WO1999015639A1 - Polymorphic cag repeat-containing gene and uses thereof - Google Patents

Polymorphic cag repeat-containing gene and uses thereof Download PDF

Info

Publication number
WO1999015639A1
WO1999015639A1 PCT/CA1998/000884 CA9800884W WO9915639A1 WO 1999015639 A1 WO1999015639 A1 WO 1999015639A1 CA 9800884 W CA9800884 W CA 9800884W WO 9915639 A1 WO9915639 A1 WO 9915639A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
schizophrenia
patients
allelic variants
hgtl
Prior art date
Application number
PCT/CA1998/000884
Other languages
French (fr)
Inventor
Guy A. Rouleau
Ridha Joober
Chawki Benkelfat
Original Assignee
Mcgill University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mcgill University filed Critical Mcgill University
Priority to BR9812254-1A priority Critical patent/BR9812254A/en
Priority to JP2000512932A priority patent/JP2001517432A/en
Priority to EP98943607A priority patent/EP1015574A1/en
Priority to AU91495/98A priority patent/AU757556B2/en
Priority to CA002303106A priority patent/CA2303106A1/en
Publication of WO1999015639A1 publication Critical patent/WO1999015639A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the invention relates to hGTl gene, a polymorphic CAG repeat-containing gene and its uses thereof for the diagnosis, prognosis and treatment of psychiatric diseases, such as schizophrenia.
  • Schizophrenia is a chronic brain disorder characterized by a behavioral syndrome combining in various degrees hallucinations, delusions, social withdrawal, affective flattening, disorganized behavior and formal thought disorders. It affects up to 1% of the general population and results in a lower level of social and occupational functioning. Many recent studies indicate that schizophrenia may originate from neural cell disturbances occurring m the developing/maturing brain. Genetic factors are known to play a major role m the etiology of this disorder as demonstrated by extensive family, twin and adoption studies. However, the quest for genes conferring susceptibility to schizophrenia has been difficult and has not yielded consistent find- mgs using both association and linkage studies.
  • HVA High pre-treatment plasma levels of HVA have been shown to predict good response to neuroleptics m most of the studies.
  • Preliminary genetic epidemiological data indicate that poor or delayed response to neuroleptic treatment is associated with an increased prevalence of schizophrenia spectrum disorders m relatives of schizophrenic probands .
  • These convergent lines of evidence suggest that long term response to neuroleptic medication may be considered as a bioclinical dimension with an etio- logically relevant significance; the two extremes of this dimension being occupied by two groups of schizophrenic patients, at least partially, distinct with respect to the pathogeny of their illness.
  • One aim of the present invention is to provide a tool for the diagnosis, prognosis and treatment of psychiatric diseases, such as schizophrenia.
  • Another aim of the present invention is to detect association between allelic variants of CAG repeat -containing genes and schizophrenia or its pheno- typic variability with respect to long term response to neuroleptic medication.
  • CAG repeat instability was associated with several neurodegenerative brain diseases that display genetic anticipation, a feature believed to be present m schizophrenia
  • some ISO- lated, though promising, reports indicate that expanded CAG repeats are more prevalent m schizophrenic patients compared to normal controls
  • CAG repeats are often very polymorphic and have been found to be over represented m coding sequences of the human genome particularly those coding for DNA-bmdmg proteins/transcription factors.
  • CAG repeats or the polyglutamine stretches for which they encode
  • CAG repeats might modulate the function of the genes (or protein) they are pare of suggesting that they might be functional polymorphisms and not silent ones.
  • a hGTl gene containing transcribed polymorphic CAG repeat which comprises a sequence as set forth in Fig. 3 and Figs. 4A-4C.
  • allelic variants of CAG repeat of hGTl gene may be associated with schizophrenia, affective diseases such as manic depression, neurodevelopmental brain diseases or with phenotypic variability with respect to long term response to neuroleptic medication. More precisely, there are 5 allelic variants of
  • CAG repeat which are identified as follows:
  • a method for the prognosis of severity of schizophrenia of a patient which comprises the steps of: a) obtaining a nucleic acid sample of the patient; and b) determining allelic variants of CAG repeat of the hGTl gene, and wherein long allelic variants are indicative of severe schizophrenia.
  • the preferred nucleic acid sample used m accordance with the present invention is DNA.
  • RNA sample an additional step is carried out, which consists m using a reverse transc ⁇ ptase to transcribe the RNA into DNA.
  • allelic variants identified as short or as having between about 171 and 177 bp are associated with mild schizophrenia and long or as having between about 180 and 183 bp (referred to as 0 and 1) are associated with severe schizophrenia.
  • a method for the identification of patient responding to neuroleptic medication which comprises the steps of: a) obtaining a nucleic acid sample of the patient; and b) determining allelic variants of CAG repeat of the hGTl gene, and wherein short allelic vari- ants are indicative of neuroleptic response.
  • allelic variants identified as short or as having between about 171 and 177 bp are associated with patient capable of neuroleptic response and long or as having between about 180 and 183 bp (referred to as 0 and 1) are associated with non-response to neuroleptic medication.
  • a non-human mammal model for the hGTl gene whose germ cells and somatic cells are modified to express at least one allelic variant of the hGTl gene and wherein the allelic variant of the hGTl being introduced into the mammal, or an ancestor of the mammal, at an embryonic stage.
  • a method for the identification of patient responding to neuroleptic medication which comprises the steps of : a) obtaining a nucleic acid sample of the patient; and b) determining allelic variants of CAG repeat of the hGTl gene, and wherein short allelic variants (from about 171 to about 177 bp) are indicative of neuroleptic response.
  • a method for the screening of therapeutic agents for the prevention and/or treatment of schizophrenia which comprises the steps of: a) administering said therapeutic agents to the non-human mammal of the present invention or schizophrenia patients; and b) evaluating the prevention and/or treatment of development of schizophrenia m said mammal or said patients.
  • a method to identify genes part of or interacting with a biochemical pathway affected by hGTl gene which comprises the steps of: a) designing probes and/or primers using the hGTl gene of the present invention and screening psychiatric patients samples with said probes and/or primers; and b) evaluating the identified gene role m psychiatric patients.
  • a method of stratifying psychiatric patients based on the allelic variants of the hGTl gene for clinical trials purposes which comprises: a) obtaining a nucleic acid sample of the patients; and b) determining allelic variants of CAG repeat of the hGTl gene, wherein patients are stratified with respect to their allelic variants and wherein short allelic variants are indicative of neuroleptic response.
  • Fig. 1 illustrates the average allelic lengths of the GCT10D04 EST CAG repeat in controls, responsive (R) and non-responsive (NR) patients, showing the shorter (S) allele only, longer (L) allele only and the sum (L+S) of the two alleles m the three groups of subjects;
  • Fig. 2 illustrates the correlation between the average length of the (CAG)n polymer of the short (a) , the long (b) alleles and the sum of 2 alleles (C) and seventy of schizophrenia m the different classes of severity of the disease;
  • Fig. 3 illustrates the sequence homology between the human GCT10D04 sequence and the mouse GT1 gene; and
  • Figs. 4A-4C illustrate the nucleotide sequence of hGTl, wherein the upstream intron is m lowercase
  • Human gene sequence (exon) is m upper case; and the transcription start site ATG in bold.
  • the main objective was to detect allelic variants of CAG repeat containing genes associated with schizophrenia or its phenotypic variability with respect to the presence or absence of schizophrenia and long term response to neuroleptic medication.
  • Assessment of response to conventional neuroleptics was based on a comprehensive review of medical files according to a priori defined criteria and blind to genotyp g.
  • Genes containing polymorphic CAG repeats were identified by means of genetic sequences data base searches.
  • the GT1 sequence includes a 5535 bp open- reading frame (ORF) of 5535 bps without interruption showing 85%homology to the mouse cDNA (Figs. 4A-4C) .
  • the sequence of GT1 is from one large (5276 bp) Bam HI fragment and three Pst I fragments (672, 200 and 371 bps) .
  • This ORF is preceded by a 490 bps intron (including a consensus splice acceptor) and 19 bps of 5'-UTR.
  • the entire ORF may be coded for by a single exon (we are still missing the sequences coding for the last 12 amino acids (36 bp) .
  • NRs schizophrenic patients were recruited according to the following criteria: (1) they all met axis I diagnosis of schizophrenia, according to the Diagnostic and Statistical Manual of Mental Disorders, version IV (American Psychiatric association, Diagnos- tic and Statistical Manual of Mental Disorders, APA; 1994) (DSM-IV) , (2) they did not experience remission of psychotic symptoms within the past 2 years, (3) the preceding 5 years, all patients underwent at least 3 periods of treatment with typical neuroleptics, from at least two distinct families of drugs, at therapeutic dosage (equal to or greater than 750 mg Chlorpromazme equivalent in monotherapy or 1000 mg chlorpromazme equivalent, when a combination of neuroleptics is used) , for a continuous period of at least 6 weeks at a time, with no significant relief of symptoms, and; (4) Unable to function without supervision m all or nearly all domains of social and vocational activities with a Global Assessment Score (GAS) ⁇ 40 withm the last 12 months .
  • GAS Global Assessment Score
  • Criteria for the selection of neuroleptic Rs patients were as follows: (1) all patients met the criteria for schizophrenia according to DSM-IV, (2) all were admitted at least once to a psychiatric care facility because of acute psychotic episode, (3) during all hospitalizations, patients experienced full or partial remission response to treatment with typical neuroleptics, at recommended dosage, withm six-eight weeks of continuous treatment; remission being defined as a rapid reduction of schizophrenic symptoms with limited residual symptoms, (4) all patients were able to function with only occasional supervision in all or nearly all domains of social and vocational activities with a GAS score > 60 withm the last 12 months, (5) no patients had to be admitted to hospitals because of psychotic exacerbation, if and when compliant to treatment and treated continuously with typical neuroleptics, and; (6) at least one psychotic relapse when neuroleptic medication is reduced or interrupted. Exclu- sion criteria for schizophrenic patients were brain trauma, any neurological condition, drug or alcohol abuse in the last two years.
  • BLAST Basic Local Alignment Search Tool
  • PCR primers were designed using DNASTAR Inc. (Madison, Wisconsin) software .
  • Genom c DNA was isolated from peripheral lymphocytes using standard methods. CAG repeat -containing fragments were amplified by PCR using specific primers for each repeat . PCR was performed m a total volume of 13 ⁇ l containing 30 ng of human genomic DNA, lOmM Tris-HCl (pH 8.8), 1.5 mM MgCl 2 , 50mM KC1 , 1% Dimethyl- sulfoxide, 250 mM each of dCTP, dGTP, and dTTP, 25 mM dATP, 1.5 uCi alpha 35S-dATP, 100 ng of each primer, and 3 units of Taq polymerase (Perkm-Elmer) .
  • DNA was denatured at 94°C for 5 mm., then subjected to 30 cycles of a 1 mm. denaturation at 94°C, a 1 mm. annealing at the optimized annealing temperature for each primer pair and a 1 mm. elongation at 72°C. This was followed by a final extension at 72°C for 5 mm.
  • N LP response score 1 83 ⁇ 0 74 (58) " 6 3 ⁇ 0 67 (43)
  • Table 1 shows the demographic and clinical characteristics of the three groups of subjects Rs, NRs, and C.
  • Table 2 shows the sixteen different candidate expressed CAG repeats identified and analyzed and includes mapping, homology, and polymorphism information. Table 2: list of different studied ESTs
  • PCR indicates Polycham Reaction, RT-PCR, reverse rra ⁇ scnp ⁇ on PCR-reaction, PNQ, potenlial number of encoded polyglutanines, TF transcription factor; ER, estrogen receptor. RA. reuno c acid receptor
  • the reference point to measure the CAG repeat length is the most common allele (180 bp fragment or 14 predicted repeats), which is taken as 0. Alleles with n repeats above or below the 0 allele are scored +n or -n.
  • C indicates the control group; Rs, neuroleptic responsive schizophrenic patients group; and NRs, neuroleptic non-responsive schizophrenic patients group. A similar trend was observed for the S allele
  • At least one parent is non French Canadian
  • Allelic frequencies are given as percent of alleles shorter than 0 ( ⁇ 0) . Frequencies are analyzed according to different diagnosis groups and ethnic background of parents. All frequencies were contrasted with the frequencies of the alleles shorter than 0 in the control group.
  • SCZ indicates schizophrenic patients; Rs, neuroleptic-responsive schizophrenic patients; NRs, neuroleptic non-responsive schizophrenic patients, and; ⁇ 2 , Chi 2 statistic with 1 degree of freedom
  • the size of the CAG repeat tract is linearly related to the pattern of severity of schizophrenia (measured blindly to genotype, using a 1-5 scoring system defined as follows: (1, episodic shift) episodes of illness interspersed between periods of health or near normal - ity, (2, mild deterioration) periods of illness occur, but there are periods of return to near normality, with some ability to work at a job and near normal or normal social functioning, (3, moderate deterioration) , the subject may occasionally experience some resolution of symptoms, but overall the course is downhill culminating in a relatively sever degree of social and occupational incapacitation, (4, severe deterioration) , the subject illness has become chronic resulting in inability to maintain employment (outside of a sheltered workshop) and social impairment, and; (5, relatively stable) , the subject illness has not changed significantly (since it started at a severe level of impairment) ; the longer the size, the worse and poorer is the outcome (Gamma statistic for S, L and L+S allele
  • the GCT10D04 sequence was 84% homologous to a mouse gene (GTl, GenBank D29801, see figure 3) from which is transcribed a 7.2 kb cDNA encoding a 196 kDa protein of unknown function, suggesting that GCT10D04 represents a portion of the human homologue, which we term hGTl.
  • the murine GTl gene is inducible with retinoic acid in the mouse embryonic carcinoma cell line P19 and is expressed at highest levels in neurons but not in glial cells.
  • a sequence homology search using the GTl protein sequence identified several conserved domains in another mouse gene (stromelysin PDGF responsive element binding protein transcription factor, GenBank U20282) and in its human homologue (AR1, GenBank U19345) , suggesting that the hGTl protein may also function as a transcription factor.
  • Common allelic variants rather than rare mutations, may be responsible for the familial aggregation observed in complex diseases such as schizophrenia. Allelic variants that are neither necessary nor sufficient to cause a disease may not be identified by link- age analysis, particularly when the attributable risk is less than 10%. In contrast, association studies are sensitive to detect such variants.
  • neu- roleptic-responsive-schizophrenic patients were sig- nificantly more likely to have hGTl gene alleles with short CAG repeats as compared to patients who are characterize by long term poor response to neuroleptics and outcome. Furthermore, a significant correlation between the size of the hGTl CAG repeat and the pattern of severity of the disease (the longer is the CAG repeat the more severe is the outcome) was identified in the group of schizophrenic patients regardless of the quality of their response to neuroleptic medication.
  • association studies with a relatively small number of subjects and a potentially high number of genes to be tested is an increased risk of false positive findings (type I error) .
  • hGTl polymorphism modulates the pattern of severity of the schizophrenia phenotype but not the susceptibility to schizophrenia per se (modifier gene hypothesis)
  • hGTl gene could influence susceptibility to schizophrenia irrespective of the pattern of severity and responsiveness to neuroleptics; the weak associa- tion in the group of resistant schizophrenic patients being the result of a selection bias.
  • Transcription factors are major actors m all neurodevelopmental phases, and might be very important when developmental activity is intensive such as bram fetal development or synaptic pruning occurring m the adolescence phase of human development. They have been implicated m animal complex behavioral traits and have also a major role in the transduction pathways involved in the biological adaptation of the central nervous system to environmental changes (ranging from physical conditions such as viral infections to psychological conditions such as nurturing behavior m mice) . It is also of interest to note that all antipsychotic drugs modulate DNA transcription m specific areas of the bram and ultimately results m modifications of neu- ronal interconnec lvity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention relates to hGT1 gene, a polymorphic CAG repeat-containing gene and its uses thereof for the diagnosis, prognosis and treatment of psychiatric diseases, such as schizophrenia.

Description

POLYMORPHIC CAG REPEAT-CONTAIN ING GENE AND USES THEREOF
BACKGROUND OF THE INVENTION (a) Field of the Invention
The invention relates to hGTl gene, a polymorphic CAG repeat-containing gene and its uses thereof for the diagnosis, prognosis and treatment of psychiatric diseases, such as schizophrenia. (b) Description of Prior Art
Schizophrenia is a chronic brain disorder characterized by a behavioral syndrome combining in various degrees hallucinations, delusions, social withdrawal, affective flattening, disorganized behavior and formal thought disorders. It affects up to 1% of the general population and results in a lower level of social and occupational functioning. Many recent studies indicate that schizophrenia may originate from neural cell disturbances occurring m the developing/maturing brain. Genetic factors are known to play a major role m the etiology of this disorder as demonstrated by extensive family, twin and adoption studies. However, the quest for genes conferring susceptibility to schizophrenia has been difficult and has not yielded consistent find- mgs using both association and linkage studies. It is thought that these difficulties are m part due to heterogeneity in etiology, both of genetic and non-genetic origins, resulting in a highly variable phenotype with respect to age at onset, symptom profile, course of illness, response to medication, long term outcome and performance on neuropsychological tests .
One promising avenue to guide research m this search for genes increasing susceptibility to schizophrenia may be to distinguish patients on the basis of therapeutic response to neuroleptics . Indeed, while most schizophrenic patients are improved by neuroleptic medication, a substantial number of subjects (15 to 25%) remains severely symptomatic despite multiple and adequate neuroleptic therapeutic attempts. In contrast to this between subject variability, within subject (from one episode to the other) consistency of neuroleptic response have been reported. Clinical pre- treatment characteristics that correlate with good neuroleptic response include spontaneous high blink-rate and blink-rate decrease under Halopeπdol challenge, absence of spontaneous movement disorders, and absence of dysphoπc reaction within 24-48 hours of neuroleptic initiation. On a long term basis, it has been demonstrated that good response to neuroleptics (but not the severity of the symptoms prior to neuroleptic medica- tion) m the early stages of the disease, predicts a better outcome. Neurophysiological characteristics that correlate with good neuroleptic response include high-frequency waves and few alpha and slow waves m computerized EEG prior to the treatment with neurolep- tics, a specific profile of changes m quantified EEG spectrum under neuroleptics and high degree of elec- trodermal activity prior to neuroleptic treatment. An important number of studies indicate that dopamine neu- rotransmission is disturbed predominantly m the responsive schizophrenic patients. High pre-treatment plasma levels of HVA have been shown to predict good response to neuroleptics m most of the studies. Preliminary genetic epidemiological data indicate that poor or delayed response to neuroleptic treatment is associated with an increased prevalence of schizophrenia spectrum disorders m relatives of schizophrenic probands . These convergent lines of evidence suggest that long term response to neuroleptic medication may be considered as a bioclinical dimension with an etio- logically relevant significance; the two extremes of this dimension being occupied by two groups of schizophrenic patients, at least partially, distinct with respect to the pathogeny of their illness.
It would be highly desirable to be provided with a tool for the diagnosis, prognosis and treatment of psychiatric diseases, such as schizophrenia.
SUMMARY OF THE INVENTION
One aim of the present invention is to provide a tool for the diagnosis, prognosis and treatment of psychiatric diseases, such as schizophrenia.
Another aim of the present invention is to detect association between allelic variants of CAG repeat -containing genes and schizophrenia or its pheno- typic variability with respect to long term response to neuroleptic medication.
In accordance with the present invention, we compared the allelic frequencies of various polymorphic candidate genes between two groups of schizophrenic patients carefully screened on the basis of their long term response to typical neuroleptics (excellent responders, Rs ; non-responders, NRs) and controls. This report summarizes our finding while considering CAG containing genes as candidates for schizophrenia. This family of candidate genes was deemed attractive for the following reasons: (1) CAG repeat instability was associated with several neurodegenerative brain diseases that display genetic anticipation, a feature believed to be present m schizophrenia, (2) some ISO- lated, though promising, reports indicate that expanded CAG repeats are more prevalent m schizophrenic patients compared to normal controls, (3) CAG repeats are often very polymorphic and have been found to be over represented m coding sequences of the human genome particularly those coding for DNA-bmdmg proteins/transcription factors. These factors are impor- tant actors in the regulation of the genetic program and neurodevelopmental processes and have been implicated in several human neurodevelopmental diseases including one that may present with schizophrenia-like symptoms, and; (4) CAG repeats (or the polyglutamine stretches for which they encode) might modulate the function of the genes (or protein) they are pare of suggesting that they might be functional polymorphisms and not silent ones. In accordance with the present invention there is provided a hGTl gene containing transcribed polymorphic CAG repeat, which comprises a sequence as set forth in Fig. 3 and Figs. 4A-4C.
The allelic variants of CAG repeat of hGTl gene may be associated with schizophrenia, affective diseases such as manic depression, neurodevelopmental brain diseases or with phenotypic variability with respect to long term response to neuroleptic medication. More precisely, there are 5 allelic variants of
CAG repeat which are identified as follows:
Size of PCR Predicted No. of CAG Shortest to amplifi .ed repeats longest fragments (bp)
171 11 -3
174 12 -2
177 13 -1
180 14 0
183 15 1
In accordance with the present invention there is provided a method for the prognosis of severity of schizophrenia of a patient, which comprises the steps of: a) obtaining a nucleic acid sample of the patient; and b) determining allelic variants of CAG repeat of the hGTl gene, and wherein long allelic variants are indicative of severe schizophrenia.
The preferred nucleic acid sample used m accordance with the present invention is DNA. For RNA sample, an additional step is carried out, which consists m using a reverse transcπptase to transcribe the RNA into DNA.
More precisely, the allelic variants identified as short or as having between about 171 and 177 bp (referred to as -3, -2 and -1) are associated with mild schizophrenia and long or as having between about 180 and 183 bp (referred to as 0 and 1) are associated with severe schizophrenia.
In accordance with the present invention there is provided a method for the identification of patient responding to neuroleptic medication, which comprises the steps of: a) obtaining a nucleic acid sample of the patient; and b) determining allelic variants of CAG repeat of the hGTl gene, and wherein short allelic vari- ants are indicative of neuroleptic response.
More precisely, the allelic variants identified as short or as having between about 171 and 177 bp (referred to as -3, -2 and -1) are associated with patient capable of neuroleptic response and long or as having between about 180 and 183 bp (referred to as 0 and 1) are associated with non-response to neuroleptic medication.
In accordance with the present invention there is provided a non-human mammal model for the hGTl gene, whose germ cells and somatic cells are modified to express at least one allelic variant of the hGTl gene and wherein the allelic variant of the hGTl being introduced into the mammal, or an ancestor of the mammal, at an embryonic stage. In accordance with the present invention there is provided a method for the identification of patient responding to neuroleptic medication, which comprises the steps of : a) obtaining a nucleic acid sample of the patient; and b) determining allelic variants of CAG repeat of the hGTl gene, and wherein short allelic variants (from about 171 to about 177 bp) are indicative of neuroleptic response. In accordance with the present invention there is provided a method for the screening of therapeutic agents for the prevention and/or treatment of schizophrenia, which comprises the steps of: a) administering said therapeutic agents to the non-human mammal of the present invention or schizophrenia patients; and b) evaluating the prevention and/or treatment of development of schizophrenia m said mammal or said patients. In accordance with the present invention there is provided a method to identify genes part of or interacting with a biochemical pathway affected by hGTl gene, which comprises the steps of: a) designing probes and/or primers using the hGTl gene of the present invention and screening psychiatric patients samples with said probes and/or primers; and b) evaluating the identified gene role m psychiatric patients. In accordance with the present invention there is provided a method of stratifying psychiatric patients based on the allelic variants of the hGTl gene for clinical trials purposes, which comprises: a) obtaining a nucleic acid sample of the patients; and b) determining allelic variants of CAG repeat of the hGTl gene, wherein patients are stratified with respect to their allelic variants and wherein short allelic variants are indicative of neuroleptic response.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 illustrates the average allelic lengths of the GCT10D04 EST CAG repeat in controls, responsive (R) and non-responsive (NR) patients, showing the shorter (S) allele only, longer (L) allele only and the sum (L+S) of the two alleles m the three groups of subjects; Fig. 2 illustrates the correlation between the average length of the (CAG)n polymer of the short (a) , the long (b) alleles and the sum of 2 alleles (C) and seventy of schizophrenia m the different classes of severity of the disease; Fig. 3 illustrates the sequence homology between the human GCT10D04 sequence and the mouse GT1 gene; and
Figs. 4A-4C illustrate the nucleotide sequence of hGTl, wherein the upstream intron is m lowercase;
Human gene sequence (exon) is m upper case; and the transcription start site ATG in bold.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the present invention, the main objective was to detect allelic variants of CAG repeat containing genes associated with schizophrenia or its phenotypic variability with respect to the presence or absence of schizophrenia and long term response to neuroleptic medication.
Accordingly, CAG repeat allelic variants were compared between three groups of subjects: two groups of schizophrenic patients, one neuroleptic-responsive (Rs; n=43) and one -non-responsive (NRs; n=63), and; a group of controls screened out for DMS-IV axis I psychiatric disorders (C; n=87) . Assessment of response to conventional neuroleptics was based on a comprehensive review of medical files according to a priori defined criteria and blind to genotyp g. Genes containing polymorphic CAG repeats were identified by means of genetic sequences data base searches. The results accordance with the present invention shows that short CAG repeat allelic variants of the hGTl gene were associated with schizophrenia irrespective of neuroleptic response (% short alleles SCZ=45%; C=31%, p=0.005). This association was highly significant in Rs (52%, p=0.0009) and marginal m NRs (40%, p=0.12) groups. A statistically significant correlation (Gamma=0.37, p=0.0024) between the CAG repeat length and the overall pattern of severity of schizophrenia was also observed. Surprisingly and accordance with the present invention, CAG repeat allelic variants of the hGTl gene show strong association with neuroleptic responsive schizophrenia and length correlation with the overall pattern of severity of the disease. The GT1 sequence includes a 5535 bp open- reading frame (ORF) of 5535 bps without interruption showing 85%homology to the mouse cDNA (Figs. 4A-4C) . The sequence of GT1 is from one large (5276 bp) Bam HI fragment and three Pst I fragments (672, 200 and 371 bps) . This ORF is preceded by a 490 bps intron (including a consensus splice acceptor) and 19 bps of 5'-UTR. The entire ORF may be coded for by a single exon (we are still missing the sequences coding for the last 12 amino acids (36 bp) . While this type of genomic organization is very peculiar and not often encountered several lines of evidence suggest that these sequences represent the GT1 gene. First, the presence of a splice acceptor upstream of the ORF suggest that the pre-mRNA will be processed. Second, the chromosomal localization was determined by polymerase chain reaction (PCR) using the NIGMS somatic cell hybrid panel and two primers designed from our sequences. Sequencing of the previously described hGTl alleles showed that they code for 10 to 14 glutamines (Q) . The CAG-repeat is generally constituted of 9 to 13 CAG repetitions followed by CAA (CAG9-13CAA) with the exception of the 13Q allele which is CAGCAACAGIOCAA.
Clinical
The study was conducted between 1994 and summer 1997. Patients have been recruited in the Douglas hospital (n=82), the Clinique Jeunes Adultes of L.H. Lafontaine Hospital (n=15) and the Schizophrenia Clinic of the Royal Ottawa Hospital (n=9) . 333 schizophrenic patients were identified as potential subjects for this study. 123 patients did not meet the criteria for schizophrenia or Rs/NRs (undifferentiated response) diagnoses. 125 and 85 patients met respectively the criteria for NRs-schizophrenia and Rs-schizophrenia. 62 NRs and 42 Rs subjects were not included in the study because refusal or other exclusion criteria.
NRs schizophrenic patients were recruited according to the following criteria: (1) they all met axis I diagnosis of schizophrenia, according to the Diagnostic and Statistical Manual of Mental Disorders, version IV (American Psychiatric association, Diagnos- tic and Statistical Manual of Mental Disorders, APA; 1994) (DSM-IV) , (2) they did not experience remission of psychotic symptoms within the past 2 years, (3) the preceding 5 years, all patients underwent at least 3 periods of treatment with typical neuroleptics, from at least two distinct families of drugs, at therapeutic dosage (equal to or greater than 750 mg Chlorpromazme equivalent in monotherapy or 1000 mg chlorpromazme equivalent, when a combination of neuroleptics is used) , for a continuous period of at least 6 weeks at a time, with no significant relief of symptoms, and; (4) Unable to function without supervision m all or nearly all domains of social and vocational activities with a Global Assessment Score (GAS) < 40 withm the last 12 months .
Criteria for the selection of neuroleptic Rs patients were as follows: (1) all patients met the criteria for schizophrenia according to DSM-IV, (2) all were admitted at least once to a psychiatric care facility because of acute psychotic episode, (3) during all hospitalizations, patients experienced full or partial remission response to treatment with typical neuroleptics, at recommended dosage, withm six-eight weeks of continuous treatment; remission being defined as a rapid reduction of schizophrenic symptoms with limited residual symptoms, (4) all patients were able to function with only occasional supervision in all or nearly all domains of social and vocational activities with a GAS score > 60 withm the last 12 months, (5) no patients had to be admitted to hospitals because of psychotic exacerbation, if and when compliant to treatment and treated continuously with typical neuroleptics, and; (6) at least one psychotic relapse when neuroleptic medication is reduced or interrupted. Exclu- sion criteria for schizophrenic patients were brain trauma, any neurological condition, drug or alcohol abuse in the last two years.
All schizophrenic patients were directly interviewed by the PI, a research psychiatrist trained in the use of the Diagnostic Interview for Genetic Studies (DIGS) (Nurnberger JI et al . , Archives of General Psychiatry. 1994;51:849-59) and their medical records were comprehensively reviewed. Complementary information from the treating physician and nurses in charge of the patients and their close relatives was obtained, whenever possible. A best estimate diagnosis was established on the basis of all the available data. Responsiveness to typical neuroleptic medication was evaluated according to a 7 point's scale. The severity of symptoms and overall psychosocial functioning were assessed using the following instruments: (1) Brief Psychiatric Rating Scale (BPRS) (Woerner MG et al . , Psychopharmacology Bulletin . 1988;24:112-117), (2) the Scale for the Assessment of Negative Symptoms (SANS) , the (3) Scale for the Assessment of Positive Symptoms, (4) the GAS, (5) the Pattern of Severity Scale, a 5 point's scale assessing overall course and outcome of the disease (American Psychiatric association, Diagnos tic and Statistical Manual of Mental Disorders, Fourth Edition, American Psychiatric association, Washington D.C.; 1994), and; (7) the Pattern of Symptoms subtypes, a categorical classification of patients according to the combination and changes over the course of the disease of positive and negative symptoms (Nurnberger JI et al . , Archives of General Psychiatry. 1994 ; 51 : 849- 59) . All these evaluation tools, except the BPRS are part of the DIGS.
The control group (C) was made by healthy volunteers recruited through advertisement in local papers (n=49) and married-in individuals from a linkage study (n=38) . All subjects this group underwent a structured psychiatric interview m order to exclude those who meet DSM-IV axis I disorders. Subjects recruited through advertisement have also been screened for schizophrenia spectrum disorders and have been tightly matched for ethnic background (mother and father ethnicity) with schizophrenic patients. All, (except one responsive), patients and controls were Caucasians. All of them gave informed and written consent . The research protocol has been approved by the three hospitals ethic committee where the research took place. Genetic methods
To identify sequences potentially encoding polymorphic polyglutamme tracts, we conducted a number of Basic Local Alignment Search Tool (BLAST) (Altschul SF et al . , Journal of Molecular Biology. 1990;215:403-410) searches using the following sequences: (1) (CAG) 30 or (CAA)30 (BLASTn, unfiltered against the non-redundant nucleic acid and the expressed sequence Tag (dbEST) databases) and, (2) Q30 (BLASTp, unfiltered, against the non-redundant protein database or tBLASTn against dbEST) . Sequences containing homopolymer tracts of >7 CAG or CAA repeats or potentially encoding a tract of >12 glutamme residues were used to design PCR primers able to amplify the CAG or CAA repeats. PCR primers were designed using DNASTAR Inc. (Madison, Wisconsin) software .
Genom c DNA was isolated from peripheral lymphocytes using standard methods. CAG repeat -containing fragments were amplified by PCR using specific primers for each repeat . PCR was performed m a total volume of 13 μl containing 30 ng of human genomic DNA, lOmM Tris-HCl (pH 8.8), 1.5 mM MgCl2, 50mM KC1 , 1% Dimethyl- sulfoxide, 250 mM each of dCTP, dGTP, and dTTP, 25 mM dATP, 1.5 uCi alpha 35S-dATP, 100 ng of each primer, and 3 units of Taq polymerase (Perkm-Elmer) . DNA was denatured at 94°C for 5 mm., then subjected to 30 cycles of a 1 mm. denaturation at 94°C, a 1 mm. annealing at the optimized annealing temperature for each primer pair and a 1 mm. elongation at 72°C. This was followed by a final extension at 72°C for 5 mm.
PCR products were electrophoresed on denaturing 6% Polyacrylamide gels and visualized by autoradiogra- phy. Absolute allele sizes were estimated according to an M13 sequence ladder. Since differences in absolute allele sizes were m all cases multiples of 3 base pairs, we assumed that variations m allele sizes were due to differences m the number of trmucleotide repeat units in the amplified sequences. By conven- tion, we designated the most common allele as 0, with less common alleles as positive or negative integers according to their number of trmucleotide repeats (e.g. if allele 0 had 20 repeats, allele +2 and -2 would have respectively 22 and 18 repeats) . Analysis:
Each subject was assigned two numeric values which represent respectively the lengths of his short (S) and long (L) alleles. Under the assumption of a quantitative effect of the CAG tract length, data were initially analyzed using a non-parametric analysis of variance (Kruskal-Wallis median statistic) where the independent variable is the diagnostic status (Rs, NRs and C) and the dependent variable is the length of the CAG repeat of S, L or the sum of the two alleles. In the case of a significant overall group effect m the
ANOVA, pair-wise contrasts between the different groups were performed using the Mann and Whitney U-statistic. This approach allows to control for the inflation of type I error secondary to multiple testing. We also analyzed data by contrasting allelic frequencies in different pairs of groups using the χ2 statistic. Alleles were grouped in different classes in accordance to the pattern of results found in the analysis of variance. Since both patient and control groups include an important number of subjects with a French Canadian ethnic origin, we reanalyzed any association finding after stratifying subjects according to the ethnic origin of their parents (both parents from French Canadian origin vs . at least one parent with non-French Canadian origin) . This analysis allows to control for associations resulting from ethnically based differences in allelic frequencies (population stratification) as opposed to those attributable to the pathological condition under study (true association) .
When a particular EST showed allelic or size association with schizophrenia and/or responsiveness to medication, further analyses were performed to investigate the putative relation linking various clinical dimensions (age at onset, pattern of severity) to the length of the CAG repeat. For this purpose, we used the Gamma correlation statistic, a non parametric statistic recommended when there are many ties in the data set. Clinical dimension that were used as criteria to define the two groups of patients (GAS, severity of current symptoms, neuroleptic responsiveness scores) were not included in this analysis. Relations between categorical variables (schizophrenia subtypes of illness, pattern of symptoms) and the CAG alleles were explored by a χ2 statistic with the appropriate degree of freedom. Logistic regression was used to determine the attributable risk conferred by any EST allelic variants which showed a positive association with schizophrenia or neuroleptic responsiveness. All analyses were made using the Statistica software (Statsoft) . Table 1 Demographic and clinical characteristics of patients and controls
Non-responsιve(62) Responsive ( 3) Controls (C) (87)
M ean age in years ±SD (n) 38±7 (62) 40± 10 (43) 44± 13 (87)
Education in vears± SD (n) l l ± 2 0 (59) l l ± 2 8 (43 ) 14± 3 3 (49)
SES of HH±SD (n)' 5 ± 24 (53) 51 ± 24(41 ) 59± 20(49)
Sex, % M 74% 67% 45%
Ethnic origin FC/OB 27/35 26/17 40/47
Subtype, U/P/D/C 27/30/4/l 6/36/1/0
Mean age at C , in years ±SD (n) 18± 3 9(55)" 24± 4 8 (43)
Illness duration in vears ±SD (n) 20± 7 0 (55) 16± 8 8 (43 )
% time as m-patιent**(n) 62% (61 )" 8 2% (43)
BPRS total score ±SD (n) 49± 8 9 (53 ) " 24± 3 9 (53 )
N LP response score 1 83 ± 0 74 (58) " 6 3 ± 0 67 (43)
Pattern of seventy 4 0 ± 0 0 (55) " 1 9 ± 0 5 (43)
*SES of HH indicates socioeconomic status head of house hold, FC/OB , French Canadian/other ethnic background, U, undiffereniiated, P, paranoid, D, disorganized, C, catatonic schizophrenia, C first consultation, BPRS. Brief Psvchiati
Rating Scale, and, NLP neuroleptic ", p<0 001
Table 1 shows the demographic and clinical characteristics of the three groups of subjects Rs, NRs, and C. The two groups of patients were comparable with respect to age, level of education and socioeconomic status of the head of household. As expected, they differed significantly according to the severity of psychosis (BPRS scores, F=280, p<0.000), the percent of time spent as inpatient since their first contact with the psychiatric institution (F=81, p<0.000) and the age at first contact with psychiatric care facilities (F=47, p<0.000) .
Table 2 shows the sixteen different candidate expressed CAG repeats identified and analyzed and includes mapping, homology, and polymorphism information. Table 2: list of different studied ESTs
Sequence ID PCR RT-PCR PNQ Homology information, potential function Polymorphic Map data
11)8930 + na 15 homology with a human RNA-binding-protem - - CUG-BP/hNab50 and xenopus ETR-1 gene
R98242 - + 27 hotrology with a cAMP-responsive transcnptional - - activator regulating late gene expression
L37868 + na 21 N-θct-3 TF, POU domain TF - HCH6
U23868 + na 26 No known homology + HCH1
U238620S + na 7 possible hotrology with transporter-like - - protein (S. cercisiae)
N55395 + na 15 human zrng finger protein TF + -
L10379 + na 28 no known homology +++ -
278314 + na 20 no known homology ++++ -
X8S326 - not done 11 no known horrology na -
T90 81 - + 10 no known homology - -
L10375 - + 16 no known homology + -
X82209 + na 27 27 Q, human rml gene disrupted by a balanced ++ - translocation in merungiorra
D26155 + na 23 SWI2/SNF2, a wide range transcnpπon factor, ++ - interacts with ER and RA receptors
GCT5E11 + na 22 no known homology -H-+ HCH3
TATABF + na 39 TFIID TATA box binding protein, general transcription 1 1 1 1 - factor
GCT10D04 + na 14 homology to a mouse retinoic acid mduceble gene +++ HCH17 and stromelysin PDGF TF.
PCR indicates Polycham Reaction, RT-PCR, reverse rraπscnpϋon PCR-reaction, PNQ, potenlial number of encoded polyglutanines, TF transcription factor; ER, estrogen receptor. RA. reuno c acid receptor
Seven of the candidate sequences showed homology or identity with DNA binding domains or transcription factors. Most of the candidates (12/16) gave a PCR product with the predicted size. Candidates that amplified a larger than expected fragment or no products at all were further analyzed by RT-PCR to control for possible mtronic interruptions in the genomic DNA. Three candidates gave an RT-PCR product of the predicted size; only one was polymorphic using a small sample of chromosomes. Overall, 10/16 candidate sequences contained a polymorphic CAG repeat. Allelic frequencies of these polymorphic CAG repeats were com- pared in the four groups of subjects.
Only allelic variants of the GCT10D04 locus (primers; SCZ15 :GGGGCAGCGGGTCCAGAATCTTC, SCZ16 : TGGCCTTGCTGCCCGTAGTGCT ; annealing temperature 62°C) showed an overall significant group effect for the L allele (Kruskal-Wallis H (2, N = 194) = 12.18, p = .002); the CAG repeat average length being the shortest m the neuroleptic-responders (Rs) , intermediate the non-responders (NRs) and longest m the control group (C) (Fig. 1) .
The reference point to measure the CAG repeat length is the most common allele (180 bp fragment or 14 predicted repeats), which is taken as 0. Alleles with n repeats above or below the 0 allele are scored +n or -n. C indicates the control group; Rs, neuroleptic responsive schizophrenic patients group; and NRs, neuroleptic non-responsive schizophrenic patients group. A similar trend was observed for the S allele
(Kruskal-Wallis H (2, N= 194) = 5.32, p =0.06). Post- hoc analysis using the U-statistic showed that this global effect was mainly due to the difference between neuroleptic-responders and normal controls (C) (L allele: adjusted-Z=-3.52 , p=0.0004; S allele: adjusted- Z= -2.28, p=0.02). Resistant schizophrenic patients showed also a trend toward smaller CAG repeat average size of the L allele compared to controls (C) (adjusted-Z=-l, 68 , p=0.09). When we analyzed the sum of the two alleles, the three groups were statistically different (p=0.01) and the difference between controls and Rs was significant at the level of p=0.004 (adjusted-z=-2.8) . Further analysis were carried out, testing the hypothesis that short alleles of the GCT10D04 were more frequent schizophrenic patients. For that purpose, two distinct classes of alleles, long (0,1) and short (-3, -2, -1), were defined and allelic frequencies between the four groups were reexammed (Table 3) . - 1 !
Table 3: frequencies of the CAG Allele short vaπants of hGTl gene
Schizophrenic patients
Controls SCZ Rs NRs
Number (2n) 174 212 86 126
% of short alleles 31% 45% 52% 40% χ2 P=0.005 P=0.0009 P=0.12
Both parents are French Canadian
Number (2n) 80 106 52 54
% of short alleles 35% 47% 54% 41%
X: P=0.09 P=0.03 P=0.5
at least one parent is non French Canadian
Number (2n) 94 106 34 72
% of short alleles 28% 42% 50% 39%
X2 P=0.03 P=0.018 P=0.12
Allelic frequencies are given as percent of alleles shorter than 0 (<0) . Frequencies are analyzed according to different diagnosis groups and ethnic background of parents. All frequencies were contrasted with the frequencies of the alleles shorter than 0 in the control group. SCZ indicates schizophrenic patients; Rs, neuroleptic-responsive schizophrenic patients; NRs, neuroleptic non-responsive schizophrenic patients, and; χ2, Chi 2 statistic with 1 degree of freedom
Schizophrenic patients, irrespective of their neuroleptic response status were more likely to carry one of the short alleles compared to controls (χ2=7.6, df=l, p=0.005) . This difference was mainly due to Rs schizophrenic patients who were significantly more likely to have small alleles compared to controls (χ2=11.0, df=l; p=0.0009) and to NRs patients (χ2=3.30, df=l, p=0.07) . Neuroleptic-non responders were marginally different from controls (χ2=2.41, df=l, p=0.12). When subjects with both parents of French Canadian origin or those with at least one parent from non French Canadian origin were analyzed separately, the same pattern emerged (Rs vs . C: χ2=4.6 , df=l, p=0.03; schizophrenics vs . C: χ2=2.7, df=l, p=0.09).
Finally, a correlation analysis indicated that the size of the CAG repeat tract is linearly related to the pattern of severity of schizophrenia (measured blindly to genotype, using a 1-5 scoring system defined as follows: (1, episodic shift) episodes of illness interspersed between periods of health or near normal - ity, (2, mild deterioration) periods of illness occur, but there are periods of return to near normality, with some ability to work at a job and near normal or normal social functioning, (3, moderate deterioration) , the subject may occasionally experience some resolution of symptoms, but overall the course is downhill culminating in a relatively sever degree of social and occupational incapacitation, (4, severe deterioration) , the subject illness has become chronic resulting in inability to maintain employment (outside of a sheltered workshop) and social impairment, and; (5, relatively stable) , the subject illness has not changed significantly (since it started at a severe level of impairment) ; the longer the size, the worse and poorer is the outcome (Gamma statistic for S, L and L+S alleles respectively: 0.25, p=0.01; 0.37, p= 0.002; 0.29, p=0.002) (Fig. 2) .
To evaluate the proportion of variance attributable to the CAG polymorphism in the phenotype responsive schizophrenia (as contrasted to the phenotype nor- mal controls) , we performed a logistic regression where the S and L alleles were the independent variables. This analysis indicate that the length of the two alleles contribute 10 % to the variance of this phenotype. A sequence homology search was performed using the GCT10D04 nucleic acid sequence (GenBank ace. no. G09710) against the non-redundant nucleic acid database (BLASTn, GenBank) . The GCT10D04 sequence was 84% homologous to a mouse gene (GTl, GenBank D29801, see figure 3) from which is transcribed a 7.2 kb cDNA encoding a 196 kDa protein of unknown function, suggesting that GCT10D04 represents a portion of the human homologue, which we term hGTl. The murine GTl gene is inducible with retinoic acid in the mouse embryonic carcinoma cell line P19 and is expressed at highest levels in neurons but not in glial cells. A sequence homology search using the GTl protein sequence identified several conserved domains in another mouse gene (stromelysin PDGF responsive element binding protein transcription factor, GenBank U20282) and in its human homologue (AR1, GenBank U19345) , suggesting that the hGTl protein may also function as a transcription factor. Common allelic variants, rather than rare mutations, may be responsible for the familial aggregation observed in complex diseases such as schizophrenia. Allelic variants that are neither necessary nor sufficient to cause a disease may not be identified by link- age analysis, particularly when the attributable risk is less than 10%. In contrast, association studies are sensitive to detect such variants.
To identify genes that may confer susceptibility to schizophrenia and/or its phenotypic variability with respect to neuroleptic responsiveness, we recruited patient according to their long term responsiveness to neuroleptic medication, a strategy that might reduce the putative genetic heterogeneity of schizophrenia. Control and patient groups were stratified according to the ethnic background of parents; thus reducing the risk of population stratification bias.
In accordance with the present invention, neu- roleptic-responsive-schizophrenic patients were sig- nificantly more likely to have hGTl gene alleles with short CAG repeats as compared to patients who are characterize by long term poor response to neuroleptics and outcome. Furthermore, a significant correlation between the size of the hGTl CAG repeat and the pattern of severity of the disease (the longer is the CAG repeat the more severe is the outcome) was identified in the group of schizophrenic patients regardless of the quality of their response to neuroleptic medication. One major limitation of association studies with a relatively small number of subjects and a potentially high number of genes to be tested is an increased risk of false positive findings (type I error) . In this study, we focused on candidate genes containing expressed and polymorphic CAG repeats, thus markedly reducing the number of genes to be tested; the number of CAG repeats is thought to be around 700 in the total human genome. Polymorphic CAG repeats containing transcripts might be much less represented. Based on these numbers, the Bonferroni corrected p-value for our tested hypothesis ought to be between 2x 10"4 and 7xl0"5. In our study, and in spite of the small sample sizes, short alleles were likely to be more frequent in responsive schizophrenia compared to controls at a p- value of 9xl0"4, which is suggestive of a true association in the case of a complex disease such as schizophrenia. Moreover, the fact that the association is detected in an ethnically very homogenous subgroup (both parents French Canadians) as well as in a mixed subgroup (at least one parent is non French Canadian) , suggests that this allelic association is very likely not to be due to stratified population bias. Furthermore, the fact that hGTl gene has a high homology with a mouse gene involved m neural cell differentiation induced by retinoic acid is consistent with both the neurodevelopmental and retinoic acid hypotheses of schizophrenia .
Patients who presented with episodic shifts and good between-episode recovery were more likely to have shorter CAG repeats m both of their hGTl alleles. This finding could be interpreted m various different ways: (1) it could indicate that hGTl short alleles have a causative effect the disease of patients with favorable outcome (good between episodes recovery, slow pro- gression of functional deficits) whereas resistant patients with sever pattern of severity (contmuos psychosis, no psychotic free episodes, rapid decline of psychosocial functioning) have other genetic or environmental factors involved in their disease. Patients falling between these two levels of severity may be a more mixed group difficult to relate to either one of the two extremes using clinical criteria (heterogeneity hypothesis), (2) it could indicate that the hGTl polymorphism modulates the pattern of severity of the schizophrenia phenotype but not the susceptibility to schizophrenia per se (modifier gene hypothesis) , and (3) ; hGTl gene could influence susceptibility to schizophrenia irrespective of the pattern of severity and responsiveness to neuroleptics; the weak associa- tion in the group of resistant schizophrenic patients being the result of a selection bias. Indeed, should another gene with a higher attributable risk than the hGTl be acting m the resistant form, the enrichment of hGTl short alleles m non-responsive patients with severe pattern of the disease would be relaxed and the association would be more difficult to identify this group. In accordance with this hypothesis, family studies have suggested that neuroleptic-delayed response and marked deterioration in the psychosocial functioning are associated with a higher degree of familial aggregation of the disease; suggesting the presence of gene(s) with relatively high penetrance.
Transcription factors are major actors m all neurodevelopmental phases, and might be very important when developmental activity is intensive such as bram fetal development or synaptic pruning occurring m the adolescence phase of human development. They have been implicated m animal complex behavioral traits and have also a major role in the transduction pathways involved in the biological adaptation of the central nervous system to environmental changes (ranging from physical conditions such as viral infections to psychological conditions such as nurturing behavior m mice) . It is also of interest to note that all antipsychotic drugs modulate DNA transcription m specific areas of the bram and ultimately results m modifications of neu- ronal interconnec lvity. Variable number of tandem repeats, including trmucleotide repeats, have been found to be over represented in genes coding for DNA- binding proteins/transcription factors. Such repeats may be the basis of a fine modulation of gene activity. We speculate that one or multiple transcription factors might be involved m the etiology of schizophrenia or its phenotypic variability (including the quality of the response to different drugs) . It is therefore of interest to consider transcription factors containing polymorphic CAG repeats as a putative candidate "family of genes" for schizophrenia and other psychiatric disorders thought to be of a neurodevelopmental origin. The present invention will be more readily understood by referring to the following examples which are given to illustrate the invention rather than to limit its scope. While the invention has been described m connection with specific embodiments thereof, it will be understood that t is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, general, the principles of the invention and including such departures from the present disclosure as come withm known or customary practice withm the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth, and as follows m the scope of the appended claims .

Claims

The embodiments of the invention m which an exclusive property or privilege is claimed are defined as follows :
1. A hGTl gene containing transcribed polymorphic CAG repeat, which comprises a sequence as set forth in Fig. 3 and Figs. 4A-4C.
2. The gene of claim 1, wherein allelic variants of CAG repeat are associated with schizophrenia, affective disorders, neurodevelopmental bra diseases or with phenotypic variability with respect to long term response to neuroleptic medication.
3. The gene of claim 2, wherein said affective disorder is manic depression.
4. A method for the prognosis of severity of schizophrenia of a patient, which comprises the steps of: a) obtaining a nucleic acid sample of said patient; and b) determining allelic variants of CAG repeat of the gene of claim 1, and wherein short allelic variants are indicative of non-severe schizophrenia.
5. A method for the identification of patient responding to neuroleptic medication, which comprises the steps of: a) obtaining a nucleic acid sample of said patient; and b) determining allelic variants of CAG repeat of the gene of claim 1, and wherein short allelic variants are indicative of neuroleptic response.
6. The method of claim 5, wherein said short allelic variants have from about 171 to about 177 bp in length.
7. A non-human mammal model for the hGTl gene of claim 1, whose germ cells and somatic cells are modified to express at least one allelic variant of the hGTl gene and wherein said allelic variant of the hGTl being introduced into the mammal, or an ancestor of the mammal, at an embryonic stage.
8. A method for the screening of therapeutic agents for the prevention and/or treatment of schizophrenia, which comprises the steps of: a) administering said therapeutic agents to the non-human mammal of claim 7 or schizophrenia patients; and b) evaluating the prevention and/or treatment of development of schizophrenia in said mammal or said patients.
9. A method to identify genes part of or interacting with a biochemical pathway affected by hGTl gene, which comprises the steps of: a) designing probes and/or primers using the hGTl gene of claim 1 and screening psychiatric patients samples with said probes and/or primers ; and b) evaluating the identified gene role in psychiatric patients.
10. A method of stratifying psychiatric patients based on the allelic variants of the hGTl gene of claim 1 for clinical trials purposes, which comprises: a) obtaining a nucleic acid sample of said patients; and b) determining allelic variants of CAG repeat of the gene of claim 1, wherein patients are stratified with respect to their allelic variants and wherein short allelic variants are indicative of neuroleptic response.
PCT/CA1998/000884 1997-09-19 1998-09-18 Polymorphic cag repeat-containing gene and uses thereof WO1999015639A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
BR9812254-1A BR9812254A (en) 1997-09-19 1998-09-18 Polymorphic cag gene of contained repetition and its uses
JP2000512932A JP2001517432A (en) 1997-09-19 1998-09-18 Genes containing polymorphic CAG repeats and uses thereof
EP98943607A EP1015574A1 (en) 1997-09-19 1998-09-18 Polymorphic cag repeat-containing gene and uses thereof
AU91495/98A AU757556B2 (en) 1997-09-19 1998-09-18 Polymorphic CAG repeat-containing gene and uses thereof
CA002303106A CA2303106A1 (en) 1997-09-19 1998-09-18 Polymorphic cag repeat-containing gene and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CA 2216057 CA2216057A1 (en) 1997-09-19 1997-09-19 Polymorphic cag repeat-containing gene, diagnosis of psychiatric diseases and therapeutic uses thereof
CA2,216,057 1997-09-19

Publications (1)

Publication Number Publication Date
WO1999015639A1 true WO1999015639A1 (en) 1999-04-01

Family

ID=4161505

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA1998/000884 WO1999015639A1 (en) 1997-09-19 1998-09-18 Polymorphic cag repeat-containing gene and uses thereof

Country Status (6)

Country Link
EP (1) EP1015574A1 (en)
JP (1) JP2001517432A (en)
AU (1) AU757556B2 (en)
BR (1) BR9812254A (en)
CA (1) CA2216057A1 (en)
WO (1) WO1999015639A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008143A2 (en) * 1998-08-07 2000-02-17 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Gene isolated on the short arm of human chromosome 17
WO2002020850A2 (en) * 2000-09-08 2002-03-14 Iowa State Universtiy Research Foundation, Inc. Novel prkag3 alleles and use of the same as genetic markers for reproductive and meat quality traits
WO2004050913A1 (en) * 2002-12-02 2004-06-17 Amarin Neuroscience Limited Treatment of huntington’s disease with epa
WO2008032056A2 (en) * 2006-09-16 2008-03-20 Genophrenix Limited Dopamine receptor interacting proteins as markers for disease

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995001437A2 (en) * 1993-06-29 1995-01-12 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
WO1997018825A1 (en) * 1995-11-17 1997-05-29 The University Of British Columbia PROTEIN WHICH INTERACTS WITH THE HUNTINGTON'S DISEASE GENE PRODUCT, cDNA CODING THEREFOR, AND ANTIBODIES THERETO

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995001437A2 (en) * 1993-06-29 1995-01-12 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
WO1997018825A1 (en) * 1995-11-17 1997-05-29 The University Of British Columbia PROTEIN WHICH INTERACTS WITH THE HUNTINGTON'S DISEASE GENE PRODUCT, cDNA CODING THEREFOR, AND ANTIBODIES THERETO

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
IMAI, Y. ET AL.: "Cloning of a retinoic acid-induced gene, GT1, in the embryonal carcinoma cell line P19: neuron-specific expression in the mouse brain", MOLECULAR BRAIN RESEARCH, XP002093328 *
JOOBER, R. ET AL.: "Apolipoprotein E genotype in Schizophrenia", AMERICAN JOURNAL OF MEDICAL GENETICS (NEUROPSYCHIATRIC GENETICS), vol. 67, no. 2, 9 April 1996 (1996-04-09), pages 235, XP002093331 *
MACIEL, P. ET AL.: "Correlation between CAG repeat length and clinical features in Machado-Joseph Disease", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 57, no. 1, July 1995 (1995-07-01), pages 54 - 61, XP002093330 *
PHILIBERT, R.A. ET AL.: "The characterization and sequence analysis of thirty CTG-repeat containing genomic cosmid clones", EUROPEAN JOURNAL OF HUMAN GENETICS, vol. 6, no. 1, January 1998 (1998-01-01), pages 89 - 94, XP002093332 *
ROBITAILLE, Y. ET AL.: "The neuropathology of CAG repeat diseases: review and update of genetic and molecular features", BRAIN PATHOLOGY, vol. 7, no. 3, July 1997 (1997-07-01), pages 901 - 926, XP002093329 *
TURECKI, G. ET AL.: "Schizophrenia and chromosome 6p", AMERICAN JOURNAL OF MEDICAL GENETICS, vol. 74, no. 2, 1997, pages 195 - 198, XP002093333 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008143A2 (en) * 1998-08-07 2000-02-17 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Gene isolated on the short arm of human chromosome 17
WO2000008143A3 (en) * 1998-08-07 2000-06-15 Deutsches Krebsforsch Gene isolated on the short arm of human chromosome 17
WO2002020850A2 (en) * 2000-09-08 2002-03-14 Iowa State Universtiy Research Foundation, Inc. Novel prkag3 alleles and use of the same as genetic markers for reproductive and meat quality traits
WO2002020850A3 (en) * 2000-09-08 2003-08-07 Univ Iowa State Res Found Inc Novel prkag3 alleles and use of the same as genetic markers for reproductive and meat quality traits
US6919177B2 (en) 2000-09-08 2005-07-19 Iowa State University Research Foundation, Inc. PRKAG3 alleles and use of the same as genetic markers for reproductive and meat quality traits
WO2004050913A1 (en) * 2002-12-02 2004-06-17 Amarin Neuroscience Limited Treatment of huntington’s disease with epa
WO2008032056A2 (en) * 2006-09-16 2008-03-20 Genophrenix Limited Dopamine receptor interacting proteins as markers for disease
WO2008032056A3 (en) * 2006-09-16 2008-07-17 Genophrenix Ltd Dopamine receptor interacting proteins as markers for disease

Also Published As

Publication number Publication date
BR9812254A (en) 2002-07-09
EP1015574A1 (en) 2000-07-05
AU9149598A (en) 1999-04-12
CA2216057A1 (en) 1999-03-19
AU757556B2 (en) 2003-02-27
JP2001517432A (en) 2001-10-09

Similar Documents

Publication Publication Date Title
Martucci et al. N-methyl-D-aspartate receptor NR2B subunit gene GRIN2B in schizophrenia and bipolar disorder: Polymorphisms and mRNA levels
Rietschel et al. Genome-wide association-, replication-, and neuroimaging study implicates HOMER1 in the etiology of major depression
Aoki-Suzuki et al. A family-based association study and gene expression analyses of netrin-G1 and-G2 genes in schizophrenia
Wishart et al. COMT Val158Met genotype and individual differences in executive function in healthy adults
Lappalainen et al. Association between alcoholism and γ‐amino butyric acid α2 receptor subtype in a Russian population
Billett et al. Obsessive compulsive disorder, response to serotonin reuptake inhibitors and the serotonin transporter gene
Zimoń et al. Dominant GDAP1 mutations cause predominantly mild CMT phenotypes
Michelon et al. Association study of the INPP1, 5HTT, BDNF, AP-2β and GSK-3β GENE variants and restrospectively scored response to lithium prophylaxis in bipolar disorder
Domschke Clinical and molecular genetics of psychotic depression
Mancama et al. Investigation of promoter variants of the histamine 1 and 2 receptors in schizophrenia and clozapine response
Wood et al. Significant support for DAO as a schizophrenia susceptibility locus: examination of five genes putatively associated with schizophrenia
Weber et al. The genetic contribution of the NO system at the glutamatergic post-synapse to schizophrenia: further evidence and meta-analysis
US20150278438A1 (en) Genetic predictors of response to treatment with crhr1 antagonists
Hattori et al. Identification of a compound short tandem repeat stretch in the 5′-upstream region of the cholecystokinin gene, and its association with panic disorder but not with schizophrenia
Yen et al. Association study of serotonin transporter gene VNTR polymorphism and mood disorders, onset age and suicide attempts in a Chinese sample
Barral et al. Linkage analyses in Caribbean Hispanic families identify novel loci associated with familial late-onset Alzheimer's disease
Karayiorgou et al. Schizophrenia genetics: uncovering positional candidate genes
Mahieu et al. No association between bipolar affective disorder and a serotonin receptor (5-HT2A) polymorphism
JP2020089370A (en) Method for predicting onset of extrapyramidal symptoms (eps) induced by antipsychotic-based treatment
Zhang et al. Association analysis of ZNF804A (zinc finger protein 804A) rs1344706 with therapeutic response to atypical antipsychotics in first-episode Chinese patients with schizophrenia
Giri et al. Genetic screening of THAP1 in primary dystonia patients of India
Vázquez-Bourgon et al. A disrupted-in-Schizophrenia 1 gene variant is associated with clinical symptomatology in patients with first-episode psychosis
Hashimoto et al. The breakpoint cluster region gene on chromosome 22q11 is associated with bipolar disorder
Rothe et al. Association study of serotonin-2A receptor gene polymorphism and panic disorder in patients from Canada and Germany
Paisán‐Ruiz et al. Homozygosity mapping through whole genome analysis identifies a COL18A1 mutation in an Indian family presenting with an autosomal recessive neurological disorder

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Kind code of ref document: A

Ref document number: 2303106

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: PA/a/2000/002726

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 1998943607

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 91495/98

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 09508821

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1998943607

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1998943607

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 91495/98

Country of ref document: AU