WO1999016890A2 - Production of proteins in plant seeds - Google Patents
Production of proteins in plant seeds Download PDFInfo
- Publication number
- WO1999016890A2 WO1999016890A2 PCT/US1998/020691 US9820691W WO9916890A2 WO 1999016890 A2 WO1999016890 A2 WO 1999016890A2 US 9820691 W US9820691 W US 9820691W WO 9916890 A2 WO9916890 A2 WO 9916890A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- barley
- seed
- hordein
- nucleic acid
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
- C12N15/8207—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8221—Transit peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/823—Reproductive tissue-specific promoters
- C12N15/8234—Seed-specific, e.g. embryo, endosperm
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
Definitions
- heterologous proteins in plant seeds offers the possibility of, for example, producing large quantities of easily harvested polypeptides, and of expressing proteins that improve their grain quality. Discussions of this concept can be found in U.S. Patent No. 5,714,474 ("Production of enzymes in seeds and their uses").
- Barley seed storage proteins account for about 8 to 15% of the dry weight of the mature barley grain.
- the major seed storage proteins in barley are alcohol-soluble prolamines, termed hordeins. which are classified into two major groups. B and C. and two minor groups. D and ⁇ (Shewry 1993). Depending on nitrogen levels, these four groups account for about 35 to 55% of total barley seed protein.
- the B-and C- hordeins account for about 70 to 80% and 10 to 20%, respectively, of the total hordein fraction, with small amounts of D- (2-4%) and ⁇ -hordeins (not precisely determined).
- the B-, D- and ⁇ -hordeins are sulfur- rich prolamines while the C hordeins are sulfur-poor prolamines (Bright and Shewry 1983).
- the hordeins are coordinately synthesized in the developing starchy endosperm tissue (Giese et al. 1983; S ⁇ rensen et al. 1989). They are cotranslationally transported into the lumen of the rough endoplamic reticulum, with simultaneous cleavage of the signal peptide, and are ultimately deposited into protein bodies (Cameron- Mills 1980; Cameron-Mills and von Wettstein 1980; Cameron-Mills and Madrid 1989).
- hordeins are encoded by structural genes on chromosome 5 (1H) of barley; the Horl, Hor2. Hor3 and Hor5 loci on chromosome 5 encode the C-, B-, D-, and ⁇ - hordein polypeptides, respectively (Jensen et al., 1980; Shewry et al. 1980; Blake et al. 1982; Shewry et al. 1983; Shewry and Parmar 1987). The genes for B-, C- and D-hordeins have been isolated and characterized (Brandt et al. 1985; Forde et al. 1985; Rasmussen and Brandt 1986; S ⁇ rensen et al. 1996).
- the B- and C-hordeins are encoded by multigene families comprising 10 to 20 members while D-hordein is encoded by a single gene (Brandt et al. 1985; Rasmussen and Brandt 1986; S ⁇ rensen et al. 1996).
- the regulation and expression of these hordein promoters have been studied by transient expression assays (Entwistle et al. 1991 ; Milller and Knudsen 1993; S ⁇ rensen et al. 1996) in barley endosperm. As determined by these assays using promoter- ;
- the D- hordein promoter is 3- to 5-fold more active than the B- or C-hordein promoters tested (S ⁇ rensen et al. 1996).
- the B-hordein promoter has also been studied using stable tobacco transformation with promoter-c ⁇ . fusions (Marris et al. 1988).
- Newly synthesized proteins pass through the ER membrane into the lumen, where they aggregate into small particles, which eventually form larger aggregates and protein bodies (which can be observed in electron micrographs).
- low density bodies that develop earlier and high density bodies that develop later and are derived from the ER.
- the high density proteins are formed when aggregation of proteins inside the lumen of the ER puts a strain on the membrane and cause it to rupture.
- the membrane may reform free of the protein aggregate, after an interval in which the protein body itself is not bounded by a membrane.
- the protein bodies remain as distinct membrane-bound entities even in mature seed.
- the present invention provides recombinant nucleic acid molecules that employ a seed maturation specific promoter linked to a polypeptide, and particularly to a construct that also includes a signal sequence that targets a linked polypeptide to an intracellular body, such as a protein body.
- Such constructs may be represented as P - X or P - SS - X wherein P is a seed maturation-specific promoter, SS is a signal sequence, such as a sequence that targets a linked polypeptide to an intracellular body, and X is a polypeptide to be expressed in seed or a plant embryo.
- X is a non-storage protein, which is targeted to a protein storage body. Seeds expressing polypeptides of interest may be harvested at preselected times that have been found to provide greatest expression or stability of the polypeptide.
- the invention provides recombinant nucleic acid molecules that employ hordein promoters, such as hordein B, and D promoters, to direct expression of polypeptides in seeds of transgenic plants, including onocot plants.
- hordein promoters such as hordein B, and D promoters
- the invention provides nucleic acid molecules in which a hordein signal sequence is operably linked to a nucleic acid sequence encoding the polypeptide of interest. It is shown that inclusion of a hordein signal sequence can significantly increase the levels of the expressed polypeptide in the plant seed.
- a wide range of polypeptides may be expressed in plant seeds in this manner, including pharmaceuticals such as insulin, interferons, erythropoietin and interleukins, and nutritional supplements.
- nucleic acid molecules provided by this aspect of the invention may be represented as Ph - hSS - X wherein Ph is a hordein promoter, hSS is a hordein signal sequence, and X is a nucleic acid molecule encoding a polypeptide (particularly a polypeptide that is not a seed storage protein), and where Ph, hSS and X are operably linked.
- Nucleic acid molecules lacking the hordein signal sequence may be represented as:
- the invention provides transgenic plants comprising these nucleic acid molecules, as well as seeds of these transgenic plants, which are useful as a source of the expressed polypeptide, or may improve the quality of the grain.
- the transgenic plants provided are stably transformed monocotyledenous plant, for example cereal plants, such as barley or wheat.
- the invention provides stably transformed barley plants from genotypes including: Harrington, Morex, Crystal, Stander. Moravian III, Galena, Salome, Steptoe, Klages and Baronesse.
- the invention also provides stably transformed wheat plants from genotypes including: Anza, Karl, Bobwhite and Yecora Rojo.
- the invention also provides a transformation method that, in conjunction with the nucleic acid molecules provided, may be employed to produce the stably transformed plants.
- This transformation method is based upon the production of green regenerable tissues from zygotic plant embryos, and may be used to transform any monocot species, including maize, wheat, barley, rice, oat, rye, millet, sorghum, tricalate, turfgrass and forage grasses.
- the transformation method comprises
- nucleic acid may be either P - hSS - X, p - ⁇ ,
- Ph - X wherein P is a seed maturation-specific promoter, SS is a signal sequence that vomts a polypeptide to an intracellular body (such as a protein body or vacuole), Ph is a hordein promoter (a particular seed maturation specific promoter), hSS is a hordein signal sequence, and X is a nucleic acid molecule encoding the selected polypeptide (which may be other than a seed storage protein), and where Ph, hSS and X (or Ph and X) are operably linked;
- the invention also provides seeds of stably transformed plants that express the selected polypeptide in their seed.
- Another aspect of the invention is a method of expressing a polypeptide in seed of a monocotyledenous plant, comprising providing a monocotyledenous plant that is stably transformed with a nucleic acid molecule of structure Ph - hSS - X, or Ph - X, and growing the plants under conditions effective to produce seed and express the polypeptide in the seed.
- the polypeptide can be used to improve the quality of the grain, or it can be extracted from the seed at a time of maximum expression or stability to be used for other purposes.
- FIG. 1 A is a schematic diagram of a four-primer strategy for producing chimeric products using the polymerase chain reaction (PCR).
- Fig. IB is a schematic diagram of a three-primer strategy for producing chimeric products using the polymerase chain reaction (PCR).
- Fig. 1C is a map of a construct that includes (from 5' to 3'), the B,-hordein promoter, the B,- hordein signal sequence, the uidA gene, and the nos 3' terminator.
- Figs. 2A and B show alignments of constructs comprising the B,-hordein promoter, the uidA gene, and the nos 3' terminator, with (2A) or without (2B) the B r hordein signal sequence.
- Fig. 3 shows the nucleic acid sequence of the B, -hordein promoter and the 57 base pair B,- hordein signal sequence (underlined).
- Fig. 4 shows the nucleic acid sequence of the D-hordein promoter and the 63 base pair D- hordein signal sequence (underlined).
- Fig. 5 is a bar graph showing GUS activity in mature barley seeds expressing constructs comprising the B,-hordein promoter, the uidA gene, and the nos 3' terminator either with (+SS) or without (-SS) the B,-hordein signal sequence.
- Fig. 6 is a bar graph showing GUS activity in immature barley seeds expressing constructs comprising the B,-hordein promoter, the uidA gene, and the nos 3' terminator either with (+SS) or without (-SS) the B,-hordein signal sequence.
- Fig. 7 is an electron photomicrograph in which an immunosignal is specific for protein bodies in GUS-expressing immature endosperm of a line that was transformed with the B,-hordein- uidA DNA construct containing the 19 amino acid N-terminal signal peptide sequence.
- nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids Only one strand of each nucleic acid sequence is shown, but it is understood that the complementary strand is included by any reference to the displayed strand
- Seq I D No 1 shows the nucleic acid sequence of the barley B, hordein promoter and signal sequence
- Seq I D No 2 shows the amino acid sequence of the barley B, hordein signal sequence Seq I D No 3 shows the nucleic acid sequence of the barley D hordein promoter and signal sequence
- Seq I D No 4 shows the amino acid sequence of the barley D hordein signal sequence
- Seq I D Nos 5- 16 show PCR primers used to amplify nucleic acid molecules as described herein
- CaMV cauliflower mosaic virus rbcS RUBISCO D- ⁇ bulose-l,5-b ⁇ sphosphate carboxylase/oxygenase
- Promoter A nucleic acid sequence that directs transcription of a protein This includes not only molecules having the prototypical sequences, but also promoters from gene homologs Also included are molecules that differ from the disclosed prototypical molecules by minor variations Such variant sequences may be produced by manipulating the nucleotide sequence of a promoter using standard procedures
- Hordein promoter A nucleic acid sequence that directs transcription of a hordein protein in seeds of a plant While any hordein promoter may be employed for this invention, the specific examples provided describe the use of the promoter sequences from the B, and D hordein genes of barley The nucleic acid sequences of the prototypical barley B, and D hordein genes are shown in Seq I D Nos 1 and 3, respectively as well as in Figs 3 and 5, respectively The promoter region excludes those nucleotides that encode the signal sequence (the underlined sequences shown in Figs 3 and 4) One of skill m the art will appreciate that the length of the promoter region may also be greater or less than the sequences depicted For example, additional 5' sequence from the hordein gene upstream region may be added to the promoter sequence, or bases may be removed from the depicted sequences However, any hordein promoter sequence must be able to direct transcription of an operably linked sequence in plant seed The ability of
- Functional homologs of the barley hordein promoters disclosed herein mav be obtained from other plant species, such as from other monocots, including wheat, rice and corn Specific examples of such homologs may have specified levels of sequence identity with the prototype hordein promoters (e g , at least 60% sequence identity) the functional homologs retain hordein promoter function, 1 e , retain the ability to confer seed specific expression on operably linked ORFs when introduced into plants Accordingly, where reference is made herein to a hordein promoter, it will be understood that such reference includes not only molecules having the sequences of the prototypical sequences disclosed herein (or variations on these sequences), but also promoters from hordein gene homologs Also included within the scope of such terms are molecules that differ from the disclosed prototypical molecules by minor variations Such variant sequences may be produced by manipulating the nucleotide sequence of hordein promoter using standard procedures such as site-directed mutagenesis or the polymerase chain reaction
- Hordein signal sequence The inventors have discovered that the inclusion of a hordein signal sequence in conjunction with a hordein promoter provides enhanced expression of certain heterologous proteins in seeds In particular, the expression of a protein in immature seeds is greatly enhanced when the ORF encoding the protein is operably linked to both a hordein promoter and a hordein signal sequence, compared with an equivalent construct in which the hordein signal sequence is absent While not wishing to be bound by speculation, it is proposed that the hordein signal sequence directs expression of a protein encoded by an operably linked ORF to a protected subcellular location, such as a vacuole or protein body It is further proposed that proteins directed to such vacuoles are protected from proteolysis du ⁇ gn certain stages of seed maturation
- the hordein signal sequence typically comprises about the first 15-25 amino acids of the hordein gene open reading frame, more usually about 18-21 ammo acids
- the nucleotide and amino acid sequences of the hordein signal sequences of the prototypical barley B, and D hordein genes are shown in Seq I D Nos 1-4
- homologous sequences may be used as effectively, as may sequences that differ in exact nucleotide or amino acid sequences, provided that such sequences result in enhanced levels of the encoded protein m immature seeds
- "enhanced expression” will be expression that is about twice that observed with an equivalent construct lacking the signal sequence
- the term "hordein signal sequence” includes not only the particular sequences shown herein, but also homologs and variants of these sequences
- Sequence identity The similarity between two nucleic acid sequences, or two amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity Sequence identity is frequently measured in terms of percentage identity (or similarity or homlogy). the higher the percentage, the more similar the two sequences are Homologs of the prototype hordein promoters and hordein signal sequences will possess a relatively high degree of sequence identity when aligned using standard methods Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman (1981); Needleman and Wunsch (1970); Pearson and Lipman (1988); Higgins and Sharp (1988); Higgins and Sharp (1989); Corpet et al. (1988): Huang et al. (1992); and Pearson et al. (1994). Altschui et al. (1994) presents a detailed consideration of sequence alignment methods and homology calculations.
- NCBI Basic Local Alignment Search Tool (Altschui et al., 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI. Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx. tblastn and tblastx. It can be accessed at htp://www.ncbi.nlm. nih.gov/BLAST/. A description of how to determine sequence identity using this program is available at http://www.ncbi.nlm.nih.gov/BLAST/blast help.html.
- Homologs of the disclosed prototype hordein signal sequences are typically characterized by possession of at least 60% sequence identity counted over the full length alignment with the amino acid sequence of the prototype using the NCBI Blast 2.0, gapped blastp set to default parameters. Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 70%, at least 75%, at least 80%, at least 90% or at least 95% sequence identity.
- Homologous hordein promoters include those from genes that encode proteins having equivalent levels of sequence identity with the B, and D hordein proteins (i.e., at least 60% and up to at least 95%).
- Oligonucleotide A linear polynucleotide sequence of up to about 100 nucleotide bases in length.
- a nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell.
- a vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication.
- a vector may also include one or more selectable marker genes and other genetic elements known in the art.
- a transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques.
- transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration, and includes transient as well as stable transform ants.
- Isolated An "isolated" biological component (such as a nucleic acid or protein or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extra- chromosomal DNA and RNA, proteins and organelles. Nucleic acids and proteins that have been
- isolated include nucleic acids and proteins purified by standard purification methods.
- the term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
- Recombinant A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
- cDNA complementary DNA: A piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences that determine transcription. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
- ORF open reading frame: A series of nucleotide triplets (codons) coding for amino acids without any termination codons. These sequences are usually translatable into a peptide.
- Transgenic plant As used herein, this term refers to a plant that contains recombinant genetic material not normally found in plants of this type and which has been introduced into the plant in question (or into progenitors of the plant) by human manipulation. Thus, a plant that is grown from a plant cell into which recombinant DNA is introduced by transformation is a transgenic plant, as are all offspring of that plant that contain the introduced transgene (whether produced sexually or asexually).
- transgenic plant also encompasses parts of plants, including fruit, seeds and pollen.
- the present invention is applicable to both dicotyledonous plants (e.g. , tomato, potato, soybean, cotton, tobacco, etc.) and monocotyledonous plants, including, but not limited to, graminaceous monocots such as wheat (Triticum spp.), rice (Oryza spp.), barley (Hordeum spp.), oats (Avena spp.), rye (Secale spp.), corn (Zea mays), sorghum and millet (Pennisettum spp).
- the present invention can be employed with barley genotypes including, but not limited to,
- the invention is particularly useful in cereals.
- Seed maturation or grain development refers to the period starting with fertilization in which metabolizable food reserves (e.g., proteins, lipids, starch, etc.) are deposited in the developing seed, particularly in storage organs of the seed, including the endosperm, testa, aleurone layer, embryo, and scutellar epithelium, resulting in enlargement and filling of the seed and ending with seed desiccation.
- metabolizable food reserves e.g., proteins, lipids, starch, etc.
- Inducible Characterized by a promoter that is upregulated by the presence or absence of a small molecule; it includes both direct and indirect inducement.
- Seed maturation specific promoter A promoter induced during seed maturation, for example increased by 25% or more during seed maturation.
- Signal/leader/target/transport sequence An N-terminal or C-terminal polypeptide sequence which is effective to co-translationally or post-translationally localize the polypeptide or protein to which it is attached to a selected intracellular vacuole or other protein storage body, chloroplast, mitochondria, or endoplasmic reticulum, or extracellular space or seed region, such as the endosperm, following secretion from the cell.
- barley is the hordein signal sequence
- other examples include signal sequences in maize (Bagga et al., Plant Cell 9: 1683- 1696, 1997 in which coexpression of the maize delta- zein and beta-zein genes results in stable accumulation of delta- zein in endoplasmic reticulum-derived bodies formed by beta-zein; Torrent et al..
- Terminal processing or termination sequence A DNA sequence located 3' to the coding region which causes RN A polymerase to terminate transcription of a gene, and dissociate from the DNA.
- An example is the nos 3' terminator.
- a terminator may also occur during post-transcription processing of mR A in vivo, as indicating where a precursor mRNA molecule should be cleaved to yield a mature mRNA species which will be translated.
- a segment containing a terminal-processing signal can be obtained by comparing cDNA encoding an endosperm-expressed product coding for the same product, thereby to identify the 3' terminus of the cDNA.
- Protein body Intracellular structure containing proteins within a unit membrane structure. In some cases this structure is referred to as a vacuole.
- Seed storage protein An endogenous plant protein which is synthesized and accumulated during seed maturation, stored in the dry grain, and mobilized during maturation. Such proteins are often stored in a protein body in a plant seed. Examples of such storage proteins include arachin, avenin, cocosin, conarchin, concocosin.
- the present invention provides recombinant constructs that are suitable for obtaining high level expression of a specified polypeptide in plant seeds.
- the constructs may be generally represented as Ph - hSS - X. wherein Ph is a hordein promoter.
- hSS is a hordein signal sequence, and
- X is a nucleic acid molecule encoding the specified polypeptide.
- Each of these three components is operably linked to the next, i.e., the hordein promoter is linked to the 5' end of the sequence encoding the hordein signal sequence, and the hordein signal sequence is operably linked to the X sequence.
- the construct will usually also contain 3' regulatory sequences, such as the Nos 3' region.
- 3' regulatory sequences such as the Nos 3' region.
- the characteristics of hordein promoters and signal sequences are described above.
- the B 1 and D hordein genes are described in Brandt et al. (1985) and S ⁇ rensen et al. (1996).
- the polypeptide "X" may be any polypeptide except for a hordein polypeptide, and in particular embodiments is other than a seed storage protein, or even a seed specific protein.
- Polypeptides X that may be expressed in plant seeds as described herein,as part of a P-X, P-SS-X, Ph-X or Ph-SS-X construct include non seed specific proteins such as human therapeutic proteins (e.g., erythropoietin, tissue plasminogen activator, urokinase and prourokinase, growth hormones, cytokines, factor VIII, epoetin- ⁇ , granulocyte colony stimulating factor, antibodies, vaccines, etc.), or more plant specific proteins such as enzymes for starch biosynthesis (e.g., ADP glucosepyrophosphorylase, EC 2.7.7.27; starch synthase, EC 2.4.1.21 ; and branching enzyme, R,Q) and seed specific proteins, such as those conferring enhanced nutritional value on the seeds. Nucleic acids encoding such proteins are well known in the art. The coding region for such a protein may be modified such that it more closely conforms to the preferred codon usage bias for
- heterologous proteins encoded by the chimeric gene include polypeptides that form immunologically active epitopes, and enzymes that catalyze conversion of intracellular metabolites, with the consequent build-up of selected metabolites in the cells.
- the expression cassette or chimeric genes in the transforming vector typically have a transc ⁇ ptional termination region at the opposite end from the transcription initiation regulatory region
- the transc ⁇ ptional termination region may normally be associated with the transc ⁇ ptional initiation region from a different gene
- the transc ⁇ ptional termination region may be selected, particularly for stability of the mRNA, to enhance expression
- Illustrative transc ⁇ ptional termination regions include the NOS terminator from Agrobacte ⁇ um Ti plasmid and the rice ⁇ -amylase terminator
- Polyadenylation tails are also commonly added to the expression cassette to optimize high levels of transcription and proper transcription termination, respectively Standard molecular biology methods, such as the polymerase chain reaction may be employed to produce these constructs
- Ph - hSS - X construct into plants is typically achieved using standard techniques
- the basic approach is to clone the construct into a transformation vector which is then introduced into plant cells by one of a number of techniques (e g , electroporation) and progeny plants containing the introduced construct are selected
- a number of techniques e g , electroporation
- progeny plants containing the introduced construct are selected
- all or part of the transformation vector will stably integrate into the genome of the plant cell
- That part of the transformation vector which integrates into the plant cell and which contains the introduced Ph - hSS - X sequence may be referred to as the recombinant expression cassette
- progeny plants containing the introduced transgene may be made based upon the detection of protein X expression or seeds or upon enhanced resistance to a chemical agent (such as an antibiotic) as a result of the inclusion of a dominant selectable marker gene incorporated into the transformation vector
- a chemical agent such as an antibiotic
- the Ph - hSS - X constructs of the present invention may be usefully expressed in a wide range of higher plants to obtain seed specific expression of selected polypeptides.
- the invention is expected to be particularly applicable to monocotyledonous cereal plants including barley, wheat, rice, rye, maize, tricaiate, millet, sorghum, and oat forage and turf grasses.
- the transformation methods described herein will enable the invention to be used with genotypes of barley including Morex, Harrington, Crystal, Stander, Moravian III, Galena, Golden Promise, Steptoe, Klages and Baronesse, and commercially important wheat genotypes including Yecora Rojo, Bobwhite, Karl and Anza.
- the invention may also be applied to dicotyledenous plants, including, but not limited to, soybean, cotton, beans, rape/canola, alfalfa, flax, sunflower, safflower, brassica, cotton, flax, peanut, clover: vegetables such as lettuce, tomato, cucurbits, cassava, potato, carrot, radish, pea, lentils, cabbage, cauliflower, broccoli, Brussels sprouts, peppers; and tree fruits such as citrus, apples, pears, peaches, apricots, and walnuts.
- soybean, cotton, beans, rape/canola alfalfa, flax, sunflower, safflower, brassica, cotton, flax, peanut, clover: vegetables such as lettuce, tomato, cucurbits, cassava, potato, carrot, radish, pea, lentils, cabbage, cauliflower, broccoli, Brussels sprouts, peppers
- tree fruits such as citrus, apples, pears, peaches, apricots, and walnuts.
- plant transformation vectors include one or more ORFs under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker.
- suitable 5' and 3' regulatory sequences for constructs of the present invention is discused above.
- Dominant selectable marker genes that allow for the ready selection of transformants include those encoding antibiotic resistance genes (e.g., resistance to hygromycin, kanamycin. bleomycin, G418, streptomycin or spectinomycin) and herbicide resistance genes (e.g., phosphinothricin acetyltransferase).
- Suitable methods may include, but are not limited to electroporation of plant protoplasts, liposome-mediated transformation, polyethylene glycol (PEG) mediated transformation, transformation using viruses, micro-injection of plant cells, micro-projectile bombardment of plant cells, vacuum infiltration, and Agrobacterium tumefaciens (AT) mediated transformation Typical procedures for transforming and regenerating plants are described in the patent documents listed at the beginning of this section f. Selection of Transformed Plants
- transformed plants are usually selected using a dominant selectable marker incorporated into the transformation vector Typically, such a marker will confer antibiotic or herbicide resistance on the seedlings of transformed plants and selection of transformants can be accomplished by exposing the seedlings to approp ⁇ ate concentrations of the antibiotic
- Polypeptides expressed in seed using the methods described herein may be harvested from the seed at any point after expression of the protein has commenced That is, it is not necessary for the seeds to have undergone maturation prior to harvesting
- the expressed proteins may be isolated from the seeds, if desired, by conventional protein purification methods For example, the seed can be milled, then extracted with an aqueous or organic extraction medium, followed by purification of the extracted foreign protein Alternatively, depending on the nature of the expressed protein and the intended use, the seeds may be used directly without purification of the expressed protein There are differences in accumulation patterns of different polypeptides or fractions within the seed For example, GUS expression with the GPDhGN-6-9-6 transgenic line has been found to peak at about 20 days, whereas GUS expression in the GPBhGN-4-34-7-1 -2 line is higher at 10-14 days than at 20 days Thus differential expression patterns can be monitored, and peptides extracted at times of expected peak expression Where the protein has been targeted to a selected intracellular body, such as a protein storage vacuole,
- Constructs employing such sequences may be represented as P - X or P - SS - X, wherein X is the polypeptide to be expressed (which may be a nonplant or non-seed specific or non-plant storage protein), P is a seed maturation-specific promoter, SS is a signal sequence, such as a sequence that targets a linked polypeptide to an intracellular body, such as a protein body in which the protein is stored
- the promoter P may be a seed-specific (including, but not limited to, endosperm-specific or embryo-specific) promoter
- a promoter is seed specific if its expression in a seed of a plant is at least ten-fold greater than in leaves or roots of the plant when the promoter is most actively expressed during seed maturation, and is considered endosperm-specific if its expression in the endosperm is at least five-fold greater than in other tissues of a seed when the promoter is most actively expressed during seed development
- Any well-known seed-specific transcription control element or promoter can be used in addition to barley hordein promoters, including, but not limited to, promoters from any gene encoding a seed storage protein, such as well-known promoters from genes encoding a rice glutelin, oryzin, or prolamme, wheat gliadm or glutenin, maize zein or glute n, oat glutehn, sorghum kafi ⁇ n, millet
- the protein In order to increase the levels of an expressed polypeptide, it is preferable for the protein to accumulate in a subcellular location in which the polypeptide is protected from proteolysis (that is, proteolytic degradation of the polypeptide is reduced by at least 10%, more typically by 25%, and most typically by at least 50%)
- the polypeptide as a fusion polypeptide comprising, in the same reading frame, the coding sequence for the polypeptide and the coding sequence for a peptide (referred to interchangeably as a signal leader, transport, or targeting sequence or peptide) that causes the fusion protein to be co-translationally or post-translationally directed to a subcellular compartment or to be secreted from the cell
- the signal peptide causes the fusion protein to be directed to a protected subcellular compartment such as the vacuole
- a signal peptide that causes a protein to accumulate in a vacuole may be referred to as a vacuolar targeting peptide
- the signal peptide is
- hordein gliadin, glutenin, zem, albumin, globulin, ADP glucosepyrophosphorylase, starch synthase branching enzyme, Em, and lea
- Another exemplary class of signal sequences are sequences effective to promote secretion of polypeptides from aleurone cells during seed germination, including the signal sequences associated with ⁇ -amylase, protease, carboxypeptidase, ⁇ ndoprotease, ribonuclease, Dnase/Rnase, (l-3)- ⁇ -glucanase, (l-3)(l-4) ⁇ - glucanase, esterase, acid phosphatase, pentosamine, endoxylanase, ⁇ -xylopyranosidase, arabinofuranosidase, ⁇ -glucosidase, (1-6) ⁇ -glucanase, peroxidase and lysophospholipase.
- the signal peptide may be cleaved by cellular enzymes co-translationally or post- translationally. Alternatively, if the signal peptide is not cleaved, the fusion polypeptide may be cleaved after purification of the fusion polypeptide, if desired. For this purpose, an amino-acid sequence may be introduced between the signal peptide and the heterologous protein to facilitate enzymatic or chemical cleavage to remove the signal peptide.
- the polymerase chain reaction was employed to produce constructs for introduction into plants.
- the methods used were variations of those described by Higuchi et al. (1 90), Horton et al. ( 1990), Pont-Kingdon et al. ( 1994) and Lefebvre et al. ( 1995).
- the methods were employed to produce a Ph - hSS - X construct in which Ph was the barley endosperm-specific Bl -hordein promoter, hSS was the barley Bl -hordein signal sequence and X was the Escherichia coli ⁇ - glucuronidase (uidA ; gus) ORF.
- the construct further included the nopaline synthase (nos) 3' terminator.
- Two PCR construction methods were used: a four primer method illustrated in Fig. 1 A, and a three primer method illustrated in Fig. IB.
- PCR reactions were performed on a thermocycler (MJ Research Inc.) using recombinant Pfu DNA polymerase (Stratagene) in a 100- ⁇ l reaction volume.
- the reaction buffer contained 20 mM
- Tris-HCl pH 8.2
- PCR conditions were 25 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 2 min, with a final extension step at 72°C for 7 min.
- the recombinant PCR strategies are shown in Figure 1. The two overlapping primers were
- BC primer 5'-GCGGCAACAAGTAC ATTGCATTACGTCCTGTAGAAACCCCA-3'
- cb primer 5'-TGGGGTTTCTACAGGACGTAATGCAAT CGTACTTGTTGCCGC-3'
- the sequence of the cb primer is the reverse complement of the BC primer.
- the two external primers were 5' GTAAAGCTTTAACAACCCACACA TTG-3' (A primer) (Seq I D No 7) and 5'-CGGAATTCGATCTAGTA ACATAGAT GACA-3' (d primer) (Seq I D No 8), each with a unique restriction enzyme site (underlined), Hind III and EcoR I, respectively
- Bhorss (Bl -hordein promoter containing the signal peptide sequence) and uidAnos (uidA coding sequence plus nos 3' terminator) fragments were obtained using the following PCR conditions
- the two major PCR products in the first reaction were 0 49 kb for Bhorss and 2 07 kb for uidAnos
- An aliquot of the first two sets of PCR reactions was diluted 50 times without gel purification and 5 ⁇ l of diluted products were directly used as templates for the second PCR reaction
- Forty pmol of external primers (A and d primers) and 2 5 units of Pfu DNA polymerase were added to 100 ⁇ l of 1 X PCR buffer
- a shorter fragment of 0 49 kb Bhorss was produced by PCR in the first reaction and this first PCR product (termed megapnmer) was diluted 50 times
- the second PCR reaction five ⁇ l of the diluted Bhorss megapnmer (Bhorss), twenty ng of template (pDMC201 4) and 40 pmol of external primers (A and d) were mixed to a final volume of 100 ⁇ l in IX PCR buffer
- the second set of PCR reactions using both the modified three- and four-primer strategies produced a 2 56 kb fragment containing the Bhorss and uidAnos DNA fragments (Fig IC)
- a smaller amount of the chimeric product was produced using the 3-p ⁇ mer strategy relative to the 4-p ⁇ mer strategy
- a third PCR reaction was carried out to obtain sufficient amounts of the chimeric product for microprojectile bombardment
- the PCR product from the 3-p ⁇ mer strategy was diluted 50-fold, 5 ⁇ l of this diluted product were added as template to 40 pmol of A/d primers in 100 ⁇ l of IX PCR buffer
- the final chimeric products, amplified in a final volume of 2 X 100 ⁇ l (2 reactions) from both 3-p ⁇ mer and 4-p ⁇ ner strategies were purified from a 0 7% agarose gel using QIAquick gel extraction kit (Qiagen Inc )
- the purified DNA fragments were eluted in 50 ⁇ l IX TE buffer,
- Example 2 Transient Assays in Barley Cells P ⁇ or to microprojectile bombardment, spikes of barley (spring cultivar Golden Promise) containing immature embryos (15-25 days post-pollination) were sterilized in 20% (v/v) bleach (5 25% sodium hypochlo ⁇ te) for 10-15 mm rinsed briefly 3 X 5 minutes with sterile water Endosperm was aseptically separated from each embryo manually and placed "groove-side down" on MS (Murashige and Skoog) basal medium (8) supplemented with 30 mg/1 maltose, 1.0 mg/1 thiamine- HC1, 0.25 mg/1 myo-inositol, 1.0 g/1 casein hydrolysate, 0.69 mg/1 proline, and solidified with 3.5 g/1 Phytagel " (Sigma).
- DNA bombardment was performed using 1 ⁇ m gold particles (Analytical Scientific, Inc.) coated with 12.5 ⁇ l of the eiuted DNA fragments (approximately 1-2 ⁇ g) using the following modifications of a published procedure (Le aux et al., 1996). Gold particles and other components necessary for precipitation were reduced to half-volume.
- the DNA/microprojectile precipitate was resuspended in 36 ⁇ l of absolute ethanol; 15 ⁇ l of the suspension was used per bombardment in a Biolistic PDS-1000/He device (Bio-Rad) at 1 100 psi.
- the bombarded endosperm tissue was incubated at 24 + 1°C in the dark for 1 day and stained for GUS activity (Jefferson et al.,
- Plasmid pl6 (Sorensen et al. 1996) contains a pUC18 backbone with the ⁇ -glucuronidase gene (uidA; gus) controlled by 550 bp of the barley endosperm-specific Bj-hordein promoter and terminated by
- Plasmid pDl l-Hor3 (Sorensen et al. 1996) contains uidA controlled by 434 bp of the D-hordein promoter and a nos terminator.
- pAHC20 (Christensen and Quail 1996) contains bar driven by the maize ubiquitin promoter, first intron and terminated by the nos 3'-end. Both of these construct include hordein promoters but do not include a hordein signal sequence. Thus, they are constructs of the type: Ph - X.
- pAHC25 (Christensen and Quail 1996) consists of uidA and bar, each under the control of the maize ubiquitin (Ubil) promoter and first intron and terminated by nos.
- Donor barley plants for immature embryos were grown in soil under controlled conditions in growth chambers as described (Wan and Lemaux, 1994; Lemaux et al.. 1996). Immature zygotic embryos were surface-sterilized, placed scutellum-side down on DBC2 medium, and incubated at 24 + 1°C. Regenerative tissues were maintained for 3-4 weeks, then cut into small pieces (about 3 to 5 mm), transferred to fresh DBC2 medium, and grown under dim light conditions. After an additional three weeks, green callusing sectors were broken into pieces (about 3 to 5 mm) and transferred to fresh DBC2 medium. Green regenerative tissues were maintained on DBC2 medium with subculturing at 3- to 4-week intervals.
- green regenerative tissues (about 3 to 5 mm, four-months old) were placed in the dark at 24 + 1 °C for one day. then transferred to DBC2 medium containing 0.2 M mannitol and 0.2 M sorbitol. Four hours after treatment with the osmoticum, green tissues were bombarded as described by Lemaux et al. (1996) with gold particles (Analytical Scientific Instruments, Alameda,
- each piece of green tissue was broken into 1 to 2 pieces (about 4 mm to 5 mm, depending on size of original tissue piece) and transferred to DBC2 medium supplemented with 5 mg/L bialaphos for bar selection.
- Green tissues were selected on DBC2 medium and 4 mm to 5 mm tissues subcultured at 3- to 4-week intervals.
- Bialaphos- resistant calli were regenerated on FHG (Hunter 1988) medium containing 1 mg/L 6-benzylaminopurine (BAP) and 3 mg/L bialaphos.
- Regenerated shoots were transferred to Magenta boxes containing rooting medium (callus-induction medium without phytohormones) containing 3 mg/L bialaphos. When shoots reached the top of the box, plantlets were transferred to soil and grown to maturity in the greenhouse.
- the DBC2 medium used for transformation is based on MS medium (Murashige and Skoog, 1962) supplemented with 30 g/L maltose, 1.0 mg/L thiamine-HCI, 0.25 g/L /wyo-inositol, 1.0 g/L casein hydrolysate, 0.69 g/L proline, and solidified with 3.5 g/L Phytagel (Sigma, St. Louis, MO).
- the medium was further supplemented with 2.5 mg/L of the plant auxin 2,4-dichlorophenoxyacetic acid (2,4-D), 0.1 mg/L of the plant cytokinin 6-benzylamino purine (BAP) and 5 ⁇ M copper (as copper sulfate).
- the composition of the DBC2 medium can be varied depending on the particular genotype that is to be transformed.
- the key ingredients of the medium will be within the following ranges: an auxin at a concentration of about 0.1 mg/L to about 5 mg/L, a cytokinin at a concentration of 0 mg/L to about 5 mg/L and copper at a concentration of about 0.1 ⁇ M to about 50 ⁇ M (and more typically about 1 to 10 ⁇ M).
- More efficient transformation may be obtained when maltose is employed as a carbon source in the medium at a concentration of up to about 60 g/L, more typically about 30 g/L (either in place of or in combination with sucrose). Histochemical staining for GUS was performed (Jefferson et al. 1987) using 5-bromo-4-chloro-3- indoxyl- ⁇ -D-glucuronic acid (X-gluc) (Gold Biotechnology, Inc., St. Louis, MO). Samples were incubated overnight at 37°C in GUS assay buffer.
- Quantitative GUS activity measurements were performed by the method of Jefferson et al. (1987) using 4-mefhylumbelliferyl- ⁇ -D-glucuronide (MUG) substrate (Sigma, St. Louis, MO). From homozygous lines a single immature endosperm was isolated at 10-14, 20 and 30 days after pollination or from mature endosperm, frozen in liquid nitrogen, and ground in GUS extraction buffer; each treatment had 4 replicates.
- MMG 4-mefhylumbelliferyl- ⁇ -D-glucuronide
- PCR product with loading dye Twenty-five ⁇ l of the PCR product with loading dye was electrophoresed on a 0.8% agarose gel with ethidium bromide and photographed using UV light. Presence of a 1.8-kb fragment with UIDA primers was consistent with an intact uidA fragment; an internal 0.34-kb fragment was produced with BAR primers.
- 10 ⁇ g of total genomic DNA from leaf tissue of each line was digested with £coRI and BamHl, separated on a 1.0% agarose gel, transferred to Zeta-Probe GT membrane (Bio-Rad, Hercules, CA) and hybridized with a radiolabeled w/_i4-specific probe following the manufacturer's instructions.
- the uidA- containing 1.8 kb Xba ⁇ -fragment from pBI221 was purified using a QIAEX gel extraction kit (QIAGEN, Chatsworth, CA) and labeled with ⁇ J ⁇ P-dCTP using random primers Results
- Nontransgenic control 80 + 31 81 + 23 36 + 13 43 + 9 GUS activity was determined by the fluorometric assays of protein extracts from developing and mature endosperm of homozygous lines. Values for GUS activity represent mean + standard deviation of four replicates for each treatment
- GPBhGN-4-34-7-1-2 and GPDhGN-6-9-6 are homozygous lines transformed with Bi-hordein-M/c/ (pi 6) and O-hordein-uidA ( ⁇ Dl l-Her3) constructs, respectively, producing T5 and T3 seeds, respectively
- Plasmids Two DNA constructs containing the Bj -hordein promoter and gus coding region with or without the signal peptide sequence were made to test the functionality of the Bi -hordein promoter-g.... fusions and to study its targeting:
- pdBhssGN5-6 (with signal sequence, Fig. 2A): the chimeric DNA construct containing the Bj -hordein promoter-signal sequence-wz ' _/a>_-..o._, produced using the PCR methods described in Example 1 , was digested with Hind ⁇ ll and SnaBl, and the Hindlll/SnaBl fragment was ligated into /z ' z.£ IH/S « ⁇ 3BI-digested pDMC201.4 (McElroy et al., 1995) to generate the pdBhssGN5-6 plasmid.
- the pDMC201.4 plasmid contains promoterless uidA and nos; the uidA gene was derived from the pGUSN358->S plasmid modified by site-directed mutagenesis for vacuolar targeting studies (Farrell and Beachy, 1990).
- the PCR-amplified fragment (Bj -hordein promoter with its signal peptide sequence plus the junction region with the 5' uidA) of the chimeric product was confirmed by DNA sequencing.
- pdBhGNl-2 without signal sequence, Fig. 2B): primers Bhor3 (5'- cgcatgcGTGCAGGTGTATGAGTCATT-3') (Seq. I.D. No.
- pBhGN- 1 was made by replacing CaMV35S promoter in p35SGN-3 (containing CaMV35S promoter-uidA-nos) with the Sphl/Xbal Bj -hordein fragment from pBhor-1.
- the / z ' «dIII/5«_7BI fragment from pBhGN-1 was replaced with the Hindlll/SnaBl fragment in pDMC201.4 to generate pdBhGNl-2.
- the 120- bp 5' Bj-hordein flanking region was deleted in both pdBhssGN5-6 and pdBhGNl-2.
- the resulting two chimeric DNA constructs were introduced using microprojectile bombardment into immature barley endosperm tissues for stable gene expression assays. Stable transformation methods, GUS staining and quantitation, and Basta sensitivity were determined as described in Example 3.
- Genomic DNA isolation, polymerase chain reaction (PCR) and DNA blot hybridization Total genomic DNA from independent calli or leaf tissues was purified as described (Dellaporta,
- genomic DNA was amplified by PCR using the primer set, UIDA 1 and UID2R.
- the primer set, Bhor8 (5'-GAAGAGATGAAGCCTGGCTAC-3') (Seq. I.D. No. 15) and GUS5516 (5'- CGATCCAGACTGAATGCC CACAGG-3') (Seq. I.D. No. 16) was used to distinguish between the Bj -hordein promoter with and without the signal sequence.
- a 229-bp hybrid product is expected from the construct containing the Bi -hordein promoter with the signal sequence while a 178-bp PCR product is expected from the construct containing the Bj -hordein promoter without the signal sequence.
- the presence of bar was tested using the primer set, BAR5F and BAR1R (Lemaux et al. 1996). Amplifications were performed with Taq DNA polymerase (Promega, Madison, WI) in a 25- ⁇ l reaction. Twenty-five ⁇ l of the PCR product with loading dye was electrophoresed on a 0.8% agarose gel with ethidium bromide and photographed using UV light.
- Presence of a 1.8-kb fragment with UIDA primers was consistent with an intact uidA fragment; an internal 0.34-kb fragment was produced with BAR primers.
- 10 ⁇ g of total genomic DNA from leaf tissue of each line was digested with Hindll and Sad, separated on a 1.0% agarose gel, transferred to Zeta-Probe GT membrane (Bio-Rad, Hercules, CA) and hybridized with a radiolabeled M._/ -specific probe following manufacturer's instructions.
- the wz ' _ -4-containing 1.8 kb Xbal-fmgmerA from pBI221 was purified using a QIAEX gel extraction kit
- T ⁇ seeds were tested for histochemical GUS activity. Strong GUS expression was seen in endosperm tissues transformed with both B ] -hordein promoters with and without the signal sequence, but not in the embryo. GUS expression from the two B ⁇ -hordein-z.z ' _/a4 constructs was very evident in developing endosperm, especially in peripheral cells of endosperm tissue and endosperm tissue near the scutellar side. The B] -hordein promoter with the signal sequence had even stronger expression in endosperm than did that without the signal sequence. No GUS expression was observed in the nontransformed control tissues.
- Relative activities of the Bi-hordein-Mzc/ . constructs were determined by fluorometric analysis of GUS in extracts of developing and mature seeds of homozygous lines.
- the specific activities of GUS driven by the Bj -hordein promoter with the signal sequence were higher in both developing and mature seeds than without the signal sequence (Figs. 6 and 7).
- developing endosperm tissues transformed with the Bi -hordein promoter with the signal sequence had more than 30 times GUS activity, compared with the Bj -hordein promoter without the signal sequence.
- GUS Leaf tissue from To plants of all six independent lines exhibited Basta resistance (Table 1). In Ti progeny all six lines tested for uidA showed a 3: 1 segregation pattern for expression of GUS. The bar gene was also stably transmitted to Tj progeny of five lines except GPdBhssGN-10; the GPdBhssGN-10 line did not expressed PAT. Homozygous transgenic lines stably expressing uidA were obtained from 4 events GPdBhGN- 1 , GPdBhssGN-7, - 10, and -23. Electron Microscopy and immunogold labeling
- the immunosignal seen at the electron microscopic level was specific for protein bodies in GUS-expressing immature endosperm of line that was transformed with the Bl-hordein-wz ' _i4 DNA construct containing the 19 amino acid N-terminal signal peptide sequence (Fig. 7). Discussion
- PCR analysis confirmed the presence of uidA and bar in genomic DNA from To plants of 6 different lines stably transformed with Bj -hordein promoters with and without the signal sequence.
- Stably transformed, developing and mature barley seeds were characterized in terms of tissue-specificity and timing of hordein promoter-driven GUS expression.
- GUS driven by both Bi- hordein promoters with and without the signal sequence was expressed exclusively in endosperm tissue, not in other tissues.
- the existence of the signal sequence with the Bj-hordein promoter dramatically enhanced GUS expression in developing transgenic endosperm. This is consistent with the results of Fiedler and Conrad (1995) that an antigen-binding single chain Fv
- scFv protein was only detectable in seeds of tobacco plants transformed with constructs containing a signal peptide sequence. After storage of mature transgenic tobacco seeds for one year at room temperature, there was no loss of scFv protein or its antigen-binding activity whereas in plants transformed with a construct without a signal peptide no detectable accumulation of scFv in ripe or developing seeds occurred. They speculated that the lack of GUS protein expression in cytosol is a result of translational or post-translational regulation by cytosolic proteases, which degrade the scFv protein if it does not enter the secretory pathway.
- Transgenic plants with a single site of transgene integration would be expected to give a segregation ratio for the transgene (and its expression) of 3:1. All six lines gave such a ratio for
- GUS expression Homozygous, stably expressing GUS transgenic lines were obtained from 4 lines. Expression of the maize ubiquitin promoter-driven PAT was also stably inherited in Tj progeny of five transgenic lines; however, one line (GPdBhssGN-10) did not show PAT expression In T2 progeny.
- results presented here show that the D- or Bj -hordein promoter can be used to develop a system for limiting foreign gene expression exclusively to the endosperm of barley seed.
- results show that the use of plants transformed with a seed-specific promoter with the signal sequence dramatically enhanced the transgene expression. This permits the creation of new crop varieties for neutraceutical and pharmaceutical purposes using vacuolar targeting strategies.
- This example uses the maize Gib I promoter, with or without deletion of a 5' flanking sequence, fused to the bacterial reporter gene, ⁇ -glucuronidase gene (uidA; gus), to demonstrate the functionality of the maize Glbl promoter in transgenic barely, for embryo specific expression.
- Plasmids ppGlblGUS (Liu and Kriz, 1996), a plasmid containing uidA reporter gene under the control of the maize embryo-specific globulin (Glbl) promoter and terminated by nos , was obtained from DEKALB Plant Genetics, Mystic, CT.
- the ppGlblGUS was digested with EcoRl to remove a 1.04- kb 5' globulin flanking region.
- the 2.58-kb EcoRl fragment containing the 0.36-kb globulin promoter, uidA coding sequence and nos 3' terminator was ligated into v ⁇ c ⁇ I-digested pUC19 to generate pdGlbGUS-6.
- the 1.04-kb 5' globulin flanking region was deleted in pdGlbGUS-6.
- the above two chimeric DNA constructs were introduced using microprojectile bombardment into immature barley endosperm tissues for both transient and stable gene expression assays.
- osmoticum treatment Cho et al., 1998b.
- the tissues were bombarded using a Biolistic PDS-1000 He gun (Bio-Rad, Hercules, CA) at 1100 psi with 1.0 ⁇ m gold particles coated with either ppGlblGUS or pdGlbGUS-6 according to the protocol of Lemaux et al. (1996).
- Osmotic treatment includes 0.2 M mannitol and 0.2 M sorbitol to give a final concentration of 0.4 M with 4-h pre-treatment and 1- or 2-d post-treatment. Stable barley transformations
- Stable transgenic GP lines were obtained via microparticle bombardment essentially as described in Wan and Lemaux 1994; Lemaux et al. 1996; and Cho et al., 1998a.
- Gold particles (1.0 ⁇ m) were coated with 25 ⁇ g of 1 : 1 molar ratio of pAHC20 and ppGlb 1 GUS or pdGlbGUS-6, and used in bombardment experiments as described above.
- Plasmid pAHC20 (Christensen and Quail, 1996) contains the herbicide resistance gene, bar, from Streptomyces hygroscopicus under the control of the maize ubiquitin Ubil promoter and first intron and nos 3' terminator.
- Bialaphos- resistant calli were regenerated on FHG (Hunter 1988) medium containing 1 mg/L 6- benzylaminopurine (BAP) and 3 mg/L bialaphos. Regenerated shoots were transferred to Magenta boxes containing rooting medium (callus-induction medium without phytohormones) containing 3 mg/L bialaphos. When shoots reached the top of the box, plantlets were transferred to soil and grown to maturity in the greenhouse.
- a section of leaf blade at the 4- to 5-leaf stage was painted using a cotton swab with a 0.25% solution (v/v) of BastaTM solution (starting concentration, 200 g/L phophinothricin, Hoechst AG, Frankfurt, Germany) plus 0.1% Tween 20. Plants were scored 1 week after herbicide application.
- genomic DNA from independent calli or leaf tissues was purified as described (Dellaporta, 1993).
- 250 ng of genomic DNA was amplified by PCR using the primer set, UIDA1 (5'- agcggccgcaTTACGTCCTGTAGAAACC-3') and UID2R (5'-agagctcTCATTGTTTGCCTCCC TG-
- PCR product with loading dye was electrophoresed on a 0.8% agarose gel with ethidium bromide and photographed using UV light. Presence of a 1.8-kb fragment with UIDA primers was consistent with an intact uidA fragment; an internal 0.34-kb fragment was produced with BAR primers.
- plasmids ppGlblGUS and pdGlbGUS-6 were used in transient assays involving microprojectile bombardment into immature barley endosperm and embryos, respectively. Two controls were included, one negative control bombarded with lxTE buffer and one positive control bombarded with pAHC25 containing uidA under control of the constitutive maize ubiquitin promoter. GUS driven by the maize embryo-specific globulin promoters was weakly expressed in embryo tissue, but not in endosperm tissue at all.
- GUS Expression driven by the two globulin promoter uidA fusions was stronger in barley immature embryos with osmotic treatment than without osmotic treatment.
- the degree of uidA gene expression in embryos driven by the undeleted globulin promoter appeared slightly weaker than that driven by the deleted globulin promoter (0.36-kb, pdGlbGUS-6).
- ABA treatment enhanced GUS expression in immature embryos without osmotic treament, but not with osmotic treatment. The negative control did not exhibit any GUS expression.
- Glbl promoters but not in the endosperm tisssue.
- GUS expression under control of the maize ubiquitin (Ubil) promoter was observed in all tissues; no GUS expression was detected in the negative control.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Pregnancy & Childbirth (AREA)
- Reproductive Health (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Pretreatment Of Seeds And Plants (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP98949710.2A EP1019517B2 (en) | 1997-09-30 | 1998-09-30 | Production of proteins in plant seeds |
ES98949710.2T ES2276475T5 (en) | 1997-09-30 | 1998-09-30 | Protein production in plant seeds |
CA002305628A CA2305628C (en) | 1997-09-30 | 1998-09-30 | Production of proteins in plant seeds |
AU95980/98A AU746032B2 (en) | 1997-09-30 | 1998-09-30 | Production of proteins in plant seeds |
DE69836552.6T DE69836552T3 (en) | 1997-09-30 | 1998-09-30 | PREPARATION OF PROTEINS IN PLANT SEEDS |
JP2000513959A JP2001518305A (en) | 1997-09-30 | 1998-09-30 | Protein production in plant seeds |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US6051097P | 1997-09-30 | 1997-09-30 | |
US60/060,510 | 1997-09-30 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1999016890A2 true WO1999016890A2 (en) | 1999-04-08 |
WO1999016890A3 WO1999016890A3 (en) | 1999-05-20 |
Family
ID=22029950
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1998/020691 WO1999016890A2 (en) | 1997-09-30 | 1998-09-30 | Production of proteins in plant seeds |
Country Status (9)
Country | Link |
---|---|
US (2) | US6642437B1 (en) |
EP (1) | EP1019517B2 (en) |
JP (2) | JP2001518305A (en) |
AT (1) | ATE346944T1 (en) |
AU (1) | AU746032B2 (en) |
CA (1) | CA2305628C (en) |
DE (1) | DE69836552T3 (en) |
ES (1) | ES2276475T5 (en) |
WO (1) | WO1999016890A2 (en) |
Cited By (178)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001021783A2 (en) * | 1999-09-24 | 2001-03-29 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoter from maize |
WO2001023593A1 (en) * | 1999-09-30 | 2001-04-05 | Meristem Therapeutics | Synthetic and chimeric promoters, expression cassettes, plasmids, vectors, transgenic plants and seeds containing them, and method for producing them |
WO2001059141A2 (en) * | 2000-02-10 | 2001-08-16 | Washington State University Research Foundation | Methods and compositions that utilize barley as a foodstuff for animals |
WO2001061023A1 (en) * | 2000-02-16 | 2001-08-23 | Plant Research International B.V. | Reduction of in planta degradation of recombinant plant products |
EP1167532A2 (en) * | 2000-06-30 | 2002-01-02 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Edible transgenic plants expressing mammalian proteins |
WO2002074977A2 (en) | 2001-03-16 | 2002-09-26 | Basf Plant Science Gmbh | Sugar and lipid metabolism regulators in plants |
WO2002099076A2 (en) | 2001-06-04 | 2002-12-12 | Basf Plant Science Gmbh | Sugar and lipid metabolism regulators in plants ii |
WO2003014356A1 (en) | 2001-08-09 | 2003-02-20 | University Of Saskatchewan | Wheat plants having increased resistance to imidazolinone herbicides |
WO2003013225A2 (en) | 2001-08-09 | 2003-02-20 | Northwest Plant Breeding Company | Wheat plants having increased resistance to imidazolinone herbicides |
WO2003014357A1 (en) | 2001-08-09 | 2003-02-20 | University Of Saskatchewan | Wheat plants having increased resistance to imidazolinone herbicides |
WO2003020914A2 (en) | 2001-09-05 | 2003-03-13 | Basf Plant Science Gmbh | Protein phosphatase stress-related polypeptides and methods of use in plants |
WO2003040344A2 (en) | 2001-11-09 | 2003-05-15 | Basf Plant Science Gmbh | Transcription factor stress-related polypeptides and methods of use in plants |
WO2003049538A2 (en) * | 2001-12-06 | 2003-06-19 | Prodigene, Inc. | Methods for the cost-effective saccharification of lignocellulosic biomass |
WO2003073839A2 (en) * | 2002-03-01 | 2003-09-12 | Plantechno S.R.L | Expression of lysosomal enzymes in plant seeds |
WO2003078629A1 (en) | 2002-03-20 | 2003-09-25 | Basf Plant Science Gmbh | Constructs and methods for the regulation of gene expression |
WO2003095655A2 (en) | 2002-05-08 | 2003-11-20 | Basf Plant Science Gmbh | Methods for increasing oil content in plants |
WO2004018687A2 (en) | 2002-08-07 | 2004-03-04 | Basf Plant Science Gmbh | Nucleic acid sequences encoding proteins associated with abiotic stress response |
WO2004053134A1 (en) | 2002-12-12 | 2004-06-24 | Bayer Cropscience S.A. | Expression cassette encoding a 5-enolpyruvylshikimate-3-phosphate synthase (epsps) and herbicide-tolerant plants containing it |
WO2004076617A2 (en) | 2003-02-27 | 2004-09-10 | Basf Plant Science Gmbh | Method for the production of polyunsaturated fatty acids |
WO2004092398A2 (en) | 2003-04-15 | 2004-10-28 | Basf Plant Science Gmbh | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
WO2004111244A2 (en) * | 2003-06-17 | 2004-12-23 | Sembiosys Genetics Inc. | Methods for the production of insulin in plants |
WO2005020673A1 (en) | 2003-08-29 | 2005-03-10 | Instituto Nacional De Technologia Agropecuaria | Rice plants having increased tolerance to imidazolinone herbicides |
WO2005083053A2 (en) | 2004-02-27 | 2005-09-09 | Basf Plant Science Gmbh | Method for producing unsaturated omega-3 fatty acids in transgenic organisms |
WO2005103253A1 (en) | 2004-04-22 | 2005-11-03 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
WO2006013010A2 (en) | 2004-07-31 | 2006-02-09 | Metanomics Gmbh | Preparation of organisms with faster growth and/or higher yield |
WO2006032707A2 (en) | 2004-09-24 | 2006-03-30 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance to environmental stress |
US7053282B1 (en) | 1998-02-09 | 2006-05-30 | Pioneer Hi-Bred International, Inc. | Alteration of amino acid compositions in seeds |
WO2006069610A2 (en) | 2004-07-02 | 2006-07-06 | Metanomics Gmbh | Process for the production of fine chemicals |
WO2006100241A2 (en) | 2005-03-22 | 2006-09-28 | Basf Plant Science Gmbh | Method for producing polyunsaturated c20 and c22 fatty acids with at least four double bonds in transgenic plants |
WO2006111512A1 (en) | 2005-04-19 | 2006-10-26 | Basf Plant Science Gmbh | Improved methods controlling gene expression |
EP1669444A4 (en) * | 2003-08-13 | 2006-11-29 | Japan Tobacco Inc | Method of elevating transformation efficiency in plant by adding copper ion |
WO2006134162A2 (en) | 2005-06-17 | 2006-12-21 | Basf Plant Science Gmbh | Lecitin-like protein kinase stress-related polypeptides and methods of use in plants |
WO2007011625A2 (en) | 2005-07-18 | 2007-01-25 | Basf Plant Science Gmbh | Yield increase in plants overexpressing the accdp genes |
WO2007011736A2 (en) | 2005-07-18 | 2007-01-25 | Basf Plant Science Gmbh | Yield increase in plants overexpressing the shsrp genes |
US7183458B1 (en) | 1999-06-07 | 2007-02-27 | Basf Plant Science Gmbh | Δ6 acetylenase and Δ6-desaturase from ceratodon purpureus |
WO2007042510A2 (en) | 2005-10-13 | 2007-04-19 | Basf Plant Science Gmbh | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
WO2007051577A2 (en) | 2005-11-02 | 2007-05-10 | Basf Plant Science Gmbh | METHOD FOR THE PRODUCTION OF γ-LINOLENIC ACID AND/OR STEARIDONIC ACID IN TRANSGENIC BRASSICACEAE AND LINACEAE |
WO2007054441A2 (en) | 2005-11-08 | 2007-05-18 | Basf Plant Science Gmbh | Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants |
WO2007087815A2 (en) | 2004-12-17 | 2007-08-09 | Metanomics Gmbh | Process for the control of production of fine chemicals |
US7262054B2 (en) | 2002-01-22 | 2007-08-28 | Sangamo Biosciences, Inc. | Zinc finger proteins for DNA binding and gene regulation in plants |
US7273923B2 (en) | 2001-01-22 | 2007-09-25 | Sangamo Biosciences, Inc. | Zinc finger proteins for DNA binding and gene regulation in plants |
US7304208B2 (en) * | 2000-05-02 | 2007-12-04 | Ventria Bioscience | Expression of human serum albumin (HSA) in monocot seeds |
WO2007137973A2 (en) | 2006-05-31 | 2007-12-06 | Metanomics Gmbh | Manipulation of the nitrogen metabolism using ammonium transporter or glucose 6-phosphate deshydrogenases or farnesyl phosphate synthetase (fpp) |
WO2007141189A2 (en) | 2006-06-08 | 2007-12-13 | Basf Plant Science Gmbh | Plants having improved growth characteristics and method for making the same |
WO2008025711A2 (en) | 2006-08-30 | 2008-03-06 | Basf Plant Science Gmbh | Method for increasing resistance to pathogens in transgenic plants |
US7393998B2 (en) * | 2002-03-08 | 2008-07-01 | Prodigene, Inc. | Commercial production of insulin and insulin-like proteins in plants |
WO2008095886A1 (en) | 2007-02-06 | 2008-08-14 | Basf Plant Science Gmbh | Compositions and methods using rna interference for control of nematodes |
WO2008095970A1 (en) | 2007-02-09 | 2008-08-14 | Basf Plant Science Gmbh | Compositions and methods using rna interference of cdpk-like for control of nematodes |
WO2008095889A1 (en) | 2007-02-06 | 2008-08-14 | Basf Plant Science Gmbh | Use of alanine racemase genes to confer nematode resistance to plants |
US7417178B2 (en) * | 2000-05-02 | 2008-08-26 | Ventria Bioscience | Expression of human milk proteins in transgenic plants |
WO2008110522A1 (en) | 2007-03-15 | 2008-09-18 | Basf Plant Science Gmbh | Use of nematode chitinase genes to control plant parasitic nematodes |
WO2008116829A1 (en) | 2007-03-23 | 2008-10-02 | Basf Plant Science Gmbh | Transgenic plant with increased stress tolerance and yield |
US7456335B2 (en) | 2001-09-03 | 2008-11-25 | Basf Plant Science Gmbh | Nucleic acid sequences and their use in methods for achieving pathogen resistance in plants |
WO2008142034A2 (en) | 2007-05-22 | 2008-11-27 | Basf Plant Science Gmbh | Plants with increased tolerance and/or resistance to environmental stress and increased biomass production |
EP2036984A2 (en) | 2002-07-26 | 2009-03-18 | BASF Plant Science GmbH | Reversion of the negative selective effect of negative marker proteins as selection procedure |
EP2045327A2 (en) | 2005-03-08 | 2009-04-08 | BASF Plant Science GmbH | Expression enhancing intron sequences |
EP2053057A2 (en) | 2004-09-24 | 2009-04-29 | BASF Plant Science GmbH | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmantal stress |
US7544859B2 (en) | 2000-02-09 | 2009-06-09 | Basf Aktiengesellschaft | Elongase gene and method for producing multiple-unsaturated fatty acids |
WO2009077545A2 (en) | 2007-12-17 | 2009-06-25 | Basf Plant Science Gmbh | Lipid metabolism protein and uses thereof i (bzip transcription factor) |
WO2009077478A2 (en) * | 2007-12-14 | 2009-06-25 | Basf Plant Science Gmbh | Promoters from brassica napus for seed specific gene expression |
EP2080432A1 (en) | 2001-08-10 | 2009-07-22 | BASF Plant Science GmbH | Sugar and lipid metabolism regulators in plants III |
EP2090662A2 (en) | 2006-04-05 | 2009-08-19 | Metanomics GmbH | Process for the production of a fine chemical |
US7595384B2 (en) * | 2003-10-31 | 2009-09-29 | National Institute Of Agrobiological Sciences | Seed-specific gene promoter from the rice 10 KDa prolaminin gene and uses thereof |
US7601889B2 (en) | 2001-03-26 | 2009-10-13 | Napier Johnathan A | Elongase gene and production of Δ9-polyunsaturated fatty acids |
WO2009129583A1 (en) | 2008-04-25 | 2009-10-29 | Commonwealth Scientific Industrial Research Organisation | Recombinant cells and methods for hydroxylating fatty acids |
EP2145960A1 (en) | 2005-08-12 | 2010-01-20 | BASF Plant Science GmbH | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with in-creased tolerance to environmental stress |
EP2154252A1 (en) * | 2008-07-16 | 2010-02-17 | Sumitomo Chemical Company, Limited | Methods for producing secreted proteins |
US20100047864A1 (en) * | 2006-10-04 | 2010-02-25 | Plant Advance Technologies PAT SAS | Process for the production of recombinant proteins using carnivorous plants |
EP2159289A2 (en) | 2005-06-23 | 2010-03-03 | BASF Plant Science GmbH | Improved methods for the production of stably transformed plants |
EP2166090A2 (en) | 2003-08-01 | 2010-03-24 | BASF Plant Science GmbH | Method for production of polyunsaturated fatty acids in transgene organisms |
EP2177605A1 (en) | 2006-10-06 | 2010-04-21 | BASF Plant Science GmbH | Method for producing polyunsaturated fatty acids in transgenic non-human organisms |
DE112008001277T5 (en) | 2007-05-29 | 2010-04-22 | Basf Plant Science Gmbh | Transgenic plants with increased stress tolerance and increased yield |
DE112008001453T5 (en) | 2007-05-22 | 2010-04-29 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance and / or resistance to environmental stress and increased biomass production CO |
US7723571B2 (en) * | 2006-06-08 | 2010-05-25 | Healthgen Biotechnology Inc. In Wuhan | Method of expressing small peptides using cereal non-storage proteins as fusion carrier in endosperm and the use thereof |
EP2189534A2 (en) | 2006-08-02 | 2010-05-26 | CropDesign N.V. | Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same |
WO2010057246A1 (en) | 2008-11-18 | 2010-05-27 | Commonwealth Scientific Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
EP2194140A2 (en) | 2005-03-02 | 2010-06-09 | Metanomics GmbH | Process for the production of fine chemicals |
EP2202314A1 (en) | 2007-01-15 | 2010-06-30 | BASF Plant Science GmbH | Use of subtilisin (RNR9) polynucleotides for achieving a pathogen resistance in plants |
DE112008002435T5 (en) | 2007-09-18 | 2010-07-22 | Basf Plant Science Gmbh | Plants with increased yield |
DE112008003433T5 (en) | 2007-12-21 | 2010-11-04 | Basf Plant Science Gmbh | Plants with increased yield (KO NUE) |
EP2256207A1 (en) | 2003-12-23 | 2010-12-01 | BASF Plant Science GmbH | Sugar and lipid metabolism regulators in plants VI |
WO2010142522A2 (en) | 2009-06-08 | 2010-12-16 | Basf Plant Science Company Gmbh | Novel fatty acid elongation components and uses thereof |
EP2264056A1 (en) | 2000-04-07 | 2010-12-22 | BASF Plant Science GmbH | Transcription factor stress-related proteins and methods of use in plants |
DE112008003224T5 (en) | 2007-11-27 | 2010-12-23 | Basf Plant Science Gmbh | Transgenic plants with increased stress tolerance and increased yield |
EP2272966A2 (en) | 2002-08-02 | 2011-01-12 | BASF Plant Science GmbH | Sugar and lipid metabolism regulators in plants IV |
DE112008002456T5 (en) | 2007-09-21 | 2011-01-13 | Basf Plant Science Gmbh | Plants with increased yield |
WO2011006948A1 (en) | 2009-07-17 | 2011-01-20 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases and elongases and uses thereof |
WO2011009801A1 (en) | 2009-07-23 | 2011-01-27 | Basf Plant Science Company Gmbh | Plants with increased yield |
WO2011023571A1 (en) | 2009-08-25 | 2011-03-03 | Basf Plant Science Company Gmbh | Nematode-resistant transgenic plants |
WO2011023800A1 (en) | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
DE112008003414T5 (en) | 2007-12-17 | 2011-03-31 | Basf Plant Science Gmbh | Lipid metabolism proteins, combinations of lipid metabolism proteins and applications thereof |
DE112009001385T5 (en) | 2008-06-03 | 2011-04-14 | Basf Plant Science Gmbh | Fatty acid dehydratases and applications thereof |
EP2311857A1 (en) | 2005-12-09 | 2011-04-20 | BASF Plant Science GmbH | polypeptides involved in regulation of sugar and lipid metabolism and methods of use VIII |
DE112008003318T5 (en) | 2007-12-19 | 2011-04-21 | Basf Plant Science Gmbh | Plants with increased yield and increased tolerance to environmental stress (IY-B) |
DE112009000313T5 (en) | 2008-02-27 | 2011-04-28 | Basf Plant Science Gmbh | Plants with increased yield |
EP2322633A2 (en) | 2003-02-17 | 2011-05-18 | Metanomics GmbH | Preparation of organisms with faster growth and/or higher yield |
US7947876B2 (en) * | 2004-09-14 | 2011-05-24 | Nippon Paper Industries Co., Ltd. | Plant and plant storage organ having GLP-1 derivative accumulated therein and method of producing the same |
WO2011061656A1 (en) | 2009-11-17 | 2011-05-26 | Basf Plant Science Company Gmbh | Plants with increased yield |
WO2011064183A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid elongase and uses thereof |
WO2011064181A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid desaturase and uses thereof |
EP2329708A1 (en) | 2002-07-10 | 2011-06-08 | The Department of Agriculture, Western Australia | Wheat plants having increased resistance to imidazolinone herbicides |
EP2330206A1 (en) | 2003-08-11 | 2011-06-08 | Kweek-en Researchbedrijf Agrico B.V. | A gene from Solanum bulbocastanum conferring resistance to Phytophthora infestans |
EP2333078A2 (en) | 2006-03-24 | 2011-06-15 | BASF Plant Science GmbH | Proteins associated with abiotic stress response and homologs |
WO2011069953A1 (en) | 2009-12-09 | 2011-06-16 | Basf Plant Science Company Gmbh | Methods for increasing the resistance of plants to fungi by silencing the fungal smt1-gene |
EP2339007A1 (en) | 2004-09-20 | 2011-06-29 | BASF Plant Science GmbH | Arabidopsis genes encoding proteins involved in sugar and lipid metabolism and methods of use |
WO2011082107A1 (en) * | 2009-12-31 | 2011-07-07 | Pioneer Hi-Bred International, Inc. | Direct and continuous root alone or root/shoot production from transgenic events derived from green regenerative tissues and its applications |
DE112009002061T5 (en) | 2008-08-27 | 2011-07-14 | BASF Plant Science GmbH, 67063 | Nematode resistant transgenic plants |
WO2011104153A1 (en) | 2010-02-23 | 2011-09-01 | Basf Plant Science Company Gmbh | Nematode-resistant transgenic plants |
EP2365063A1 (en) | 2003-03-31 | 2011-09-14 | University Of Bristol | New vegetable acyltransferases specifically for long-chain polyunsaturated fatty acids |
EP2366781A1 (en) | 2005-11-24 | 2011-09-21 | BASF Plant Science GmbH | Process for the production of delta5-unsaturated fatty acids in transgenic organisms |
EP2377937A1 (en) | 2006-05-30 | 2011-10-19 | CropDesign N.V. | Plants with reduced expression of a CLE-like gene having enhanced yield-related traits and a method for making the same |
EP2380984A2 (en) | 2006-02-16 | 2011-10-26 | BASF Plant Science GmbH | Nucleic acid |
EP2380986A1 (en) | 2006-01-12 | 2011-10-26 | BASF Plant Science GmbH | Use of stomatin (STM1) polynucleotides for achieving a pathogen resistance in plants |
EP2390336A2 (en) | 2007-07-13 | 2011-11-30 | BASF Plant Science GmbH | Transgenic plants with increased stress tolerance and yield |
WO2011161093A1 (en) | 2010-06-25 | 2011-12-29 | Basf Plant Science Company Gmbh | Acyltransferases and uses therof in fatty acid production |
WO2012000026A1 (en) | 2010-06-28 | 2012-01-05 | Commonwealth Scientific And Industrial Research Organisation | Methods of producing lipids |
EP2404499A2 (en) | 2004-06-16 | 2012-01-11 | BASF Plant Science GmbH | Nucleic acid molecules encoding Lipid Metabolism Protein (LMP) and methods of use in plants |
DE112009002267T5 (en) | 2008-09-23 | 2012-01-19 | Basf Plant Science Gmbh | Plants with increased yield (LT) |
DE112009001994T5 (en) | 2008-08-19 | 2012-01-19 | Basf Plant Science Gmbh | Increased yield plants by increasing or generating one or more activities in a plant or part thereof |
DE112009002048T5 (en) | 2008-08-26 | 2012-01-26 | Basf Plant Science Gmbh | Nucleic acid encoding desaturases and modified plant oil |
DE112009001585T5 (en) | 2008-07-01 | 2012-02-23 | Basf Plant Science Gmbh | Promoters of Brassica napus for seed-specific gene expression |
EP2431472A1 (en) | 2005-07-06 | 2012-03-21 | CropDesign N.V. | Plant yield improvement by STE20-like gene expression |
EP2434019A1 (en) | 2003-08-01 | 2012-03-28 | BASF Plant Science GmbH | Process for the production of fine chemicals |
EP2439280A1 (en) | 2006-03-31 | 2012-04-11 | BASF Plant Science GmbH | Plants having enhanced yield-related traits and a method for making the same |
WO2012052468A2 (en) | 2010-10-21 | 2012-04-26 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases, elongases, elongation components and uses therof |
EP2455472A2 (en) | 2006-10-13 | 2012-05-23 | BASF Plant Science GmbH | Plants with increased yield |
DE112009002342T5 (en) | 2008-10-23 | 2012-06-14 | Basf Plant Science Gmbh | Method for producing a transgenic cell with increased content of gamma-aminobutyric acid (GABA) |
DE112009002577T5 (en) | 2008-10-23 | 2012-06-21 | Basf Plant Science Gmbh | Increased Yield Plants (NUE) |
WO2012084756A1 (en) | 2010-12-20 | 2012-06-28 | Basf Plant Science Company Gmbh | Nematode-resistant transgenic plants |
EP2471930A1 (en) | 2002-12-20 | 2012-07-04 | Metanomics GmbH & Co. KGaA | Method for producing aminoacids |
EP2487245A2 (en) | 2006-10-12 | 2012-08-15 | BASF Plant Science GmbH | Method for increasing pathogen resistance in transgenic plants |
EP2487246A2 (en) | 2007-08-02 | 2012-08-15 | BASF Plant Science GmbH | Transgenic plants with increased stress tolerance and yield |
EP2492345A2 (en) | 2007-05-04 | 2012-08-29 | BASF Plant Science GmbH | Seed enhancement by combinations of pyruvate kinases |
DE112009003708T5 (en) | 2008-12-12 | 2012-09-13 | Basf Plant Science Gmbh | Desaturases and methods of producing polyunsaturated fatty acids in transgenic organisms |
EP2500420A1 (en) | 2006-08-24 | 2012-09-19 | BASF Plant Science GmbH | Pythium omega 3 desaturase with specificity to all omega 6 fatty acids longer than 18 carbon chains |
EP2508609A1 (en) | 2003-05-28 | 2012-10-10 | Basf Se | Wheat plants having increased tolerance to imidazolinone herbicides |
WO2013024121A2 (en) | 2011-08-18 | 2013-02-21 | Basf Plant Science Company Gmbh | Increase of sucrose transporter activity in the seeds of plants |
EP2573188A2 (en) | 2005-03-02 | 2013-03-27 | Metanomics GmbH | Process for the production of fine chemicals |
EP2573179A1 (en) | 2005-09-15 | 2013-03-27 | CropDesign N.V. | Plants having increased yield and method for making the same |
WO2013096991A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Research Organisation | Production of dihydrosterculic acid and derivatives thereof |
WO2013096993A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
WO2013096992A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Reserach Organisation | Simultaneous gene silencing and supressing gene silencing in the same cell |
EP2612918A1 (en) | 2012-01-06 | 2013-07-10 | BASF Plant Science Company GmbH | In planta recombination |
EP2617294A1 (en) * | 2001-02-14 | 2013-07-24 | Ventria Bioscience | Expression of human milk proteins in transgenic plants |
EP2623584A1 (en) | 2004-02-27 | 2013-08-07 | BASF Plant Science GmbH | Method for producing polyunsatured fatty acids in transgenic plants |
US8552256B2 (en) | 2008-04-11 | 2013-10-08 | National Institute Of Agrobiological Sciences | Gene capable of being expressed specifically in endosperm of plant, promoter for the gene, and use of the gene and the promoter |
US8558058B2 (en) | 2001-12-06 | 2013-10-15 | Applied Biotechnology Institute | Monocotyledonous seed expressing exo-1,4B-glucanase |
WO2013185184A2 (en) | 2012-06-15 | 2013-12-19 | Commonwealth Scientific And Industrial Research Organisation | Production of long chain polyunsaturated fatty acids in plant cells |
WO2014020533A2 (en) | 2012-08-03 | 2014-02-06 | Basf Plant Science Company Gmbh | Novel enzymes, enzyme components and uses thereof |
US8709761B2 (en) | 2009-10-22 | 2014-04-29 | Applied Biotechnology Institute, Inc. | Methods of saccharification of polysaccharides in plants |
US8709742B2 (en) | 2009-10-22 | 2014-04-29 | Applied Biotechnology Institute, Inc. | Methods of saccharification of polysaccharides in plants |
US8795744B2 (en) | 2005-11-18 | 2014-08-05 | Commonwealth Scientific And Industrial Research Organisation | Feedstuffs for aquaculture comprising stearidonic acid |
WO2014117988A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing hcp7 |
WO2014118018A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing ein2 |
WO2014117990A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing hcp6 |
WO2014135682A1 (en) | 2013-03-08 | 2014-09-12 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing mybtf |
US8835715B1 (en) | 2000-06-30 | 2014-09-16 | Basf Plant Science Gmbh | Plants expressing Δ6-desaturase genes and oils from these plants containing PUFAS and method for producing unsaturated fatty acids |
EP2821492A2 (en) | 2009-05-13 | 2015-01-07 | BASF Plant Science Company GmbH | Acyltransferases and uses thereof in fatty acid production |
WO2015092709A1 (en) | 2013-12-17 | 2015-06-25 | Basf Plant Science Company Gmbh | Methods for conversion of the substrate specificity of desaturases |
US9074224B2 (en) | 2009-08-03 | 2015-07-07 | Recombinetics, Inc. | Methods and compositions for targeted gene modification |
EP2966157A1 (en) | 2014-07-07 | 2016-01-13 | Commonwealth Scientific and Industrial Research Organisation | Processes for producing industrial products from plant lipids |
EP2980220A1 (en) | 2005-09-20 | 2016-02-03 | BASF Plant Science GmbH | Improved methods controlling gene expression |
WO2016075327A2 (en) | 2014-11-14 | 2016-05-19 | Basf Plant Science Company Gmbh | Production of pufas in plants |
WO2016128470A1 (en) | 2015-02-11 | 2016-08-18 | Basf Se | Herbicide-resistant hydroxyphenylpyruvate dioxygenases |
EP2816117B1 (en) | 2004-09-29 | 2016-11-30 | Collplant Ltd. | Collagen producing plants and methods of generating and using same |
WO2017083920A1 (en) | 2015-11-18 | 2017-05-26 | Commonwealth Scientific And Industrial Research Organisation | Rice grain with thickened aleurone |
US9718759B2 (en) | 2013-12-18 | 2017-08-01 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising docosapentaenoic acid |
EP3205668A1 (en) | 2016-02-15 | 2017-08-16 | Brendan Patrick Purcell | Method for biofabricating composite material |
US10005713B2 (en) | 2014-06-27 | 2018-06-26 | Commonwealth Scientific And Industrial Research Organisation | Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the sn-2 position |
US10138490B2 (en) | 2002-09-11 | 2018-11-27 | Michel Matringe | Transformed plants tolerant to herbicides due to overexpression of prephenate dehydrogenase and p-hydroxyphenylpyruvate dioxygenase |
EP3473647A1 (en) | 2017-06-29 | 2019-04-24 | Modern Meadow, Inc. | Yeast strains and methods for producing collagen |
US10308948B2 (en) | 2011-07-27 | 2019-06-04 | Applied Biotechnology Institute, Inc. | Method of increasing expression of nucleic acid molecules in plants using multiple transcription units |
US10626408B2 (en) | 2004-09-29 | 2020-04-21 | Collplant Ltd. | Collagen producing plants and methods of generating and using same |
WO2020168277A1 (en) | 2019-02-14 | 2020-08-20 | Cargill, Incorporated | Brassica plants producing elevated levels of polyunsaturated fatty acids |
US11214844B2 (en) | 2017-11-13 | 2022-01-04 | Modern Meadow, Inc. | Biofabricated leather articles having zonal properties |
US11352497B2 (en) | 2019-01-17 | 2022-06-07 | Modern Meadow, Inc. | Layered collagen materials and methods of making the same |
US11441153B2 (en) | 2018-02-15 | 2022-09-13 | Monsanto Technology Llc | Compositions and methods for improving crop yields through trait stacking |
US11913166B2 (en) | 2015-09-21 | 2024-02-27 | Modern Meadow, Inc. | Fiber reinforced tissue composites |
Families Citing this family (29)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
ES2276475T5 (en) * | 1997-09-30 | 2014-07-11 | The Regents Of The University Of California | Protein production in plant seeds |
ES2224792B1 (en) * | 2002-06-28 | 2007-02-16 | Era Plantech, S.L. | PRODUCTION OF PEPTIDES AND PROTEINS BY ACCUMULATION OF PROTEIN BODIES DERIVED FROM ENDOPLASMIC RETICLES IN PLANTS. |
JP2007517504A (en) * | 2003-12-09 | 2007-07-05 | ベントリア バイオサイエンス | High-level expression of fusion polypeptides in plant seeds using seed storage proteins as fusion carriers |
EP1711048A4 (en) * | 2003-12-23 | 2008-05-14 | Ventria Bioscience | Methods of expressing heterologous protein in plant seeds using monocot non seed-storage protein promoters |
GB0426161D0 (en) | 2004-11-29 | 2004-12-29 | Era Plantech S L | Protein isolation and purification |
GB0426160D0 (en) * | 2004-11-29 | 2004-12-29 | Era Plantech S L | Production of proteins |
AU2006257101B2 (en) * | 2005-04-19 | 2011-04-28 | Basf Plant Science Gmbh | Starchy-endosperm and/or germinating embryo-specific expression in mono-cotyledonous plants |
EP1885862B1 (en) | 2005-05-23 | 2015-07-29 | Arcadia Biosciences Inc. | Safflower with elevated gamma-linolenic acid |
EP1920057A4 (en) | 2005-08-03 | 2009-03-18 | Grains Res & Dev Corp | Polysaccharide synthases |
WO2007081487A2 (en) * | 2005-12-15 | 2007-07-19 | Ventria Bioscience | Production of human defensins in plant cells |
US8163880B2 (en) * | 2006-02-23 | 2012-04-24 | Era Biotech S.A. | Production of biologically active proteins |
US9555097B2 (en) | 2006-02-23 | 2017-01-31 | Era Biotech, S.A. | Recombinant protein bodies as immunogen-specific adjuvants |
US20100189706A1 (en) | 2007-01-30 | 2010-07-29 | Cathy Chang | Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them |
AU2008214568B2 (en) | 2007-02-16 | 2013-04-18 | Basf Plant Science Gmbh | Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants |
CA2682286A1 (en) * | 2007-04-13 | 2008-10-23 | Basf Plant Science Gmbh | Polynucleotides for regulation of high level tissue-preferred expression in crop plants |
US7847160B2 (en) * | 2007-08-15 | 2010-12-07 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoters |
US7964770B2 (en) * | 2007-09-28 | 2011-06-21 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoter from Sorghum kafirin gene |
WO2011008565A1 (en) | 2009-06-29 | 2011-01-20 | Synthetic Genomics, Inc. | Acyl-acp thioesterase genes and uses therefor |
US8993844B1 (en) | 2010-05-27 | 2015-03-31 | University Of Wyoming | Production of spider silk protein in corn |
EP2418284A1 (en) | 2010-08-13 | 2012-02-15 | ERA Biotech, S.A. | Protein body-inducing polypeptide sequences |
CA2867139A1 (en) | 2011-04-11 | 2012-10-18 | Targeted Growth, Inc. | Identification and the use of krp mutants in plants |
KR101339703B1 (en) | 2012-07-23 | 2013-12-11 | 전북대학교산학협력단 | Method for preparing recombinant porcine epidemic diarrhea virus (pedv) vaccine using plant and the pedv vaccine thereof |
CN105518136A (en) | 2013-07-10 | 2016-04-20 | 巴斯夫欧洲公司 | RNAI for the control of phytopathogenic fungi and oomycetes by inhibiting the expression of CYP51 genes |
US20160208274A1 (en) * | 2015-01-21 | 2016-07-21 | Northeastern State University | Blood clot-dissolving proteins produced in seeds |
BR112018003425B1 (en) * | 2015-08-25 | 2021-11-03 | Unilever Ip Holdings B.V. | MOLDED SALTED CONCENTRATED ARTICLE AND PROCESS FOR PREPARING A MOLDED SALTED CONCENTRATED ARTICLE |
WO2019057845A1 (en) * | 2017-09-20 | 2019-03-28 | Aarhus Universitet | Nepenthesin-1 derived resistance to fungal pathogens in major crop plants |
US10894812B1 (en) | 2020-09-30 | 2021-01-19 | Alpine Roads, Inc. | Recombinant milk proteins |
WO2022072718A1 (en) | 2020-09-30 | 2022-04-07 | Nobell Foods, Inc. | Recombinant milk proteins and food compositions comprising the same |
US10947552B1 (en) | 2020-09-30 | 2021-03-16 | Alpine Roads, Inc. | Recombinant fusion proteins for producing milk proteins in plants |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5538880A (en) | 1990-01-22 | 1996-07-23 | Dekalb Genetics Corporation | Method for preparing fertile transgenic corn plants |
US5610042A (en) | 1991-10-07 | 1997-03-11 | Ciba-Geigy Corporation | Methods for stable transformation of wheat |
US5714474A (en) | 1990-03-23 | 1998-02-03 | Mogen International | Production of enzymes in seeds and their use |
US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
US5773269A (en) | 1996-07-26 | 1998-06-30 | Regents Of The University Of Minnesota | Fertile transgenic oat plants |
US5780708A (en) | 1990-01-22 | 1998-07-14 | Dekalb Genetics Corporation | Fertile transgenic corn plants |
Family Cites Families (28)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4699644A (en) | 1985-12-23 | 1987-10-13 | Brandt Alan E | Plant nutrient composition |
GB8611818D0 (en) | 1986-05-15 | 1986-06-25 | Shell Int Research | Plant generation method |
US5403736A (en) | 1987-03-06 | 1995-04-04 | Mitsui Petrochemical Industries, Ltd. | Method of inducing formation of adventitious bud |
JPS6427466A (en) | 1987-04-24 | 1989-01-30 | Matsushita Electric Works Ltd | Method for cultivating tissue |
US5350688A (en) | 1988-03-31 | 1994-09-27 | Kirin Beer Kabushiki Kaisha | Method for regeneration of rice plants |
US5270200A (en) * | 1988-04-12 | 1993-12-14 | The Plant Cell Research Institute | Arcelin seed storage proteins from phaseolus vulgaris |
WO1989012102A1 (en) | 1988-06-01 | 1989-12-14 | The Texas A&M University System | Method for transforming plants via the shoot apex |
JPH04500153A (en) * | 1988-07-29 | 1992-01-16 | ザ・ワシントン・ユニバーシティ | Production of commercially valuable polypeptides with genetically transformed endosperm tissue |
EP0519011A1 (en) * | 1990-03-05 | 1992-12-23 | The Upjohn Company | Protein expression via seed specific regulatory sequences |
DE69133512T2 (en) | 1990-11-23 | 2006-09-28 | Bayer Bioscience N.V. | Process for the transformation of monocotyledonous plants |
JP3605411B2 (en) | 1991-05-15 | 2004-12-22 | モンサント・カンパニー | Production of transformed rice plants |
US5565355A (en) | 1991-12-19 | 1996-10-15 | New Zealand Forest Research Institute Limited | Growth medium |
US5773691A (en) * | 1992-03-19 | 1998-06-30 | E. I. Du Pont De Nemours And Company | Chimeric genes and methods for increasing the lysine and threonine content of the seeds of plants |
US5320961A (en) | 1992-11-16 | 1994-06-14 | Board Of Trustees Operating Michigan State University | Method for asexual in vitro propagation of fertile corn plants |
US5281529A (en) | 1992-11-16 | 1994-01-25 | Board Of Trustees Operating Michigan State University | Method for in vitro sexual reproduction of corn plants |
DE69431748D1 (en) * | 1993-03-02 | 2003-01-02 | Du Pont | INCREASE IN METHIONINE CONTENT IN PLANT SEEDS BY EXPRESSING 10KD ZEIN FROM MAIZE |
EP0688160B1 (en) | 1993-03-11 | 1998-05-13 | National Research Council Of Canada | Enhanced regeneration system for cereals |
US5693506A (en) * | 1993-11-16 | 1997-12-02 | The Regents Of The University Of California | Process for protein production in plants |
KR960706564A (en) * | 1993-11-30 | 1996-12-09 | 미리암 디. 메코너헤이 | Chimeric Genes and Methods for Increasing the Lysine Content of the Seeds of Corn, Soybean and Rapeseed Plants |
JPH07213183A (en) | 1994-02-04 | 1995-08-15 | Sapporo Breweries Ltd | Method for regenerating plant body of barley |
JPH07255304A (en) | 1994-03-17 | 1995-10-09 | New Oji Paper Co Ltd | Method for large amount of multiplication of plant of genus acacia |
CA2195206A1 (en) | 1994-07-29 | 1996-02-15 | Benjamin A. Bowen | Transgenic cereal plants |
US5650558A (en) * | 1996-01-16 | 1997-07-22 | The United States Of America As Represented By The Secretary Of Agriculture | Glutenin genes and their uses |
EP0879293A1 (en) * | 1996-02-08 | 1998-11-25 | Institut Für Pflanzengenetik Und Kulturpflanzenforschung | Cassettes for the expression of storable proteins in plants |
US5850016A (en) * | 1996-03-20 | 1998-12-15 | Pioneer Hi-Bred International, Inc. | Alteration of amino acid compositions in seeds |
US6066781A (en) * | 1997-02-13 | 2000-05-23 | Applied Phytologics, Inc. | Production of mature proteins in plants |
US6235529B1 (en) * | 1997-04-29 | 2001-05-22 | The Regents Of The University Of California | Compositions and methods for plant transformation and regeneration |
ES2276475T5 (en) * | 1997-09-30 | 2014-07-11 | The Regents Of The University Of California | Protein production in plant seeds |
-
1998
- 1998-09-30 ES ES98949710.2T patent/ES2276475T5/en not_active Expired - Lifetime
- 1998-09-30 AU AU95980/98A patent/AU746032B2/en not_active Expired
- 1998-09-30 EP EP98949710.2A patent/EP1019517B2/en not_active Expired - Lifetime
- 1998-09-30 WO PCT/US1998/020691 patent/WO1999016890A2/en active IP Right Grant
- 1998-09-30 AT AT98949710T patent/ATE346944T1/en not_active IP Right Cessation
- 1998-09-30 DE DE69836552.6T patent/DE69836552T3/en not_active Expired - Lifetime
- 1998-09-30 US US09/164,210 patent/US6642437B1/en not_active Expired - Lifetime
- 1998-09-30 JP JP2000513959A patent/JP2001518305A/en active Pending
- 1998-09-30 CA CA002305628A patent/CA2305628C/en not_active Expired - Lifetime
-
2003
- 2003-06-13 US US10/461,634 patent/US7157629B2/en not_active Expired - Lifetime
-
2010
- 2010-08-26 JP JP2010189034A patent/JP2010252820A/en active Pending
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5538880A (en) | 1990-01-22 | 1996-07-23 | Dekalb Genetics Corporation | Method for preparing fertile transgenic corn plants |
US5780708A (en) | 1990-01-22 | 1998-07-14 | Dekalb Genetics Corporation | Fertile transgenic corn plants |
US5714474A (en) | 1990-03-23 | 1998-02-03 | Mogen International | Production of enzymes in seeds and their use |
US5610042A (en) | 1991-10-07 | 1997-03-11 | Ciba-Geigy Corporation | Methods for stable transformation of wheat |
US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
US5773269A (en) | 1996-07-26 | 1998-06-30 | Regents Of The University Of Minnesota | Fertile transgenic oat plants |
Non-Patent Citations (1)
Title |
---|
"Seeds: Physiology of Development and Germination", 1994, PLENUM PRESS |
Cited By (317)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7053282B1 (en) | 1998-02-09 | 2006-05-30 | Pioneer Hi-Bred International, Inc. | Alteration of amino acid compositions in seeds |
US7183458B1 (en) | 1999-06-07 | 2007-02-27 | Basf Plant Science Gmbh | Δ6 acetylenase and Δ6-desaturase from ceratodon purpureus |
US9611441B2 (en) | 1999-07-06 | 2017-04-04 | Basf Plant Science Gmbh | Plants expressing Δ6-desaturase genes and oils from these plants containing PUFAS and method for producing unsaturated fatty acids |
US6403862B1 (en) | 1999-09-24 | 2002-06-11 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoter from maize |
WO2001021783A3 (en) * | 1999-09-24 | 2001-10-18 | Pioneer Hi Bred Int | Seed-preferred promoter from maize |
WO2001021783A2 (en) * | 1999-09-24 | 2001-03-29 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoter from maize |
WO2001023593A1 (en) * | 1999-09-30 | 2001-04-05 | Meristem Therapeutics | Synthetic and chimeric promoters, expression cassettes, plasmids, vectors, transgenic plants and seeds containing them, and method for producing them |
JP2003510088A (en) * | 1999-09-30 | 2003-03-18 | メリステム・テラピューティクス | Synthetic and chimeric promoters, expression cassettes, plasmids, vectors, transgenic plants, and seeds containing them, and methods of producing them |
FR2799205A1 (en) * | 1999-09-30 | 2001-04-06 | Meristem Therapeutics | SYNTHETIC AND CHEMICAL PROMOTERS, EXPRESSION CASSETTES, PLASMIDS, VECTORS, TRANSGENIC SEED PLANTS CONTAINING SAME, AND METHOD OF OBTAINING SAME |
US8933300B2 (en) | 2000-02-09 | 2015-01-13 | Basf Aktiengesellschaft | Elongase gene, and process for the preparation of polyunsaturated fatty acids |
US7544859B2 (en) | 2000-02-09 | 2009-06-09 | Basf Aktiengesellschaft | Elongase gene and method for producing multiple-unsaturated fatty acids |
WO2001059141A2 (en) * | 2000-02-10 | 2001-08-16 | Washington State University Research Foundation | Methods and compositions that utilize barley as a foodstuff for animals |
WO2001059141A3 (en) * | 2000-02-10 | 2001-12-06 | Univ Washington | Methods and compositions that utilize barley as a foodstuff for animals |
WO2001061023A1 (en) * | 2000-02-16 | 2001-08-23 | Plant Research International B.V. | Reduction of in planta degradation of recombinant plant products |
EP1130104A1 (en) * | 2000-02-16 | 2001-09-05 | Stichting Dienst Landbouwkundig Onderzoek | Reduction of in planta degradation of recombinant plant products |
EP2281894A2 (en) | 2000-04-07 | 2011-02-09 | BASF Plant Science GmbH | Protein kinase stress-related proteins and methods of use in plants |
EP2264056A1 (en) | 2000-04-07 | 2010-12-22 | BASF Plant Science GmbH | Transcription factor stress-related proteins and methods of use in plants |
US7417178B2 (en) * | 2000-05-02 | 2008-08-26 | Ventria Bioscience | Expression of human milk proteins in transgenic plants |
US7718851B2 (en) | 2000-05-02 | 2010-05-18 | Ventria Bioscience | Expression of human milk proteins in transgenic plants |
US7304208B2 (en) * | 2000-05-02 | 2007-12-04 | Ventria Bioscience | Expression of human serum albumin (HSA) in monocot seeds |
US8686225B2 (en) | 2000-05-02 | 2014-04-01 | Ventria Bioscience Inc. | Monocot seed product comprising a human blood protein |
US8158857B2 (en) | 2000-05-02 | 2012-04-17 | Ventria Bioscience | Monocot seed product comprising a human serum albumin protein |
EP1167532A3 (en) * | 2000-06-30 | 2002-06-19 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Edible transgenic plants expressing mammalian proteins |
EP1167532A2 (en) * | 2000-06-30 | 2002-01-02 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Edible transgenic plants expressing mammalian proteins |
US8835715B1 (en) | 2000-06-30 | 2014-09-16 | Basf Plant Science Gmbh | Plants expressing Δ6-desaturase genes and oils from these plants containing PUFAS and method for producing unsaturated fatty acids |
US7273923B2 (en) | 2001-01-22 | 2007-09-25 | Sangamo Biosciences, Inc. | Zinc finger proteins for DNA binding and gene regulation in plants |
US7705139B2 (en) | 2001-01-22 | 2010-04-27 | Sangamo Biosciences, Inc. | Zinc finger proteins for DNA binding and gene regulation in plants |
US8680021B2 (en) | 2001-01-22 | 2014-03-25 | Sangamo Biosciences, Inc. | Zinc finger proteins for DNA binding and gene regulation in plants |
EP2617294A1 (en) * | 2001-02-14 | 2013-07-24 | Ventria Bioscience | Expression of human milk proteins in transgenic plants |
WO2002074977A2 (en) | 2001-03-16 | 2002-09-26 | Basf Plant Science Gmbh | Sugar and lipid metabolism regulators in plants |
US7601889B2 (en) | 2001-03-26 | 2009-10-13 | Napier Johnathan A | Elongase gene and production of Δ9-polyunsaturated fatty acids |
WO2002099076A2 (en) | 2001-06-04 | 2002-12-12 | Basf Plant Science Gmbh | Sugar and lipid metabolism regulators in plants ii |
WO2003013225A2 (en) | 2001-08-09 | 2003-02-20 | Northwest Plant Breeding Company | Wheat plants having increased resistance to imidazolinone herbicides |
WO2003014356A1 (en) | 2001-08-09 | 2003-02-20 | University Of Saskatchewan | Wheat plants having increased resistance to imidazolinone herbicides |
WO2003014357A1 (en) | 2001-08-09 | 2003-02-20 | University Of Saskatchewan | Wheat plants having increased resistance to imidazolinone herbicides |
EP2080432A1 (en) | 2001-08-10 | 2009-07-22 | BASF Plant Science GmbH | Sugar and lipid metabolism regulators in plants III |
US7456335B2 (en) | 2001-09-03 | 2008-11-25 | Basf Plant Science Gmbh | Nucleic acid sequences and their use in methods for achieving pathogen resistance in plants |
WO2003020914A2 (en) | 2001-09-05 | 2003-03-13 | Basf Plant Science Gmbh | Protein phosphatase stress-related polypeptides and methods of use in plants |
WO2003040344A2 (en) | 2001-11-09 | 2003-05-15 | Basf Plant Science Gmbh | Transcription factor stress-related polypeptides and methods of use in plants |
WO2003049538A2 (en) * | 2001-12-06 | 2003-06-19 | Prodigene, Inc. | Methods for the cost-effective saccharification of lignocellulosic biomass |
US8558058B2 (en) | 2001-12-06 | 2013-10-15 | Applied Biotechnology Institute | Monocotyledonous seed expressing exo-1,4B-glucanase |
WO2003049538A3 (en) * | 2001-12-06 | 2003-07-31 | Prodigene Inc | Methods for the cost-effective saccharification of lignocellulosic biomass |
US7262054B2 (en) | 2002-01-22 | 2007-08-28 | Sangamo Biosciences, Inc. | Zinc finger proteins for DNA binding and gene regulation in plants |
WO2003073839A2 (en) * | 2002-03-01 | 2003-09-12 | Plantechno S.R.L | Expression of lysosomal enzymes in plant seeds |
WO2003073839A3 (en) * | 2002-03-01 | 2003-12-18 | Plantechno S R L | Expression of lysosomal enzymes in plant seeds |
US7393998B2 (en) * | 2002-03-08 | 2008-07-01 | Prodigene, Inc. | Commercial production of insulin and insulin-like proteins in plants |
US7554006B2 (en) | 2002-03-08 | 2009-06-30 | Prodigeue, Inc. | Commercial production of insulin and insulin-like protein in plants |
WO2003078629A1 (en) | 2002-03-20 | 2003-09-25 | Basf Plant Science Gmbh | Constructs and methods for the regulation of gene expression |
WO2003095655A2 (en) | 2002-05-08 | 2003-11-20 | Basf Plant Science Gmbh | Methods for increasing oil content in plants |
EP2329708A1 (en) | 2002-07-10 | 2011-06-08 | The Department of Agriculture, Western Australia | Wheat plants having increased resistance to imidazolinone herbicides |
EP2036984A2 (en) | 2002-07-26 | 2009-03-18 | BASF Plant Science GmbH | Reversion of the negative selective effect of negative marker proteins as selection procedure |
EP2272966A2 (en) | 2002-08-02 | 2011-01-12 | BASF Plant Science GmbH | Sugar and lipid metabolism regulators in plants IV |
WO2004018687A2 (en) | 2002-08-07 | 2004-03-04 | Basf Plant Science Gmbh | Nucleic acid sequences encoding proteins associated with abiotic stress response |
EP2278018A2 (en) | 2002-08-07 | 2011-01-26 | BASF Plant Science GmbH | Nucleic acid sequences encoding proteins associated with abiotic stress response |
US10138490B2 (en) | 2002-09-11 | 2018-11-27 | Michel Matringe | Transformed plants tolerant to herbicides due to overexpression of prephenate dehydrogenase and p-hydroxyphenylpyruvate dioxygenase |
WO2004053134A1 (en) | 2002-12-12 | 2004-06-24 | Bayer Cropscience S.A. | Expression cassette encoding a 5-enolpyruvylshikimate-3-phosphate synthase (epsps) and herbicide-tolerant plants containing it |
EP2471930A1 (en) | 2002-12-20 | 2012-07-04 | Metanomics GmbH & Co. KGaA | Method for producing aminoacids |
EP2322633A2 (en) | 2003-02-17 | 2011-05-18 | Metanomics GmbH | Preparation of organisms with faster growth and/or higher yield |
WO2004076617A2 (en) | 2003-02-27 | 2004-09-10 | Basf Plant Science Gmbh | Method for the production of polyunsaturated fatty acids |
EP2390313A1 (en) | 2003-03-31 | 2011-11-30 | University Of Bristol | New vegetable acyltransferases specifically for long-chain polyunsaturated fatty acids |
EP2365063A1 (en) | 2003-03-31 | 2011-09-14 | University Of Bristol | New vegetable acyltransferases specifically for long-chain polyunsaturated fatty acids |
WO2004092398A2 (en) | 2003-04-15 | 2004-10-28 | Basf Plant Science Gmbh | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
EP2674496A2 (en) | 2003-04-15 | 2013-12-18 | BASF Plant Science GmbH | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
EP2508609A1 (en) | 2003-05-28 | 2012-10-10 | Basf Se | Wheat plants having increased tolerance to imidazolinone herbicides |
EP1959017A1 (en) * | 2003-06-17 | 2008-08-20 | SemBioSys Genetics Inc. | Methods for the production of insulin in plants |
EA014887B1 (en) * | 2003-06-17 | 2011-02-28 | Сембайосиз Джинетикс Инк. | Method for the expression of insulin in plant seeds, a method for obtaining plant seeds comprising insulin and a plant capable of setting seeds comprising insulin |
WO2004111244A2 (en) * | 2003-06-17 | 2004-12-23 | Sembiosys Genetics Inc. | Methods for the production of insulin in plants |
WO2004111244A3 (en) * | 2003-06-17 | 2005-02-03 | Sembiosys Genetics Inc | Methods for the production of insulin in plants |
AU2004247762B2 (en) * | 2003-06-17 | 2010-05-27 | Sembiosys Genetics Inc. | Methods for the production of insulin in plants |
US7547821B2 (en) | 2003-06-17 | 2009-06-16 | Sembiosys Genetics Inc. | Methods for the production of insulin in plants |
EP2172536A2 (en) | 2003-08-01 | 2010-04-07 | BASF Plant Science GmbH | Method for producing polyunsaturated fatty acids in transgenic organisms |
EP2166070A2 (en) | 2003-08-01 | 2010-03-24 | BASF Plant Science GmbH | Method for producing polyunsaturated fatty acids in transgenic organisms |
EP2166069A2 (en) | 2003-08-01 | 2010-03-24 | BASF Plant Science GmbH | Method for producing polyunsaturated fatty acids in transgenic organisms |
EP2166071A2 (en) | 2003-08-01 | 2010-03-24 | BASF Plant Science GmbH | Method for producing polyunsaturated fatty acids in transgenic organisms |
EP2166089A2 (en) | 2003-08-01 | 2010-03-24 | BASF Plant Science GmbH | Method for production of polyunsaturated fatty acids in transgenic organisms |
EP2434019A1 (en) | 2003-08-01 | 2012-03-28 | BASF Plant Science GmbH | Process for the production of fine chemicals |
EP3395945A1 (en) | 2003-08-01 | 2018-10-31 | BASF Plant Science GmbH | Method for producing polyunsatured fatty acids in transgenic organisms |
EP2169052A2 (en) | 2003-08-01 | 2010-03-31 | BASF Plant Science GmbH | Method for production of polyunsaturated fatty acids in transgenic organisms |
EP2169053A2 (en) | 2003-08-01 | 2010-03-31 | BASF Plant Science GmbH | Method for production of polyunsaturated fatty acids in transgenic organisms |
EP2166090A2 (en) | 2003-08-01 | 2010-03-24 | BASF Plant Science GmbH | Method for production of polyunsaturated fatty acids in transgene organisms |
EP2330206A1 (en) | 2003-08-11 | 2011-06-08 | Kweek-en Researchbedrijf Agrico B.V. | A gene from Solanum bulbocastanum conferring resistance to Phytophthora infestans |
US7709700B2 (en) | 2003-08-13 | 2010-05-04 | Japan Tobacco Inc. | Method for improving plant transformation efficiency by adding copper ion |
EP1669444A4 (en) * | 2003-08-13 | 2006-11-29 | Japan Tobacco Inc | Method of elevating transformation efficiency in plant by adding copper ion |
WO2005020673A1 (en) | 2003-08-29 | 2005-03-10 | Instituto Nacional De Technologia Agropecuaria | Rice plants having increased tolerance to imidazolinone herbicides |
EP2294913A1 (en) | 2003-08-29 | 2011-03-16 | Instituto Nacional de Tecnologia Agropecuaria | Rice plants having increased tolerance to imidazolinone herbicides |
EP2982240A1 (en) | 2003-08-29 | 2016-02-10 | Instituto Nacional de Tecnologia Agropecuaria | Rice plants having increased tolerance to imidazolinone herbicides |
US7595384B2 (en) * | 2003-10-31 | 2009-09-29 | National Institute Of Agrobiological Sciences | Seed-specific gene promoter from the rice 10 KDa prolaminin gene and uses thereof |
US7700835B2 (en) | 2003-10-31 | 2010-04-20 | National Institute Of Agrobiological Sciences | AGPase promoter from rice and uses thereof |
US7619135B2 (en) * | 2003-10-31 | 2009-11-17 | National Institute Of Agrobiological Sciences | Seed-specific promoter from the rice glutelin GluB-4 gene and uses thereof |
EP2256207A1 (en) | 2003-12-23 | 2010-12-01 | BASF Plant Science GmbH | Sugar and lipid metabolism regulators in plants VI |
WO2005083053A2 (en) | 2004-02-27 | 2005-09-09 | Basf Plant Science Gmbh | Method for producing unsaturated omega-3 fatty acids in transgenic organisms |
EP2623584A1 (en) | 2004-02-27 | 2013-08-07 | BASF Plant Science GmbH | Method for producing polyunsatured fatty acids in transgenic plants |
WO2005103253A1 (en) | 2004-04-22 | 2005-11-03 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
EP2357243A2 (en) | 2004-04-22 | 2011-08-17 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
EP2357244A2 (en) | 2004-04-22 | 2011-08-17 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
EP2363492A2 (en) | 2004-04-22 | 2011-09-07 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
EP2404499A2 (en) | 2004-06-16 | 2012-01-11 | BASF Plant Science GmbH | Nucleic acid molecules encoding Lipid Metabolism Protein (LMP) and methods of use in plants |
EP2080769A2 (en) | 2004-07-02 | 2009-07-22 | Metanomics GmbH | Process for the production of fine chemicals |
WO2006069610A2 (en) | 2004-07-02 | 2006-07-06 | Metanomics Gmbh | Process for the production of fine chemicals |
WO2006013010A2 (en) | 2004-07-31 | 2006-02-09 | Metanomics Gmbh | Preparation of organisms with faster growth and/or higher yield |
US7947876B2 (en) * | 2004-09-14 | 2011-05-24 | Nippon Paper Industries Co., Ltd. | Plant and plant storage organ having GLP-1 derivative accumulated therein and method of producing the same |
EP2345730A1 (en) | 2004-09-20 | 2011-07-20 | BASF Plant Science GmbH | Arabidopsis genes encoding proteins involved in sugar and lipid metabolism and methods of use |
EP2348117A1 (en) | 2004-09-20 | 2011-07-27 | BASF Plant Science GmbH | Arabidopsis genes encoding proteins involved in sugar and lipid metabolism and methods of use |
EP2339007A1 (en) | 2004-09-20 | 2011-06-29 | BASF Plant Science GmbH | Arabidopsis genes encoding proteins involved in sugar and lipid metabolism and methods of use |
EP2053057A2 (en) | 2004-09-24 | 2009-04-29 | BASF Plant Science GmbH | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmantal stress |
WO2006032707A2 (en) | 2004-09-24 | 2006-03-30 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance to environmental stress |
US10626408B2 (en) | 2004-09-29 | 2020-04-21 | Collplant Ltd. | Collagen producing plants and methods of generating and using same |
EP2816117B1 (en) | 2004-09-29 | 2016-11-30 | Collplant Ltd. | Collagen producing plants and methods of generating and using same |
EP2096177A2 (en) | 2004-12-17 | 2009-09-02 | Metanomics GmbH | Process for the production of lutein |
WO2007087815A2 (en) | 2004-12-17 | 2007-08-09 | Metanomics Gmbh | Process for the control of production of fine chemicals |
EP2199304A1 (en) | 2004-12-17 | 2010-06-23 | Metanomics GmbH | Process for the control of production of fine chemicals |
EP2194140A2 (en) | 2005-03-02 | 2010-06-09 | Metanomics GmbH | Process for the production of fine chemicals |
EP2573188A2 (en) | 2005-03-02 | 2013-03-27 | Metanomics GmbH | Process for the production of fine chemicals |
EP2045327A2 (en) | 2005-03-08 | 2009-04-08 | BASF Plant Science GmbH | Expression enhancing intron sequences |
EP2166102A2 (en) | 2005-03-08 | 2010-03-24 | BASF Plant Science GmbH | Expression enhancing intron sequences |
EP2166100A2 (en) | 2005-03-08 | 2010-03-24 | BASF Plant Science GmbH | Expression enhancing intron sequences |
EP2166099A2 (en) | 2005-03-08 | 2010-03-24 | BASF Plant Science GmbH | Expression enhancing intron sequences |
EP2166101A2 (en) | 2005-03-08 | 2010-03-24 | BASF Plant Science GmbH | Expression enhancing intron sequences |
WO2006100241A2 (en) | 2005-03-22 | 2006-09-28 | Basf Plant Science Gmbh | Method for producing polyunsaturated c20 and c22 fatty acids with at least four double bonds in transgenic plants |
WO2006111512A1 (en) | 2005-04-19 | 2006-10-26 | Basf Plant Science Gmbh | Improved methods controlling gene expression |
WO2006134162A2 (en) | 2005-06-17 | 2006-12-21 | Basf Plant Science Gmbh | Lecitin-like protein kinase stress-related polypeptides and methods of use in plants |
EP2159289A2 (en) | 2005-06-23 | 2010-03-03 | BASF Plant Science GmbH | Improved methods for the production of stably transformed plants |
EP2431472A1 (en) | 2005-07-06 | 2012-03-21 | CropDesign N.V. | Plant yield improvement by STE20-like gene expression |
WO2007011736A2 (en) | 2005-07-18 | 2007-01-25 | Basf Plant Science Gmbh | Yield increase in plants overexpressing the shsrp genes |
EP3222729A2 (en) | 2005-07-18 | 2017-09-27 | BASF Plant Science GmbH | Increase in root length in arabidopsis plants over-expressing the arabidopsis shmt4 (shm4) gene (at4g13930) |
WO2007011625A2 (en) | 2005-07-18 | 2007-01-25 | Basf Plant Science Gmbh | Yield increase in plants overexpressing the accdp genes |
EP2145960A1 (en) | 2005-08-12 | 2010-01-20 | BASF Plant Science GmbH | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with in-creased tolerance to environmental stress |
EP2573179A1 (en) | 2005-09-15 | 2013-03-27 | CropDesign N.V. | Plants having increased yield and method for making the same |
EP2980220A1 (en) | 2005-09-20 | 2016-02-03 | BASF Plant Science GmbH | Improved methods controlling gene expression |
WO2007042510A2 (en) | 2005-10-13 | 2007-04-19 | Basf Plant Science Gmbh | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
EP2450434A2 (en) | 2005-10-13 | 2012-05-09 | BASF Plant Science GmbH | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
US8952217B2 (en) | 2005-10-14 | 2015-02-10 | Metanomics Gmbh | Process for decreasing verbascose in a plant by expression of a chloroplast-targeted fimD protein |
WO2007051577A2 (en) | 2005-11-02 | 2007-05-10 | Basf Plant Science Gmbh | METHOD FOR THE PRODUCTION OF γ-LINOLENIC ACID AND/OR STEARIDONIC ACID IN TRANSGENIC BRASSICACEAE AND LINACEAE |
WO2007054441A2 (en) | 2005-11-08 | 2007-05-18 | Basf Plant Science Gmbh | Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants |
US11166479B2 (en) | 2005-11-18 | 2021-11-09 | Commonwealth Scientific And Industrial Research Organisation | Feedstuffs for aquaculture comprising stearidonic acid |
US8795744B2 (en) | 2005-11-18 | 2014-08-05 | Commonwealth Scientific And Industrial Research Organisation | Feedstuffs for aquaculture comprising stearidonic acid |
EP2366781A1 (en) | 2005-11-24 | 2011-09-21 | BASF Plant Science GmbH | Process for the production of delta5-unsaturated fatty acids in transgenic organisms |
EP2388332A1 (en) | 2005-11-24 | 2011-11-23 | BASF Plant Science GmbH | Process for the production of delta5-unsaturated fatty acids in transgenic organisms |
EP2311857A1 (en) | 2005-12-09 | 2011-04-20 | BASF Plant Science GmbH | polypeptides involved in regulation of sugar and lipid metabolism and methods of use VIII |
EP2311856A1 (en) | 2005-12-09 | 2011-04-20 | BASF Plant Science GmbH | Polypeptides involved in regulation of sugar and lipid metabolism and methods of use VIII |
EP2314606A1 (en) | 2005-12-09 | 2011-04-27 | BASF Plant Science GmbH | Nucleic acid molecules encoding polypeptides involved in regulation of sugar and lipid metabolism and methods of use VIII |
EP2314607A1 (en) | 2005-12-09 | 2011-04-27 | BASF Plant Science GmbH | Polypeptides involved in regulation of sugar and lipid metabolism and methods of use VIII |
EP2500422A2 (en) | 2005-12-09 | 2012-09-19 | BASF Plant Science GmbH | Nucleic acid molecules encoding polypeptides involved in regulation of sugar and lipid metabolism and methods of use VIII |
EP2522722A2 (en) | 2005-12-09 | 2012-11-14 | BASF Plant Science GmbH | Nucleic acid molecules encoding polypeptides involved in regulation of sugar and lipid metabolism and methods of use VIII |
EP2380986A1 (en) | 2006-01-12 | 2011-10-26 | BASF Plant Science GmbH | Use of stomatin (STM1) polynucleotides for achieving a pathogen resistance in plants |
EP2380984A2 (en) | 2006-02-16 | 2011-10-26 | BASF Plant Science GmbH | Nucleic acid |
EP2333078A2 (en) | 2006-03-24 | 2011-06-15 | BASF Plant Science GmbH | Proteins associated with abiotic stress response and homologs |
EP2441844A1 (en) | 2006-03-31 | 2012-04-18 | BASF Plant Science GmbH | Plants having enhanced yield-related traits and a method for making the same |
EP2439280A1 (en) | 2006-03-31 | 2012-04-11 | BASF Plant Science GmbH | Plants having enhanced yield-related traits and a method for making the same |
EP2090662A2 (en) | 2006-04-05 | 2009-08-19 | Metanomics GmbH | Process for the production of a fine chemical |
EP2377937A1 (en) | 2006-05-30 | 2011-10-19 | CropDesign N.V. | Plants with reduced expression of a CLE-like gene having enhanced yield-related traits and a method for making the same |
EP2439277A1 (en) | 2006-05-30 | 2012-04-11 | CropDesign N.V. | Plants overexpressing SYR polypeptide having enhanced yield-related traits and a method for making the same |
EP2497778A2 (en) | 2006-05-31 | 2012-09-12 | Metanomics GmbH | Manipulation of the nitrogen metabolism |
WO2007137973A2 (en) | 2006-05-31 | 2007-12-06 | Metanomics Gmbh | Manipulation of the nitrogen metabolism using ammonium transporter or glucose 6-phosphate deshydrogenases or farnesyl phosphate synthetase (fpp) |
US7723571B2 (en) * | 2006-06-08 | 2010-05-25 | Healthgen Biotechnology Inc. In Wuhan | Method of expressing small peptides using cereal non-storage proteins as fusion carrier in endosperm and the use thereof |
EP2436761A1 (en) | 2006-06-08 | 2012-04-04 | BASF Plant Science GmbH | Plants having improved growth characteristics and method for making the same |
WO2007141189A2 (en) | 2006-06-08 | 2007-12-13 | Basf Plant Science Gmbh | Plants having improved growth characteristics and method for making the same |
EP2436760A1 (en) | 2006-06-08 | 2012-04-04 | BASF Plant Science GmbH | Plants having improved growth characteristics and method for making the same |
EP2189533A1 (en) | 2006-08-02 | 2010-05-26 | CropDesign N.V. | Plants having improved characteristics and a method for making the same |
EP2189534A2 (en) | 2006-08-02 | 2010-05-26 | CropDesign N.V. | Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same |
EP2199395A1 (en) | 2006-08-02 | 2010-06-23 | CropDesign N.V. | Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same |
EP2543732A1 (en) | 2006-08-02 | 2013-01-09 | CropDesign N.V. | Plants transformed with a nucleic acid encoding chloroplastic fructose-1,6-bisphosphatase having increased yield, and a method for making the same |
EP2199394A1 (en) | 2006-08-02 | 2010-06-23 | CropDesign N.V. | Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same |
EP2199396A1 (en) | 2006-08-02 | 2010-06-23 | CropDesign N.V. | Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same |
US9029111B2 (en) | 2006-08-24 | 2015-05-12 | Basf Plant Science Gmbh | Isolation and characterization of a novel pythium omega 3 desaturase with specificity to all omega 6 fatty acids longer than 18 carbon chains |
US10113189B2 (en) | 2006-08-24 | 2018-10-30 | Basf Plant Science Gmbh | Isolation and characterization of a novel pythium omega 3 desaturase with specificity to all omega 6 fatty acids longer than 18 carbon chains |
EP2500420A1 (en) | 2006-08-24 | 2012-09-19 | BASF Plant Science GmbH | Pythium omega 3 desaturase with specificity to all omega 6 fatty acids longer than 18 carbon chains |
WO2008025711A2 (en) | 2006-08-30 | 2008-03-06 | Basf Plant Science Gmbh | Method for increasing resistance to pathogens in transgenic plants |
US20100047864A1 (en) * | 2006-10-04 | 2010-02-25 | Plant Advance Technologies PAT SAS | Process for the production of recombinant proteins using carnivorous plants |
US8178749B2 (en) * | 2006-10-04 | 2012-05-15 | Plant Advanced Technologies Pat Sas | Process for the production of recombinant proteins using carnivorous plants |
EP2177605A1 (en) | 2006-10-06 | 2010-04-21 | BASF Plant Science GmbH | Method for producing polyunsaturated fatty acids in transgenic non-human organisms |
EP2182056A1 (en) | 2006-10-06 | 2010-05-05 | BASF Plant Science GmbH | Method for producing polyunsaturated fatty acids in transgenic non-human organisms |
EP2487245A2 (en) | 2006-10-12 | 2012-08-15 | BASF Plant Science GmbH | Method for increasing pathogen resistance in transgenic plants |
EP2455472A2 (en) | 2006-10-13 | 2012-05-23 | BASF Plant Science GmbH | Plants with increased yield |
EP2202314A1 (en) | 2007-01-15 | 2010-06-30 | BASF Plant Science GmbH | Use of subtilisin (RNR9) polynucleotides for achieving a pathogen resistance in plants |
WO2008095889A1 (en) | 2007-02-06 | 2008-08-14 | Basf Plant Science Gmbh | Use of alanine racemase genes to confer nematode resistance to plants |
WO2008095886A1 (en) | 2007-02-06 | 2008-08-14 | Basf Plant Science Gmbh | Compositions and methods using rna interference for control of nematodes |
WO2008095970A1 (en) | 2007-02-09 | 2008-08-14 | Basf Plant Science Gmbh | Compositions and methods using rna interference of cdpk-like for control of nematodes |
WO2008110522A1 (en) | 2007-03-15 | 2008-09-18 | Basf Plant Science Gmbh | Use of nematode chitinase genes to control plant parasitic nematodes |
EP2163637A1 (en) | 2007-03-23 | 2010-03-17 | BASF Plant Science GmbH | Transgenic plants with increased stress tolerance and yield |
EP2537938A2 (en) | 2007-03-23 | 2012-12-26 | BASF Plant Science GmbH | Physcomitrella patents genes which improve stress tolerance |
WO2008116829A1 (en) | 2007-03-23 | 2008-10-02 | Basf Plant Science Gmbh | Transgenic plant with increased stress tolerance and yield |
DE112008000747T5 (en) | 2007-03-23 | 2010-01-28 | Basf Plant Science Gmbh | Transgenic plants with increased stress tolerance and increased yield |
EP2492346A2 (en) | 2007-05-04 | 2012-08-29 | BASF Plant Science GmbH | Seed enhancement by combinations of pyruvate kinases |
EP2492345A2 (en) | 2007-05-04 | 2012-08-29 | BASF Plant Science GmbH | Seed enhancement by combinations of pyruvate kinases |
DE112008001453T5 (en) | 2007-05-22 | 2010-04-29 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance and / or resistance to environmental stress and increased biomass production CO |
WO2008142034A2 (en) | 2007-05-22 | 2008-11-27 | Basf Plant Science Gmbh | Plants with increased tolerance and/or resistance to environmental stress and increased biomass production |
DE112008001452T5 (en) | 2007-05-22 | 2010-12-16 | Basf Plant Science Gmbh | Plants with increased tolerance and / or resistance to environmental stress and increased biomass production |
DE112008001277T5 (en) | 2007-05-29 | 2010-04-22 | Basf Plant Science Gmbh | Transgenic plants with increased stress tolerance and increased yield |
EP2390336A2 (en) | 2007-07-13 | 2011-11-30 | BASF Plant Science GmbH | Transgenic plants with increased stress tolerance and yield |
EP2487246A2 (en) | 2007-08-02 | 2012-08-15 | BASF Plant Science GmbH | Transgenic plants with increased stress tolerance and yield |
DE112008002435T5 (en) | 2007-09-18 | 2010-07-22 | Basf Plant Science Gmbh | Plants with increased yield |
DE112008002456T5 (en) | 2007-09-21 | 2011-01-13 | Basf Plant Science Gmbh | Plants with increased yield |
EP2594647A2 (en) | 2007-09-21 | 2013-05-22 | BASF Plant Science GmbH | Plants with increased yield |
EP2594645A2 (en) | 2007-09-21 | 2013-05-22 | BASF Plant Science GmbH | Plants with increased yield |
EP2594646A2 (en) | 2007-09-21 | 2013-05-22 | BASF Plant Science GmbH | Plant with increased yield |
DE112008003224T5 (en) | 2007-11-27 | 2010-12-23 | Basf Plant Science Gmbh | Transgenic plants with increased stress tolerance and increased yield |
WO2009077478A2 (en) * | 2007-12-14 | 2009-06-25 | Basf Plant Science Gmbh | Promoters from brassica napus for seed specific gene expression |
WO2009077478A3 (en) * | 2007-12-14 | 2009-12-10 | Basf Plant Science Gmbh | Promoters from brassica napus for seed specific gene expression |
DE112008003237T5 (en) | 2007-12-14 | 2011-03-17 | Basf Plant Science Gmbh | Promoters of Brassica napus for seed-specific gene expression |
DE112008003414T5 (en) | 2007-12-17 | 2011-03-31 | Basf Plant Science Gmbh | Lipid metabolism proteins, combinations of lipid metabolism proteins and applications thereof |
WO2009077545A2 (en) | 2007-12-17 | 2009-06-25 | Basf Plant Science Gmbh | Lipid metabolism protein and uses thereof i (bzip transcription factor) |
DE112008003318T5 (en) | 2007-12-19 | 2011-04-21 | Basf Plant Science Gmbh | Plants with increased yield and increased tolerance to environmental stress (IY-B) |
EP2604622A2 (en) | 2007-12-19 | 2013-06-19 | BASF Plant Science GmbH | Plants with increased yield and/or increased tolerance to environmental stress (IY-BM) |
DE112008003433T5 (en) | 2007-12-21 | 2010-11-04 | Basf Plant Science Gmbh | Plants with increased yield (KO NUE) |
DE112009000313T5 (en) | 2008-02-27 | 2011-04-28 | Basf Plant Science Gmbh | Plants with increased yield |
US8552256B2 (en) | 2008-04-11 | 2013-10-08 | National Institute Of Agrobiological Sciences | Gene capable of being expressed specifically in endosperm of plant, promoter for the gene, and use of the gene and the promoter |
WO2009129583A1 (en) | 2008-04-25 | 2009-10-29 | Commonwealth Scientific Industrial Research Organisation | Recombinant cells and methods for hydroxylating fatty acids |
DE112009001385T5 (en) | 2008-06-03 | 2011-04-14 | Basf Plant Science Gmbh | Fatty acid dehydratases and applications thereof |
DE112009001585T5 (en) | 2008-07-01 | 2012-02-23 | Basf Plant Science Gmbh | Promoters of Brassica napus for seed-specific gene expression |
EP2826864A2 (en) | 2008-07-01 | 2015-01-21 | BASF Plant Science GmbH | Promoters from Brassica napus for seed specific gene expression |
EP2154252A1 (en) * | 2008-07-16 | 2010-02-17 | Sumitomo Chemical Company, Limited | Methods for producing secreted proteins |
DE112009001994T5 (en) | 2008-08-19 | 2012-01-19 | Basf Plant Science Gmbh | Increased yield plants by increasing or generating one or more activities in a plant or part thereof |
DE112009002048T5 (en) | 2008-08-26 | 2012-01-26 | Basf Plant Science Gmbh | Nucleic acid encoding desaturases and modified plant oil |
DE112009002061T5 (en) | 2008-08-27 | 2011-07-14 | BASF Plant Science GmbH, 67063 | Nematode resistant transgenic plants |
DE112009002267T5 (en) | 2008-09-23 | 2012-01-19 | Basf Plant Science Gmbh | Plants with increased yield (LT) |
DE112009002577T5 (en) | 2008-10-23 | 2012-06-21 | Basf Plant Science Gmbh | Increased Yield Plants (NUE) |
DE112009002342T5 (en) | 2008-10-23 | 2012-06-14 | Basf Plant Science Gmbh | Method for producing a transgenic cell with increased content of gamma-aminobutyric acid (GABA) |
US10648046B2 (en) | 2008-11-18 | 2020-05-12 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
WO2010057246A1 (en) | 2008-11-18 | 2010-05-27 | Commonwealth Scientific Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
US11976287B2 (en) | 2008-11-18 | 2024-05-07 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing ω-3 fatty acids |
EP3260544A1 (en) | 2008-11-18 | 2017-12-27 | Commonwealth Scientific and Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
US9994792B2 (en) | 2008-11-18 | 2018-06-12 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
US9976107B2 (en) | 2008-11-18 | 2018-05-22 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing ω-3 fatty acids |
DE112009003708T5 (en) | 2008-12-12 | 2012-09-13 | Basf Plant Science Gmbh | Desaturases and methods of producing polyunsaturated fatty acids in transgenic organisms |
EP2669380A1 (en) | 2008-12-12 | 2013-12-04 | BASF Plant Science GmbH | Desaturases and process for the production of polyunsaturated fatty acids in transgenic organisms |
EP2821492A2 (en) | 2009-05-13 | 2015-01-07 | BASF Plant Science Company GmbH | Acyltransferases and uses thereof in fatty acid production |
WO2010142522A2 (en) | 2009-06-08 | 2010-12-16 | Basf Plant Science Company Gmbh | Novel fatty acid elongation components and uses thereof |
DE112010002353T5 (en) | 2009-06-08 | 2012-08-09 | Basf Plant Science Company Gmbh | NEW FATTY ACID ELONGATION COMPONENTS AND APPLICATIONS THEREOF |
WO2011006948A1 (en) | 2009-07-17 | 2011-01-20 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases and elongases and uses thereof |
DE112010002967T5 (en) | 2009-07-17 | 2012-10-11 | Basf Plant Science Company Gmbh | New fatty acid desaturases and -elongases and applications thereof |
DE112010003032T5 (en) | 2009-07-23 | 2012-08-02 | Basf Plant Science Company Gmbh | Plants with increased yield |
WO2011009801A1 (en) | 2009-07-23 | 2011-01-27 | Basf Plant Science Company Gmbh | Plants with increased yield |
US9074224B2 (en) | 2009-08-03 | 2015-07-07 | Recombinetics, Inc. | Methods and compositions for targeted gene modification |
DE112010003389T5 (en) | 2009-08-25 | 2012-06-14 | Basf Plant Science Company Gmbh | Nematode resistant transgenic plants |
WO2011023571A1 (en) | 2009-08-25 | 2011-03-03 | Basf Plant Science Company Gmbh | Nematode-resistant transgenic plants |
EP3121283A1 (en) | 2009-08-31 | 2017-01-25 | BASF Plant Science Company GmbH | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
EP3178937A1 (en) | 2009-08-31 | 2017-06-14 | BASF Plant Science Company GmbH | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
EP3418387A1 (en) | 2009-08-31 | 2018-12-26 | Basf Plant Science Company GmbH | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
WO2011023800A1 (en) | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
US8709742B2 (en) | 2009-10-22 | 2014-04-29 | Applied Biotechnology Institute, Inc. | Methods of saccharification of polysaccharides in plants |
US8709761B2 (en) | 2009-10-22 | 2014-04-29 | Applied Biotechnology Institute, Inc. | Methods of saccharification of polysaccharides in plants |
DE112010004469T5 (en) | 2009-11-17 | 2012-09-06 | Basf Plant Science Company Gmbh | Plants with increased yield |
WO2011061656A1 (en) | 2009-11-17 | 2011-05-26 | Basf Plant Science Company Gmbh | Plants with increased yield |
WO2011064183A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid elongase and uses thereof |
WO2011064181A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid desaturase and uses thereof |
WO2011069953A1 (en) | 2009-12-09 | 2011-06-16 | Basf Plant Science Company Gmbh | Methods for increasing the resistance of plants to fungi by silencing the fungal smt1-gene |
US9273321B2 (en) | 2009-12-31 | 2016-03-01 | Pioneer Hi Bred International Inc. | In vitro plant bioassay methods |
WO2011082107A1 (en) * | 2009-12-31 | 2011-07-07 | Pioneer Hi-Bred International, Inc. | Direct and continuous root alone or root/shoot production from transgenic events derived from green regenerative tissues and its applications |
WO2011104153A1 (en) | 2010-02-23 | 2011-09-01 | Basf Plant Science Company Gmbh | Nematode-resistant transgenic plants |
WO2011161093A1 (en) | 2010-06-25 | 2011-12-29 | Basf Plant Science Company Gmbh | Acyltransferases and uses therof in fatty acid production |
WO2012000026A1 (en) | 2010-06-28 | 2012-01-05 | Commonwealth Scientific And Industrial Research Organisation | Methods of producing lipids |
EP2695936A1 (en) | 2010-10-21 | 2014-02-12 | BASF Plant Science Company GmbH | Novel fatty acid desaturases and uses thereof |
DE112011103527T5 (en) | 2010-10-21 | 2013-10-17 | Basf Plant Science Company Gmbh | New fatty acid desaturases, elongases, elongation components and applications thereof |
WO2012052468A2 (en) | 2010-10-21 | 2012-04-26 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases, elongases, elongation components and uses therof |
WO2012084756A1 (en) | 2010-12-20 | 2012-06-28 | Basf Plant Science Company Gmbh | Nematode-resistant transgenic plants |
DE112011104462T5 (en) | 2010-12-20 | 2013-09-12 | Basf Plant Science Company Gmbh | Nematode resistant transgenic plants |
US10308948B2 (en) | 2011-07-27 | 2019-06-04 | Applied Biotechnology Institute, Inc. | Method of increasing expression of nucleic acid molecules in plants using multiple transcription units |
WO2013024121A2 (en) | 2011-08-18 | 2013-02-21 | Basf Plant Science Company Gmbh | Increase of sucrose transporter activity in the seeds of plants |
WO2013096993A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
WO2013096991A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Research Organisation | Production of dihydrosterculic acid and derivatives thereof |
WO2013096992A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Reserach Organisation | Simultaneous gene silencing and supressing gene silencing in the same cell |
EP2612918A1 (en) | 2012-01-06 | 2013-07-10 | BASF Plant Science Company GmbH | In planta recombination |
WO2013102875A1 (en) | 2012-01-06 | 2013-07-11 | Basf Plant Science Company Gmbh | In planta recombination |
US11306271B2 (en) | 2012-06-15 | 2022-04-19 | Commonwealth Scientific And Industrial Research Organisation | Process for producing extracted lipid comprising docosahexaenoic acid |
EP3266316A1 (en) | 2012-06-15 | 2018-01-10 | Commonwealth Scientific and Industrial Research Organisation | Production of long chain polyunsaturated fatty acids in plant cells |
US11834621B2 (en) | 2012-06-15 | 2023-12-05 | Nuseed Global Innovation Ltd. | Lipid comprising polyunsaturated fatty acids |
US9999607B2 (en) | 2012-06-15 | 2018-06-19 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising polyunsaturated fatty acids |
US9932290B2 (en) | 2012-06-15 | 2018-04-03 | Commonwealth Scientific And Industrial Research Organisation | Process for producing ethyl esters of polyunsaturated fatty acids |
US10335386B2 (en) | 2012-06-15 | 2019-07-02 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising polyunsaturated fatty acids |
US10655082B2 (en) | 2012-06-15 | 2020-05-19 | Commonwealth Scientific And Industrial Research Organisation | Oil comprising polyunsaturated fatty acids |
US9932289B2 (en) | 2012-06-15 | 2018-04-03 | Commonwealth Scientific And Industrial Research Ogranisation | Process for producing ethyl esters of polyunsaturated fatty acids |
US10899992B2 (en) | 2012-06-15 | 2021-01-26 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising polyunsaturated fatty acids |
US9932541B2 (en) | 2012-06-15 | 2018-04-03 | Commonwealth Scientific And Industrial Research Organisation | Process for producing ethyl esters of polyunsaturated fatty acids |
US9969954B2 (en) | 2012-06-15 | 2018-05-15 | Commonwealth Scientific And Industrial Research Organisation | Oil comprising polyunsaturated fatty acids |
WO2013185184A2 (en) | 2012-06-15 | 2013-12-19 | Commonwealth Scientific And Industrial Research Organisation | Production of long chain polyunsaturated fatty acids in plant cells |
WO2014020533A2 (en) | 2012-08-03 | 2014-02-06 | Basf Plant Science Company Gmbh | Novel enzymes, enzyme components and uses thereof |
WO2014117990A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing hcp6 |
WO2014118018A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing ein2 |
WO2014117988A1 (en) | 2013-01-29 | 2014-08-07 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing hcp7 |
WO2014135682A1 (en) | 2013-03-08 | 2014-09-12 | Basf Plant Science Company Gmbh | Fungal resistant plants expressing mybtf |
WO2015092709A1 (en) | 2013-12-17 | 2015-06-25 | Basf Plant Science Company Gmbh | Methods for conversion of the substrate specificity of desaturases |
US9725399B2 (en) | 2013-12-18 | 2017-08-08 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising long chain polyunsaturated fatty acids |
US9718759B2 (en) | 2013-12-18 | 2017-08-01 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising docosapentaenoic acid |
US10190073B2 (en) | 2013-12-18 | 2019-01-29 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising long chain polyunsaturated fatty acids |
US11623911B2 (en) | 2013-12-18 | 2023-04-11 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising docosapentaenoic acid |
US10125084B2 (en) | 2013-12-18 | 2018-11-13 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising docosapentaenoic acid |
US10800729B2 (en) | 2013-12-18 | 2020-10-13 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising long chain polyunsaturated fatty acids |
US10005713B2 (en) | 2014-06-27 | 2018-06-26 | Commonwealth Scientific And Industrial Research Organisation | Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the sn-2 position |
US10793507B2 (en) | 2014-06-27 | 2020-10-06 | Commonwealth Scientific And Industrial Research Organisation | Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the SN-2 position |
EP4303288A2 (en) | 2014-07-07 | 2024-01-10 | Nuseed Global Innovation Ltd | Processes for producing industrial products from plant lipids |
EP2966157A1 (en) | 2014-07-07 | 2016-01-13 | Commonwealth Scientific and Industrial Research Organisation | Processes for producing industrial products from plant lipids |
WO2016075327A2 (en) | 2014-11-14 | 2016-05-19 | Basf Plant Science Company Gmbh | Production of pufas in plants |
WO2016128470A1 (en) | 2015-02-11 | 2016-08-18 | Basf Se | Herbicide-resistant hydroxyphenylpyruvate dioxygenases |
US11913166B2 (en) | 2015-09-21 | 2024-02-27 | Modern Meadow, Inc. | Fiber reinforced tissue composites |
WO2017083920A1 (en) | 2015-11-18 | 2017-05-26 | Commonwealth Scientific And Industrial Research Organisation | Rice grain with thickened aleurone |
EP3205667A1 (en) | 2016-02-15 | 2017-08-16 | Brendan Patrick Purcell | Biofabricated material containing collagen fibrils |
EP3205668A1 (en) | 2016-02-15 | 2017-08-16 | Brendan Patrick Purcell | Method for biofabricating composite material |
EP3747900A1 (en) | 2016-02-15 | 2020-12-09 | Modern Meadow, Inc. | Method for biofabricating composite material |
EP3747901A1 (en) | 2016-02-15 | 2020-12-09 | Modern Meadow, Inc. | Biofabricated material containing collagen fibrils |
US10519285B2 (en) | 2016-02-15 | 2019-12-31 | Modern Meadow, Inc. | Method for biofabricating composite material |
US11001679B2 (en) | 2016-02-15 | 2021-05-11 | Modern Meadow, Inc. | Biofabricated material containing collagen fibrils |
US10370504B2 (en) | 2016-02-15 | 2019-08-06 | Modern Meadow, Inc. | Method for making a biofabricated material containing collagen fibrils |
US10301440B2 (en) | 2016-02-15 | 2019-05-28 | Modern Meadow, Inc. | Biofabricated material containing collagen fibrils |
US11286354B2 (en) | 2016-02-15 | 2022-03-29 | Modern Meadow, Inc. | Method for making a biofabricated material containing collagen fibrils |
US10370505B2 (en) | 2016-02-15 | 2019-08-06 | Modern Meadow, Inc. | Method for making biofabricated composite |
EP3205666A1 (en) | 2016-02-15 | 2017-08-16 | Brendan Patrick Purcell | Method for making a biofabricated material containing collagen fibrils |
EP3205669A1 (en) | 2016-02-15 | 2017-08-16 | Brendan Patrick Purcell | Composite biofabricated material |
US11525042B2 (en) | 2016-02-15 | 2022-12-13 | Modern Meadow, Inc. | Composite biofabricated material |
US11530304B2 (en) | 2016-02-15 | 2022-12-20 | Modern Meadow, Inc. | Biofabricated material containing collagen fibrils |
US11542374B2 (en) | 2016-02-15 | 2023-01-03 | Modern Meadow, Inc. | Composite biofabricated material |
EP3473647A1 (en) | 2017-06-29 | 2019-04-24 | Modern Meadow, Inc. | Yeast strains and methods for producing collagen |
US11214844B2 (en) | 2017-11-13 | 2022-01-04 | Modern Meadow, Inc. | Biofabricated leather articles having zonal properties |
US11441153B2 (en) | 2018-02-15 | 2022-09-13 | Monsanto Technology Llc | Compositions and methods for improving crop yields through trait stacking |
US12116586B2 (en) | 2018-02-15 | 2024-10-15 | Monsanto Technology Llc | Compositions and methods for improving crop yields through trait stacking |
US11352497B2 (en) | 2019-01-17 | 2022-06-07 | Modern Meadow, Inc. | Layered collagen materials and methods of making the same |
WO2020168277A1 (en) | 2019-02-14 | 2020-08-20 | Cargill, Incorporated | Brassica plants producing elevated levels of polyunsaturated fatty acids |
Also Published As
Publication number | Publication date |
---|---|
DE69836552T2 (en) | 2007-09-13 |
ES2276475T5 (en) | 2014-07-11 |
CA2305628C (en) | 2008-08-26 |
ATE346944T1 (en) | 2006-12-15 |
JP2010252820A (en) | 2010-11-11 |
DE69836552D1 (en) | 2007-01-11 |
AU9598098A (en) | 1999-04-23 |
EP1019517A2 (en) | 2000-07-19 |
WO1999016890A3 (en) | 1999-05-20 |
US7157629B2 (en) | 2007-01-02 |
US6642437B1 (en) | 2003-11-04 |
AU746032B2 (en) | 2002-04-11 |
CA2305628A1 (en) | 1999-04-08 |
DE69836552T3 (en) | 2014-10-09 |
ES2276475T3 (en) | 2007-06-16 |
JP2001518305A (en) | 2001-10-16 |
EP1019517B2 (en) | 2014-05-21 |
US20040088754A1 (en) | 2004-05-06 |
EP1019517B1 (en) | 2006-11-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1019517B1 (en) | Production of proteins in plant seeds | |
Qu et al. | Evaluation of tissue specificity and expression strength of rice seed component gene promoters in transgenic rice | |
AU2007286176B2 (en) | Production of high tryptophan maize by chloroplast targeted expression of anthranilate synthase | |
Cho et al. | Inheritance of tissue-specific expression of barley hordein promoter-uidA fusions in transgenic barley plants | |
JP2011101653A (en) | Method and composition for expression of transgene in plant | |
AU2006237346B2 (en) | Expression cassettes for seed-preferential expression in plants | |
WO2006133983A1 (en) | Starchy-endosperm and/or germinating embryo-specific expression in mono-cotyledonous plants | |
US20140127747A1 (en) | Regulation of Translation of Heterologously Expressed Genes | |
Joshi et al. | A maize α-zein promoter drives an endosperm-specific expression of transgene in rice | |
US7169967B2 (en) | Globulin-1 promoter from maize and method of using same | |
Croissant-Sych et al. | Identification of positive and negative regulatory cis-elements of the rice glutelin Gt3 promoter | |
Häkkinen et al. | Modifying seeds to produce proteins | |
US7183109B2 (en) | Embryo preferred promoter and method of using same | |
US10577620B2 (en) | Transit peptide from Arabidopsis chloroplast chaperonin 10-2 and methods of use | |
US7112723B2 (en) | Globulin 2 regulatory region and method of using same | |
Ahmadi et al. | The promoter of a metallothionein-like gene from the tropical tree Casuarina glauca is active in both annual dicotyledonous and monocotyledonous plants | |
Zhou et al. | The endosperm-specific expression of a rice prolamin chimaeric gene in transgenic tobacco plants | |
uidAnos Bhorss | 1mm lPciu lrcai | |
US8642749B2 (en) | Regulatory region preferentially expressing to seed embryo and method of using same | |
EP1882037A2 (en) | Expression cassettes for seed-preferential expression in plants |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 95980/98 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2305628 Country of ref document: CA Ref country code: CA Ref document number: 2305628 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 513959 Kind code of ref document: A Format of ref document f/p: F |
|
NENP | Non-entry into the national phase |
Ref country code: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1998949710 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1998949710 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWG | Wipo information: grant in national office |
Ref document number: 95980/98 Country of ref document: AU |
|
WWG | Wipo information: grant in national office |
Ref document number: 1998949710 Country of ref document: EP |