WO1999006570A2

WO1999006570A2 - Plasmids

Info

Publication number: WO1999006570A2
Application number: PCT/EP1998/005007
Authority: WO
Inventors: Andrew Peter Goldsbrough
Original assignee: Unilever Plc; Unilever N.V.
Priority date: 1997-07-29
Filing date: 1998-07-27
Publication date: 1999-02-11
Also published as: AU9161998A; WO1999006570A3

Abstract

Recombinant plasmids comprising a non-selectable marker, their propagation in the absence of selection pressure and their use in genetic modification techniques are disclosed.

Description

PLASMIDS

Field of the Invention

This invention relates to recombinant DNA constructs, a method for their propagation at high levels and their use in genetic modification techniques. In particular, it relates to recombinant plasmids which do not contain genes which act as selectable markers in a microbial host and their propagation in such a microbial host in the absence of selective pressure.

Background of the Invention Plasmids are nucleic acid molecules which have an origin of replication and are autonomously replicating (i.e. do not rely on replication of the host cell chromosome in order to replicate) and so are distinguishable from transposons, which molecules comprise sequences which cause the transposon to become stably integrated into the host cell genome. Presently, the identification and separation of cells which have been transformed by the introduction of a cloning vector such as a plasmid is typically achieved by incorporating within the vector a marker known as a selectable marker. Selectable markers allow transformed cells to be isolated from those which have not taken up the vector by virtue of their ability to survive on selective media which are inhibitory to growth or lethal to non- transformed cells. Commonly, a gene coding for a protein conferring resistance to a biocide, particularly an antibiotic such as ampicillin or kanamycin, is incorporated into the vector. Non-transformed cells cultured in a growth medium containing the biocide will selectively be killed, whereas the transformed cells will survive. In addition to providing a method of identifying and separating transformed cells, the presence in the plasmid of a selectable marker ensures that transformed cells cultured in the appropriate selective medium experience selection pressure to maintain the plasmid. In the absence of such selection, it generally would be expected that the plasmid would progressively be lost from the cell population over the course of successive cell divisions, as the plasmid would not be conferring any selective advantage. Replication of the plasmid at a reasonable copy number in the course of successive cell divisions is, of course, highly advantageous where isolation of the plasmid on a preparative scale for subsequent use in genetic manipulation techniques is desired. Accordingly, where a plasmid is desired to be introduced into a non-microbial host, it is conventional to carry out any preliminary genetic manipulation in a microbial host because of convenience (e.g. ease of DNA extraction from the nicrobial host) and then to propagate the desired plasmid on a large scale in an intermediate microbial host to produce large amounts of the plasmid before its introduction into the final, non-microbial host.

The use of selectable marker genes to facilitate cloning and detection of plasmids in bacteria is not without its problems. Concern has been expressed, for example, that the widespread use of antibiotic selection markers in the preparation of plasmids intended for transformation into host plant cells and subsequent regeneration of transformed material into whole plants expressing resistance could lead to the general spread of antibiotic resistance in the environment, with the risk that commonly used antibiotics would be rendered less effective. However, if one attempts to use a plasmid without a selectable marker (and thus, without the possibility of exerting selective pressure for retention of the plasmid) it is to be expected that the plasmid will be lost from the transformed microbial intermediate host. This problem is mentioned, for example, by Lorenzo (1994 Trends in Biotechnology 12, 365-371) who states (p 367) "Although the substitution of such markers with non-antibiotic alternatives ... is straightforward, it does not solve the problems of plasmid instability in the absence of selective pressure" .

A number of suggestions to overcome this problem of instability have been proposed in the prior art. Mostly these centre on the use of transposon-based vectors, which can stably integrate into the host cell chromosome. Thus, for example, Lorenzo (cited above) with reference to transformation of genetically modified organisms (GMOs) to be released into the environment, describes a Tn5-based minitransposon vector. The vector is maintained in an intermediate bacterial host in a plasmid vector (pGP704) under selective pressure (pGP704 comprises the bla β- lactamase antibiotic resistance selectable marker gene) , but when introduced into the GMO host the minitransposon portion "jumps" from the plasmid into the host cell chromosome. A particular embodiment of this system is disclosed in which a kanamycin resistance marker gene, present in the transposon vector, is excisable by use of the ParA enzyme system in the GMO host. Broadly similar transposon-based vectors have been disclosed by Cebolla et al , (1993 Appl. Env. Microbiol. 59, 2511-2519). Transposon-based vectors are not generally suitable for use in transforming eukaryotic final host cells. Accordingly, there is a need for the development of a method for isolating, identifying and propagating transformed microbial cells which does not rely upon the use of conventional selectable markers, such as antibiotic resistance markers, in the cloning vehicle and hence avoids potential problems arising from expression of the selected trait in the final recombinant host.

Summary of the Invention It has surprisingly been found that host cells, transformed with a plasmid incorporating a marker which allows transformed cells to be distinguished and isolated from untransformed cells by a method which does not involve inhibition of the growth of the untransformed cells, can be propagated on a large scale with retention of the plasmid. In this way, the use of selectable markers, including antibiotic resistance markers, may be avoided.

In a first aspect the invention provides a plasmid for propagation in an intermediate host, prior to introduction into a final host, the plasmid comprising a non-selectable marker that confers an identifiable characteristic on the intermediate host, which conferred characteristic enables transformed intermediate host cells to be distinguished from untransformed intermediate host cells, and wherein the plasmid does not comprise a marker gene which can provide the basis for selection in the intermediate host.

In a second aspect the invention provides a method of propagating in an intermediate host a plasmid for introduction into a final host, the method comprising the steps of:

(a) introducing the plasmid into the intermediate host, the plasmid comprising a non-selectable marker that confers an identifiable characteristic on the intermediate host, which conferred characteristic enables transformed intermediate host cells to be distinguished from untransformed intermediate host cells, and wherein the plasmid does not comprise a marker gene which can provide the basis for selection in the intermediate host;

(b) identifying transformed host cells on the basis of the conferred identifiable characteristic; and

(c) growing the transformed intermediate host, in the absence of selective pressure, to cause replication of the plasmid.

In a third aspect the invention provides a method of obtaining a transformed final host cell, the method comprising the steps of:

(a) propagating a plasmid according to the method of the second aspect of the invention;

(b) extracting the plasmid from the grown transformed intermediate host; and (c) introducing the replicated plasmid into the final host cell.

In a further aspect, the invention provides a method for propagating a transformed host cell in a growth medium wherein the medium does not actively inhibit the growth of untransformed cells.

The invention also provides a method for obtaining plant cells into which additional DNA has been inserted comprising transforming plant cells with a plasmid according to the invention. Plants generated from plant cells incorporating said recombinant cloning plasmid and progeny of such plants are also provided. Techniques for the generation of plantlets from transformed plant cells are well known to those skilled in the art.

As used herein a plasmid is an autonomously replicating agent, comprising nucleic acid into which additional nucleic acid can or has been inserted. Methods of constructing plasmids are well known to those of average skill in the art and are described, for example, in Sambrook et al. 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press (hereinafter "Sambrook").

A marker is any sequence which confers an identifiable characteristic on the host cell into which it is introduced, wherein the conferred characteristic provides the basis for identifying the cell. A selectable marker provides for the selection of transformed cells based on their ability to survive on selective media. A non- selectable marker, by contrast, does not rely upon the selective inhibition of growth of untransformed cells as the means of distinguishing transformed cells.

The present invention may be more fully understood by reference to the following description, when read together with the accompanying drawings in which:

Figure 1 shows a map of plasmid pUC19

Figure 2 shows a map of plasmid pPBI97-2

Figure 3 shows a map of plasmid pPBI96-35

Figure 4 shows a map of plasmid pPBI96-40

Figure 5 shows a map of plasmid pPBI96-46 Figure 6 shows a map of plasmid p97-2B

Figure 7 shows a map of plasmid p97-2CWTl

Figure 8 shows a map of plasmid p97-2BUbiNos

Figure 9 shows a map of plasmid p97-2B-UN

Figure 10 shows a map of plasmid p97-2BUbiBAR Figure 11 shows a map of plasmid p97-29A^~, and Figure 12 is a photograph of a Southern blot demonstrating stable integration of a gene of interest into a transformed plant

The maps of Figures to 1 to 11 show (where present) the approximate positions of the ampicillin marker, origin of replication, LacZ gene, plant selectable marker gene and polylinker, and gene of interest (not all of the plasmids comprise all of these features) .

The present invention is based on the unexpected finding that bacterial cells transformed with a plasmid can be both identified and propagated with retention of the construct in the absence of selection based on inhibition of the growth of non-transformed cells. Given that transformation efficiency is very low, it has previously generally been held that in order to detect the few transformed cells which have acquired the plasmid against the background of the vast numbers of untransformed cells, selective pressure in favour of the transformed cells is necessary, hence the development of methods for identifying and separating transformed cells based on biocide resistance as discussed above. It would also generally be expected that selection pressure would be important for propagation of the plasmid in high yield over the course of successive cell divisions.

Conveniently the intermediate host is a microbial organism (bacterium, virus, yeast or fungus) . Advantageously the intermediate host is a prokaryotic organism (bacterium) and the final host is a eukaryotic organism (especially a plant or part thereof such as a plantlet or plant cell[s]). A large number of bacteria are commonly used in the laboratory for propagation of plasmids (e.g. E. coli ) , and any of these may be a suitable intermediate host for use in the present invention.

Methods of introducing plasmid DNA into intermediate or final hosts are well known to those skilled in the art (see Sambrook et al) and form no part of the present invention. Such methods include transformation, transfection, transduction, electroporation, and "biolistic" delivery methods .

The plasmid for use according to the invention is preferably a plasmid based on the Col El origin of replication. A particularly suitable plasmid provided according to the invention is pPBI97-2 which is derived from the well known and commercially available plasmid cloning vector pUC19 (Yanish-Perron et al, (1985), Gene, 33 , 103-119) . Alternative origins of replication which may be suitable for inclusion in a plasmid in accordance with the invention are the yeast 2 micron circle origin of replication, the Bovine papilloma virus origin of replication, and the M13 origin of replication (recognised in E. coli ) .

The non-selectable marker for use according to the invention may be any marker which does not rely upon the inhibition of growth of untransformed cells as the basis for identifying the transformed cell. Conveniently, a non- selectable marker is chosen which enables the desired transformed cells to be identified on the basis of their visual appearance, under appropriate culture conditions but it will be appreciated that the invention extends to the use of markers which do not directly give rise to changes in appearance of transformed cells, such as vector-specific DNA sequences which may be detected through colony hybridisation with a suitably labelled oligonucleotide probe .

In a particularly preferred embodiment according to the invention, the non-selectable marker chosen confers a colour change on the transformed cell, thereby enabling readily visual identification of transformed cells.

A change in visual appearance in the absence of selection pressure has been used as the basis for distinguishing cells infected with a virus, such as the bacteriophage M13 , from uninfected cells (Marvin et al, 1969, Bacteriol, Rev., 33, 172-209). Here, the retardation of bacterial growth resulting from viral infection can be visualised against a background lawn of non-infected cells. This would not lead to the expectation that cells transformed with plasmids could be identified and propagated simply using a visual marker in the absence of selection pressure as the skilled person would not consider plasmids comparable with viruses or bacteriophage.

Markers conferring a change in visual appearance, in the presence of an appropriate substrate if required which could suitably be incorporated in a plasmid according to the invention are known in the art and within reach of the average skilled worker. One such detection system is the LacZ system (Messing et al, 1977, Proc. Natl .Acad. Sci . USA (94) : 3642-3646) which is widely used to distinguish cells transformed with recombinant vectors from those transformed with non-recombinant vectors on the basis of the observed colour change in the presence of the chromogenic substrate X-gal . The LacZ detection system has not previously been used to identify cells transformed with plasmid from untransformed cells in the absence of selection pressure. In preferred embodiments the plasmids to which the present invention relates comprise a marker gene which provides the basis for selection of transformed final host cells but which cannot be used as selectable markers in the intermediate host. The selectable marker gene may be, for example, one which confers resistance to a substance which is toxic to the final host but which has no effect on the intermediate host (and therefore the substance cannot be used to exert selective pressure in the intermediate host) . Alternatively the selectable marker gene may be one which cannot be expressed in the intermediate host (e.g. because it comprises a promoter sequence which is not active in the intermediate host but which is active in the final host) .

Where the final host is a plant or plant cell, a number of suitable selectable marker genes are available, including: nptll (resistance to Kanamycin, G418 and neomycin) ; Ble (resistance to bleomycin and phleomycin) ; dhfr (resistance to methotrexate) ; cat (resistance to chloramphenicol) ; and bar (resistance to the herbicides phosphinothricin and bialophos) . Other selectable marker genes for plant transformation are disclosed by Yoder & Goldsbrough (1994 Bio/Technology 12, 263-267) . These genes either do not confer resistance to a relevant substance for a prokaryotic intermediate host, or else may be linked to a eukaryotic- specific or plant-specific promoter which is not active in a prokaryotic intermediate host. Preferred plant selectable marker genes for selection of transformed final host cells are npt II and bar.

In addition to marker genes which may be selectable in the final host, the plasmids of the invention or of use in the method of the invention will typically comprise a sequence of interest. The sequence of interest may desirably comprise a gene of interest to be expressed (in the sense or antisense orientation) in the final host cell.

Plasmids in accordance with, or for use in the method of, the invention preferably comprise one or more cloning sites (e.g. for insertion of a sequence of interest) . The cloning site(s) may conveniently take the form of a polylinker, that is a sequence containing multiple adjacent restriction sites, so as to allow flexibility in cloning. Appropriate cloning sites which may suitably be employed will be readily apparent to the average skilled worker based on the general knowledge in the art. Conveniently, the multiple cloning region of the cloning vector pBluescript (available from Stratagene - La Jolla, California) may be used. It will be appreciated that the cloning site or sites in the plasmid according to the invention should be positioned such that insertion of additional DNA into the site(s) does not prevent detection of any markers present on the plasmid.

It will be appreciated that although the present invention calls for the use of a non-selectable marker, markers which are selectable in the intermediate host may conveniently be incorporated in precursors for use in the various genetic manipulation steps involved in constructing the desired recombinant plasmids, provided that they are ultimately removed prior to use in the method according to the invention. Incorporating a selectable marker in the precursors renders the process of selecting transformed intermediate host cells in the preliminary manipulation steps less time-consuming whilst its absence in the constructs of the invention that are ultimately produced avoids the problems associated with the presence of selectable markers in recombinant products as identified above .

Suitable intermediate host selectable markers which may be employed in this way are well known in the art and include, for example, genes coding for a protein conferring resistance to an antibiotic such as ampicillin or kanamycin.

In order that the intermediate host selectable marker may readily be removed at the appropriate stage in the genetic manipulation it may conveniently be flanked by a pair of restriction enzyme cleavage sites, which may be complementary or different provided that they can be treated to permit ligation to each other, such that excision of the marker and re-ligation of the plasmid would generate the plasmid according to the invention. Suitably, the restriction enzyme chosen should have a rarely occurring recognition sequence so that there are unlikely to be additional such sites in the constructs of the invention which would interfere with this process. It will be appreciated that in order to further minimise the chances of an interfering site being present, it would be advantageous to include one or more alternative sets of different restriction sites with different rarely occurring recognition sequences. Should an interfering site be present, the plasmid may readily be modified by the average skilled person to avoid the interference for example by inserting different sites.

The restriction enzymes chosen may generate either "blunt" or "sticky-ended" fragments, with the latter being preferred as they provide increased re-ligation efficiency. Suitable rare cutting and enzymes which may be used are well known in the art and include Ascl, NotI, Pad (available from New England Biolabs) which generate sticky end fragments and Pmel (available from New England Biolabs) which generates blunt end fragments . Ascl is a preferred restriction enzyme for use in the present invention but any site may conveniently be used provided that it does not otherwise interfere in the construct, that is it is not present in the plasmid backbone nor is it present in any gene of interest to be incorporated subsequently.

Alternatively, the intermediate selectable marker may be removed using other techniques conventionally known in the art for such purpose, for example through incorporation of a site specific recombination system or through the use of commercially available, rare cutting intron encoded endonucleases (New England Biolabs) or other such systems which would allow excision of the selectable marker.

Transformed intermediate host cells according to the invention may be propagated in a growth medium in the absence of selection pressure, that is, the growth medium does not actively inhibit the growth of untransformed cells. Suitable growth media for use according to the invention are conventional in the art.

In accordance with a particular embodiment of the invention, the cloning vector plasmid pPBI97-2 was prepared by modifying the plasmid vector pUC19, a well known and commercially available 2686 bp E. coli plasmid cloning vector. Recognition sequences for the rare cutting restriction enzyme Ascl were engineered into the plasmid at positions flanking the pUC19 ampicillin resistance marker, and the pUC19 polylinker cloning sites were removed and replaced with a simple linking sequence in such a way that the plasmid LacZ gene is permanently functional, so that it gives rise to blue colonies of appropriate E. coli strains when plated on to appropriate media containing the chromogenic substrate X-gal . A new polylinker cloning site was introduced at a different position such that cloning of additional DNA into it would not interfere with the function of the LacZ gene. A map of plasmids pUC19 and PPBI97-2 is presented in Figures 1 and 2 of the accompanying drawings .

Plasmid pPBl97-2 retains important features of pUC19 such as the ampicillin resistance marker, a multiple cloning site polylinker for insertion of desired DNA sequences and the Col El origin of replication for ease of making large amounts of the vector in E. coli . It also retains the LacZ gene but modified such that it is separated from the polylinker cloning region such that insertion of DNA into the polylinker does not render the LacZ gene nonfunctional. As the selectable antibiotic marker is readily excisable in pPBl97-2, the plasmid may advantageously be used in the preparation of plasmid DNA for use in plant transformation systems for the reasons discussed above.

In accordance with the invention, genes of interest for plant transformation may be cloned into the polylinker cloning site of plasmid pPBl97-2 using standard cloning procedures conventional in the art and the resulting plasmid digested with Ascl. The digested DNA is purified by fractionation on a low melting point agarose gel, or some other such conventional method, and the fraction containing the gene of interest and backbone plasmid purified away from the ampicillin marker gene-containing fraction. This ampicillin marker-free fragment is self- ligated to create a viable plasmid without a selection marker which can be used to transform competent E. coli cells and plated onto media containing X-gal without antibiotic selection. The resulting blue, transformed cells are detectable against a background lawn of white, non-transformed cells and are re-streaked until single blue colonies are obtained. These can be used to prepare large scale amounts of pure plasmid DNA for subsequent use in genetic modification.

In a further aspect the invention provides plasmid pPBI97-2 (also referred to as p97-2) and derivatives thereof.

Plasmid pPBl97-2/p97-2 has been made the subject of a deposit under the Budapest Treaty at the NCIMB (National

Collections of Industrial and Marine Bacteria, 23 St.

Machar Drive, Aberdeen AB2 1RY) , under accession number NCIMB , deposited on July 1998

(being on or before the date of filing of the present application) .

Derivatives of pPBl97-2 are defined for present purposes as being plasmids which are substantially identical to pPBI97- 2 but in which: a sequence of interest has been inserted [typically at the polylinker cloning site shown in Figure 2]); and/or plasmids from which the ampicillin resistance gene has been deleted [e.g. by re-ligation following Ascl digestion] ; and/or plasmids comprising deletions, insertions or inversions at the polylinker site shown in Figure 2. A particular derivative of pPBI97-2 is pSR97- 29A^~ (as herein defined) , wherein a sequence of interest comprising the maize waxy promoter, a portion of a gene of interest (in the sense orientation, intended to inhibit expression of the full length homologous gene in a host cell by "sense co-suppression") and a Nos terminator was inserted into pPBI97-2; and the ampicillin resistance gene was deleted. The invention also provides, in particular embodiments, other derivatives of pPBl97-2, such as plasmid p97-2B and plasmid p97-2C (as herein defined with reference to the description below) , and derivatives thereof (which are substantially identical to p97-2B or p97-2C but from which the ampicillin resistance gene has been deleted and/or in which a sequence of interest has been inserted) . A particular derivative of p97-2C is p97-2CWTl (as herein defined with reference to the description below) which comprises the maize waxy promoter and Nos terminator.

EXAMPLES

The following examples are provided by way of illustration only.

DNA manipulations were performed using standard procedures well known in the art, as described, for example, in Sambrook.

Example 1: Construction of plasmid pPBI97-2

1.1) Introduction of an Ascl site at position 1477 of pUC19, 3' to the ampicillin resistance marker.

A 1646bp (approx.) PCR fragment was generated using pUC19 (Gen Bank Accession #x02514, available from New England Biolabs, Beverly MA, USA (and other commercial suppliers)) as a template and the primers puc2 ( 5 '

ATAGGCGCGCCACGGGGTCTGACGCTAGTGG 3 ' , SEQ ID NO: 1) and puc3 (5' GGAAACAGCTATGACCATGAT 3', SEQ ID NO: 2). The amplified fragment corresponds to coordinates 1500 (approx) through clockwise to 460 (approx.) (figure 1). The primer puc2 results in the introduction of an Ascl site (highlighted in bold in the above puc2 primer sequence) close to the end of the amplified fragment. pUC19 was digested with Oral and Smal . Following calf intestinal alkaline phosphatase (CIAP) treatment the 1153bp (approx.) fragment containing the origin of replication and part of the LacZ gene and polylinker cloning sites (approx. positions 410-1563 in figure 1) was gel-purified and ligated to the PCR fragment described above to generate p96-35 (figure 3) .

1.2) Introduction of Ascl site at the Sspl site in pPBl96- 35, 5¹ to the ampicillin resistance marker.

An Ascl linker fragment was purchased from New England Biolabs and inserted by ligation (using standard procedures) at the Sspl site of p96-35 to create pPBI96-40 (figure 4) .

1.3) Permanent LacZ.

PPBI96-40 (figure 4) was digested with the restriction enzymes EcoRI and Hindlll at either end of the polylinker. The sites were made blunt ended using dNTPs and Klenow polymerase using methods known in the art and a Sail linker of the sequence 5' GGTCGACC 3' (Catalogue no. 1027 from New England Biolabs) was ligated in place of the deleted polylinker sites. The linker was inserted in order to restore the amino acid reading frame of the LacZ gene. The linker used was chosen arbitrarily - other sequences of suitable length and sequence could have been used. The resulting plasmid is pPBI96-46 (figure 5) .

1.4) Insertion of new polylinker cloning sites. The multiple cloning region of the cloning vector pBluescript was amplified from pBluescript by PCR using the primers bsl (5 ^■ ACTACATGTAACAGCTATGACCATG 3 ' , SEQ ID NO : 3 ) and bs2 ( 5 'ACTACATGTGTAAAACGACGGCCAGT 3 ' , SEQ ID NO : 4) . Following digestion with Aflll the resulting amplified DNA fragment was inserted into the Afllll site of p96-46 to produce pPBI97-2.

1.5) Insertion of a test gene of interest The Ubiquitin promoter-GUS fusion was transferred as an EcoRI - Hindlll fragment (from the plasmid pAHC25, ref = Christensen. A.H. & Quail, P.H. 1996. Ubiquitin promoter- based vectors for high level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Research 5: 213-218) into the EcoRI and Hindlll sites of pPBI97-2, the resulting plasmid (pPBl97-49) digested with Ascl and the desired ampicillin marker-free fragment purified.

This was then self ligated and transformed into 20μl MAX efficiency DH5™ E. coli competent cells (Life Technologies Catalogue no. 18258-012) following the methods as described by the suppliers.

The transformed cells from the above experiments were plated at serial 10-fold dilutions onto LB media without antibiotic selection, and either with or without the substrate X-gal.

Results

The resulting lawns of cells plated on media containing X- gal were screened visually. Blue colonies could be observed (amongst the background lawn of "white" colonies) resulting from cells which had been transformed with a recombinant plasmid comprising the purified pPBl97-2 backbone + Ubi-GUS gene. Blue colonies were streaked out onto fresh LB plates containing X-gal for 2-3 rounds until single blue colonies were obtained. Single colonies were used to inoculate 2ml cultures of LB broth (without selection) and incubated, shaking, overnight at 37°C. DNA was prepared from the cultures using standard "miniprep" procedures known to those skilled in the art.

The resulting plasmid DNA was digested with diagnostic restriction enzymes to confirm that the plasmid conformed to that predicted (i.e. pPBI97-49 without the Ascl fragment containing the ampicillin resistance marker) . Following confirmation colonies were inoculated into a 400ml culture of LB broth (without selection) and incubated, shaking, overnight at 37°C. DNA was prepared from the culture using a standard "maxiprep" procedure. DNA yields were comparable to those obtained from cultures of cells transformed with plasmids containing the ampicillin resistance selection marker and grown in the presence of lOOμg/ml ampicillin. The resulting DNA was used for particle bombardment of immature wheat embryos. Bombarded DNA gave transient GUS expression results indistinguishable from those obtained by bombarding with the ampicillin resistance marker-containing plasmid (pAHC25) from which the Ubi-GUS gene had been derived.

The resulting lawns of cells plated on LB media without X- gal were screened by colony hybridisation (a standard technique known to those skilled in the art) , using 32P radiolabelled pUC19 as a probe. Positively hybridising colonies could be observed - resulting from cells which had been transformed with the recombinant plasmid comprising the purified pPBl97-2 backbone + Ubi-GUS gene. These colonies were identified by lining up autoradiograms with the bacterial plates. Colonies were streaked out onto fresh LB plates for 2-3 rounds until single positively hybridising colonies were obtained. Single colonies were used to inoculate 2ml cultures of LB broth (without selection) and incubated, shaking, overnight at 37°C. DNA was prepared from the cultures using standard "miniprep" procedures known to those skilled in the art. The resulting plasmid DNA was digested with diagnostic restriction enzymes to confirm that the plasmid conformed to that predicted (i.e. pPBl97-49 without the Ascl fragment containing the ampicillin resistance marker) . The plasmid DNAs obtained were indistinguishable from those obtained via visual detection as described above. Following confirmation colonies were inoculated into a 400ml culture of LB broth (without selection) and incubated, shaking, overnight at 37°C. DNA was prepared from the culture using a standard 'maxiprep' procedure. DNA yields were comparable to those obtained from cultures of cells transformed with plasmids containing the ampicillin resistance selection marker and grown in the presence of lOOμg/ml ampicillin. The resulting DNA was used for particle bombardment of immature wheat embryos. Bombarded DNA gave transient GUS expression results indistinguishable from those obtained by bombarding with the ampicillin resistance marker-containing plasmid (pAHC25) from which the Ubi-GUS gene had been derived.

For both methods of detection described above, yields of plasmid DNA achieved were comparable to cultures grown of cells containing the ampicillin selection marker-containing plasmids grown with selection. The use of the LacZ gene for visual selection was more satisfactory as it provided a simple visual screen and did not involve the use of radioactivity.

Example 2 : Construction of alternative plasmid vectors 2.1) Details of plasmid constructions:

Details and figures for the construction of the following plasmids is provided (all are derived from pPBI97-2, described above) : p97-2B, p97-2C, p97-2CWTl, 97-2BUbiNos, PPBI97-2B-UN, p97-2BUbiBAR and pSR97-29A-.

Plasmid p97-2B (figure 6) was produced by deleting the polylinker sites from Ecll36 II to Smal in the plasmid PPBI97-2, by digesting pPBI97-2 with these two enzymes followed by self ligation. Ecll36II is an isoschizomer of SstI and so recognises the SstI site but leaves a blunt end. (Thus, digestion of pPBI97-2 with Ecll36ll and Smal leaves two blunt ends which can be joined by a blunt-end ligation reaction) . This reduced the number of enzyme recognition sites in the polylinker. p97-2C was produced by digesting pPBl97-2A with Ecll36 II and Smal, ligating the products of digestion and selecting recombinants in which the polylinker region between the Smal and Ecll36 II sites was reinserted in the opposite orientation.

p97-2CWTl was produced as follows: pWxGS+ comprising a maize granule bound starch synthase gene (Shure et al . , 1983 Cell 35, 225-233) promoter-GUS-Nos fusion was obtained as a gift from Sue Wessler, (University of Georgia, Athens, USA) . pSRWXGUSl was produced by inserting a Sad linker [d(pCGAGCTCG0] (New England Biolabs [NEB] catalogue no. 1044) into the Smal site in pWxGS+ . The GUS gene was then deleted by digesting pSRWXGUSl with SacI, ligating the products of digestion and selecting recombinants in which the GUS gene is deleted, to produce the plasmid p97-WTl. The Waxy-NOS sequences in p97-WTl were finally transferred as a Hindlll/ EcoRI fragment into the Hindlll/ EcoRI fragments of the plasmid p97-2C to produce the plasmid p97- 2CWT1, shown in Figure 7. This plasmid comprises the maize waxy promoter (which confers endosperm expression) and a NOS terminator, with a small polylinker therebetween for insertion of a gene of interest to be expressed in a tissue specific manner in a transformed plant.

p97-2BUbi-Nos was produced in the following way: a Sad linker was inserted at the Smal site of the plasmid pAHC25 (Christensen, A.H. and Quail, P.H., 1996 Transgenic Research, 5: 213-218) to produce an intermediate plasmid. The GUS gene was removed from this intermediate plasmid by digesting with Sad followed by self ligation and identification of recombinant molecules lacking the GUS sequence to produce the plasmid pPBl95-9. pPBI95-9 was digested with EcoRI and following self ligation recombinant molecules lacking the Ubi-BAR sequences were identified. The resulting plasmid was designated pPBI96-23. The Ubi- Nos sequences in pPBI96-23 were transferred as an EcoRI - Hindlll fragment into the EcoRI and Hindlll sites of p97-2B to produce the plasmid pPBI97-2BUbiNos, illustrated in figure 8. This plasmid is similar to p97-2CWTl, in that it comprises a plant promoter (in this instance, the ubiquitin promoter) upstream of the NOS terminator, with a small polylinker region in between.

pPBl97-2B-UN was made in the following manner: an Nptll sequence was amplified as a PCR product using the primers AG95-7: 5' GATGAGCTCCGTTTCGCATGATTGAACAAGATGG (SEQ ID NO : 5) and AG95-8 : 5 ' GTCGAGCTCAGAAGAACTCGTCAAGAAGGC, (SEQ ID NO: 6) using pPBIBAG3 (Goldsbrough et al 1994 "Complementation of the tomato anthocyanin without ( aw) mutant using the dihydroflavonol 4-reductase gene", Plant Physiology 105, 491-496) as template for the Nptll sequence. The amplified product was cloned into the .SstI site of pBluescript

(Stratagene) and sequenced. The sequencing revealed that the Nptll sequence was of the 'mutant' form rather than the wild-type as had been expected. The 'mutant' form carries a single base change which is flanked by unique Ncol and SphI sites. The pBluescript clone was digested with Ncol and SphI to remove the region containing the single base change. Two oligonucleotides, (Nptl:CCCGACGGCGAGGATCTCGTCGTGACC, SEQ ID NO:7 and Npt2 : CATGGGTCACGACGAGATCCTCGCCGTCGGGCATG, SEQ ID NO: 8) were then annealed to each other to form an Ncol/ SphI fragment. This was cloned into the Ncol/ SphI digested Bluescript/Nptll clone, and the resulting clone was sequenced to confirm that the gene was now of the wild type form. The Nptll sequences was then purified as a Sad fragment and insterted at the Sad site of pPBl96-23 to produce pUNl . The orientation of the Nptll sequence in pUNl was determined by restriction digest analysis.

A Nptll-Nos BamHI/EcoRI fragment was purified from pUNl and ligated to the vector backbone of p97-2BUbi-Nos (described above) following digestion with BamHI and EcoRI, replacing the Nos fragment in p97-2Bubi-Nos . The resulting plasmid was designated pPBI97-2B-UN and is illustrated in figure 9. The plasmid comprises the ubiquitin promoter to drive the expression of the plant selectable marker gene Npt II. At the other end of the ubiquitin promoter is a polylinker which may be used for insertion of a gene of interest if desired (together with an appropriate promoter sequence) .

p97-2BUbiBAR was prepared as follows: the BAR-Nos sequences were purified as a BamHI - EcoRI fragment from pAHC25 and inserted into the BamHI and EcoRI sites of p97-2BUbiNos, replacing the Nos frgament in p97-2BubiNos to produce the plasmid p97-2BUbiBAR, shown in figure 10. This plasmid is essentially similar to p97-2B-UN, but the ubiqitin promoter drives the expression of the selectable marker gene BAR (which confers resistance to the herbicides phosphinothricin and bialophos) . pSR97-29A- (shown schematically in figure 11) was constructed in the following way: the plant gene of interest was purified as a Sad fragment and ligated to pSRWXGUSl which had been digested with Sad. Recombinant molecules in which the gene of interest was present and the GUS gene absent were identified. The maize waxy promoter- gene of interest-Nos cassette was then purified as an EcoRI - Hindlll fragment and inserted into the EcoRI and Hindlll sites of p97-2A to produce the plasmid pSR96-29. Following removal of the ampicillin resistance gene the resulting plasmid was designated pSR97-29A-. The plasmid contains a portion of a gene of interest operably linked to the maize waxy promoter in a sense orientation, so that introduction of the plasmid into a plant which comprises a native gene homologous to the gene of interest will result in decreased expression of the native gene product in the plant (via the phenomenon of "co-suppression"). Those skilled in the art will readily appreciate that a full length sequence (e.g. cDNA or genomic DNA) of the gene of interest could equally be linked to a plant promoter in the sense orientation, so as to cause a plant into which the plasmid is introduced, to express the gene of interest. If the plant already contains a native gene homologous to the gene of interest, this may result in increased overall expression of the gene product in the plant. Alternatively, a full length or partial fragment of the gene of interest may be operably linked in the antisense orientation to a plant promoter, so as to cause antisense inhibition of the native homologous gene in the plant. Those skilled in the art will appreciate that the foregoing comments apply generally to the invention and are not particularly restricted to plasmid pSR97-29A- or derivatives thereof.

2.2) Stable transformation of wheat using p97-2A derived plasmids

Wheat varieties Florida and Bobwhite have been transformed using plasmids derived from p97-2A, particularly plasmid pSR97-29A^~.

Transformation was performed by particle bombardment of immature scutellum tissues, essentially as described in Barcelo and Lazzeri 1995 (Transformation of cereals by microprojectile bombardment of immature inflorescence and scutellum tissues, ppll3-123 in Methods in Molecular biology - plant gene transfer and expression protocols (vol49) Jones, H. [ed] Humana press Inc., Totowa, NJ) .

Figure 12 shows a Southern blot of a primary transformant of the variety Bobwhite following transformation with plasmid pSR97-29A- which contains a gene of interest under control of the Maize waxy promoter. Lane 1 shows genomic

DNA of the transformant digested with the restriction enzyme Sad and probed with the gene of interest. Lane 2 is genomic DNA of the transformant digested with the restriction enzymes BamHI and EcoRI and probed with the gene of interest. Lanes 3 , 4 & 5 contain 1, 5 & 10 copy reconstructions of the gene of interest, probed with the gene of interest indicating that approximately 10 copies of the gene of interest have integrated in the transformant

(compare lane 1 with lane 5) .

Claims

1. A method of propagating in an intermediate host a plasmid for introduction into a final host, the method comprising the steps of:

2. A method of obtaining a transformed final host cell, the method comprising the steps of:

(a) propagating a plasmid according to the method of claim 1;

(b) extracting the replicated plasmid from the grown transformed intermediate host; and

(c) introducing the replicated plasmid into the final host cell.

3. A method according to claim 1 or 2 , wherein the intermediate host is prokaryotic and the final host is eukaryotic .

4. A method according to any one of claims 1, 2 or 3 , wherein the intermediate host is a bacterium and the final host is a plant or part thereof.

5. A method according to any of the preceding claims, wherein the characteristic conferred on the transformed intermediate host by the plasmid is a colour change relative to an untransformed intermediate host.

6. A method according to any one of the preceding claims, wherein the non-selectable marker comprises the LacZ gene.

7. A method according to any one of the preceding claims, wherein the plasmid comprises a marker gene which is selectable in the final host but not in the intermediate host.

8. A plasmid for propagation in an intermediate host, prior to introduction into a final host, the plasmid comprising a non-selectable marker that confers an identifiable characteristic on the intermediate host, which conferred characteristic enables transformed intermediate host cells to be distinguished from untransformed intermediate host cells, and wherein the plasmid does not comprise a marker gene which can provide the basis for selection in the intermediate host.

9. A plasmid according to claim 8, suitable for use in the method of any one of claims 1-7.

10. A plasmid according to claim 8 or 9, comprising one or more cloning sites into which a nucleic acid sequence of interest may be inserted.

11. A plasmid according to any one of claims 8, 9 or 10, comprising a Col El origin of replication.

12. Plasmid pPBI97-2 (as herein defined with reference to the accompanying description) , or a derivative thereof.

13. Plasmid pSR97-29A^_ (as herein defined with reference to the accompanying description) or a derivative thereof.

14. Plasmid p97-2B (as herein defined with reference to the accompanying description) or a derivative thereof.

15. Plasmid p97-2C (as herein defined with reference to the accompanying description) or a derivative thereof.

16. Plasmid p97-2CWTl (as herein defined with reference to the accompanying description) or a derivative thereof.

17. A method of propagating an intermediate host cell transformed with a plasmid in a growth medium wherein the medium does not actively inhibit the growth of untransformed cells.

18. A method according to claim 17, wherein the transformed intermediate host cell is used in a method according to any one of claims 1-7.

19. Use of a plasmid according to any one of claims 8- 16, in a method according to any one of claims 1-7.

20. A transformed final host cell, obtained by performance of the method of any one of claims 2-7.

21. A transformed final host plant cell, according to claim 20

22. A recombinant plant grown from a transformed plant cell according to claim 21, or the progeny thereof.