-situ hybridisation. These latter results would indicate if and where the BHV-2 has become established.
Depending on these initial results, either the recombinant virus expressing FnBP alone or the virus expressing both FnBP and IFN-γ will be selected for local infusion into the mammary glands of a group of barren cows in the late or dry (non-milking) phase of the lactation cycle. Regular and careful examination will assess any clinical effect of the BHV-2 on the cattle. Regular serum and mammary gland (lacteal) samples will be tested as above for isotype and sub-isotype activity against BHV-2 and FnBP. The cows will be re-inoculated after 6 weeks and sacrificed and analysed as described above.
Using primary and adapted cell lines from bovine mammary tissue (in collaboration with Dr. J. Fitzpatrick) the recombinant BHV-2 / IFN-γ will be used to attempt the in vitro enhancement of MHC Class U expression on the bovine tissue culture cells utilising monoclonal antibodies against cattle MHC Class π (Fitzpatrick, J.L., Mayer, S.J., Vilela, C, Bland, P.W. and Stokes, CR. (1994). Journal of Dairy Science, 77, 2940). Bovine IFN-γ has been shown to increase the functional capability of mammary gland neutrophils against S.aureus (Sordillo, L.M., Sinder, M., Hughes, H., Afseth, G., Campos, M. and Babiuk, L.A. (1991). Journal of Dairy Science, 74, 4164).
Modulating Tissue Specific Expression using different Enhancer / Promoter Sequences
The area of tissue specific expression has, and continues to generate, considerable interest as a tool in gene therapy and in the production of therapeutic agents for interspecies administration. This area holds great promise in the development of polyvalent recombinant vaccines directed against specific diseases in different target organs, resulting in a more appropriate local immune response to a systemically administered vaccine. The mammary gland and mastitis form an ideal model for investigation of this principle as a long standing problem associated with vaccination against mastitis has been the generation of an appropriate immune response (Yancey, R.J. (1997). Proceedings of the British Mastitis Conference, 36). Both viral and endogenous mammary specific enhancer-promoters have already been identified in cattle and other species (Hall, L., Emery, D.C., Davies, M.S., Parker, D. and Craig, R.K. (1987). Biochemistry Journal, 242, 735; Vilotte, J.L., Soulier, S., Mercier, J.C., Gaye, P., Hue-Delahaie, D. and Furet, J.P. (1987). Biochimie, 69, 609; Laird, J.E., Jack, L., Hall, L., Boulton, A.P., Parker, D. and Craig, R.K. (1988). Biochemistry Journal, 254, 85; Lefebvre, P., Berard, D.S., Cordingley, M.G. and Hager, G.L. (1991). Molecular and Cellular Biology, 11, 2529; Alexander, L.J. (1994). Bovine β-lactoglobulin gene. Unpublished data.; Davey, H.W., Ogg, S.L., Husaini, Y., Snell, R.G., Korobko, I.V., Mather, LH. and Wilkins, R.J. (1997). Gene, 199, 57).
More specifically an enhancer element from the long terminal repeat (LTR) of the mouse mammary tumor virus (MMTV) has been shown to endow the herpes simplex thymidine kinase promoter with a mammary cell specific response (Mink, S., Hartig, E., Jennewein, P., Doppler, W. and Cato, A.C.B. (1992). Molecular and Cellular Biology, 12, 4906). Other studies have shown this effect is not lactation dependent (Mok, E., Golovkina, TN. and Ross, S.R. (1992). Journal of Virology, 66, 7529). Initially the DΝA fragment encoding the MMTV mammary enhancer region (Mink, S., Hartig, E., Jennewein, P., Doppler, W. and Cato, A.C.B. (1992). Molecular and Cellular Biology, 12, 4906) will be engineered in front of a CMV promoter driving the expression of enhanced green fluorescent protein (EGFP) (in collaboration with Dr G. Banting) as an easily assessable marker of expression in primary and adapted cell lines of differing origin, including HCl 1 (in collaboration with Dr J. Fitzpatrick). This will confirm the specificity of this enhancer fragment in the bovine mammary environment. Recent studies by the author have demonstrated that EGFP will express in bovine cell lines. Other mammary promoter/enhancer sequences will be considered such as bovine α-lactalbumin (Vilotte, J.L., Soulier, S., Mercier, J.C., Gaye, P., Hue-Delahaie, D. and Furet, J.P. (1987). Biochimie, 69, 609), β-lactoglobulin (Alexander, L.J. (1994). Bovine b-lactoglobulin gene. Unpublished data) or butyrophilin (Davey, H.W., Ogg, S.L., Husaini, Y., Snell, R.G., Korobko, I.V., Mather, LH. and Wilkins, R.J. (1997) Gene, 199, 57) which although limiting expression to the lactating period, unlike MMTV, would allow investigation of the species specificity of these promoter/enhancers. Following identification, a suitable promoter/enhancer will be engineered to direct expression of IFΝ-γ and FnBP. This expression will then be assessed in vitro for tissue specificity using western blotting and/or ELISA as an essential prelude to in vivo studies.
Industrial Applicability
The skilled addressee will appreciate the industrial applicability of the present invention
REFERENCES
Anonymous 1998, (Abstract)
Alexander, L.J. (1994). Bovine b-lactoglobulin gene. Unpublished data,
An, L.L. and Whitton, J.L. (1997). A Multivalent Minigene Vaccine, Containing B-Cell, Cytotoxic T-Lymphocyte, and Th Epitopes from Several Microbes, Induces Appropriate Responses In Vivo and Confers Protection against More than One Pathogen. Journal of Virology, 71, 2292
Baumann, H. and Graudie, J. (1994). The acute phase response. Immunology Today, 15, 74
Bello, L.J., Whitbeck, J.C. and Lawrence, W.C. (1992). Bovine Herpesvirus 1 as a live virus vector for expression of foreign genes. Virology, 190, 666
Birnboim, H.C. and Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Research, 7, 1513
Booth, J. (1997). Progress in Mastitis Control - An evolving Problem. Proceedings of the British Mastitis Conference, 3
Bradley, S.J. (1998). Milk Price League Table. British Dairying, 4, 18
Bramley, A.J. and Dodd, F.H. (1998). Mastitis control: progress and prospects. Journal of Dairy Science, 51, 481 Campbell, A.M. (1986), Monoclonal Technology, in: Laboratory techniques in biochemistry and molecular biology, eds. R.H. Burdon and P.H. van Knippenberg Alsevier, Amsterdam
Capuco, AN., Bright, S.A., Pankey, J.W., Wood, D.L., Miller, R.H. and Bitman, J. (1998). Increased susceptibility to intramammary infection following removal of teat canal keratin. Journal of Dairy Science, 75, 2126
Cerretti, P.D., McKereghan, K., Larsen, A., Cosman, D., Gillis, S. and Baker, P.E. (1986). Cloning, sequence and expression of bovine IFΝ-gamma. Journal of Immunology, 136, 4561
Chandran, R.C., Shahani, K.M. and Holly, K.G. (1964). Lysozyme content of human milk. Nature, 204, 688
Cilli, V. and Castrucci, G. (1976). Infection of cattle with Bovid herpesvirus. Folia Veterinaria Latina, 6, 1
Clark, J.M. (1988). Novel non-templated nucleotide addition reactions catalysed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Research, 16, 9677
Clark, N.J., Hissey, P., Buchan, K. and Harris, S. (1997). pPV: A Novel IRES -Containing Vector to Facilitate Plasmid Immunisation and Antibody Response Characterisation. Immunotechnology, 3, 145
Davey, H.W., Ogg, S.L., Husaini, Y., Snell, R.G., Korobko, IN., Mather, LH. and Wilkins, R.J. (1997). Structure and Sequence of th Bovine Butyrophilin gene. Gene, 199, 57
Dower, W.J., Miller, J.F. and Ragsdale, C.W. (1988). High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acid Research, 16, 6127 Duncan, B.E., Bernoco, D., Davis, W.C. and Osburn, B.I. (1987). Distribution of T and B lymphocytes in mammary dry secretions, colostrum and blood of adult dairy cattle. Veterinary Immunology and Immunopathology, 14, 101
Efstathiou, S. and Minson, A.C. (1995). Herpes virus-based vectors. British medical Bulletin, 51, 45
Farabaugh, PJ. (1978). Sequence of the lacl gene. Nature, 21 A, 765
Finch, J.M., Winter, A., Walton, A.W. and Leigh, J.A. (1997). Further studies on the efficacy of a live vaccine against mastitis caused by Streptococcus uberis. Vaccine, 15, 1138
Fitzpatrick, J.L., Mayer, S.J., Vilela, C, Bland, P.W. and Stokes, CR. (1994). Cytokine-Induced Major Histocompatability Complex Class II Antigens on Cultured Bovine Mammary Gland Epithelial Cells. Journal of Dairy Science, 11, 2940
Flexner, C, Hugin, A. and Moss, B. (1987). Prevention of vaccinia virus infection in immunodeficient mice by vector-directed IL-2 expression. Nature, 330, 259
Flexner, C, Murphy, B.R., Rooney, J.F., Wohlenberg, C, Yuferov, V., Notkins, A.L. and Moss, B. (1988). Successful vaccination with a polyvalent live vector despite existing immunity to an expressed antigen. Nature, 335, 259
Fox, L.K., Liggit, H.D., Yilma, T. and Corbeil, L.B. (1990). The effects of interferon intramammary administration on mammary phagocyte function. Journal of Veterinary Medicine, 37, 28
Frost, A.J. and Mattila, T. (1988). The effect on inflammation of the bovine mammary gland of vaccination with a cell wall extract of Staphylococcus aureus. Zentralblatt Fur Veterinarmedizin - Reihe B, 35, 688 Gonzalez, R.N., Cullor, J.S., Jasper, D.E. and Bushnell, R.B. (1989). Prevention of clinical coliform mastitis in dairy cows by a mutant Escherichia co/i vaccine. Can. J. Vet. Res. 53:301. 53, 301
Gossen, M. (1995). Science, 268, 1766
Gossen, M. and Bujard, H. (1992). Proceedings of the National Academy of Sciences, 89,
5547
Hall, L., Emery, D.C, Davies, M.S., Parker, D. and Craig, R.K. (1987). Organisation and Sequence of the Human a-lactalbumin gene. Biochemistry Journal, 242, 735
Harmon, R.J. and Heald, C.W. (1982). Migration of polymorphonuclear leukocytes into bovine mammary gland during experimentally induced Staphylococcus aureus mastitis. American Journal of Veterinary Research, 43, 992
He, X.S., Rivkina, M. and Robinson, W.S. (1996). Construction of Adenoviral and Retroviral Vectors Coexpressing the Genes Encoing the Hepatitis B Surface Antigen and B7-1 Protein. Gene, 175, 121
Hibbit, K.G., N. Craven and E.H. Batten, (1992), Anatomy, Physiology and Immunology of the Udder, in: Bovine Medicine, eds. A.H. Andrews, R.W. Blowey, H. Boyd and R.G. Eddy Blackwell Scientific Publications, Oxford 273.
Hill, A.W. (1981). Factors influencing the outcome of Escherichia coli mastitis in cows.
. Research in Veterinary Science, 31, 107
Hill, A.W., Heneghan, J.S., Field, T.R. and Williams, M.R. (1983). Increase in Specific Opsonic Activity in Bovine Milk Following Experimental Escherichia coli Mastitis. Research in Veterinary Science, 35, 222-226. 35, 222 Hogan, J.S., Smith, K.L., Todhunter, D.A. and Schoenberger, P.S. (1992). Field trial to determine efficacy of an Escherichia coli J5 mastitis vaccine. Journal of Dairy Science, 75, 78
Hogan, J.S., Weiss, W.P., Todhunter, D.A., Smith, K.L. and Schoenberger, P.S. (1992). Efficacy of an Escherichia coli J5 mastitis vaccine in an experimental challenge trial. Journal of Dairy Science, 75, 415
Howard, C.J., Taylor, G. and Brownlie, J. (1980). Surface receptors for immunoglobulin on bovine polymorphonuclear neutrophils and macrophages. Research in Veterinary Science, 29, 128
Jensen, D.L. and Eberhart, R.J. (1981). Total and differential cell counts in secretions of the nonlactating bovine mammary gland. American Journal of Veterinary Research, 42, 743
Jonsson, K., Signas, C and Lindberg, M. (1991). Two different genes encode fibronectin binding prtoetins in Staphylococcus aureus. The complete nucleotide sequence and characterisation of the second gene. European Journal of Biocemistry, 202, 1041
Kaiser, T. (1984). Factors affecting the isolation of CCC DNA from Streptomyces lividans and Escherichia coli. Plasmid, 12, 19
Karupiah, G., Blanden, R.V. and Ramshaw, LA. (1990). Interferon-gamma is involved in the recovery of athymic nude mice from recombinant vaccinia virus/interleukin 2 infection. Journal of experimental medicine, 172, 1495
Kehrli, M.E., Goff, J.P., Stevens, M.G. and Boone, T.C. (1991). Effects of granulocyte colony stimulating factor administration to periparturient cows on neutrophils and bacterial shedding.
. Journal of Dairy Science, 74, 2448 Kehrli, M.E., Nonnecke, BJ. and Roth, J.A. (1989). Alterations in bovine lymphocyte functionduring the periparturient period. American Journal of Veterinary Research, 50, 215
Kenny, K., F. Bastida-Corcvera and N.L. Norcross, (1992), The Enhancement of Mammary Gland Immunity through Vaccination, in: Bovine medicine, eds. A.H. Andrews, R.W. Blowey, H. Boyd and R.G. Eddy Blackwell Scientific Publications, Oxford 335.
Killington, R.A., Randall, R.E., Yeo, J., Honess, R.W., Halliburton, I.W. and Watson, D.H. (1978). Observations of antigenic relatedness between viruses of the herpes simplex "neutroseron". I ARC Scientific Publications, 185
Kohler and Milstein (1975). MAbs. Journal o Immunology????
Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell, 44, 283
Kozak, M. (1987). At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. Journal of Molecular Biology, 196, 947
Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680
Laird, J.E., Jack, L., Hall, L., Boulton, A.P., Parker, D. and Craig, R.K. (1988). Structure and Expression of the Guinea-pig a-lactalbumin gene. Biochemistry Journal, 254, 85
Lee, C.S., Wooding, F.B.P. and Kemp, P. (1980). Identification, properties, and differential counts of cell populations using electron microscopy of dry cow secretions, colostrum, and milk from normal cows. Journal of Dairy Research, 47, 39
Lefebvre, P., Berard, D.S., Cordingley, M.G. and Hager, G.L. (1991). Two Regions of the Mouse Mammary Tumour Virus Long Terminal Repeat Regulate the Activity of its Promoter in Mammary Cell Lines. Molecular and Cellular Biology, 11, 2529 Mamo, W., Jonsson, P., Flock, J.I., Lindberg, M., Muller, H., Wadstom, T. and Nelson, L. (1994). Vaccination against Staphylococcus aureus mastitis: immunological response of mice vaccinated with fibronectin-binding protein (FnBP- A) to challenge with S. aureus. Vaccine, 12, 988
Marchuk, D., Drumm, M., Saulino, A. and Collins, F.S. (1991). Construction of T-vectors, a rapid and general system of direct cloning of PCR products. Nucleic Acids Research, 19, 1154
Martin, W.B. and Scott, F.M. (1979). Latent infection of cattle with bovid herpesvirus 2. Archives of Virology, 60, 51
May, J.T. and Orders, G. (1993). Bovine mammillitis virus growth in human cells [letter]. Veterinary Record, 133, 148
Miltenburg, J., de Lange, D., Crauwels, A., Bongers, J., Tielen, M., Schukken, Y. and Elbers, A. (1996). Veterinary Record, 139, 204
Mink, S., Hartig, E., Jennewein, P., Doppler, W. and Cato, A.C.B. (1992). A Mammary Cell-Specific Enhancer in Mouse Mammary Tumour Virus DNA is Composed of Multiple Regulatory Elements Including Binding Sites for CTF/NF1 and a Novel Transcription Factor, Mammary Cell-Activating Factor. Molecular and Cellular Biology, 12, 4906
Mok, E., Golovkina, TN. and Ross, S.R. (1992). A Mouse Mammary Tumour Virus Mammary Gland Enhancer Confers Tissue-Specific but not Lactation-Dependent Expression in Transgenic Mice. Journal of Virology, 66, 7529
Molla, A., Jang, S.K., Paul, AN., Reuer, Q. and Wimmer, E. (1992). Cardioviral Internal Ribosomal Entry Site is Functional in a Genetically Engineered Distronic Poliovirus. Nature, 356, 255 Moreira, R. and Noren, C. (1995). Biotechniques, 19, 56
Murphy, J.M. and Stuart, O.M. (1953). The effect of introducing small numbers od Streptococcus agalactiae (Cornell Strain 48) directly into the bovine teat cavity. Cornell Vet. 43, 290
Musoke, A.J., F.R. Rurangirwa and V.M. Nantulya, (1987), Biological properties of bovine immunoglobulins and systemic aritibody responses, in: The Ruminant Immune System in Health and Disease, ed. W.I. Morrison Cambridge University Press, Cambridge 393.
Nickerson, S.C, Baker, P.A. and Trinidad, P. (1989). Local immunostimulation of the bovine mammary gland with interleukin-2. Journal of Dairy Science, 72, 1764
Nickerson, S.C, Owens, W.E. and Watts, J.L. (1989). Effects of recombinant granulocyte colony-stimulating factor on Staphylococcus aureus mastitis in lactating dairy cows. Journal of Dairy Science, 72, 3286
Oliver, S.P. and Bushe, T. (1987). Growth inhibition of Escherichia coli and Kebsiella pneurnoniae during involution of the bovine mammary gland: relation to secretory composition. American Journal of Veterinary Research, 48, 1669
Outteridge, P.M. and Lee, C.S. (1998). The defense mechanisms of the mammary gland of domestic ruminants. Progress in Veterinary Microbiology Immunology, 4, 165
Paape, M.J., Wergin, W.P. and Guidry, A.J. (1981). Phagocytic defense of the ruminant mammary gland. Advances in Experimental Medical Biology, 137, 555
Park, Y.H., Fox, L.K., Hamilton, MJ. and Davis, W.C. (1992). Bovine mononuclear leukocyte subpopulations in peripheral blood and mammary gland secretions during lactation. Journal of Dairy Science, 75, 998 Persson, K., Larsson, I. and Hallen Sandgren, C (1993). Effects of certain inflammatory mediators on bovine neutrophil migration in vivo and in vitro. Veterinary Immunology and Immunopathology, 37, 99
Pighetti, G.M. and Sordillo, L.M. (1994). Enhanced antigen-specific responses in bovine mammary glands following administration of interleukin-2. Journal of Dairy Science, 78, 528
Rainard, P. (1998). Binding of bovine lactoferrin to Streptococcus agalactiae. FEMS Microbiology Letters, 98, 235
Reddy, P.G., McVey, D.S., Chengappa, M.M., Blecha, F., Minocha, H.C. and Baker, P.A. (1990). Bovine recombinant granulocyte-colony stimulating factor enhancement of bovine neutrophil functions in vitro. American Journal of Veterinary Research, 51, 1395
Rixon, F.J. and J. McLauchlan, (1998), Herpes simplex virus vectors, in: Molecular virology - A practical approach, eds. A.J. Davidson and R.M. Elliot Blavkwell Scientific Publications, Oxford 284.
Saiki, Gelfand, D.H., Stoffel, S., Scharf, J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988). Primer directed enzymic amplification of DNA with a thermostable DNA polymerase. Science, 239, 487
Schlam, O.W., Lasmanis, J. and Carroll, E.J. (1964). American Journal of Veterinary Research, 25, 83
Schuck, P. (1997). Use of surface plasmon reasonance to probe the equilibrium and dynamic aspects of interactions between biological macromolecules. Annual Reviews in Biophysics of Biomolecular Structure, 26, 541
Shafer- Weaver, K. and Sordillo, L.M. (1996). Enhancing bactericidal activity of bovine lymphoid cells during the periparturient period. Journal of Dairy Science, 19, 1347 Sheppard, M. and May, J.T. (1989). Location and characterization of the bovine herpesvirus type 2 thymidine kinase gene. Journal of General Virology, 70, 3067
Shuster, D.E., Lee, E.K. and Kehrli, M.E. (1996). American Journal of Veterinary Research, 57, 1569
Signas, C, Raucci, G., Jonsson, K., Lingren, P., Anantharamaiah, G.M., Hook, M. and Lindberg, M. (1989). Nucleotide sequence of the gene for a fibronectin-binding protein from Staphylococcus aureus: use of this peptide sequence in the synthesis of biologically active peptides. Proceedings of the National Academy of Sciences, 86, 699
Smith, K.L. and Hogan, J.S. (1996). Future Prospects for Mastitis Control. . Proceedings of XLX World Buiatrics Conference, 1, 263
Smith, K.L. and S.P. Oliver, (1981), Lactoferrin: a component of nonspecific defense of the involuting bovine mammary gland, in: The Ruminant Immune System, ed. J.E. Butler Plenum Press, ew ork 535.
Smith, K.L. and Todhunter, D.A. (1982). The physiology of mammary gland during the dry period and the relationship to infection. Proceedings of the Annual Meeting of the National Mastitis Council, 87
Sordillo, L.M. (1992). Cytokines at drying off: potential role in mastitis control. Proceedings of the 31st Annual Meeting of the National Mastitis Council, 160
Sordillo, L.M., Afseth, G., Davies, G. and Babiuk, L.A. (1992). Effects of recombinant granulocyte-macrophage colony-stimulating factor on bovine peripheral blood and mammary gland neutrophil function in vitro. Canadian Journal of Veterinary Research, 56, 16 Sordillo, L.M. and Babiuk, L.A. (1991). Controlling acute Escherichia coli mastitis during the periparturient period with recombinant bovine interferon gamma. Veterinary Microbiology, 28, 189
Sordillo, L.M. and Babiuk, L.A. (1991). Modulation of mammary neutrophil function during the periparturient period following in vitro exposure to recombinant bovine interferon-gamma. Veterinary Immunology and Immunopathology, 27, 393
Sordillo, L.M., Campos, M. and Babiuk, L.A. (1991). Antibacterial activity of bovine mammary gland lymphocytes following treatment with interleukin-2. Journal of Dairy Science, 74, 3370
Sordillo, L.M. and Nickerson, S.C. (1988). Moφhometric changes in the bovine mammary gland during involution and lactogenesis. American Journal of Veterinary Research, 49, 1112
Sordillo, L.M., Nickerson, S.C, Akers, H.M. and Oliver, S.P. (1998). Secretion composition during bovine mammary involution and the relationship with mastitis. International Journal of Biochemistry, 19, 1165
Sordillo, L.M., Nickerson, S.C. and Akers, R.M. (1989). Pathology of Staphylococcus aureus mastitis during lactogenesis: relationship with bovine mammary structure and function. Journal of Dairy Science, 72, 228
Sordillo, L.M. and Peel, J.E. (1992). Effect of interferon-gamma on the production of tumor necrosis factor during acute Es-cherichia coli mastitis. Journal of Dairy Science, 75,
2528
Sordillo, L.M., Shafer- Weaver, K. and DeRosa, D. (1997). Immunobiology of the Mammary Gland. Journal of Dairy Science, 80, 1851 Sordillo, L.M., Sinder, M., Hughes, H., Afseth, G., Campos, M. and Babiuk, L.A. (1991). Pathological changes in bovine mammary glands following intramammary infusion of recombinant interleukin-2. Journal of Dairy Science, 74, 4164
Taylor, B.C., Dellinger, J.D., Cullor, J.S. and Scott, J.L. (1994). Bovine milk lymphocytes display the phenotype of memory T cells and are predominantly CD8+. Cellular Immunology, 156, 245
Torre, P.M., Konur, P.K. and Oliver, S.P. (1992). Proliferative response of mammary gland mononuclear cells to recombinant bovine interleukin-2. Veterinary Immunology and Immunopathology, 32, 351
Treece, J.M., Morse, G.E. and Levy, C (1998). Lipid analyses of bovine teat canal keratin. . Journal of Dairy Science, 49, 1240
Turner, A.J., Kovesdy, L. and Morgan, I.R. (1976). Isolation and characterisation of bovine heφesvirus mammillitis virus and its pathogenicity for cattle. Australian Veterinary Journal, 52, 166
Tyler, J.W., Cullor, J.S. and Ruffin, D.C (1993). Immunization and immunotherapy for mastitis. [Review] [47 refs]. Veterinary Clinics of North America - Food Animal Practice, 9, 537
Velan, B., Cohen, S., Grosfeld, H., Leitner, M. and Shafferman, A. (1985). Bovine interferon alpha genes: Structure and expression. Journal of Biological Chemistry, 260, 5498
Vilotte, J.L., Soulier, S., Mercier, J.C., Gaye, P., Hue-Delahaie, D. and Furet, J.P. (1987). Complete Nucleotide Sequence of Bovine Alpha-lactalbumin Gene: Comparison with its Rat Counteφart. Biochimie, 69, 609
Watts, J.L. (1988). Etiological agents of Bovine Mastitis. Veterinary Microbiology, 16, 41 Weber, L., Peterhans, E. and Wyler, R. (1983). The chemiluminescent response of bovine polymoφbonuclear leukocytes isolated from milk and blood. Veterinary Immunology and Immunopathology, 4, 397
Wier, J.P. and Dacquel, E.J. (1995). Plasmid insertion vectors that facilitate construction of heφes simplex virus gene delivery vectors. Gene, 154, 123
Yancey, R.J. (1997). Vaccines for bovine mastitis: fact or fiction. Proceedings of the British Mastitis Conference, 36
Yilma, T. (1994). Genetically engineered vaccines for animal viral diseases. Journal of the American Veterinary Medical Association, 204, 1606
Yoshida, K., Ichiman, Y., Narikawa, S. and Evans, W.B. (1984). Staphylococcal capsular vaccine for preventing mastitis in two herds in Georgia. Journal of Dairy Science, 67, 620

Claims

Claims
1. A BHV-2 based vector comprising at least one cytokine-encoding DNA sequence.
2. A BHV-2 based vector according to claim 1 in which the cytokine is selected from interleukins (IL), colony stimulating factors (CSF), interferons (IFN) and tumour necrosis factors (TNF).
3. A BHV-2 based vector according to claim 1 or 2 in which the cytokine is IFN-╬│.
4. A BHV-2 based vector according to claim 3 in which the IFN-╬│ is bovine IFN-╬│.
5. A BHV-2 based vector according to any preceding claim in which the cytokine is expressed after introduction of the vector into a cell or organism.
6. A BHV-2 based vector according to any preceding claim further comprising at least one copy of an antigen-encoding DNA sequence.
7. A BHV-2 based vector according to claim 6 in which the antigen is selected from proteins expressed by mastitis-causing bacterial species or portions of such proteins.
8. A BHV-2 based vector according to claim 7 in which the protein is a protein expressed by Staphylococcus aureus; Streptococcus agalactia, Streptococcus dysgalactia, Streptococcus uberis or Escherichica coli.
9. A BHN-2 based vector according to claim 8 in which the protein is the fibronectin binding protein of Staphylococcus aureus, Lipopolysaccharide (LPS) K85 or J5 core antigen.
10. A BHV-2 based vector according to any one of claims 6 to 9 in which the antigen is expressed after introduction of the vector into a cell or organism.
11. A BHV-2 based vector according to any preceding claim comprising at least one mutation which inhibits reversion of the vector to a wild type form.
12. A BHV-2 based vector according to claim 11 in which the mutation is a frame shift mutation.
13. A BHV-2 based vector according to any preceding claim further comprising at least one marker gene expressed after introduction of the vector into a cell or organism.
14. A BHV-2 based vector according to claim 13 in which the marker gene is selected from ╬▓-galactosidase and EGFP.
15. A BHV-2 based vector according to any preceding claim which further comprises a gene sequence which, on expression, causes viral deactivation.
16. A BHV-2 based vector according to any preceding claim in which at least one of the cytokine, antigen, marker and viral deactivation gene sequences is controlled by an internal ribosomal entry site.
17. A BHV-2 based vector according to any preceding claim in which at least one of the cytokine, antigen, marker and viral deactivation gene sequences is inserted in a BHV-2 thymidine kinase or glycoprotein gene sequence or portion thereof or sequence derived from such a sequence or portion thereof.
18. A recombinant virus produced using a BHV-2 based vector according to any preceding claim.
19. The use of a BHV-2 based vector according to any one of claims 1 to 17 or a recombinant virus according to claim 18 as a vaccine.
20. A BHV-2 based vector according to any one of claims 1 to 17 in which the cell or organism is selected from ruminants, cattle, sheep, goats, dogs, cats, horses or man or cells or tissues thereof.
21. A vaccine comprising or consisting of a BHV-2 based vector according to any one of claims 1 to 17 or a recombinant virus according to claim 18 and a pharmaceutically acceptable diluent.
22. A method of preventing or treating a mucosal disease comprising treating a subject with a BHV-2 based vector according to any one of claims 1 to 17 or a recombinant virus according to claim 18 or a vaccine according to claim 21.
23. A method according to claim 22 in which the subject is selected from ruminants, cattle, sheep, goats, dogs, cats, horses, or man or cells or tissues thereof.
24. A method of preventing or treating a stress-induced disease in a subject, the method comprising administering to the subject a vector according to any one of claims 1 to 17 or a vaccine according to claim 18 whereby stress results in expression of at least the cytokine.
25. A method according to claim 24 where stress results in expression of the cytokine and the antigen.
26. A method according to claim 24 or 25 in which the subject is a cow.
27. A method of expressing a polypeptide or protein in a cell or organism, the method comprising introducing a vector according to any one of claims 1 to 17 or a virus according to claim 18 into the cell or organism whereby at least the cytokine is expressed from the vector.
28. A method according to claim 27 in which the organism or cell is selected from ruminants, including cattle, sheep, goats, & horses, dogs, cats, or man or cells or tissues thereof.
29. A method according to claim 27 or 28 in which the expression of the protein leads to an immune response in the cell or organism.
PCT/GB1998/002927 1997-09-29 1998-09-29 Bovine herpesvirus 2 (bhv-2) based vector and its uses WO1999016892A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU92725/98A AU9272598A (en) 1997-09-29 1998-09-29 Bovine herpesvirus 2 (bhv-2) based vector and its uses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB9720633.8A GB9720633D0 (en) 1997-09-29 1997-09-29 BHV-2 vector
GB9720633.8 1997-09-29

Publications (1)

Publication Number Publication Date
WO1999016892A1 true WO1999016892A1 (en) 1999-04-08

Family

ID=10819764

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1998/002927 WO1999016892A1 (en) 1997-09-29 1998-09-29 Bovine herpesvirus 2 (bhv-2) based vector and its uses

Country Status (3)

Country Link
AU (1) AU9272598A (en)
GB (1) GB9720633D0 (en)
WO (1) WO1999016892A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11649268B2 (en) * 2016-06-16 2023-05-16 Eth Zurich Fibronectin-binding peptides for use in tumor or fibrosis diagnosis and therapy

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0294349A2 (en) * 1987-06-01 1988-12-07 Alfa-Laval Agri International Ab A fibronectin binding protein as well as its preparation
EP0343137A1 (en) * 1988-05-20 1989-11-23 Alfa-Laval Agri International Ab Fibronectin binding protein
EP0397633A2 (en) * 1989-05-11 1990-11-14 Alfa-Laval Agri International Ab Fibronectin binding protein as well as its preparation
EP0471457A2 (en) * 1990-07-24 1992-02-19 Novagene, Inc. Herpesvirus-based viral vector which expresses a foot & mouth disease virus epitope
WO1994004174A1 (en) * 1992-08-21 1994-03-03 The University Of Melbourne Cytokine applications
WO1994024296A2 (en) * 1993-04-19 1994-10-27 University Of Saskatchewan Recombinant bovine herpesvirus type 1 vaccines
EP0663403A1 (en) * 1993-11-23 1995-07-19 Akzo Nobel N.V. Vector vaccines of bovine herpesvirus I
WO1996003510A1 (en) * 1994-07-22 1996-02-08 Merck & Co., Inc. A polynucleotide herpes virus vaccine
WO1996029421A1 (en) * 1995-03-23 1996-09-26 Cantab Pharmaceuticals Research Limited Vectors for gene delivery
WO1997014799A1 (en) * 1995-10-16 1997-04-24 Smithkline Beecham Plc Fibronectic binding protein b compounds

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0294349A2 (en) * 1987-06-01 1988-12-07 Alfa-Laval Agri International Ab A fibronectin binding protein as well as its preparation
EP0343137A1 (en) * 1988-05-20 1989-11-23 Alfa-Laval Agri International Ab Fibronectin binding protein
EP0397633A2 (en) * 1989-05-11 1990-11-14 Alfa-Laval Agri International Ab Fibronectin binding protein as well as its preparation
EP0471457A2 (en) * 1990-07-24 1992-02-19 Novagene, Inc. Herpesvirus-based viral vector which expresses a foot & mouth disease virus epitope
WO1994004174A1 (en) * 1992-08-21 1994-03-03 The University Of Melbourne Cytokine applications
WO1994024296A2 (en) * 1993-04-19 1994-10-27 University Of Saskatchewan Recombinant bovine herpesvirus type 1 vaccines
EP0663403A1 (en) * 1993-11-23 1995-07-19 Akzo Nobel N.V. Vector vaccines of bovine herpesvirus I
WO1996003510A1 (en) * 1994-07-22 1996-02-08 Merck & Co., Inc. A polynucleotide herpes virus vaccine
WO1996029421A1 (en) * 1995-03-23 1996-09-26 Cantab Pharmaceuticals Research Limited Vectors for gene delivery
WO1997014799A1 (en) * 1995-10-16 1997-04-24 Smithkline Beecham Plc Fibronectic binding protein b compounds

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TYLER J.W. ET AL.: "Immunization and immunotherapy for mastitis", VETERINARY CLINICS OF NORTH AMERICA: FOOD ANIMAL PRACTICE, vol. 9, no. 3, November 1993 (1993-11-01), pages 537 - 549, XP002095921 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11649268B2 (en) * 2016-06-16 2023-05-16 Eth Zurich Fibronectin-binding peptides for use in tumor or fibrosis diagnosis and therapy

Also Published As

Publication number Publication date
AU9272598A (en) 1999-04-23
GB9720633D0 (en) 1997-11-26

Similar Documents

Publication Publication Date Title
JP3260368B2 (en) Treatment of neoplastic disease with interleukin-10
CA1339776C (en) Equine-gamma-interferon
HU193507B (en) Process for producing interferen-like pelypeptides
NZ263550A (en) Preparing cancer vaccines containing autologous tumour cells characterised in that tumour cells or firbroblasts are cultivated and transfected ex vivo with a composition of dna and a dna binding molecule conjugate
US11826408B2 (en) CD200 inhibitors and methods of use thereof
Zhang et al. Mammary gland expression of antibacterial peptide genes to inhibit bacterial pathogens causing mastitis
KR20230013016A (en) Vaccine against African swine fever virus infection
CN107353347A (en) A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof
WO1999016885A1 (en) Killer t cell receptor recognizing human immunodeficiency virus
US6201115B1 (en) Amplifying sequences, vectors comprising these sequences and their uses in compositions for the expression of nucleotide sequences in transfected cells therapeutic and vaccine applications
KR20230153405A (en) Adenovirus encoding IL-15
EP1389043B1 (en) Foot and mouth disease virus vaccine
CA2217450A1 (en) Use of an &#34;immunodeficiency-virus suppressing lymphokine (isl)&#34; to inhibit the replication of viruses, in particular of retroviruses
AU2002303503A1 (en) Foot and mouth disease virus vaccine
JPH02500327A (en) Genetically engineered vaccines against mycobacteria
WO1997000321A1 (en) Immune response modulators and uses therefor
WO1999016892A1 (en) Bovine herpesvirus 2 (bhv-2) based vector and its uses
AU724905B2 (en) Animal gene therapy
RU2326942C1 (en) Method of preparation of recombinant birds virus for vaccination and genetic therapy
JP2002513581A (en) Recombinant virus expressing foreign DNA encoding feline CD80, feline CTLA-4 or feline CD86 and uses thereof
Carvalho et al. Culture of human amniotic cells: a system to study interferon production
WO2003087348A1 (en) Packaging cell line for diphtheria toxin expressing non-replicating adenovirus
CN107253995A (en) It is a kind of by bovine albumin, Bov IFN γ and Bov IFN α fusion protein constituted and preparation method thereof
KR100318093B1 (en) Recombinant Aujesky&#39;s disease Virus
US5366728A (en) Stable forms of antigenic Taenia ovis polypeptides

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 09424683

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA