WO1999004825A9 - Methods and compositions for the diagnosis and treatment of neuropsychiatric disorders - Google Patents

Abstract

The present invention relates to the mammalian fsh05 gene, a novel gene associated with bipolar affective disorder (BAD) in humans. The invention encompasses fsh05 nucleic acids, recombinant DNA molecules, cloned genes or degenerate variants thereof, fsh05 gene products and antibodies directed against such gene products, cloning vectors containing mammalian fsh05 gene molecules, and hosts that have been genetically engineered to express such molecules. The invention further relates to methods for the identification of compounds that modulate the expression of fsh05 and to using such compounds as therapeutic agents in the treatment of fsh05 disorders and neuropsychiatric disorders. The invention also relates to methods for the diagnostic evaluation, genetic testing and prognosis of fsh05 disorders and neuropsychiatric disorders including schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective disorder or a unipolar affective disorder, and to methods and compositions for the treatment of these disorders.

Description

METHODS MID COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF NEUROPSYCHIATRIC DISORDERS

This application is a continuation-in-part of copending application Serial No. 08/828,010 filed March 27, S 1997, which is incorporated by reference herein in its entirety.

This invention was supported in part by Grant Nos. R03 MH-48695, R01 MH-47563, R01-MH49499, and K21MH00916 from the National Institutes of Health. The U.S. Government may 0 have rights in this invention.

1. INTRODUCTION The present invention relates to the mammalian fshOS gene, a novel gene associated with neuropsychiatric and 5 oxidative stress disorders in humans. The invention encompasses fsh05 nucleic acids, recombinant DNA molecules, cloned genes or degenerate variants thereof, fsh05 gene products and antibodies directed against such gene products, cloning vectors containing mammalian fsh05 gene molecules, 0 and hosts that have been genetically engineered to express such molecules. The invention further relates to methods for the identification of compounds that modulate the expression, synthesis and activity of fsh05 and to using compounds such as those identified as therapeutic agents in the treatment of 5 a fsh05 disorder; a neuropsychiatric disorder, including, by way of example and not of limitation, schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective disorder or a unipolar affective disorder; or an oxidative stress disorder. The invention also relates 0 to methods for the diagnostic evaluation, genetic testing and prognosis of a fsh05 disorder, of a neuropsychiatric disorder, including, by way of example and not of limitation, schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective disorder or a unipolar 5 affective disorder, or of an oxidative stress disorder. 2. BACKGROUND OF THE INVENTION

2.1. NEUROPSYCHIATRIC DISORDERS There are only a few psychiatric disorders in which clinical manifestations of the disorder can be correlated with demonstrable defects in the structure and/or function of the nervous system. Well-known examples of such disorders include Huntington¹s disease, which can be traced to a mutation in a single gene and in which neurons in the striatum degenerate, and Parkinson's disease, in which dopaminergic neurons in the nigro-striatal pathway degenerate. The vast majority of psychiatric disorders, however, presumably involve subtle and/or undetectable changes, at the cellular and/or molecular levels, in nervous system structure and function. This lack of detectable neurological defects distinguishes "neuropsychiatric" disorders, such as schizophrenia, attention deficit disorders, schizoaffective disorder, bipolar affective disorders, or unipolar affective disorder, from neurological disorders, in which anatomical or biochemical pathologies are manifest. Hence, identification of the causative defects and the neuropathologies of neuropsychiatric disorders are needed in order to enable clinicians to evaluate and prescribe appropriate courses of treatment to cure or ameliorate the symptoms of these disorders.

One of the most prevalent and potentially devastating of neuropsychiatric disorders is bipolar affective disorder (BAD) , also known as bipolar mood disorder (BP) or manic-depressive illness, which is characterized by episodes of elevated mood (mania) and depression (Goodwin, et al . , 1990, Manic Depressive Illness , Oxford University Press, New York) . The most severe and clinically distinctive forms of BAD are BP-I (severe bipolar affective (mood) disorder) , which affects 2-3 million people in the United States, and SAD-M (schizoaffective disorder manic type) . They are characterized by at least one full episode of mania, with or without episodes of major depression (defined by lowered mood, or depression, with associated disturbances in rhythmic behaviors such as sleeping, eating, and sexual activity) . BP-I often co-segregates in families with more etiologically heterogeneous syndromes, such as with a unipolar affective 5 disorder such as unipolar major depressive disorder (MDD) , which is a more broadly defined phenotype (Freimer and Reus, 1992, in The Molecular and Genetic Basis of Neurological Disease , Rosenberg, et al . , eds., Butterworths, New York, pp. 951-965; Mclnnes and Freimer, 1995, Curr. Opin. Genet.

10 Develop., 5, 376-381). BP-I and SAD-M are severe mood disorders that are frequently difficult to distinguish from one another on a cross-sectional basis, follow similar clinical courses, and segregate together in family studies (Rosenthal, et al . , 1980, Arch. General Psychiat. 37, 804-

15 810; Levinson and Levitt, 1987, Am. J. Psychiat. 144, 415- 426; Goodwin, et al . , 1990, Manic Depressive Illness , Oxford University Press, New York) . Hence, methods for distinguishing neuropsychiatric disorders such as these are needed in order to effectively diagnose and treat afflicted

20 individuals.

Currently, individuals are typically evaluated for BAD using the criteria set forth in the most current version of the American Psychiatric Association's Diagnostic and Statistical Manual of Mental Disorders (DSM) . While many

25 drugs have been used to treat individuals diagnosed with BAD, including lithium salts, carbamazepine and valproic acid, none of the currently available drugs are adequate. For example, drug treatments are effective in only approximately 60-70% of individuals diagnosed with BP-I. Moreover, it is

30 currently impossible to predict which drug treatments will be effective in, for example, particular BP-I affected individuals. Commonly, upon diagnosis, affected individuals are prescribed one drug after another until one is found to be effective. Early prescription of an effective drug

35 treatment, therefore, is critical for several reasons, including the avoidance of extremely dangerous manic episodes and the risk of progressive deterioration if effective treatments are not found.

The existence of a genetic component for BAD is strongly supported by segregation analyses and twin studies (Bertelεon, et al . , 1977, Br. J. Psychiat. 130, 330-351;

Freimer and Reus, 1992, in The Molecular and Genetic Basis of Neurological Disease, Rosenberg, et al . , eds., Butterworths, New York, pp. 951-965; Pauls, et al . , 1992, Arch. Gen. Psychiat. 49, 703-708). Efforts to identify the chromosomal location of genes that might be involved in BP-I, however, have yielded disappointing results in that reports of linkage between BP-I and markers on chromosomes X and 11 could not be independently replicated nor confirmed in the re-analyses of the original pedigrees, indicating that with BAD linkage studies, even extremely high lod scores at a single locus, can be false positives (Baron, et al . , 1987, Nature 326, 289- 292; Egeland, et al . , 1987, Nature 325, 783-787; Kelsoe, et al . , 1989, Nature 342, 238-243; Baron, et al . , 1993, Nature Genet. 3, 49-55). Recent investigations have suggested possible localization of BAD genes on chromosomes 18p and 21q, but in both cases the proposed candidate region is not well defined and no unequivocal support exists for either location (Berrettini, et al . , 1994, Proc. Natl. Acad. Sci. USA 91, 5918-5921; Murray, et al . , 1994, Science 265, 2049-2054; Pauls, et al . , 1995, Am. J. Hum. Genet. 57, 636-643; Maier, et al . , 1995, Psych. Res. 59, 7-15; Straub, et al . , 1994, Nature Genet. 8, 291-296).

Mapping genes for common diseases believed to be caused by multiple genes, such as BAD, may be complicated by the typically imprecise definition of phenotypes, by etiologic heterogeneity, and by uncertainty about the mode of genetic transmission of the disease trait. With neuropsychiatric disorders there is even greater ambiguity in distinguishing individuals who likely carry an affected genotype from those who are genetically unaffected. For example, one can define an affected phenotype for BAD by including one or more of the broad grouping of diagnostic classifications that constitute the mood disorders: BP-I, SAD-M, MDD, and bipolar affective (mood) disorder with hypomania and major depression (BP-II) . Thus, one of the greatest difficulties facing psychiatric geneticists is uncertainty regarding the validity of phenotype designations, since clinical diagnoses are based solely on clinical observation and subjective reports. Also, with complex traits such as neuropsychiatric disorders, it is difficult to genetically map the trait-causing genes because: (1) neuropsychiatric disorder phenotypes do not exhibit classic Mendelian recessive or dominant inheritance patterns attributable to a single genetic locus, (2) there may be incomplete penetrance, i .e . , individuals who inherit a predisposing allele may not manifest disease; (3) a phenocopy phenomenon may occur, i.e., individuals who do not inherit a predisposing allele may nevertheless develop disease due to environmental or random causes; (4) genetic heterogeneity may exist, in which case mutations in any one of several genes may result in identical phenotypes.

Despite these difficulties, however, identification of the chromosomal location, sequence and function of genes and gene products responsible for causing neuropsychiatric disorders such as bipolar affective disorders is of great importance for genetic counseling, diagnosis and treatment of individuals in affected families.

2.2. OXIDATIVE STRESS DISORDERS The accumulation of oxidative stress is recognized to be contributing factor to tissue damage in conditions ranging from autoimmunity, inflammation and ischemia, to head trauma, cataracts, and neurological disorders such as stroke, Parkinson's disease, and Alzheimer's disease. Defects in antioxidant defense mechanisms, such as mutations in oxidoreductases, therefore, are thought to be responsible for development of various diseases. For example, mutations in Cu/Zn εuperoxide dismutase gene are associated with familial amyotrophic lateral sclerosis (Rosen, et al . , 1993, Nature 362:59-62), and mutations in mitochondrial cytochrome c oxidaεe genes segregate with late-onset Alzheimer's disease (Davis, et al . , 1997, Proc. Natl. Acad. Sci. USA 94:4526- 5 4531) .

The zeta-crystallin superfamily is a collection of quinone oxidoreductases (Babiychuk, et al . , 1995, J. Biol. Chem. 270, 26224-26231) . High levels of zeta-crystallin is expressed in guinea pig lens and is thought to be an 0 adaptation to control reactive oxygen species (ROS) formation. An autosomal dominant mutation in the guinea pig zeta-crystallin gene is associated with congenital cataract formation (Huang, et al . , 1990, Exp. Eye Research 50:317- 325) . 5

3. SUMMARY OF THE INVENTION It is an object of the present invention to identify genetic bases for neuropsychiatric and/or oxidative stress disorders, provide methods of treating and diagnosing 0 neuropsychiatric and/or oxidative stress disorders, and provide methods for identifying compounds for use as part of therapeutic and/or diagnostic methods.

In particular, the present invention relates, first, to the mammalian fsh05 gene, a novel gene encoding a 5 protein of 363 amino acids and with an open reading frame of 1089 base pairs, that is associated with neuropsychiatric disorders in humans, e . g. , schizophrenia, attention deficit disorders, schizoaffective disorders, bipolar affective disorders, and/or unipolar affective disorders; and with 0 oxidative stress disorders; including fshOS nucleic acids, recombinant DNA molecules, cloned genes or degenerate variants thereof.

The invention further relates to novel mammalian fsh05 gene products and to antibodies directed against such 5 mammalian fshOS gene products, or conserved variants or fragments thereof. fsh05 nucleic acid and amino acid sequences are provided herein. The invention also relates to vectors, including expression vectors, containing mammalian fsh05 gene molecules, and hosts that have been genetically engineered to express such fsh05 gene products.

The invention further relates to methods for the treatment of fshOS , neuropsychiatric or oxidative stress disorders, wherein such methods comprise administering compounds which modulate the expression of a mammalian fshOS gene and/or the synthesis or activity of a mammalian fshOS gene product so symptoms of the disorder are ameliorated. The invention further relates to methods for the treatment of mammalian fεh05 , neuropsychiatric, or oxidative stress disorders resulting from fsh05 gene mutations, wherein such methods comprise supplying the mammal with a nucleic acid molecule encoding an unimpaired fshOS gene product such that an unimpaired fshOS gene product is expressed and symptoms of the disorder are ameliorated.

The invention further relates to methods for the treatment of mammalian fshOS , neuropsychiatric, or oxidative stress disorders resulting from fεh05 gene mutations, wherein such methods comprise supplying the mammal with a cell comprising a nucleic acid molecule that encodes an unimpaired fshOS gene product such that the cell expresses the unimpaired fsh05 gene product and symptoms of the disorder are ameliorated. In addition, the present invention is directed to methods that utilize the fsh05 gene and/or gene product sequences for the diagnostic evaluation, genetic testing and prognosis of a fshOS disorder, a neuropsychiatric disorder, or an oxidative stress disorder. For example, the invention relates to methods for diagnosing fshOS , neuropsychiatric, or oxidative stress disorders, wherein such methods comprise measuring fsh05 gene expression in a patient sample, or detecting a fsh05 mutation in the genome of the mammal suspected of exhibiting such a disorder. The invention still further relates to methods for identifying compounds capable of modulating the expression of the mammalian fεh05 gene and/or the synthesis or activity of the mammalian fsh05 gene products, wherein such methods comprise contacting a compound to a cell that expresses a fshOS gene, measuring the level of fεh05 gene expression, gene product expression or gene product activity, and comparing this level to the level of fεh05 gene expression, gene product expression or gene product activity produced by the cell in the absence of the compound, such that if the level obtained in the presence of the compound differs from that obtained in its absence, a compound capable of modulating the expression of the mammalian fsh05 gene and/or the synthesis or activity of the mammalian fshOS gene products has been identified.

The invention also relates to methods for identifying a compound capable of modulating oxidative stress, wherein such methods comprise contacting a compound to a cell that expresses a fεh05 gene, measuring a level of oxidative stress expressed by the cell, and comparing the level obtained in the presence of the compound to a level of oxidative stress obtained in the absence of the compound, such that if the two levels obtained differ, a compound capable of modulating oxidative stress has been identified.

The invention further relates to methods for treating an oxidative stress disorder in a mammal comprising administering to the mammal a compound that modulates the synthesis, expression or activity of a mammalian fsh05 gene or fsh05 gene product so that symptoms of the disorder are ameliorated. fsh05 gene and/or gene products can also be utilized as markers for mapping of the region of the long arm of human chromosome 18 spanned by chromosomal markers D18S1121 and DS18S380.

The neuropsychiatric disorders referred to herein can include, but are not limited to, schizophrenia; attention deficit disorder; a schizoaffective disorder; a bipolar affective disorder, e .g. , severe bipolar affective (mood) disorder (BP-I) , bipolar affective (mood) disorder with hypomania and major depression (BP-II) ; schizoaffective disorder manic type (SAD-M) ; or a unipolar affective disorder e.g. , unipolar major depressive disorder (MDD) .

The oxidative stress disorders referred to herein can include, but are not limited to, autoimmunity, inflammation and ischemia, head trauma, cataracts, neurological disorders such as stroke, Parkinson's disease, Alzheimer's disease, and defects in antioxidant defense mechanisms, such as mutations in oxidoreductases e .g. , mutations in Cu/Zn superoxide dismutaεe gene are associated with familial amyotrophic lateral sclerosis (Rosen, et al . , 1993, Nature 362:59-62) and mutations in mitochondrial cytochrome c oxidase genes segregate with late-onset Alzheimer's disease.

The term "fεh05 disorder" as used herein refers to a disorder involving an aberrant level of fεh05 gene expression, gene product synthesis and/or gene product activity relative to levels found in normal, unaffected, unimpaired individuals, levels found in clinically normal individuals, and/or levels found in a population whose level represents a baseline, average fshOS level.

3.1. DEFINITIONS As used herein, the following terms shall have the abbreviations indicated.

BAC, bacterial artificial chromosomes

BAD, bipolar affective disorder(s) BP, bipolar mood disorder

BP-I, severe bipolar affective (mood) disorder BP-II, bipolar affective (mood) disorder with hypomania and major depression bp, base pair(s)

EST, expressed sequence tag lod, logarithm of odds MDD, unipolar major depressive disorder

ROS, reactive oxygen species

RT-PCR, reverse transcriptase PCR SSCP, single-stranded confor ational polymorphism

SAD-M, schizoaffective disorder manic type

STS, short tag sequence

YAC, yeast artificial chromosome

4. BRIEF DESCRIPTION OF THE FIGURES

Figures 1A-1C depict fsh05 nucleotide (SEQ ID NO:^~ and amino acid sequences (SEQ ID NO: 2) contained in cDNA clones FSH5-1 and FSH5-2.

Figure 2A-2B depict the nucleotide sequence of the open reading frame of the fsh.05 gene (SEQ ID NO: 12) and the

.encoded amino acid sequence (SEQ ID NO: 13) .

Figures 3A-3B depict the fsh05 nucleotide sequences of exon 1 and the adjacent intron-exon border sequences (SEQ ID NO: 14) and the nucleotide sequences of exon 2 and the adjacent intron-exon border sequences (SEQ ID NO: 15) . Exon 1 and Exon 2 are separated by an intron of 6489 base pairs. Exon 1 is 167 bp in length (as shown delineated by the brackets (J. One set of primers (see Table 3) was designed to hybridize to sequences outside and flanking the exon (as shown in bold) and to amplify the whole coding region plus the intron-exon boundaries. The amplification product is 325 bp including the intron-exon boundaries and the entire exon 1.

Exon 2 is 925 bp in length including the stop codon, but not the 3' -UTR (as shown by the brackets U) . The four sets of primers are indicated in the sequence (see Table 3) amplify products that overlap with each other and cover the whole coding region of exon 2 plus the 5 ' intron-exon boundary .

5. DETAILED DESCRIPTION OF THE INVENTION Described herein is the identification of a novel mammalian fshOS gene, which is associated with neuropsychiatric disorders such as human bipolar affective disorder (BAD) , and with oxidative stress disorders . fsh05 gene and gene product sequences are described in the example

-10-

Έ SHEET RULE 26) presented below in section 6. This invention is based, in part, on the genetic and physical mapping of the fsh05 gene to a specific, narrow portion of chromosome 18, also described in the Example presented below in Section 6.

5.1. THE fsh05 GENE The fsh05 gene is a novel gene associated with neuropsychiatric disorders, including BAD, and oxidative stress disorders. Nucleic acid sequences of the identified fsh05 gene are described herein. As used herein, "fsh05 gene" refers to:

(a) a nucleic acid molecule containing the DNA sequence shown in SEQ ID NO:l or contained in the cDNA clones FSH3-1 (ATCC accession No. 98317) and/or FSH5-2 (ATCC accession No. 98318) and/or contained in the full length fsh05 clone (SEQ ID NO: 12) (ATTC 98472), as deposited with the American Type Culture Collection (ATCC) ;

(b) any DNA sequence that encodes a poiypeptide containing: the amino acid sequence shown in Figures 1A-1C (SEQ ID NO: 2) , the amino acid sequence encoded by the cDNA clones FSH5-1 (ATCC 98317) and/or FSH5-2 (ATCC 98318), the amino acid sequence shown in Figures 2A-2B encoded by the cDNA clone of fsh05 (SEQ ID NO: 13) (ATTC 98472);

(c) any DNA sequence that hybridizes to the complement of the DNA sequences that encode the amino acid sequence shown in SEQ ID NO: 2, or contained in the cDNA clones F5H5-1 (ATCC 98317) and/or FSH5-2 (ATCC 98318) and/or contained in the full length fsh05 clone (SEQ ID NO: 13) , as deposited with the ATCC, under highly stringent conditions, e.g., hybridization to filter-bound DNA in 0.5 M NaHP0₄ , 7% sodium dodecyl sulfate (SDS) , 1 mM EDTA at 65 C, and washing in O.lxSSC/O.1% SDS at 68C (Ausubel F.M. et al. , eds. , 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York, at p. 2.10.3); and/or

(d) any DNA sequence that hybridizes to the complement of the DNA sequences that encode the amino acid sequence shown SEQ ID NO: 3 or contained in the cDNA clones FSH5-1 (ATCC 98317) and/or FSH5-2 (ATCC 98318) and/or contained in the full length fshOS clone (SEQ ID NO: 12), as depoεited with the ATCC, under less stringent conditions, εuch aε moderately εtringent conditionε, e .g. , waεhing in 0.2xSSC/0.1% SDS at 42°C (Ausubel et al . , 1989, supra) , and encodeε a gene product functionally equivalent to a fsh05 gene product.

As used herein, fshOS gene may also refer to degenerate variantε and/or alternate spliced variants of DNA sequences (a) through (d) .

The term "functionally equivalent to a fεh05 gene product," as used herein, refers to a gene product that exhibits at least one of the biological activities of an endogenous, unimpaired fεhOS gene. In one embodiment, a functionally equivalent fεh05 gene product is one that, when present in an appropriate cell type, is capable of ameliorating, preventing or delaying the onset of one or more symptoms of a fεh05 disorder. In another embodiment, a functionally equivalent fεhOS gene product is one that, when present in an appropriate cell type, is capable of ameliorating, preventing or delaying the onset of one or more symptoms of a neuropsychiatric disorder. In yet another embodiment, a functionally equivalent fsh05 gene product is one that, when present in an appropriate cell type, is capable of ameliorating, preventing or delaying the onset of one or more symptoms of a BAD, such as, for example, severe bipolar affective (mood) disorder, bipolar affective (mood) disorder with hypomania and major depression, or schizoaffective disorder manic type. In yet another embodiment, a functionally equivalent fsh05 gene product is one that, when present in an appropriate cell type, is capable of ameliorating, preventing or delaying the onset of one or more symptoms of an oxidative stress disorder. In one embodiment, an fsh05 gene product is one that is identified by assays, as capable, when expressed in an appropriate yeast strain, of providing the yeast host with a defense against oxidative stress (see Babiychuk, et al . , 1995, J. Biol. Chem. 270, 26224-26231).

In yet another embodiment, an fεh05 gene product is one that is identified by asεays as capable, when expresεed in an appropriate bacterial εtrain, of providing the bacterial hoεt with a defense against oxidative stress (Liu and Chang, 1994, Mol. and Bioc. Paras. 66:201-210; Storz, 1989, J. Bact. 171:2049-2055). Such bacterial strains can include, but are not limited to, Leiεhmania spp. , Eεcherichia coli, and Salmonella typhimurium . fεh05 sequences can include, for example either genomic DNA (gDNA) or cDNA sequences. When referring to a nucleic acid which encodes a given amino acid sequence, therefore, it is to be understood that the nucleic acid need not only be a cDNA molecule, but can also, for example, refer to a gDNA sequence from which an mRNA species is transcribed that is procesεed to encode the given amino acid sequence.

The invention also includes nucleic acid molecules, preferably DNA molecules, that hybridize to, and are therefore the complements of, the DNA sequences (a) through (d) , in the preceding paragraph. Such hybridization conditions may be highly stringent or less highly stringent, as described above. In instances wherein the nucleic acid molecules are deoxyoligonucleotides ("oligos"), highly stringent conditions may refer, e . g. , to washing in 6xSSC/0.05% sodium pyrophosphate at 37°C (for 14-base oligos) , 48°C (for 17-base oligos) , 55°C (for 20-base oligos) , and 60°C (for 23-base oligos) . These nucleic acid molecules may encode or act as fshOS gene antisense molecules, useful, for example, in fεh05 gene regulation (for and/or as antisense primers in amplification reactions of fεhOS gene nucleic acid sequences) . With respect to fεhOS gene regulation, such techniques can be used to regulate, for example, a fsh05 disorder, a neuropsychiatric disorder, such as BAD, or an oxidative stress disorder. Further, such sequences may be used as part of ribozyme and/or triple helix sequences, also useful for fshOS gene regulation. Still further, such molecules may be used as components of diagnostic methods whereby, for example, the presence of a particular fsh05 allele responsible for causing a fshOS diεorder, a neuropεychiatric disorder such as BAD, e .g. , manic-depression, or an oxidative stress disorder, may be detected.

The invention also encompasεeε:

(a) DNA vectors that contain any of the foregoing fsh05 coding sequences and/or their complements (i.e., antisense) ;

(b) DNA expression vectors that contain any of the foregoing fshOS coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences; and (c) genetically engineered host cells that contain any of the foregoing fshOS coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences in the host cell.

As used herein, regulatory elements include but are not limited to inducible and non-inducible promoters, enhancers, operators and other elements known to those skilled in the art that drive and regulate expression. Such regulatory elements include but are not limited to the cytomegalovirus hCMV immediate early gene, the early or late promoters of SV40 adenovirus, the lac system, the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage A, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase, the promoters of acid phosphatase, and the promoters of the yeast α-mating factors.

The invention further includes fragments of any of the DNA sequences disclosed herein. In one embodiment, a "fragment" refers to a fεh05 nucleic acid that encodes an amino acid sequence recognized by an antibody directed against the fεhOS protein. In another embodiment, a

"fragment" refers to a nucleic acid that encodes an amino acid sequence which exhibits a fsh05 biological function, as described above for fsh05 functional derivatives.

In one embo3iment, the fsh.05 gene sequences of the invention are mammalian gene sequences, with human sequences being preferred.

In another embodiment, the fsh.05 gene sequences of the invention are gene sequences encoding fsh05 gene products containing poiypeptide portions corresponding to (that is, poiypeptide portions exhibiting amino acid sequence similarity to) the amino acid sequence depicted in Figures 2A-2B, wherein the corresponding portion exhibits greater than about 50% amino acid identity with the Figures 2A-2B sequence.

In yet another embodiment, the fsh05 gene sequences of the invention are gene sequences encoding fsh.05 gene products containing poiypeptide portions corresponding to (that is, poiypeptide portions exhibiting amino acid sequence similarity to) the amino acid sequence depicted in Figures 2A-2B, wherein the corresponding portion exhibits greater than about 50% amino acid sequence identity with the Figures 2A-2B sequence, averaged across the fsh05 gene product's entire length.

In a further embodiment, the fsh.05 gene sequences of the invention are gene sequences that do not comprise the coding sequence of expressed sequence tag (EST) U55988. In addition to the human fsh05 gene sequences disclosed in Figures 2A-2B, additional fsh05 gene sequences can be identified and readily isolated, without undue experimentation, by molecular biological techniques well known in the art, used in conjunction with the fsh05 sequences disclosed herein. For example, additional human fsh05 gene sequences at the same or at different genetic loci as those disclosed in Figures 2A-2B can be isolated readily. There can exist, for example, genes at other genetic or physical loci within the human genome that encode proteins that have extensive homology to one or more domains of the fsh05 gene product and that encode gene products functionally equivalent to a fsh05 gene product. Further, homologous

-15- fsh05 gene sequences present in other species can be identified and isolated readily.

With respect to identification and isolation of fsh05 gene sequences present at the same genetic or physical locus as those sequences disclosed in Figures 2A-2B, such sequences can, for example, be obtained readily by utilizing standard sequencing and bacterial artificial chromosome "BAC) technologies in connection with BAC54 (Identification Reference EpHS996, ATCC Accession No. 98363).

For example, sheared libraries can be made from BAC54. Fragments of a convenient size, e.g., in the size range of approximately 1 kb, are cloned into a standard plasmid, and sequenced. Further fsh05 sequences can then readily be identified by alignment of the BAC sequences with the fsh05 sequences depicted in Figures 2A-2B. Alternatively,

BAC subclones containing additional fsh05 sequences can be identified by identifying those subclones which hybridize to probes derived from the fsh05 sequences depicted in Figures

2A-2B.

With respect to the cloning of a fsh05 gene homologue in human or other species (e.g., mouse), the isolated fsh05 gene sequences disclosed herein may be labeled and used to screen a cDNA library constructed from uRNA obtained from appropriate cells or tissues (e . g . , brain tissues) derived from the organism (e . g . , mouse) of interest.

The hybridization conditions used should be of a lower stringency when the cDNA library is derived from an organism different from the type of organism from which the labeled sequence was derived.

Alternatively, the labeled fragment may be used to screen a genomic library derived from the organism of interest, again, using appropriately stringent conditions. Low stringency conditions are well known to those of skill in the art, and will vary predictably depending on the specific organisms from which the library and the labeled sequences are derived. For guidance regarding such conditions see, for example, Sambrook, et al., 1989, Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Press, N.Y.; and Auεubel, et al . , 1989, Current Protocols in Molecular Biology, Green Publishing Associateε and Wiley Interεcience, N.Y.

Further, a fεh05 gene homologue may be iεolated from, for example, human nucleic acid, by performing PCR uεing two degenerate oligonucleotide primer pools designed on the basis of amino acid sequences within the fεhOS gene product disclosed herein. The template for the reaction may be cDNA obtained by reverse transcription of mRNA prepared from, for example, human or non-human cell lines or tissue known or suspected to express a fsh05 gene allele (such as human brain cell lines e .g. , ATCC CRL-7605, ATCC CRL-7948, ATCC CRL-2060 PFSK-1, ATCC CRL-2176 SW 598, American Type Culture Collection, Rockville, MD; cortical neuronal cell lines, e .g. , Ronnett, et al . , 1990, Science 248, 603-605; Ronnett, et al . , 1994, Neuroscience 63, 1081-1099; and Dunn, et al . , 1996, Int. J. Dev. Neurosci. 14, 61-68; neuronal line HCN-1A, Westlund et al . , 1992, Int. J. Dev. Neurosci. 10, 361-373) . The PCR product may be subcloned and sequenced to ensure that the amplified sequences represent the sequences of a fshOS gene nucleic acid sequence. The PCR fragment may then be used to isolate a full length cDNA clone by a variety of methods. For example, the amplified fragment may be labeled and used to screen a bacteriophage cDNA library. Alternatively, the labeled fragment may be used to isolate genomic clones via the screening of a genomic library.

PCR technology may also be utilized to isolate full length cDNA sequences. For example, RNA may be isolated, following standard procedures, from an appropriate cellular or tissue source (i.e., one known, or suspected, to express the fsh05 gene, such as, for example, blood samples or brain tissue samples obtained through biopsy or post-mortem) . A reverse transcription reaction may be performed on the RNA using an oligonucleotide primer specific for the most 5' end of the amplified fragment for the priming of first strand synthesis. The resulting RNA/DNA hybrid may then be "tailed" with guanines using a standard terminal transferase reaction, the hybrid may be digested with RNAaεe H, and εecond εtrand εyntheεiε may then be primed with a poly-C primer. Thuε, cDNA sequences upstream of the amplified fragment may easily be isolated. For a review of cloning strategieε that may be uεed, see e.g., Sambrook et al . , 1989, εupra . fεhOS gene sequences may additionally be used to isolate mutant fεhOS gene alleles. Such mutant alleles may be isolated from individuals either known or proposed to have a genotype that contributes to the symptoms of a fεh05 disorder, a neuropsychiatric disorder such as BAD, for example, manic-depression, or an oxidative stresε disorder. Mutant alleles and mutant allele products may then be utilized in the therapeutic and diagnostic systems described below. Additionally, such fεh05 gene sequences can be used to detect fεhOS gene regulatory (e.g., promoter) defects which can be associated with a fshOS disorder, a neuropsychiatric disorder such as BAD, or an oxidative stress disorder. A cDNA of a mutant fεh05 gene may be isolated, for example, by using PCR, a technique that is well known to those of skill in the art. In this case, the first cDNA strand may be synthesized by hybridizing an oligo-dT oligonucleotide to mRNA isolated from tissue known or suspected to be expressed in an individual putatively carrying the mutant fεh05 allele, and by extending the new strand with reverse transcriptase. The second strand of the cDNA is then synthesized using an oligonucleotide that hybridizes specifically to the 5' end of the normal gene. Using these two primers, the product is then amplified via PCR, cloned into a suitable vector, and subjected to DNA sequence analysis through methods well known to those of skill in the art. By comparing the DNA sequence of the mutant fεh05 allele to that of the normal fshOS allele, the mutation(ε) reεponsible for the loss or alteration of function of the mutant fsh05 gene product can be ascertained. Alternatively, a genomic library can be constructed using DNA obtained from an individual suspected of or known to carry a mutant fεh05 allele, or a cDNA library can be constructed using RNA from a tissue known, or suspected, to express a mutant fshOS allele. An unimpaired fεhos gene or any suitable fragment thereof may then be labeled and used as a probe to identify the corresponding mutant fshOS allele in such libraries. Clones containing the mutant fsh05 gene sequences may then be purified and subjected to sequence analysiε according to methods well known to those of skill in the art.

Additionally, an expression library can be conεtructed utilizing cDNA εynthesized from, for example, RNA iεolated from a tissue known, or suspected, to expresε a mutant fshOS allele in an individual εuεpected of or known to carry εuch a mutant allele. In this manner, gene products made by the putatively mutant tissue may be expressed and screened using standard antibody screening techniques in conjunction with antibodies raised against the normal fshOS gene product, as described, below, in Section 5.3. (For screening techniques, see, for example, Harlow and Lane, eds., 1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor Press, Cold Spring Harbor.)

In cases where a fshOS mutation results in an expressed gene product with altered function (e.g., as a result of a misεense or a frameshift mutation) , a polyclonal set of anti-_fsh05 gene product antibodies are likely to cross-react with the mutant fεh05 gene product. Library clones detected via their reaction with such labeled antibodies can be purified and subjected to sequence analysis according to methods well known to those of skill in the art. fshOS mutations can further be detected using PCR amplification techniques. Primers can routinely be designed to amplify overlapping regions of the whole fsh05 sequence including the promoter region. In one embodiment, primers are designed to cover the exon-intron boundaries such that, first, coding regions can be scanned for mutations. In a specific embodiment, the amplification primers used are those set forth in Table 1, Section 6 below, and axe used to amplify and detect mutations, if any, in Exon 1 and/or Exon 2 (see Section 6) .

Genomic DNA isolated from lymphocytes of normal and affected individuals is used as PCR template. PCR products from normal and affected individuals are compared, either by single strand conformational polymorphism (SSCP) mutation detection techniques and/or by sequencing . The mutations responsible for the loss or alteration of function of the mutant fsh05 gene product can then be ascertained.

5.2. PROTEIN PRODUCTS OF THE fsh05 GENE fsh05 gene products, or peptide fragments thereof, can be prepared for a variety of uses. For example, such gene products, or peptide fragments thereof, can be used for the generation of antibodies, in diagnostic assays, or for the identification of other cellular or extracellular gene products involved in the regulation of a fsh05 disorder, a neuropsychiatric disorder such as BAD, or an oxidative stress disorder .

The amino acid sequence depicted in Figures 2A-2B (SEQ ID NO: 2) represents a fshOS gene product. The fsh05 gene product, sometimes referred to herein as a "fsh05 protein", includes those gene products encoded by the fsh05 gene sequences described in Section 5.1, above.

In one embodiment, the present invention encompasses polypeptides and peptides with at least 70 to 75% amino acid sequence identity with the fsh05 gene product (SEQ

ID NO: 13) . In a preferred embodiment, the present invention encompasses polypeptides and peptides with at least 80% amino acid sequence identity with the fsh05 gene product (SEQ ID

NO: 13) .

In addition, fsh05 gene products may include proteins that represent functionally equivalent gene products (see Section 5.1 for a definition and for assays useful in identifying such functional derivatives with no undue

-20- experimentation) . Such an equivalent fεhOS gene product may contain deletions, including internal deletions, additions, including additions yielding fusion proteins, or substitutions of amino acid residues within and/or adjacent to the amino acid sequence encoded by the fshOS gene sequences described, above, in Section 5.1, but that result in a "silent" change, in that the change produces a functionally equivalent fshOS gene product. Amino acid subεtitutions may be made on the basis of εimilarity in polarity, charge, εolubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, aεparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Alternatively, where alteration of function is desired, deletion or non-conservative alterations can be engineered to produce altered, including reduced fshOS gene products. Such alterations can, for example, alter one or more of the biological functions of the fshOS gene product. Further, such alterations can be selected so as to generate fshOS gene products that are better suited for expression, scale up, etc. in the host cells chosen. For example, cysteine residues can be deleted or substituted with another amino acid residue in order to eliminate disulfide bridges. The fεh05 gene products, peptide fragments thereof and fusion proteins thereof, may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing the fsh05 gene polypeptides, peptides, fusion peptide and fusion polypeptides of the invention by expressing nucleic acid containing fεhOS gene sequences are described herein. Methods that are well known to those skilled in the art can be used to construct expresεion vectors containing fεh05 gene product coding sequences and appropriate transcriptional and tranεlational control εignalε. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. See, for example, the techniques described in Sambrook, et al . , 1989, εupra, and Ausubel, et al . , 1989, supra. Alternatively, RNA capable of encoding fshOS gene product sequences may be chemically syntheεized uεing, for example, εyntheεizers. See, for example, the techniqueε deεcribed in "Oligonucleotide Syntheεiε", 1984, Gait, ed., IRL Preεε, Oxford.

A variety of host-expresεion vector εystems may be utilized to express the fshOS gene coding sequences of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells that may, when transformed or transfected with the appropriate nucleotide coding sequences, exhibit the fshOS gene product of the invention in situ . These include but are not limited to microorganisms such as bacteria (e.g., E. coli , B . εubtiliε) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing fshOS gene product coding sequences; yeast (e.g., Saccharomyces , Pichia) transformed with recombinant yeast expression vectors containing the fεh05 gene product coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the fεh05 gene product coding sequences; plant cell systems infected with recombinant virus expresεion vectors (e .g. , cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing fshOS gene product coding sequences; or mammalian cell εystems (e.g., COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e .g. , metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter) . In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the fεhOS gene product being expresεed. For example, when a large quantity of εuch a protein is to be produced, for the generation of pharmaceutical compositionε of fsh05 protein or for raiεing antibodieε to fεhOS protein, for example, vectorε that direct the expreεεion of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited, to the E. coli expresεion vector pUR278 (Ruther et al . , 1983, EMBO J. 2, 1791), in which the fεhOS gene product coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectorε (Inouye and Inouye, 1985, Nucleic Acids Res. 13, 3101-3109; Van Heeke and Schuster, 1989, J. Biol. Chem. 264, 5503-5509); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST) . In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety. In an insect system, Autographa calif ornica , nuclear polyhedrosiε virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The fεh05 gene coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter) . Succesεful inεertion of fεhOS gene coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene) . These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expresεed. (e .g. , Be Smith, et al . , 1983, J. Virol. 46, 584; Smith, U.S. Patent No. 4,215,051).

In mammalian host cells, a number of viral-based expresεion systems may be utilized. In caseε where an adenoviruε iε used as an expression vector, the fεhOS gene coding sequence of interest may be ligated to an adenovirus transcription/tranεlation control complex, e .g. , the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Inεertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing fεh05 gene product in infected hostε. (e .g. , See Logan and Shenk, 1984, Proc. Natl. Acad. Sci. USA 81, 3655-3659). Specific initiation εignalε may alεo be required for efficient tranεlation of inserted fεh05 gene product coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire fεhOS gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the fεhOS gene coding sequence is inserted, exogenous translational control signals, including, perhaps, the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner, et al . , 1987, Methods in Enzymol. 153, 516-544).

In addition, a host cell strain may be chosen that modulates the expresεion of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and proceεεing (e .g. , cleavage) of protein productε may be important for the function of the protein. Different hoεt cellε have characteristic and specific mechanisms for the post-translational procesεing and modification of proteinε and gene productε. Appropriate cell lineε or hoεt syεtemε can be chosen to ensure the correct modification and procesεing of the foreign protein expressed. To this end, eukaryotic host cells that possess the cellular machinery for proper procesεing of the primary tranεcript, glycoεylation, and phosphorylation of the gene product may be uεed. Such mammalian hoεt cellε include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3 , and WI38.

For long-term, high-yield production of recombinant proteinε, εtable expreεsion is preferred. For example, cell lines that stably express the fεh05 gene product may be engineered. Rather than using expression vectors that contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e .g. , promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci that in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines that express the fsh05 gene product. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the fsh05 gene product.

A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al . , 1977, Cell 11, 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska and Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48, 2026), and adenine phosphoriboεyltransferase (Lowy, et al . , 1980, Cell 22, 817) genes can be employed in tk", hgprt" or aprt" cells, respectively. Also, an imetabolite resiεtance can be uεed as the basiε of εelection for the following geneε: dhfr, which conferε reεiεtance to methotrexate (Wigler, et al . , 1980, Natl. Acad. Sci. USA 77, 3567; O'Hare, et al . , 1981, Proc. Natl. Acad. Sci. USA 78, 1527); gpt, which confers resiεtance to mycophenolic acid (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78, 2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al . , 1981, J. Mol. Biol. 150, 1) ; and hygro, which conferε reεiεtance to hygromycin (Santerre, et al . , 1984, Gene 30, 147).

Alternatively, any fusion protein may be readily purified by utilizing an antibody specific for the fusion protein being expressed. For example, a system described by Janknecht, et al . allows for the ready purification of non- denatured fusion proteins expressed in human cell lines (Janknecht, et al . , 1991, Proc. Natl. Acad. Sci. USA 88, 8972-8976) . In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the gene's open reading frame is translationally fused to an amino-terminal tag consisting of six histidine residues. Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni²⁺ nitriloacetic acid-agarose columns and histidine-tagged proteins are selectively eluted with imidazole-containing buffers.

The fsh05 gene products can also be expressed in transgenic animals. Animals of any species, including, but not limited to, mice, rats, rabbits, guinea pigs, pigs, micro-pigs, goats, sheep, and non-human primates, e .g. , baboons, monkeys, and chimpanzees may be used to generate fεh05 transgenic animalε. The term "tranεgenic, " as used herein, refers to animals expressing fεh05 gene sequences from a different specieε (e.g., mice expressing human fεhOS sequences) , as well as animalε that have been genetically engineered to overexpress endogenous (i.e., same εpecieε) fεh05 sequences or animals that have been genetically engineered to no longer express endogenous fεhOS gene sequences (i.e., "knock-out" animals), and their progeny.

Any technique known in the art may be used to introduce an fεhOS gene transgene into animalε to produce the founder lines of transgenic animalε. Such techniques include, but are not limited to pronuclear microinjection (Hoppe and Wagner, 1989, U.S. Pat. No. 4,873,191); retrovirus mediated gene transfer into germ lines (Van der Putten, et al . , 1985, Proc. Natl. Acad. Sci., USA 82, 6148-6152); gene targeting in embryonic stem cells (Thompson, et al . , 1989, Cell 56, 313-321); electroporation of embryos (Lo, 1983, Mol. Cell. Biol. 3, 1803-1814); and sperm-mediated gene transfer (Lavitrano et al . , 1989, Cell 57, 717-723) (For a review of such techniques, see Gordon, 1989, Tranεgenic Animalε, Intl. Rev. Cytol. 115, 171-229)

Any technique known in the art may be uεed to produce tranεgenic animal cloneε containing an fsh05 transgene, for example, nuclear transfer into enucleated oocytes of nuclei from cultured embryonic, fetal or adult cells induced to quiescence (Campbell, et al . , 1996, Nature 380, 64-66; Wilmut, et al . , Nature 385, 810-813).

The present invention provides for transgenic animals that carry an fεh05 transgene in all their cells, as well as animals that carry the transgene in some, but not all their cells, i.e., mosaic animals. The transgene may be integrated as a single transgene or in concatamers, e . g. , head-to-head tandems or head-to-tail tandems. The transgene may also be selectively introduced into and activated in a particular cell type by following, for example, the teaching of Lasko et al. (Lasko, et al . , 1992, Proc. Natl. Acad. Sci. USA 89, 6232-6236). The regulatory sequences required for such a cell-type specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art. When it iε desired that the fεh05 gene transgene be integrated into the chromosomal site of the endogenous fεh05 gene, gene targeting is preferred. Briefly, when εuch a technique is to be utilized, vectors containing some nucleotide sequences homologous to the endogenouε fεhOS gene are deεigned for the purpose of integrating, via homologous recombination with chromosomal sequences, into and disrupting the function of the nucleotide sequence of the endogenous fεh05 gene. The transgene may also be selectively introduced into a particular cell type, thus inactivating the endogenouε fεhOS gene in only that cell type, by following, for example, the teaching of Gu, et al . (Gu, et al . , 1994, Science 265, 103-106) . The regulatory εequenceε required for εuch a cell-type εpecific inactivation will depend upon the particular cell type of intereεt, and will be apparent to thoεe of skill in the art.

Once transgenic animals have been generated, the expresεion of the recombinant fsh05 gene may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tiεεueε to assay whether integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques that include but are not limited to Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and RT-PCR (reverse transcriptase PCR) . Samples of fsh05 gene- expressing tissue, may also be evaluated immunocytochemically using antibodies specific for the fshOS transgene product.

5.3. ANTIBODIES TO fsh05 GENE PRODUCTS Described herein are methods for the production of antibodies capable of specifically recognizing one or more fsh05 gene product epitopes or epitopes of conserved variants or peptide fragments of the fεh05 gene products.

Such antibodies may include, but are not limited to, polyclonal antibodies, monoclonal antibodies (mAbs) , humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')₂ fragments, fragments produced by a Fab expresεion library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above. Such antibodieε may be used, for example, in the detection of a fεh05 gene product in an biological sample and may, therefore, be utilized as part of a diagnostic or prognostic technique whereby patients may be tested for abnormal levels of fshOS gene productε, and/or for the preεence of abnormal forms of such gene products. Such antibodieε may alεo be utilized in conjunction with, for example, compound screening schemeε, aε described, below, in Section 5.8, for the evaluation of the effect of test compounds on fsh05 gene product levels and/or activity. Additionally, such antibodies can be used in conjunction with the gene therapy techniqueε deεcribed, below, in Section 5.9.0.2 to, for example, evaluate the normal and/or engineered fεh05- expreεεing cellε prior to their introduction into the patient.

Anti-fsh05 gene product antibodieε may additionally be uεed aε a method for the inhibition of abnormal fεh05 gene product activity. Thus, such antibodies may, therefore, be utilized as part of treatment methods for an fεhOS disorder, a neuropsychiatric disorder, such as BAD, or an oxidative streεs disorder.

For the production of antibodies against a fεh05 gene product, various host animals may be immunized by injection with a fεh05 gene product, or a portion thereof. Such host animals may include, but are not limited to rabbits, mice, and rats, to name but a few. Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels εuch aε aluminum hydroxide, εurface active εubstances εuch as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigen, such aε a fshOS gene product, or an antigenic functional derivative thereof. For the production of polyclonal antibodies, host animalε such as those described above, may be immunized by injection with fεh05 gene product supplemented with adjuvantε aε alεo described above.

Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen, may be obtained by any technique that provideε for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique of Kohler and Milεtein, (1975, Nature 256, 495-497; and U.S. Patent No. 4,376,110), the human B-cell hybridoma technique (Koεbor et al . , 1983, Immunology Today 4, 72; Cole et al . , 1983, Proc. Natl. Acad. Sci. USA 80, 2026-2030), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodieε And Cancer Therapy, Alan R. Liεs, Inc., pp. 77- 96) . Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this invention may be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo makes this the presently preferred method of production.

In addition, techniques developed for the production of "chimeric antibodies" (Morrison, et al . , 1984, Proc. Natl. Acad. Sci., 81, 6851-6855; Neuberger, et al . ,

1984, Nature 312, 604-608; Takeda, et al . , 1985, Nature, 314, 452-454) by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region. (See, e .g. , Cabilly et al., U.S. Patent No. 4,816,567; and Boss et al., U.S. Patent No. 4,816397, which are incorporated herein by reference in their entirety.) In addition, techniques have been developed for the production of humanized antibodies. (See, e .g. , Queen, U.S. Patent No. 5,585,089, which is incorporated herein by reference in its entirety.) An immunoglobulin light or heavy chain variable region consists of a "framework" region interrupted by three hypervariable regions, referred to aε complementarity determining regionε (CDRε) . The extent of the framework region and CDRs have been precisely defined (see, "Sequenceε of Proteins of Immunological Interest", Kabat, E. et al., U.S.Department of Health and Human Services (1983) . Briefly, humanized antibodies are antibody molecules from non-human species having one or more CDRs from the non- human species and a framework region from a human immunoglobulin molecule. Alternatively, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778; Bird, 1988, Science 242, 423-426; Huston, et al . , 1988, Proc. Natl. Acad. Sci. USA 85, 5879-5883; and Ward, et al . , 1989, Nature 334, 544-546) can be adapted to produce single chain antibodies against fεh05 gene products. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain poiypeptide.

Antibody fragments that recognize specific epitopes may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragments, which can be produced by pepsin digestion of the antibody molecule and the Fab fragments, which can be generated by reducing the disulfide bridgeε of the F(ab')₂ fragments. Alternatively, Fab expression libraries may be constructed (Huse, et al . , 1989, Science, 246, 1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. 5.4. USES OF fsh05 GENE SEQUENCES, GENE PRODUCTS. AND ANTIBODIES

Described herein are variouε applicationε of fεhOS gene sequences, fεhOS gene products, including peptide fragments and fusion proteins thereof, and of antibodies directed against fsh05 gene products and peptide fragments thereof. Such applications include, for example, prognostic and diagnostic evaluation of a fshOS disorder, a neuropsychiatric disorder, such as BAD, or an oxidative streεε diεorder, and the identification of εubjectε with a prediεpoεition to εuch diεorderε, aε deεcribed, below, in Section 5.5. Additionally, εuch applications include methods for the treatment of a fsh05 diεorder, a neuropsychiatric disorder, such as BAD, or an oxidative streεε diεorder, aε deεcribed, below, in Section 5.9, and for the identification of compoundε that modulate the expreεεion of the fshOS gene and/or the εynthesis or activity of the fsh05 gene product, as described below, in Section 5.8. Such compounds can include, for example, other cellular products that are involved in mood regulation and in fεh05 disorders, neuropsychiatric disorders, such as BAD, or oxidative streεs disorderε. These compounds can be used, for example, in the amelioration of fsh05 disorders, neuropsychiatric disorders, such as BAD, and oxidative stress disorders.

5.5. DIAGNOSIS OF ABNORMALITIES OF A fsh05 ,

NEUROPSYCHIATRIC OR OXIDATIVE STRESS DISORDER

A variety of methods can be employed for the diagnostic and prognostic evaluation of fshOS disorders, neuropsychiatric disorders, such as BAD, or oxidative stress disorderε, and for the identification of subjects having a predispoεition to such disorderε.

Such methodε may, for example, utilize reagents such as the fsh05 gene nucleotide sequences described in Sections 5.1, and antibodies directed against fshOS gene products, including peptide fragments thereof, as described, above, in Section 5.3. Specifically, εuch reagents may be used, for example, for:

(1) the detection of the presence of fεh05 gene mutations, or the detection of either over- or under- expression of fshOS gene mRNA relative to the state of a fεh05 disorder, a neuropsychiatric diεorder, such aε BAD, or an oxidative εtreεε diεorder;

(2) the detection of either an over- or an under- abundance of fshOS gene product relative to the unaffected εtate; and

(3) the detection of an aberrant level of fshOS gene product activity relative to the unaffected εtate. fεhOS gene nucleotide sequences can, for example, be used to diagnose an fεh05 , neuropsychiatric, or oxidative εtreεε diεorder using, for example, the techniques for fshOS mutation detection described above in Section 5.1.

The methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits compriεing at least one specific fshOS gene nucleic acid or anti-fsh05 gene antibody reagent described herein, which may be conveniently used, e .g. , in clinical settings, to diagnose patients exhibiting abnormalities of a fsh05 disorder, a neuropsychiatric disorder, such as BAD, or an oxidative stress disorder. For the detection of fεhOS mutations, any nucleated cell can be used as a starting source for genomic nucleic acid. For the detection of fsh05 gene expression or fsh05 gene products, any cell type or tissue in which the fεhOS gene is expressed may be utilized. Nucleic acid-based detection techniques are described, below, in Section 5.6. Peptide detection techniques are described, below, in Section 5.7. 5.6. DETECTION OF fεh05

NUCLEIC ACID MOLECULES

A variety of methods can be employed to screen for the presence of fshOS mutationε and to detect and/or assay levels of fεhOS nucleic acid sequences.

Mutations within the fshOS gene can be detected by utilizing a number of techniques. Nucleic acid from any nucleated cell can be used as the starting point for such asεay techniques, and may be iεolated according to εtandard nucleic acid preparation procedureε that are well known to those of skill in the art. fsh05 nucleic acid sequences may be used in hybridization or amplification assays of biological samples to detect abnormalities involving fεhOS gene structure, including point mutations, insertions, deletions, inversions, translocations and chromosomal rearrangements. Such assays may include, but are not limited to. Southern analyseε, εingle-εtranded conformational polymorphism analyses (SSCP) , and PCR analyses.

Diagnostic methods for the detection of fεhOS gene- specific mutations can involve for example, contacting and incubating nucleic acids including recombinant DNA molecules, cloned genes or degenerate variants thereof, obtained from a sample, e .g. , derived from a patient sample or other appropriate cellular source, such as lymphocytes, with one or more labeled nucleic acid reagents including recombinant DNA molecules, cloned genes or degenerate variants thereof, as described in Section 5.1, under conditions favorable for the specific annealing of these reagents to their complementary sequences within the fεh05 gene. The diagnostic methods of the present invention further encompass contacting and incubating nucleic acids for the detection of single nucleotide mutations or polymorphismε of the fsh05 gene. Preferably, the lengthε of theεe nucleic acid reagents are at least 15 to 30 nucleotides. After incubation, all non- annealed nucleic acids are removed from the nucleic acid : fεh05 molecule hybrid. The presence of nucleic acids that have hybridized, if any such molecules exist, iε then detected. Using εuch a detection scheme, the nucleic acid from the cell type or tisεue of intereεt can be immobilized, for example, to a εolid εupport εuch aε a membrane, or a plaεtic εurface such as that on a microtiter plate or polystyrene beadε. In thiε caεe, after incubation, non- annealed, labeled nucleic acid reagents of the type described in Section 5.1 are eaεily removed. Detection of the remaining, annealed, labeled fεh05 nucleic acid reagentε iε accompliεhed uεing standard techniques well-known to those in the art. The fεhOS gene sequences to which the nucleic acid reagents have annealed can be compared to the annealing pattern expected from a normal fsh05 gene sequence in order to determine whether a fεhOS gene mutation is present. In a preferred embodiment, fεhOS mutations or polymorphisms can be detected by using a microassay of fshOS nucleic acid εequences immobilized to a substrate or "gene chip" (see, e .g. Cronin, et al., 1996, Human Mutation 7:244- 255) . Alternative diagnostic methods for the detection of fshOS gene specific nucleic acid molecules, in patient samples or other appropriate cell sources, may involve their amplification, e.g., by PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Patent No. 4,683,202), followed by the detection of the amplified molecules using techniques well known to those of skill in the art. The resulting amplified sequences can be compared to those that would be expected if the nucleic acid being amplified contained only normal copies of the fεh05 gene in order to determine whether a fεh05 gene mutation existε.

Additionally, well-known genotyping techniques can be performed to identify individuals carrying fεh05 gene mutations. Such techniques include, for example, the use of restriction fragment length polymorphisms (RFLPs) , which involve sequence variations in one of the recognition sites for the specific restriction enzyme used. Additionally, improved methods for analyzing DNA polymorphisms, which can be utilized for the identification of fεhOS gene mutations, have been described that capitalize on the presence of variable numbers of short, tande ly repeated DNA εequenceε between the reεtriction enzyme εiteε. For example, Weber (U.S. Pat. No. 5,075,217) deεcribeε a DNA marker based on length polymorphisms in blockε of (dC-dA)n- (dG-dT)n εhort tandem repeats. The average separation of (dC-dA)n-(dG-dT)n blocks is estimated to be 30,000-60,000 bp. Markers that are so cloεely εpaced exhibit a high frequency co-inheritance, and are extremely useful in the identification of genetic mutations, such as, for example, mutations within the fsh05 gene, and the diagnosis of diseaεeε and diεorderε related to fεhOS mutationε. Alεo, Caεkey et al . (U.S. Pat.No. 5,364,759) deεcribe a DNA profiling aεεay for detecting εhort tri and tetra nucleotide repeat sequences. The process includes extracting the DNA of interest, such as the fεhOS gene, amplifying the extracted DNA, and labelling the repeat sequences to form a genotypic map of the individual's DNA. The level of fεh05 gene expression can also be assayed. For example, RNA from a cell type or tissue known, or suspected, to express the fεhOS gene, such as brain, may be isolated and tested utilizing hybridization or PCR techniques such as are described, above. The isolated cells can be derived from cell culture or from a patient. The analysis of cells taken from culture may be a necessary step in the asεeεεment of cellε to be used as part of a cell-based gene therapy technique or, alternatively, to test the effect of compounds on the expresεion of the fsh05 gene. Such analyses may reveal both quantitative and qualitative aspects of the expresεion pattern of the fsh05 gene, including activation or inactivation of fεhOS gene expreεεion.

In one embodiment of εuch a detection scheme, a cDNA molecule is synthesized from an RNA molecule of interest (e .g. , by reverse transcription of the RNA molecule into cDNA) . A sequence within the cDNA iε then uεed as the template for a nucleic acid amplification reaction, such as a PCR amplification reaction, or the like. The nucleic acid reagents used aε synthesis initiation reagents (e.g., primers) in the reverse transcription and nucleic acid amplification steps of this method are chosen from among the fεhOS gene nucleic acid reagents described in Section 5.1. The preferred lengths of such nucleic acid reagents are at least 9-30 nucleotideε. For detection of the amplified product, the nucleic acid amplification may be performed uεing radioactively or non-radioactively labeled nucleotideε. Alternatively, enough amplified product may be made εuch that the product may be viεualized by standard ethidium bromide εtaining or by utilizing any other suitable nucleic acid staining method. Additionally, it is possible to perform such fεhOS gene expresεion assays "in situ", i.e., directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Nucleic acid reagents such as those described in Section 5.1 may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G.J., 1992, "PCR In Situ Hybridization: Protocols And Applications", Raven Press, NY).

Alternatively, if a sufficient quantity of the appropriate cells can be obtained, standard Northern analysis can be performed to determine the level of mRNA expression of the fεhOS gene.

5.7. DETECTION OF fsh05 GENE PRODUCTS Antibodies directed against unimpaired or mutant fsh05 gene products or conserved variants or peptide fragments thereof, which are discuεsed, above, in Section 5.3, may also be used as diagnosticε and prognoεticε for a fshOS disorder, a neuropsychiatric disorder, such as BAD, or an oxidative stress diεorder, as described herein. Such methods may be used to detect abnormalities in the level of fsh05 gene product εynthesiε or expression, or abnormalities in the structure, temporal expression, and/or physical location of fεhOS gene product. The antibodies and immunoaεεay methods described below have, for example, important in vitro applications in assesεing the efficacy of treatmentε for fεh05 disorders, neuropsychiatric disorderε, εuch aε BAD, or oxidative εtreεε diεorderε. Antibodieε, or fragmentε of antibodieε, such as those described below, may be used to screen potentially therapeutic compounds in vitro to determine their effects on fsh05 gene expression and fshOS peptide production. The compounds that have beneficial effects on an fεh05 diεorder, a neuropεychiatric disorder, such as BAD, or an oxidative streεs disorder, can be identified, and a therapeutically effective dose determined. In vitro immunoassays may also be used, for example, to assess the efficacy of cell-based gene therapy for an fsh05 disorder, a neuropsychiatric disorder, such as BAD, or an oxidative streεε diεorder. Antibodies directed against fsh05 peptides may be used in vitro to determine, for example, the level of fεh05 gene expression achieved in cellε genetically engineered to produce fεh05 peptides. In the case of intracellular fεh05 gene products, such an asseεsment is done, preferably, using cell lysates or extracts. Such analysis will allow for a determination of the number of transformed cells necessary to achieve therapeutic efficacy in vivo , as well as optimization of the gene replacement protocol.

The tissue or cell type to be analyzed will generally include those that are known, or suspected, to express the fεhOS gene. The protein isolation methods employed herein may, for example, be such as those described in Harlow and Lane (1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) . The isolated cells can be derived from cell culture or from a patient. The analysiε of cellε taken from culture may be a neceεεary εtep in the aεsesεment of cellε to be uεed aε part of a cell-baεed gene therapy technique or, alternatively, to teεt the effect of compoundε on the expreεsion of the fεhOS gene.

Preferred diagnostic methods for the detection of fshOS gene products or conserved variants or peptide fragments thereof, may involve, for example, immunoassays wherein the fshOS gene products or conεerved variantε or peptide fragmentε are detected by their interaction with an anti-f εh05 gene product-εpecifiσ antibody.

For example, antibodieε, or fragments of antibodies, such aε those described, above, in Section 5.3, useful in the present invention may be used to quantitatively or qualitatively detect the presence of fεh05 gene products or conserved variantε or peptide fragmentε thereof. Thiε can be accomplished, for example, by immunofluorescence techniques employing a fluorescently labeled antibody (see below, this Section) coupled with light microscopic, flow cytometric, or fluorimetric detection. Such techniques are especially preferred for fεh05 gene products that are expresεed on the cell εurface. The antibodies (or fragments thereof) useful in the present invention may, additionally, be employed hiεtologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of fsh05 gene products or conserved variants or peptide fragments thereof. In situ detection may be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody of the present invention. The antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. Through the use of such a procedure, it is possible to determine not only the presence of the fεh05 gene product, or conserved variants or peptide fragments, but also its distribution in the examined tiεεue. Uεing the preεent invention, those of ordinary εkill will readily perceive that any of a wide variety of hiεtological methods (such as staining procedures) can be modified in order to achieve such in situ detection. Immunoaεεayε for fεhOS gene products or conserved variants or peptide fragmentε thereof will typically comprise incubating a sample, such as a biological fluid, a tiεεue extract, freεhly harveεted cellε, or lyεateε of cellε, that have been incubated in cell culture, in the preεence of a detectably labeled antibody capable of identifying fεhOS gene productε or conεerved variantε or peptide fragments thereof, and detecting the bound antibody by any of a number of techniques well-known in the art. The biological sample may be brought in contact with and immobilized onto a solid phase support or carrier such as nitrocellulose, or other solid support that iε capable of immobilizing cells, cell particles or soluble proteins. The support may then be washed with suitable buffers followed by treatment with the detectably labeled fshOS gene specific antibody. The εolid phaεe εupport may then be waεhed with the buffer a εecond time to remove unbound antibody. The amount of bound label on εolid εupport may then be detected by conventional means. By "solid phase support or carrier" is intended any εupport capable of binding an antigen or an antibody. Well- known εupports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, a ylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the carrier can be either soluble to εome extent or inεoluble for the purposeε of the preεent invention. The εupport material may have virtually any possible structural configuration so long aε the coupled molecule is capable of binding to an antigen or antibody. Thus, the εupport configuration may be εpherical, aε in a bead, or cylindrical, aε in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Preferred supportε include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation. The binding activity of a given lot of anti-fs 05 gene product antibody may be determined according to well known methods. Thoεe skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation.

One of the ways in which the fsh05 gene peptide- εpecific antibody can be detectably labeled iε by linking the same to an enzyme and use in an enzyme immunoasεay (EIA) (Voller, A., "The Enzyme Linked Immunosorbent Assay (ELISA)", 1978, Diagnostic Horizons 2, 1-7, Microbiological Asεociateε Quarterly Publication, Walkerεville, MD) ; Voller, A. et al . , 1978, J. Clin. Pathol. 31, 507-520; Butler, J.E., 1981, Meth. Enzymol. 73, 482-523; Maggio, E. (ed.), 1980, Enzyme Immunoaεεay, CRC Press, Boca Raton, FL, ; Ishikawa, E. et al . , (eds.), 1981, Enzyme Immunoasεay, Kgaku Shoin, Tokyo). The enzyme which iε bound to the antibody will react with an appropriate εubεtrate, preferably a chromogenic substrate, in such a manner as to produce a chemical moiety that can be detected, for example, by spectrophotometric, fluorimetric or by viεual means. Enzymes that can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nucleaεe, delta-5-steroid isomeraεe, yeast alcohol dehydrogenase, α-glycerophosphate, dehydrogenase, triose phosphate iεomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, 3-galactosidaεe, ribonucleaεe, urease, catalase, glucoεe-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. The detection can be accompliεhed by colorimetric methodε that employ a chromogenic εubstrate for the enzyme. Detection may also be accompliεhed by viεual compariεon of the extent of enzymatic reaction of a εubεtrate in compariεon with εimilarly prepared εtandards.

Detection may alεo be accompliεhed using any of a variety of other immunoaεεayε. For example, by radioactively labeling the antibodieε or antibody fragments, it is possible to detect fsh05 gene peptides through the use of a radioimmunoasεay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoaεεayε, Seventh Training Courεe on Radioligand Assay Techniques, The Endocrine Society, March, 1986) . The radioactive isotope can be detected by such means aε the use of a gamma counter or a scintillation counter or by autoradiography.

It iε alεo possible to label the antibody with a fluorescent compound. When the fluorescently labeled antibody iε expoεed to light of the proper wave length, itε preεence can then be detected due to fluoreεcence. Among the moεt commonly uεed fluoreεcent labeling compoundε are fluoreεcein iεothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluoresca ine.

The antibody can alεo be detectably labeled uεing fluoreεcence emitting metalε εuch aε ¹⁵²Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA) . The antibody also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium eεter, imidazole, acridinium salt and oxalate ester.

Likewise, a bioluminescent compound may be used to label the antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological syεtems in which a catalytic protein increases the efficiency of the che iluminescent reaction. The presence of a bioluminescent protein iε determined by detecting the preεence of lumineεcence. Important biolumineεσent compounds for purposeε of labeling are luciferin, luciferaεe and aequorin. fsh05 gene productε can alεo be identified by assays in which expression of fεhOS in an appropriate yeast strain provides the yeast host with a defense against oxidative streεε (εee Babiychuk, et al . , 1995, J. Biol. Chem. 270, 26224-26231, incorporated by reference in its entirety) . 5 In another embodiment, fεhOS gene products are identified by aεsays in which expreεεion of fεhOS in an appropriate bacterial εtrain provideε the bacterial hoεt with a defenεe againεt oxidative εtreεε (Liu and Chang, 1994, Mol. and Bioc. Paras. 66:201-210; Storz, 1989, J. Bact. 171:2049-

10 2055; each of which iε incorporated by reference in itε entirety) . Such bacterial εtrainε can include, but are not limited to, Leishmania spp. , Escherichia coli , and Salmonella typhimurium .

In a εpecific embodiment, the regulated expression

15 of fεh05 in E. coli protects the cells from oxidative εtreεs. pBAD bacterial expression vectors (Guzman, 1995, J. Bact. 177(14) :4121-4130, incorporated by reference in its entirety) are used to expreεε a full length fεhOS cDNA in E. coli εtrain KS272 (εee Section 7) . Inhibition of bacterial growth

20 iε meaεured and used to quantitate the degree of protection, if any, that varying levels of expreεsed fsh05 provide to bacterial cells.

5.8. SCREENING ASSAYS FOR COMPOUNDS 25 THAT MODULATE fsh05 GENE ACTIVITY

The following assays are designed to identify compounds that bind to a fεhOS gene product, intracellular proteins or portions of proteins that interact with a fεh05 gene product, compounds that interfere with the interaction

30 of a fεhOS gene product with intracellular proteins and compounds that modulate the activity of fεh05 gene (i.e., modulate the level of fεh05 gene expresεion and/or modulate the level of fεh05 gene product activity) . Aεsays may additionally be utilized that identify compounds that bind to

35 fsh05 gene regulatory εequences (e.g., promoter εequenceε; εee e .g. , Platt, 1994, J. Biol. Chem. 269, 28558-28562), and that may modulate the level of fεhOS gene expreεεion. Compoundε may include, but are not limited to, small organic molecules, εuch aε ones that are able to cross the blood- brain barrier, gain entry into an appropriate cell and affect expresεion of the fεh05 gene or some other gene involved in a fεhOS regulatory pathway, or intracellular proteinε. Methods for the identification of such intracellular proteins are described, below, in Section 5.8.2. Such intracellular proteins may be involved in the control and/or regulation of mood. Further, among these compounds are compounds that affect the level of fεhOS gene expresεion and/or fshOS gene product activity and that can be used in the therapeutic treatment of fεhOS disorders,,neuropsychiatric disorders such as BAD, or oxidative stress diεorderε, aε deεcribed, below, in Section 5.9.

Compoundε may include, but are not limited to, peptides such as, for example, soluble peptides, including but not limited to, Ig-tailed fusion peptides, and members of random peptide libraries; (see, e .g. , Lam, et al . , 1991, Nature 354, 82-84; Houghten, et al . , 1991, Nature 354, 84- 86) , and combinatorial chemistry-derived molecular library made of D- and/or L- configuration amino acids, phosphopeptides (including, but not limited to members of random or partially degenerate, directed phosphopeptide libraries; see, e . g. , Songyang, et al . , 1993, Cell 72, 767- 778) , antibodies (including, but not limited to, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain antibodies, and FAb, F(ab^,)₂ and FAb expresεion library fragmentε, and epitope-binding fragments thereof) , and small organic or inorganic molecules.

Such compounds may further comprise compoundε, in particular drugε or memberε of classes or families of drugs, known to ameliorate or exacerbate the symptoms of a neuropsychiatric disorder such as BAD. Such compoundε include antidepressants such as lithium saltε, carbamazepine, valproic acid, lyεergic acid diethylamide (LSD) , p- chlorophenylalanine, p-propyldopacetamide dithiocarbamate derivatives e .g. , FLA 63; anti-anxiety drugs, e .g. , diazepam; monoamine oxidase (MAO) inhibitors, e .g. , iproniazid, clorgyline, phenelzine and iεocarboxazid; biogenic a ine uptake blockers, e .g. , tricyclic antidepressants such as desipramine, imipramine and amitriptyline; εerotonin reuptake inhibitors e .g. , fluoxetine; antipsychotic drugs such as phenothiazine derivatives (e .g. , chlorpromazine (thorazine) and trifluopromazine) ) , butyrophenones (e .g. , haloperidol (Haldol) ) , thioxanthene derivativeε (e.g., chlorprothixene) , and dibenzodiazepineε (e.g., clozapine); benzodiazepines; dopaminergic agonists and antagoniεtε e .g. , L-DOPA, cocaine, amphetamine, α-methyl-tyrosine, reserpine, tetrabenazine, benzotropine, pargyline; noradrenergic agoniεtε and antagoniεtε e .g. , clonidine, phenoxybenzamine, phentolamine, tropolone.

Compounds identified via assays such as those described herein may be useful, for example, in elaborating the biological function of the fsh05 gene product, and for ameliorating fshOS disorders, neuropsychiatric disorderε, εuch as BAD, or oxidative εtress disorders. Assays for testing the effectiveness of compounds, identified by, for example, techniques such as those described in Sections 5.8.: - 5.8.3, are discussed, below, in Section 5.8.4.

5.8.1. ASSAYS FOR QUANTIFYING LEVELS OF PROTECTION OF HOST CELLS AGAINST OXIDATIVE STRESS CONFERRED BY EXPRESSION OF fεh05

Test compounds that modulate activity of fshOS gene products can be identified by asεays in which expresεion of fshOS in an appropriate yeast strain provides the yeast host with a defense against oxidative streεs (see Babiychuk, et al . , 1995, J. Biol. Chem. 270, 26224-26231, incorporated by reference in its entirety) , and in which addition of the test compound to the assay modulates (i.e., either increaseε or decreaεeε) the amount of protection conferred by fshOS expression. The assays of the present invention are preferably carried out in mammalian εyεte ε. Yeaεt growth iε meaεured and used to quantitate the degree of protection, if any, that varying levels of expresεed fsh05 , in the preεence of varying levelε of the teεt compound, provide to yeaεt cellε.

In another embodiment, teεt compoundε that modulate activity of fsh05 gene products are identified by assays in which expresεion of fεhOS in an appropriate bacterial εtrain provideε the bacterial hoεt with a defense against oxidative stresε (Liu and Chang, 1994, Mol. and Bioc. Paraε. 66:201- 210; Storz, 1989, J. Bact. 171:2049-2055; each of which iε incorporated by reference in itε entirety) , and in which addition of the teεt compound to the aεεay modulateε (i . e . , either increases or decreases) the amount of protection conferred by fεhOS expresεion. Bacterial growth is measured and used to quantitate the degree of protection, if any, that varying levels of expresεed fεh05, in the presence of varying levelε of the test compound, provide to bacterial cells. Such bacterial strains can include, but are not limited to, Leiεhmania εpp. , Eεcherichia coli , and Salmonella typhimurium .

Compounds that may be identified may include, but are not limited to, drugs or members of classes or families of drugs known to ameliorate or exacerbate the symptoms of oxidative streεε disorder. Such compounds include reduced glutathione (GSH) , glutathione precursors, e.g., N- acetylcyεteine; antioxidantε, e .g. , vitaminε E and C, beta carotene and quinones; inhibitors of lipid membrane peroxidation, e.g., 21-aminosteroid U74006F (tirilazad meεylate) , and lazaroids; antioxidantε εuch aε mazindol; dizocilpine maleate; εelegiline; εulfhydryls N-acetyleysteine and cyεteamine; dimethylthiourea; EUK-8 a synthetic, low molecular salen-manganese complex; εynthetic manganeεe-based metalloprotein superoxide diεmutase mimic, SC52608; free radical scavengers or suppreεεorε, e . g. , pegorgotein, tocotrienol, tocopherol, MDL 74,18, LY231617, MCI-186, AVS (nicaraven) , allopurinol, rifampicin, oxypurinol, hypochlorouε acid or recombinant human Cu,Zn-SOD.

In one εpecific embodiment, a teεt compound added to the aεεay increaεeε the expreεsion of fεh05 in E. coli and increaseε the protection of the cellε from oxidative εtreεε.

In another εpecific embodiment, a teεt compound added to the aεεay decreaεeε the expreεεion of fεhOS in E. coli and decreaεeε the protection of the cellε from oxidative εtreεs.

5.8.2. IN VITRO SCREENING ASSAYS FOR COMPOUNDS THAT BIND TO THE fsh05 GENE PRODUCT

In vitro εyεtemε may be designed to identify compoundε capable of binding the fεhOS gene productε of the invention. Compoundε identified may be useful, for example, in modulating the activity of unimpaired and/or mutant fεhOS gene products, may be useful in elaborating the biological function of the fsh05 gene product, may be utilized in screens for identifying compounds that disrupt normal fsh05 gene product interactions, or may in themselves disrupt such interactions.

The principle of the assays used to identify compounds that bind to the fsh05 gene product involves preparing a reaction mixture of the fsh05 gene product and the test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex that can be removed and/or detected in the reaction mixture. These asεays can be conducted in a variety of ways. For example, one method to conduct such an asεay would involve anchoring fsh05 gene product or the teεt εubεtance onto a εolid phaεe and detecting fshOS gene product/teεt compound complexeε anchored on the εolid phaεe at the end of the reaction. In one embodiment of such a method, the fεhOS gene product may be anchored onto a solid εurface, and the test compound, which is not anchored, may be labeled, either directly or indirectly. In practice, microtiter plates may conveniently be utilized aε the εolid phaεe. The anchored component may be immobilized by non-covalent or covalent attachments. Non- covalent attachment may be accomplished by simply coating the solid surface with a solution of the protein and drying. Alternatively, an immobilized antibody, preferably a monoclonal antibody, εpecific for the protein to be immobilized may be uεed to anchor the protein to the εolid εurface. The surfaces may be prepared in advance and stored. In order to conduct the asεay, the non-immobilized component iε added to the coated εurface containing the anchored component. After the reaction iε complete, unreacted componentε are removed (e .g. , by waεhing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previouεly non-immobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non-immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the εurface; e .g. , using a labeled antibody specific for the previously non-immobilized component (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody) .

Alternatively, a reaction can be conducted in a liquid phaεe, the reaction products separated from unreacted components, and complexes detected; e .g. , using an immobilized antibody specific for fsh05 gene product or the test compound to anchor any complexes formed in solution, and a labeled antibody εpecific for the other component of the poεsible complex to detect anchored complexes. 5.8.3. ASSAYS FOR INTRACELLULAR PROTEINS THAT INTERACT WITH fεhOS GENE PRODUCTS

Any method suitable for detecting protein-protein interactions may be employed for identifying fεhOS protein- protein interactions.

Among the traditional methods that may be employed are co-immunoprecipitation, cross-linking and co-purification through gradients or chromatographic columns. Utilizing procedures such as these allows for the identification of proteins, including intracellular proteins, that interact with fsh05 gene products. Once isolated, εuch a protein can be identified and can be uεed in conjunction with εtandard techniques, to identify proteins it interacts with. For example, at least a portion of the amino acid sequence of a protein that interactε with the fshOS gene product can be ascertained using techniques well known to those of skill in the art, such as via the Edman degradation technique (see, e.g., Creighton, 1983, "Proteins: Structures and Molecular Principles," W.H. Freeman & Co., N.Y. , pp.34-49). The amino acid sequence obtained may be used as a guide for the generation of oligonucleotide mixtures that can be used to screen for gene sequences encoding such proteins. Screening made be accomplished, for example, by standard hybridization or PCR techniques. Techniques for the generation of oligonucleotide mixtures and the screening are well-known. (See, e.g., Ausubel, supra , and 1990, "PCR Protocols: A Guide to Methods and Applications," Innis, et al . , eds. Academic Preεε, Inc., New York).

Additionally, methodε may be employed that reεult in the εimultaneouε identification of geneε that encode the a protein which interactε with an fsh05 protein. Theεe methods include, for example, probing expression libraries with labeled fεh05 protein, using fεhOS protein in a manner similar to the well known technique of antibody probing of λgtll libraries.

One method that detects protein interactions in vivo, the two-hybrid εyεtem, iε deεcribed in detail for illustration only and not by way of limitation. One version of this syεtem haε been deεcribed (Chien, et al . , 1991, Proc. Natl. Acad. Sci. USA, 88, 9578-9582) and iε commercially available from Clontech (Palo Alto, CA) . Briefly, utilizing εuch a εyεtem, plaεmidε are conεtructed that encode two hybrid proteinε: one conεiεtε of the DNA-binding domain of a tranεcription activator protein fuεed to the fsh05 gene product and the other consists of the transcription activator protein'ε activation domain fuεed to an unknown protein that iε encoded by a cDNA that has been recombined into this plaεmid aε part of a cDNA library. The DNA-binding domain fusion plasmid and the cDNA library are transformed into a εtrain of the yeaεt Saccharomyces cerevisiae that contains a reporter gene (e .g. , HBS or lacZ) whose regulatory region contains the transcription activator's binding site. Either hybrid protein alone cannot activate transcription of the reporter gene: the DNA-binding domain hybrid cannot becauεe it does not provide activation function and the activation domain hybrid cannot because it cannot localize to the activator's binding siteε.

Interaction of the two hybrid proteins reconstitutes the functional activator protein and results in expression of the reporter gene, which is detected by an assay for the reporter gene product. The two-hybrid system or related methodology may be used to screen activation domain libraries for proteins that interact with the "bait" gene product. By way of example, and not by way of limitation, fεh05 gene products may be used as the bait gene product. Total genomic or cDNA sequences are fused to the DNA encoding an activation domain. This library and a plasmid encoding a hybrid of a bait fεhOS gene product fused to the DNA-binding domain are co-transformed into a yeast reporter strain, and the resulting transformants are screened for those that express the reporter gene. For example, and not by way of limitation, a bait fsh05 gene sequence, such as the open reading frame of the fsh05 gene SEQ ID NO: 8, can be cloned into a vector such that it iε translationally fused to the DNA encoding the DNA-binding domain of the GAL4 protein. These colonieε are purified and the library plaεmidε responsible for reporter gene expresεion are isolated. DNA sequencing iε then used to identify the proteins encoded by the library plas idε.

A cDNA library of the cell line from which proteinε that interact with bait fεh05 gene product are to be detected can be made using methodε routinely practiced in the art. According to the particular εyεtem deεcribed herein, for example, the cDNA fragmentε can be inεerted into a vector εuch that they are tranεlationally fuεed to the tranεcriptional activation domain of GAL4. Thiε library can be co-tranεformed along with the bait fεhOS gene-GAL4 fuεion plasmid into a yeast strain that contains a lacZ gene driven by a promoter that contains GAL4 activation sequence. A cDNA encoded protein, fused to GAL4 transcriptional activation domain, that interacts with bait fsh05 gene product will reconεtitute an active GAL4 protein and thereby drive expreεεion of the HIS3 gene. Colonies that express HIS3 can be detected by their growth on petri dishes containing semi- εolid agar based media lacking histidine. The cDNA can then be purified from theεe strains, and used to produce and isolate the bait fεhOS gene-interacting protein using techniques routinely practiced in the art.

5.8.4. ASSAYS FOR COMPOUNDS THAT INTERFERE WITH fεh05 GENE PRODUCT MACROMOLECULE INTERACTION fsh05 gene products of the invention may, in vivo, interact with one or more macromolecules, including intracellular macromolecules, such as proteins. Such macromolecules may include, but are not limited to, nucleic acid molecules and those proteins identified via methods εuch as those described, above, in Sections 5.8.1 - 5.8.2. For purposeε of thiε diεcuεεion, the macromolecules are referred to herein as "binding partners". Compounds that disrupt fεhOS binding in this way may be useful in regulating the activity of the fεh05 gene product, especially mutant fεhOS gene products. Such compounds may include, but are not limited to molecules such aε peptides, and the like, aε described, for example, in Section 5.8.2 above, which would be capable of gaining access to an fεhOS gene product. The basic principle of the asεay εystems used to identify compounds that interfere with the interaction between the fεhOS gene product and its binding partner or partners involveε preparing a reaction mixture containing the fεhOS gene product, and the binding partner under conditionε and for a time εufficient to allow the two to interact and bind, thuε forming a complex. In order to test a compound for inhibitory activity, the reaction mixture is prepared in the presence and absence of the test compound. The teεt compound may be initially included in the reaction mixture, or may be added at a time εubεequent to the addition of fεh05 gene product and itε binding partner. Control reaction mixtureε are incubated without the teεt compound or with a placebo. The formation of any complexes between the fεhOS gene protein and the binding partner is then detected. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of the fεh05 gene protein and the interactive binding partner. Additionally, complex formation within reaction mixtures containing the test compound and normal fεh05 gene protein may also be compared to complex formation within reaction mixtures containing the test compound and a mutant fεhOS gene protein. This comparison may be important in those caseε wherein it is desirable to identify compounds that disrupt interactions of mutant but not normal fεhOS gene proteins. The assay for compounds that interfere with the interaction of the fεhOS gene products and binding partnerε can be conducted in a heterogeneouε or homogeneouε format. Heterogeneouε aεεays involve anchoring either the fεhOS gene product or the binding partner onto a solid phase and detecting complexes anchored on the solid phase at the end of the reaction. In homogeneous aεεayε, the entire reaction iε carried out in a liquid phase. In either approach, the order of addition of reactants can be varied to obtain different information about the compounds being tested. For example, test compounds that interfere with the interaction between the fεh05 gene products and the binding partners, e .g. , by competition, can be identified by conducting the reaction in the presence of the test subεtance; i.e., by adding the teεt εubεtance to the reaction mixture prior to or simultaneously with the fεh05 gene protein and interactive intracellular binding partner. Alternatively, test compounds that disrupt preformed complexes, e .g. , compounds with higher binding constantε that diεplace one of the components from the complex, can be tested by adding the test compound to the reaction mixture after complexes have been formed. The various formats are deεcribed briefly below.

In a heterogeneous assay syεtem, either the fsh05 gene product or the interactive binding partner, iε anchored onto a εolid εurface, while the non-anchored εpecies is labeled, either directly or indirectly. In practice, microtiter plates are conveniently utilized. The anchored species may be immobilized by non-covalent or covalent attachments. Non-covalent attachment may be accomplished simply by coating the solid surface with a solution of the fεhOS gene product or binding partner and drying. Alternatively, an immobilized antibody specific for the species to be anchored may be used to anchor the species to the solid surface. The surfaces may be prepared in advance and stored.

In order to conduct the assay, the partner of the immobilized species is exposed to the coated surface with or without the test compound. After the reaction is complete, unreacted components are removed (e .g. , by washing) and any complexes formed will remain immobilized on the εolid εurface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the non-immobilized specieε iε pre-labeled, the detection of label immobilized on the εurface indicateε that complexeε were formed. Where the non-immobilized species is not pre- labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the initially non-immobilized specieε (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody) . Depending upon the order of addition of reaction components, test compounds that inhibit complex formation or that disrupt preformed complexes can be detected. Alternatively, the reaction can be conducted in a liquid phase in the presence or absence of the teεt compound, the reaction products separated from unreacted components, and complexeε detected; e .g. , uεing an immobilized antibody specific for one of the binding components to anchor any complexes formed in solution, and a labeled antibody specific for the other partner to detect anchored complexes. Again, depending upon the order of addition of reactants to the liquid phase, test compounds that inhibit complex or that disrupt preformed complexeε can be identified. In an alternate embodiment of the invention, a homogeneous aεεay can be used. In this approach, a preformed complex of the fεhOδ gene protein and the interactive binding partner is prepared in which either the fsh05 gene product or its binding partners is labeled, but the signal generated by the label is quenched due to complex formation (see, e.g., U.S. Patent No. 4,109,496 by Rubenstein which utilizeε thiε approach for immunoaεεayε) . The addition of a teεt εubstance that competeε with and diεplaces one of the species from the preformed complex will result in the generation of a signal above background. In thiε way, teεt εubstances that diεrupt fεhOδ gene protein/binding partner interaction can be identified.

In a particular embodiment, the fεhOδ gene product can be prepared for immobilization uεing recombinant DNA techniqueε deεcribed in Section 5.2. above. For example, the fshOδ coding region can be fuεed to a glutathione-S- tranεferaεe (GST) gene uεing a fuεion vector, εuch aε pGEX- 5X-1, in such a manner that its binding activity is maintained in the resulting fusion protein. The interactive binding partner can be purified and used to raise a monoclonal antibody, using methodε routinely practiced in the art and deεcribed above, in Section 5.3. Thiε antibody can be labeled with the radioactive iεotope ¹²⁵I, for example, by methodε routinely practiced in the art. In a heterogeneouε aεsay, e.g., the GST-fsh05 fusion protein can be anchored to glutathione-agarose beads. The interactive binding partner can then be added in the presence or absence of the test compound in a manner that allows interaction and binding to occur. At the end of the reaction period, unbound material can be washed away, and the labeled monoclonal antibody can be added to the syεtem and allowed to bind to the complexed componentε. The interaction between the fεhOδ gene protein and the interactive binding partner can be detected by meaεuring the amount of radioactivity that remainε aεεociated with the glutathione-agaroεe beads. A successful inhibition of the interaction by the test compound will result in a decrease in measured radioactivity.

Alternatively, the GST-fεhOδ gene fusion protein and the interactive binding partner can be mixed together in liquid in the absence of the solid glutathione-agarose beads. The test compound can be added either during or after the species are allowed to interact. This mixture can then be added to the glutathione-agaroεe beads and unbound material is washed away. Again the extent of inhibition of the fεhOδ gene product/binding partner interaction can be detected by adding the labeled antibody and measuring the radioactivity asεociated with the beadε.

In another embodiment of the invention, theεe εame techniques can be employed using peptide fragments that correspond to the binding domains of the fεhOδ protein and/or the interactive or binding partner (in caseε where the binding partner iε a protein) , in place of one or both of the full length proteinε. Any number of methods routinely practiced in the art can be used to identify and isolate the binding sites. These methods include, but are not limited to, mutagenesiε of the gene encoding one of the proteinε and screening for disruption of binding in a co- immunoprecipitation assay. Compensating mutations in the gene encoding the second species in the complex can then be selected. Sequence analysis of the genes encoding the respective proteins will reveal the mutations that correspond to the region of the protein involved in interactive binding. Alternatively, one protein can be anchored to a solid surface using methods described in thiε Section above, and allowed to interact with and bind to itε labeled binding partner, which haε been treated with a proteolytic enzyme, εuch aε trypεin. After washing, a short, labeled peptide comprising the binding domain may remain asεociated with the εolid material, which can be iεolated and identified by amino acid εequencing. Alεo, once the gene coding for the segments can be engineered to expresε peptide fragmentε of the protein, which can then be teεted for binding activity and purified or synthesized. For example, and not by way of limitation, a fεhOδ gene product can be anchored to a solid material as described, above, in this Section by making a GST-fεhOδ fusion protein and allowing it to bind to glutathione agarose beads. The interactive binding partner obtained can be labeled with a radioactive isotope, such as ³⁵S, and cleaved with a proteolytic enzyme such as trypsin. Cleavage products can then be added to the anchored GST-fsh05 fuεion protein and allowed to bind. After washing away unbound peptides, labeled bound material, representing the binding partner binding domain, can be eluted, purified, and analyzed for amino acid sequence by well-known methods. Peptides so identified can be produced synthetically or fused to appropriate facilitative proteins using recombinant DNA technology. 5.8.5. ASSAYS FOR IDENTIFICATION OF COMPOUNDS THAT AMELIORATE A fεhOδ DISORDER, A NEUROPSYCHIATRIC DISORDER, OR AN OXIDATIVE STRESS DISORDER

Compoundε, including but not limited to binding compoundε identified via aεεay techniques such as those described, above, in Sections 5.8.1 - 5.8.4, can be tested for the ability to ameliorate symptomε of a fshOδ diεorder or a disorder of thought and/or mood, including thought disorderε such as schizophrenia, εchizotypal personality disorder; psychosis; mood disorderε, εuch aε schizoaffective disorders (e .g. , schizoaffective disorder manic type (SAD-M); bipolar affective (mood) disorderε, such as severe bipolar affective (mood) disorder (BP-I) , bipolar affective (mood) disorder with hypomania and major depression (BP-II) ; unipolar affective disorders, εuch as unipolar major depressive diεorder (MDD) , dyεthymic disorder; obsessive- compulsive disorders; phobias, e.g., agoraphobia; panic disorderε; generalized anxiety diεorders; somatization disorders and hypochondriaεiε; and attention deficit disorders.

In a specific embodiment, a compound that ameliorates symptomε of an fshOδ diεorder decreases or ameliorates the effects of tissue damage, owing to the accumulation of oxidative stress, in a condition, including, but not limited to autoimmunity, inflammation, ischemia, head trauma, cataracts, and neurological disorders such as stroke, Parkinson's diseaεe and Alzheimer'ε disease.

It should be noted that the assayε deεcribed herein can identify compoundε that affect fshOδ gene activity by either affecting fshOδ gene expression or by affecting the level of fshOδ gene product activity. For example, compounds may be identified that are involved in another step in the pathway in which the fshOδ gene and/or fεhOδ gene product iε involved and, by affecting this same pathway may modulate the effect of fεhOδ on the development of a neuropsychiatric diεorder εuch aε BAD, or an oxidative εtreεs diεorder Such compounds can be used as part of a therapeutic method for the treatment of the disorder.

Described below are cell-baεed and animal model- based assayε for the identification of compoundε exhibiting such an ability to ameliorate symptomε of a fεhOδ diεorder, a neuropsychiatric disorder, such as BAD, or an oxidative εtreεε diεorder.

Firεt, cell-baεed systems can be used to identify compounds that may act to ameliorate symptomε of a fεhOδ diεorder, a neuropεychiatric diεorder, such as BAD, or an oxidative streεε diεorder. Such cell εystems can include, for example, recombinant or non-recombinant cell, such as cell lines, that expresε the fshOδ gene.

In utilizing such cell εyεtemε, cellε that express fεhOδ may be exposed to a compound suspected of exhibiting an ability to ameliorate symptomε of a fεhOδ diεorder, a neuropεychiatric diεorder, εuch aε BAD, or an oxidative εtreεε diεorder, at a sufficient concentration and for a sufficient time to elicit εuch an amelioration of such symptoms in the exposed cells. After exposure, the cells can be assayed to measure alterations in the expression of the fεhOδ gene, e .g. , by asεaying cell lyεates for fεhOδ mRNA transcriptε (e . g. , by Northern analyεis) or for fshOδ gene products expressed by the cell; compounds that modulate expresεion of the fshOδ gene are good candidateε as therapeutics. Alternatively, the cells are examined to determine whether one or more cellular phenotypes asεociated with an fshOδ diεorder, a neuropsychiatric disorder, such as BAD, or an oxidative εtreεε diεorder, haε been altered to reεemble a more normal or unimpaired, unaffected phenotype, or a phenotype more likely to produce a lower incidence or severity of disorder symptomε.

In addition, animal-baεed εyεtems or models for a fshOδ disorder, a neuropsychiatric disorder, such as BAD, or an oxidative streεs diεorder, which may include, for example, fshOδ mice, may be uεed to identify compoundε capable of ameliorating εymptomε of the diεorder. Such animal modelε may be uεed as test subεtrates for the identification of drugs, pharmaceuticals, therapies and interventions that may be effective in treating εuch diεorderε. For example, animal modelε may be exposed to a compound εuεpected of exhibiting an ability to ameliorate εymptomε, at a εufficient concentration and for a εufficient time to elicit εuch an amelioration of εymptomε of a fεhOδ disorder, a neuropsychiatric disorder, such aε BAD, or an oxidative stress disorder, in the exposed animalε. The response of the animals to the exposure may be monitored by asεeεεing the reverεal of such symptomε.

With regard to intervention, any treatmentε that reverεe any aεpect of symptoms of a fεhOδ disorder, a neuropsychiatric disorder, such aε BAD, or an oxidative εtreεs disorder, should be considered as candidates for human therapeutic intervention in such a disorder. Dosages of test agents may be determined by deriving dose-responεe curves, as discussed in Section 5.10.1, below.

5.9. COMPOUNDS AND METHODS FOR THE TREATMENT OF fεhOδ , NEUROPSYCHIATRIC OR OXIDATIVE STRESS DISORDERS

Described below are methods and compositions whereby a fεhOδ disorder, a disorder of thought and/or mood, such as BAD, or an oxidative stress disorder, may be treated.

For example, such methods can compriεe administering compounds which modulate the expresεion of a mammalian fεhOδ gene and/or the εyntheεiε or activity of a mammalian fεhOδ gene product εo εymptomε of the disorder are ameliorated.

Alternatively, in those instances whereby the mammalian fεhOδ , neuropsychiatric, or oxidative streεε diεorderε result from fshOδ gene mutations, such methods can comprise supplying the mammal with a nucleic acid molecule encoding an unimpaired fshOδ gene product such that an unimpaired fshOδ gene product is expresεed and symptoms of the disorder are ameliorated. In another embodiment of methods for the treatment of mammalian fshOδ, neuropsychiatric, or oxidative stress disorders resulting from fshOδ gene mutations, such methods can comprise supplying the mammal with a cell comprising a nucleic acid molecule that encodeε an unimpaired fεhOδ gene product εuch that the cell expreεεes the unimpaired fεhOδ gene product and symptoms of the disorder are ameliorated.

In caseε in which a loεε of normal fεhOδ gene product function reεultε in the development of a fεhOδ diεorder, a neuropsychiatric diεorder, or an oxidative εtreεε disorder phenotype, an increase in fεhOδ gene product activity would facilitate progresε towardε an asymptomatic state in individuals exhibiting a deficient level of fεhOδ gene expresεion and/or fshOδ gene product activity. Methods for enhancing the expresεion or εyntheεiε of fshOδ can include, for example, methodε such as those described below, in Section 5.9.2.

Alternatively, εymptoms of fshoOδ disorderε, neuropsychiatric disorders, such as BAD, or oxidative stress disorder, may be ameliorated by adminiεtering a compound that decreases the level of fεhOδ gene expresεion and/or fεhOδ gene product activity. Methodε for inhibiting or reducing the level of fshOδ εyntheεiε or expression can include, for example, methods such as those described in Section 5.9.1. In one embodiment of treatment methods, the compounds administered comprise compounds, in particular drugs, reported to ameliorate or exacerbate the symptomε of a neuropεychiatric diεorder, εuch aε BAD. Such compounds include antidepressants such as lithium salts, carbamazepine, valproic acid, lysergic acid diethylamide (LSD) , p- chlorophenylalanine, p-propyldopacetamide dithiocarbamate derivatives e .g. , FLA 63; anti-anxiety drugs, e .g. , diazepam; monoamine oxidase (MAO) inhibitors, e .g. , iproniazid, clorgyline, phenelzine and isocarboxazid; biogenic amine uptake blockerε, e.g., tricyclic antidepressants such as desipramine, imipramine and amitriptyline; εerotonin reuptake inhibitorε e.g., fluoxetine; antipsychotic drugs such as phenothiazine derivatives (e .g. , chlorpromazine (thorazine) and trifluopromazine) ) , butyrophenones (e .g. , haloperidol (Haldol) ) , thioxanthene derivatives (e.g., chlorprothixene) , and dibenzodiazepines (e . g. , clozapine); benzodiazepineε; dopaminergic agonists and antagonists e.g., L-DOPA, cocaine, amphetamine, α-methyl-tyrosine, reserpine, tetrabenazine, benzotropine, pargyline; noradrenergic agonistε and antagonists e.g., clonidine, phenoxybenzamine, phentolamine, tropolone.

In another embodiment of the treatment methods, the compounds administered comprise compounds, in particular drugs, reported to ameliorate or exacerbate the symptoms of oxidative εtresε diεorder. Such compounds include reduced glutathione (GSH) , glutathione precursors, e .g. , N- acetylcysteine; antioxidants, e.g., vitamins E and C, beta carotene and quinones; inhibitors of lipid membrane peroxidation, e .g. , 21-aminoεteroid U74006F (tirilazad meεylate) , and lazaroidε; antioxidants such as mazindol; dizocilpine maleate; selegiline; sulfhydryls N-acetyleysteine and cysteamine; dimethylthiourea; EUK-8 a synthetic, low molecular salen-manganese complex; synthetic manganese-based metalloprotein superoxide diεmutaεe mimic, SC52608; free radical scavengers or suppressors, e.g., pegorgotein, tocotrienol, tocopherol, MDL 74,18, LY231617, MCI-186, AVS

(nicaraven) , allopurinol, rifampicin, oxypurinol, hypochlorous acid or recombinant human Cu,Zn-SOD.

5.9.1. INHIBITORY ANTISENSE, RIBOZYME AND TRIPLE HELIX APPROACHES

In another embodiment, symptoms of certain fshoOδ disorders, neuropsychiatric disorders, such as BAD, or oxidative stress disorders may be ameliorated by decreasing the level of fshOδ gene expreεsion and/or fshOδ gene product activity by using fshOδ gene sequences in conjunction with well-known antisense, gene "knock-out," ribozyme and/or triple helix methods to decrease the level of fshOδ gene expression. Among the compounds that may exhibit the ability to modulate the activity, expression or synthesis of the fshOδ gene, including the ability to ameliorate the symptomε of a fεhOδ disorder, a neuropsychiatric disorder, εuch as BAD, or an oxidative stresε disorder are antisense, ribozyme, and triple helix molecules. Such molecules may be designed to reduce or inhibit either unimpaired, or if appropriate, mutant target gene activity. Techniques for the production and use of such molecules are well known to those of skill in the art. Antiεenεe RNA and DNA moleculeε act to directly block the tranεlation of mRNA by hybridizing to targeted mRNA and preventing protein tranεlation. Antisenεe approacheε involve the design of oligonucleotides that are complementary to a target gene mRNA. The antisenεe oligonucleotideε will bind to the complementary target gene mRNA tranεcripts and prevent translation. Absolute complementarity, although preferred, is not required.

A sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisenεe nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatcheε with an RNA it may contain and still form a stable duplex (or triplex, as the case may be) . One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.

In one embodiment, oligonucleotides complementary to non-coding regions of the fshOδ gene could be used in an antisenεe approach to inhibit tranεlation of endogenouε fεhOδ mRNA. Antiεense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

Regardless of the choice of target sequence, it is preferred that in vitro studies are first performed to quantitate the ability of the antiεense oligonucleotide to inhibit gene expresεion. It iε preferred that theεe εtudies utilize controls that distinguiεh between antisense gene inhibition and nonspecific biological effects of oligonucleotideε. It iε also preferred that theεe studies compare levels of the target RNA or protein with that of an internal control RNA or protein. Additionally, it is envisioned that resultε obtained using the antisense oligonucleotide are compared with those obtained using a control oligonucleotide. It is preferred that the control oligonucleotide is of approximately the same length aε the teεt oligonucleotide and that the nucleotide εequence of the oligonucleotide differε from the antiεenεe εequence no more than is necessary to prevent specific hybridization to the target sequence.

The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single- stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e . g. , for targeting host cell receptors in vivo) , or agents facilitating transport across the cell membrane (see, e . g. , Letsinger, et al . , 1989, Proc. Natl. Acad. Sci. U.S.A. 86, 6553-6556; Lemaitre, et al . , 1987, Proc. Natl. Acad. Sci. U.S.A. 84, 648-652; PCT Publication No. WO88/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134, published April 25, 1988), hybridization- triggered cleavage agents (see, e.g., Krol et al . , 1988,

BioTeσhniques 6, 958-976) or intercalating agentε (see, e.g., Zon, 1988, Phar . Res. 5, 539-549) . To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc. The antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D- galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinoεine, 2 , 2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueoεine, 5 '-methoxycarboxymethyluracil, 5-methoxyuracil , 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v) , wybutoxosine, pεeudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-

5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v) , 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.

The antiεense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinoεe, xyluloεe, and hexoεe.

In yet another embodiment, the antisense oligonucleotide compriseε at leaεt one modified phoεphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof. In yet another embodiment, the antisenεe oligonucleotide iε an α-anomeric oligonucleotide. An α- anomeric oligonucleotide formε εpecific double-εtranded hybrids with complementary RNA in which, contrary to the usual 3-units, the strands run parallel to each other (Gautier, et al . , 1987, Nucl. Acids Res. 15, 6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue, et al . , 1987, Nucl. Acids Res. 15, 6131-6148), or a chimeric RNA-DNA analogue (Inoue, et al . , 1987, FEBS Lett. 215, 327- 330) .

Oligonucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosyεtems, etc.). Aε examples, phosphorothioate oligonucleotides may be εyntheεized by the method of Stein, et al . (1988, Nucl. Acids Res. 16, 3209) , methylphosphonate oligonucleotides can be prepared by use of controlled pore glasε polymer εupportε

(Sarin, et al . , 1988, Proc. Natl. Acad. Sci. U.S.A. 85, 7448- 7451) , etc.

While antiεense nucleotideε complementary to the target gene coding region εequence could be used, those complementary to the transcribed, untranslated region are most preferred. For example, antisense oligonucleotides having the following sequences can be utilized in accordance with the invention:

1) 5 -CTGTAGTTGA-3 •

2) -CTGTAGTTGATAAGTCG-3 '

3) -CTGTAGTTGATAAGTCGTCCGGCGA-3

4) -CTGTAGTTGATAAGTCGTCCGGCGATACTGGGGAGTCAATTCGGAGGGAA-3 '

5) -TGTGACCTTTTTAACATCAACTTAA-3 •

6. 5 ' -TGTGACCTTTTTAACATCAACTTAATGGAGTGAGACAGTTGTCATTCGAC-3 ' ANTISENSE MOLECULES:

1. 5' TACAGCATGC 3' (10 bases)

2. 5' TACAGCATGCGGGCGGT 3' (17 bases)

3. 5' TACAGCATGCGGGCGGTGAAGGACC 3' (25 baseε)

4. 5' TACAGCATGCGGGCGGTGAAGGACCTGAAGGTCCCGAGGCGGTAAGGGGT 3' (50 bases)

5. 5' TGTGACCTTTTTAACATCAACTTAA 3' (25 baseε, end of coding region)

6. 5 ' TGTGACCTTTTTAACATCAACTTAATGGAGTGAGACAGTTGTCATTCGAC 3 ' (50 bases, end of coding region)

Antisense molecules should be delivered to cells that express the target gene in vivo . A number of methods have been developed for delivering antisense DNA or RNA to cells; e.g., antisenεe moleculeε can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g., antisenεe linked to peptides or antibodieε that εpecifically bind receptors or antigens expressed on the target cell surface) can be administered systemically.

However, it is often difficult to achieve intracellular concentrations of the antiεenεe εufficient to εuppress translation of endogenous mRNAs. Therefore a preferred approach utilizes a recombinant DNA construct in which the antisense oligonucleotide iε placed under the control of a strong pol III or pol II promoter. The use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of single stranded RNAs that will form complementary base pairs with the endogenous target gene transcripts and thereby prevent translation of the target gene mRNA. For example, a vector can be introduced e.g. , such that it is taken up by a cell and directs the transcription of an antisense RNA. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expresεion in mammalian cellε. Expresεion of the εequence encoding the antiεenεe RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290, 304-310), the promoter contained in the 3' long terminal repeat of Rous εarcoma viruε (Yamamoto, et al . ,

1980, Cell 22, 787-797), the herpeε thymidine kinaεe promoter (Wagner, et al . , 1981, Proc. Natl. Acad. Sci. U.S.A. 78, 1441-1445) , the regulatory εequences of the metallothionein gene (Brinster, et al . , 1982, Nature 296, 39-42), etc. Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct which can be introduced directly into the tissue site. Alternatively, viral vectors can be used that selectively infect the desired tissue, in which case administration may be accomplished by another route (e.g., systemically).

Ribozyme molecules designed to catalytically cleave target gene mRNA transcripts can also be used to prevent translation of target gene mRNA and, therefore, expression of target gene product. (See, e.g., PCT International Publication WO90/11364, published October 4, 1990; Sarver, et al . , 1990, Science 247, 1222-1225).

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. (For a review, see Rossi, 1994, Current Biology 4, 469-471). The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage event. The composition of ribozyme molecules must include one or more sequences complementary to the target gene mENA, and must include the well known catalytic sequence responsible for mRNA cleavage. For this sequence, lee, e . g . , U.S. Patent No. 5,093,246, which is incorporated herein by reference in its entirety.

While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy target gen' mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking ^"regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Myers, 1995, Molecular Biology and Biotechnology: A Comprehensive Desk

Reference, VCH Publishers, New York, (see especially Figure

4, page 833) and in Haseloff and Gerlach, 1988, Nature, 334,585-59 1, which is incorporated herein by reference in its entirety .

Preferably the ribozyme is engineered so that the cleavage recognition site is located near the 5 ' end of the target gene mRNA, i . e . , to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts .

For example, hammerhead ribozymes having the following sequences can be utilized in accordance with the invention:

1) 5 ' -UUCGAAACCUAUGUCAAAGCAGGNNNNCCUGAGNAGUCAGGGAGG

CUU3 ' which will cleave between nucleotides 48 and 49 in Figure 1A.

2) 5 ' -AAAGGGAGGCUUAACUGAGGGGUCAAAGCAGGNNNNCCUGAGNAG UCAGCGGCCUGCUGAAUAGUUGAUGUC -3 ' which will cleave between nucleotides 25 and 26 in Figure 1A.

HAMMERHEAD RIBOZYMES: 1. 5'- GGG AAU GGC GGA GCC CUG GAA GUC

[CA] GAA GUG GCG GGC GUA CGA CAU -3'

2. 5'- GUU GGG GCU CAG CCG GGU CAC [CA] CAG CUU CUG CAU GGC

UUG -3'

The ribozymes of the present invention also include RNA endoribonucleaseε (hereinafter "Cech-type ribozymeε") εuch as the one that occurs naturally in Tetrahymena thermophila (known as the IVS, or L-19 IVS RNA) and that has been extensively described by Thomas Cech and collaborators (Zaug, et al . , 1984, Science, 224, 574-578; Zaug and Cech, 1986, Science, 231, 470-475; Zaug, et al . , 1986, Nature, 324, 429-433; published International patent application No. WO 88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47, 207-216). The Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present in the target gene.

As in the antisense approach, the ribozymes can be composed of modified oligonucleotides (e.g., for improved stability, targeting, etc.) and should be delivered to cells that express the target gene in vivo . A preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous target gene messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency. Endogenous target gene expresεion can alεo be reduced by inactivating or "knocking out" the target gene or its promoter using targeted homologous recombination (e.g., see Smithies, et al . , 1985, Nature 317, 230-234; Thomas and Capecchi, 1987, Cell 51, 503-512; Thompson, et al . , 1989, Cell 5, 313-321; each of which is incorporated by reference herein in its entirety) . For example, a mutant, non- functional target gene (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous target gene (either the coding regions or regulatory regions of the target gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that expresε the target gene in vivo . Inεertion of the DNA construct, via targeted homologous recombination, resultε in inactivation of the target gene. Such approacheε are particularly εuited in the agricultural field where modifications to ES (embryonic stem) cells can be used to generate animal offspring with an inactive target gene (e .g. , see Thomas and Capecchi, 1987 and Thompson, 1989, supra) . However this approach can be adapted for use in humans provided the recombinant DNA constructs are directly administered or targeted to the required site in vivo using appropriate viral vectors.

Alternatively, endogenous target gene expresεion can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the target gene (i.e., the target gene promoter and/or enhancers) to form triple helical structures that prevent transcription of the target gene in target cells in the body. (See generally, Helene, 1991, Anticancer Drug Des., 6(6), 569-584; Helene, et al . , 1992, Ann. N.Y. Acad. Sci., 660, 27-36; and Maher, 1992, Bioaεεayε 14(12), 807-815). Nucleic acid moleculeε to be uεed in triplex helix formation for the inhibition of tranεcription εhould be single stranded and composed of deoxynucleotides. The baεe composition of these oligonucleotides must be designed to promote triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretcheε of either purines or pyrimidineε to be preεent on one εtrand of a duplex. Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC⁺ triplets across the three associated strandε of the resulting triple helix. The pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand. In addition, nucleic acid molecules may be chosen that are purine-rich, for example, contain a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residueε are located on a εingle εtrand of the targeted duplex, reεulting in GGC tripletε across the three strandε in the triplex.

Alternatively, the potential εequenceε that can be targeted for triple helix formation may be increaεed by creating a so called "switchback" nucleic acid molecule. Switchback molecules are syntheεized in an alternating 5 *-3', 3' -5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex. In instanceε wherein the antiεenεe, ribozyme, and/or triple helix molecules described herein are utilized to inhibit mutant gene expression, it is possible that the technique may so efficiently reduce or inhibit the transcription (triple helix) and/or translation (antisense, ribozyme) of mRNA produced by normal target gene alleles that the possibility may arise wherein the concentration of normal target gene product present may be lower than is necessary for a normal phenotype. In such cases, to ensure that substantially normal levels of target gene activity are maintained, therefore, nucleic acid molecules that encode and express target gene polypeptides exhibiting normal target gene activity may, be introduced into cells via gene therapy methods such as those described, below, in Section 5.9.2 that do not contain sequenceε εusceptible to whatever antisense, ribozyme, or triple helix treatments are being utilized. Alternatively, in instances whereby the target gene encodes an extracellular protein, it may be preferable to co- administer normal target gene protein in order to maintain the requisite level of target gene activity.

Anti-sense RNA and DNA, ribozyme, and triple helix molecules of the invention may be prepared by any method known in the art for the synthesis of DNA and RNA molecules, as discussed above. These include techniques for chemically syntheεizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical εynthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.

5.9.2. GENE REPLACEMENT THERAPY

With respect to an increase in the level of normal fshOδ gene expression and/or fshOδ gene product activity, fεhOδ gene nucleic acid sequences, described, above, in Section 5.1, can, for example, be utilized for the treatment of a fshOδ disorder, a neuropsychiatric disorder, such as BAD, or an oxidative stress disorder. Such treatment can be administered, for example, in the form of gene replacement therapy. Specifically, one or more copies of a normal fshOδ gene or a portion of the fεhOδ gene that directε the production of a fshOδ gene product exhibiting normal fεhOδ gene function, may be inεerted into the appropriate cellε within a patient, using vectors that include, but are not limited to adenovirus, adeno-asεociated viruε, and retroviruε vectors, in addition to other particles that introduce DNA into cells, such as liposomeε.

Because the fεhOδ gene is expresεed in the brain, εuch gene replacement therapy techniqueε εhould be capable delivering fεhOδ gene sequences to these cell types within patients. Thus, in one embodiment, techniques that are well known to those of skill in the art (see, e.g., PCT Publication No. WO89/10134, published April 25, 1988) can be used to enable fshOδ gene sequenceε to cross the blood-brain barrier readily and to deliver the sequences to cells in the brain. With respect to delivery that is capable of crosεing the blood-brain barrier, viral vectors such as, for example, thoεe described above, are preferable. In another embodiment, techniques for delivery involve direct administration of such fshOδ gene sequenceε to the εite of the cellε in which the fεhOδ gene sequenceε are to be expreεsed.

Additional methods that may be utilized to increase the overall level of fshOδ gene expression and/or fshOδ gene product activity include the introduction of appropriate fsh05-expressing cells, preferably autologous cells, into a patient at positions and in numbers that are sufficient to ameliorate the symptoms of a fεhOδ disorder, a neuropsychiatric disorder, such as BAD, or an oxidative stress disorder. Such cells may be either recombinant or non-recombinant.

Among the cells that can be administered to increase the overall level of fshOδ gene expression in a patient are normal cells, preferably brain cells, that express the fshOδ gene.

Alternatively, cells, preferably autologous cells, can be engineered to express fεhOδ gene sequences, and may then be introduced into a patient in positions appropriate for the amelioration of the symptoms of a fεhOδ disorder, a neuropsychiatric diεorder, εuch as BAD, or an oxidative streεε diεorder. Alternately, cellε that expreεε an unimpaired fεhOδ gene and that are from a MHC matched individual can be utilized, and may include, for example, brain cellε. The expreεsion of the fεhOδ gene sequenceε iε controlled by the appropriate gene regulatory εequenceε to allow εuch expreεsion in the necessary cell types. Such gene regulatory sequences are well known to the skilled artisan. Such cell-based gene therapy techniques are well known to those skilled in the art, see, e.g., Anderson, U.S. Patent NO. 5,399,349. When the cells to be administered are non- autologous cells, they can be administered using well known techniques that prevent a hoεt immune response against the introduced cellε from developing. For example, the cellε may be introduced in an encapsulated form which, while allowing for an exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognized by the host immune system.

Additionally, compounds, such as those identified via techniques such as those described, above, in Section 5.8, that are capable of modulating fεhOδ gene product activity can be administered using standard techniques that are well known to those of skill in the art. In instances in which the compounds to be administered are to involve an interaction with brain cells, the administration techniques should include well known ones that allow for a crosεing of the blood-brain barrier.

5.10. PHARMACEUTICAL PREPARATIONS

AND METHODS OF ADMINISTRATION The compounds that are determined to affect fεhOδ gene expresεion or gene product activity can be adminiεtered to a patient at therapeutically effective doses to treat or ameliorate a fεhOδ disorder, a neuropsychiatric disorder, such as BAD, or an oxidative stress disorder. A therapeutically effective dose refers to that amount of the compound sufficient to result in amelioration of symptomε of such a disorder.

5.10.1. EFFECTIVE DOSE Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD_JO (the dose lethal to 50% of the population) and the EDso (the doεe therapeutically effective in 50% of the population) . The doεe ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD^/ED^. Compounds that exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

The data obtained from the cell culture aεsays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of εuch compounds lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC^ (i . e . , the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

5.10.2. FORMULATIONS AND USE Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.

Thus, the compounds and their physiologically acceptable salts and solvates may be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.

For oral administration, the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose) ; fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate) ; lubricants (e.g., magnesium stearate, talc or silica); disintegrantε (e.g., potato starch or sodium starch glycolate) ; or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suεpenεionε, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e .g . , lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils) ; and preservatives (e . g. , methyl or propyl-p-hydroxybenzoates or sorbic acid) . The preparations may also contain buffer saltε, flavoring, coloring and sweetening agents as appropriate.

Preparations for oral administration may be suitably formulated to give controlled release of the active compound.

For buccal administration the compositionε may take the form of tabletε or lozenges formulated in conventional manner.

For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from presεurized packε or a nebuliεer, with the uεe of a suitable propellant, e .g. , dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e .g. , gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi- dose containers, with an added preservative. The compositions may take such forms as suεpensions, solutions or emulsionε in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

In addition to the formulationε deεcribed previouεly, the compoundε may alεo be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

The compositionε may, if deεired, be preεented in a pack or dispenser device that may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.

6. EXAMPLE: IDENTIFICATION AND CLONING OF THE fsh05 GENE In the Example presented in this Section, studies are described that, first, define an interval approximately 500 kb on the long arm of human chromosome 18 within which a region associated with a neuropsychiatric disorder is located and, second, identify and clone a novel gene, referred to herein as fshOδ, which lies within this region and which can be involved in neuropsychiatric disorders.

6.1. MATERIALS AND METHODS Linkage Disecruilibrium. Linkage disequilibrium (LD) studieε were performed using DNA from a population εample of neuropεychiatric diεorder (BP-I) patientε. The population εample and LD techniqueε were as described in Freimer et al., 1996, Nature Genetics !2.:436-441. The present LD study took advantage of the additional physical markers identified via the physical mapping techniques described below.

Yeast artificial chromosome (YAC) mapping. For physical mapping, yeast artificial chromosomes (YACs) containing human sequences were mapped to the region being analyzed based on publicly available maps (Cohen et al . , 1993, C.R. Acad. Sci. 316, 1484-1488). The YACs were then ordered and contig reconstructed by performing standard short tag sequence (STS) -content mapping with microsatellite markers and non-polymorphic STSs available from databaseε that surround the genetically defined candidate region.

Bacterial artificial chromosome (BAC) mapping. The STSs from the region were uεed to εcreen a human BAC library (Reεearch Geneticε, Huntεville, AL) . The endε of the BACε were cloned or directly εequenced. The end sequences were used to amplify the next overlapping BACs. From each BAC, additional microsatellites were identified. Specifically, random sheared libraries were prepared from overlapping BACs within the defined genetic interval. BAC DNA was sheared with a nebulizer (CIS-US Inc. , Bedford, MA) . Fragments in the size range of 600 to 1,000 bp were utilized for the sublibrary production. Microsatellite sequenceε from the εublibrarieε were identified by corresponding microsatellite probes. Sequences around such repeats were obtained to enable development of PCR primers for genomic DNA.

Radiation hybrid (RH. mapping. Standard RH mapping techniques were applied to a Stanford G3 RH mapping panel (Research Genetics, Huntεville, AL) to order all microsatellite markers and non-polymorphic STSs in the region being analyzed.

Sample sequencing. Random sheared libraries were made from all the BACs within the defined genetic region. Approximately 6,000 subclones within the approximately 500 kb region were sequenced with vector primers in order to achieve a 6-fold sequence coverage of the region. All sequenceε were processed through an automated sequence analysis pipeline that assessed quality, removed vector sequences and masked repetitive sequences. The resulting sequences were then compared to public DNA and protein databases using BLAST algorithms (Altschul, et al . , 1990, J. Molec. Biol., 215, 403-410) . cDNA library screening. A human fetal brain cDNA library was purchased Clontech (Palo Alto, CA) and used according to manufacturer's recommendations. cDNA selection was uεed as an additional method for gene identification of transcribed sequenceε over large regions of the genome. Through a combination of characterizations including physical mapping and RNA hybridization, the selected cDNAs were arranged into transcription unitε. The cDNA εelection technique was carried out as described by Rommens, et al . (1994, in Identification of Tranεcribed Sequenceε , Hochgeschwender and Gardiner, edε., Plenum Preεε, New York, pp. 65-79) .

Transcription mapping. The combination of sample sequencing and cDNA εelection were arranged into tentative transcription units which provided the framework for a detailed transcription map of the genomic region of interest. Cloning of full length fshOδ construct. The full length fshOδ construct was made by restriction digestion and ligation of overlapping fsh05 cDNA clones. The cDNA clone zsh36 was constructed by first and second strand synthesis from human placental RNA purchased from Clontech (Palo to, CA) . The clone fshOSwl3 was isolated from a human skeletal muscle library (Stratagene, La Jolla, CA) . The two clones, zsh36 and fsh05wl3 overlap and contain a unique Sinai site in the overlapping region. The clones were digested with Smal and EcoRI (to release the fragments from the vector) and the correct fragments were isolated from an IMP agarose gel . The vector pBluescript SK (Stratagene, La Jolla, CA) was prepared by digestion with EcoRI. A three-way ligation was performed using the two S al/EcoRI fragments and the vector. The ligation was transformed into DH10 cells. Clones were screened for the correct orientation by PCR and by restriction digestion. The positive clones were then sequenced to confirm the cloning junction.

The next step was to extend the newly formed clone designated fsh05FLl9 3' using clone ym36h07 (Genome Systems, St. Louis, MO ) . These clones overlap and there is a Xhol site in the region of overlap. fsh05FL19 was digested with Xhol releasing a Xhol fragment from this clone. U55988 was digested with Xhol and the correct fragment was isolated from IMP agarose. The U55988 and fsh05FLl9 fragments were ligated together. Clones were screened by digestion for proper orientation of the U55988 Xhol fragment. Positive clones were then sequenced to confirm the cloning junctions. One of these clones, designated EpDHlOb (SEQ ID NO: 7) was deposited with the ATCC [Accession No. 98472].

Determination of Exon Sizes. The genomic structure of the fsh05 was determined by aligning the cDNA sequence with the genomic sequence and by identifying the splice sites for the intron-exon boundaries. The intron between exon 1 and exon 2 is approximately 6489 bp in length. Northern analvsiε. Standard Northern analysis techniques were utilized in probing human and fetal multiple tissue Northern blots purchased from Clontech (Palo Alto, CA) . Blots were hybridized to a 777 bp probe, which was derived by PCR from a fεhOδ cDNA sequence.

In situ hybridization analyεis. In situ hybridization was performed as described in Rhodes et al. (1996, J. Neurosci. 16(16) :4846-4860) .

6.2. RESULTS Genetic regions involved in bipolar affective disorder (BAD) human genes had previously been reported to map to portions of the long (18q) and short (18p) arms of human chromosome 18, including a broad 18q genetic region of about 6-7 cM between markers D18S469 and D18S554 (U.S. Provisional Applications Serial Nos. 60/014,498 and

60/023,438, filed on March 28, 1996 and August 23, 1996, respectively, the entire contents of each of which are incorporated herein by reference; Freimer, et al . , 1996, Neuropsychiat. Genet. 67, 254-263; Freimer, et al . , 1996, Nature Geneticε 12, 436-441) , the entire contentε of each of which are incorporated herein by reference.

Linkage Diseguilibrium. Prior to attempting to identify gene sequenceε, εtudieε were performed to further narrow the neuropsychiatric disorder region. Specifically, a linkage disequilibrium (LD) analysis was performed using population sampleε and techniqueε as described in Section 6.1, above, which took advantage of the additional physical markers identified via the physical mapping techniques described below. Hiσh resolution phvεical mapping uεing YAC. BAC and

RH technicues. In order to provide the preciεe order of genetic markerε neceεεary for linkage and LD mapping, and to guide new microsatellite marker development for finer mapping, a high resolution physical map of the I8q23 candidate region was developed using YAC, BAC and RH techniques. For such physical mapping, first, YACs were mapped to the chromosome 18 region being analyzed. Using the mapped YAC contig as a framework, the region from publicly available markers D18S1161 and D18S554, which spanε most of the D18S469-D18S554 region described above, was also mapped and contiged with BACs. Sublibraries from the contiged BACε were conεtructed, from which microsatellite marker sequences were identified and sequenced.

To ensure development of an accurate physical map, the radiation hybrid (RH) mapping technique was independently applied to the region being analyzed. RH was used to order all microsatellite markers and non-polymorphic STSs in the region. Thus, the high resolution physical map ultimately constructed was obtained using data from RH mapping and STS- content mapping.

The new markers identified via physical mapping were typed in an LD analysiε of εampleε collected from familieε affected with bipolar affective diεorder. One interpretation of the results of this LD analysis narrows down the chromosome 18 long arm region within which a gene involved in neuropsychiatric disorders lies to an interval of about 500 kb between the publicly available markers D18S1121 and D18S380.

The BAC clones within the newly identified 500 kb neuropsychiatric disorder region were further analyzed to identify specific genes within the region. A combination of sample sequencing, cDNA selection and transcription mapping analyses were combined to arrange sequences into tentative transcription unitε, that iε, tentatively delineating the coding sequences of genes within this genomic region of interest.

One of the transcription units identified was termed fshOδ . The corresponding fshOδ gene can, therefore, be involved in neuropsychiatric disorderε. cDNA selection. fεhOS cDNA cloneε were isolated through εcreening and random εequencing of a human fetal brain cDNA library. Among the cDNA cloneε identified were FSH5-1 (ATCC accession No. 98317) and FSH5-2 (ATCC accession No. 98318) . Upon sequence analysis of these clones, a partial cDNA sequence was deduced (SEQ ID N0:1J that encoded a partial amino acid sequence that was missing the first 60 amino acids encoded by the full length cDNA (see below) . In addition, an EST was identified, EST U55988, that encompasses the 3', primarily non-coding, region of fsh05.

Cloning of full length fsh05 construct. A full length cDNA, designated EpDHlOb (ATCC accession No. 98472], was isolated as described above in Section 6.1. The cDNA encodes a protein of 363 amino acids and has an open reading frame of 1089 base pairs (SEQ ID NO:8).

Genomic structure. Upon further analysis of genomic sequences, it was determined that the full length fsh05 gene sequence (SEQ ID NO: 12) is contained within BAC54 (Identification Reference EpHS996, ATCC Accession No. 98363). fshOS nucleotide and amino acid sequences are shown in

Figures 1A-3A.

Exon sizes. Exons 1 and 2 and their intron-exon border sequences are shown in Figures 3 -3B. Exon 1 and Exon 2 are separated by an intron of 6489 bp. Exon 1 is 167 bp in length (as shown delineated by the brackets [] in Figure 3A) . One set of primers were designed to hybridize to sequences outside and flanking the exon (as shown in bold) and to hence amplify the whole coding region plus the intron-exon boundaries. The amplification product is 325 bp including the intron-exon borders and the entire exon 1 (see also Table 1 above) .

Exon 2 and its intron-exon border sequences are shown in Figure 3A-3B. Exon 2 is 925 bp in length including the stop codon, but not the 3' -UTR (as shown delineated by the brackets [ ] in Figures 3A-3B) . The four sets of primers indicated in the sequence (see also Table 3) amplify products that overlap with each other and cover the whole coding region of exon 2 plus the 5' intron-exon border. Amino acid sequence identity. The fsh05 gene product sequence depicted in Figures 1A-1C exhibits some amino acid sequence similarity with two known genes identified from other distantly related species. First, the fsh05 gene product exhibits approximately 43% amino acid sequence identity with the entire coding region (340 amino acids) of p36, a possible Leishmania amazonensis quinone oxidoreductase

(Liu and Chang, 1994, Mol. Biochem. Parasitol. 66, 201-120).

Table 1

Table 2

Table 3

Primer Name Sequence S-3Q ID NO.

Exon 1 exlf 5* AGAGAGCGGGCGGAGGCGCAG 3' 16 exlr 5' ACGCGGGCGGGCTGGGGACT 3^* 17

Exon 2 ex2Af 5 ' CTCTAAGCAGAATCTAAATGCCT 3 * 18 ex2Ar 5' TAAGATACTCGGGTTTCACTGAG 3' 19 ex2Bf 5' ATACACAGTTGGCCAAGCTGTG 3 20 ex2Br 5' TTATAGTTGATAGGACGATCACAG 3 21 ex2Cf 5' CCAGTTTGCCATGCAGCTTTC 3' 22 ex2Cr 5' TGTACGCTGGCAGATTTCTTGA 3^* 23 ex2Df 5 ' CTTGATAGTAATAGGGTTTATCTCTG 3' 24 ex2Dr 5* GAGTAATTCTGAGACATAAAGTGC 3' 25

The depicted portion of the fεhOδ gene product also exhibits approximately 46% amino acid sequence identity with the 341 terminal amino acid portion of ARP, an Arabidopsis thaliana NADPH oxidoreductase homolog (Babiychuk, et al . , 1995, J. Biol. Chem. 270, 26224-26231). Like ARP, the fshOδ gene product may therefore provide the cells in which it is expressed with protection against oxidative stress, as described below.

ARP, with which the fεhOδ gene product shares at least 46% amino acid sequence identity, has been previously identified by a functional assay in which expression of ARP in a yeast strain provides the yeast host with a defense against oxidative stresε (Babiychuk, et al . , 1995, J. Biol. Chem. 270, 26224-26231). The role of fshOδ gene product in protection of cellε against oxidative stress may be similarly asseεsed by such an assay.

The role of fεhOδ gene product in protection of cells against oxidative stresε may alεo be assessed by assays in which expresεion of fshOδ in an appropriate bacterial εtrain provideε the bacterial hoεt with a defenεe against oxidative stresε (Liu and Chang, 1994, Mol. and Bioc. Paraε. 66:201-210; Storz, 1989, J. Bact. 171:2049-2055). Such bacterial strains can include, but are not limited to. Leiεhmania spp. , Eεcherichia coli , and Salmonella typhimurium.

Oxidative εtress refers to the damage done to cells and tissues by reactive oxygen species (ROS) , such as superoxide anion and hydrogen peroxide, which are natural byproducts of metabolism and can also result from exposure to free radical-generating compounds in the environment. For example, ROS can oxidize proteins, altering or destroying their function or oxidize lipids, causing a chain reaction leading to losε of cell membrane integrity. Hydrogen peroxide, which breakε down to produce hydroxyl radicals, can alεo activate NF-kB, a transcription factor involved in stimulating inflammatory responεeε. Aerobic organisms have evolved a number of enzymatic and non-enzymatic antioxidant defense mechanismε to counteract the harmful effectε of ROS and maintain the cellular εteady-εtate of pro-oxidantε and antioxidants (Sies, 1993, Eur. J. Biochem. 215:213-219). The carboxy1-terminal half of the ARP protein, which iε homologous to the entire fsh05, was shown to be the functional domain that provided the defense against oxidative stress in the experiments mentioned above. Therefore, it is predicted that fsh05 performs a similar protective function against oxidative streεε in human cells.

Further structural analysis of the carboxyl- terminal half of ARP, with which the fεhOδ gene product shares at least 46% amino acid sequence identity, shows that it belongs to the zeta-crystallin superfamily, a collection of quinone oxidoreductaseε (Babiychuk, et al . , 1995, J. Biol. Chem. 270, 26224-26231) . High levelε of zeta-cryεtallin iε expreεεed in guinea pig lens and is thought to be an adaptation to control ROS formation. An autoεomal dominant mutation in the guinea pig zeta-cryεtallin gene is associated with congenital cataract formation (Huang, et al . , 1990, Exp. Eye Research 50:317-325). In general, the accumulation of oxidative stresε is recognized to be contributing factor to tisεue damage in conditionε ranging from autoimmunity, inflammation and ischemia, to head trauma, cataracts, and neurological disorders such as stroke, Parkinson's disease and Alzheimer's disease. Defects in antioxidant defense mechanisms, such as mutations in oxidoreductases, therefore, are thought to be responεible for variouε disease development. For example, mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral scleroεis (Rosen, et al . , 1993, Nature 362:59-62) and mutations in mitochondrial cytochrome c oxidaεe geneε εegregate with late-onset Alzheimer's disease (Davis, et al . , 1997, Proc. Natl. Acad. Sci. USA 94:4526-4531).

Northern analysis. Northern analysiε waε uεed to examine fshOδ expression. The Northern analysis revealed that fshOδ is expressed in adult heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, and in fetal brain, lung, liver, and kidney. Bands of 6 kb and 4 kb were seen in all the above tissues.

In situ hybridization analysis. In situ analysiε using monkey brain shows that the fshOδ sequence is highly expressed in the brain, and is widely and predominantly expressed in cortical areas, including the hippocampus and entorhinal cortex.

There is also a high level of expression in the cerebellum and amygdala. In cortical regions, there is some clear laminar differentiation, with the CA3 subfield of the hippocampus and layer 6 of entorhinal cortex giving the strongeεt signal. There were lower levels of expression of fεhOδ in basal ganglia, i.e., the caudate and putamen, and in the thalamus, hypothalamus, and brainstem. Given the high level and εpecific pattern of expression of fsh05 in brain sections, fshOδ is likely to play an important defense mechanism against oxidative stress in brain, as well as other tissues where it is expresεed, and that, aε a corollary, mutationε in fshOδ could be involved in BAD aε well aε other neurological disorders.

For example, the regions in which fshOδ is expresεed, e.g., the hippocampuε, thalamuε, and baεal ganglia, as well as the neocortex, cerebellum, and hemispheric white matter, are regions of the brain in which extracellular plaques containing amyloid deposition, which are a prominent feature of Alzheimer's disease, may form (see e .g. , Goldman et al., 1991, in Kandel et al. , Principleε of Neural Science , 3rd Edition, Elsevier, New York, p. 977) .

Furthermore, the regions in which fεhOδ is expressed, e.g., the hippocampus and its major input pathway from the entorhinal cortex, the amygdala, the hypothalamus, the thalamuε, and portions of the neocortex compriεe part of the neural pathway proposed to regulate emotions (see, e.g., Kupfermann, 1991, in Kandel et al., Principleε of Neural Science , 3rd Edition, Elsevier, New York, p. 737) . Altered expression of fshOδ in εuch regionε may lead to disorders of emotional stateε, such aε BAD.

7. EXAMPLE: PROTECTION OF E. COLI FROM

OXIDATIVE STRESS BY EXPRESSION OF fshOδ

In this example, fshOδ gene products are identified by aεεayε in which the regulated expression of fshOδ in E. coli provides the E. coli host with a defense against oxidative stress (Liu and Chang, 1994, Mol. and Bioc. Paras. 66:201-210; Storz, 1989, J. Bact. 171:2049-2055). Such asεays can be used to identify fshOδ gene products, and portions, fragments or domains thereof that confer a protective defense against oxidative stress. Such assayε can also be used in screenε of teεt compoundε that affect fεhOδ activity and that may be uεed to ameliorate the εymptoms of a fεhOδ disorder or a neuropsychiatric disorder, such as BAD. pBAD bacterial expresεion vectors (Guzman, 1995, J.

Bact. 177(14) :4121-4130) are used to express a full length fεhOδ cDNA in E . coli strain KS272. The pBAD vectors contain the araB promotor, which is inducible with arabinose. Expreεεion with theεe vectorε iε titratable by controlling arabinose concentration. This promotor also allows for highly efficient repression of expresεion with glucose. There are two general classes of vector in the pBAD series. pBADlδ contains a relatively high copy number of pBR origin of replication. pBAD30 contains a very low copy number of pACYC origin. This permits more control over expresεion levelε than with typical bacterial expreεεion vectorε. Experiments are run in parallel with both types.

Assays are run using the following filter paper test. KS272 cells containing fεhOδ constructε or vector controls are plated in NZY top agarose onto NZY plates containing ampicillin (lOOmg/ml) and either L-arabinose or glucoεe (in varying concentrationε) . One quarter inch filter paper discs saturated in 1.0 - 1.5 mM diamide, 3% hydrogen peroxide, or 3% cumene hydroperoxide are placed in the center of the plates. The plates are incubated overnight at 37° C. Diameters of the areas of inhibited bacterial growth are measured. These measurementε quantitate the degree of protection, if any, that varying levels of expreεεed fεhOδ provide to bacterial cellε.

8. DEPOSIT OF MICROORGANISMS The following microorganisms were deposited with the American Type Culture Collection (ATCC) , Rockville, Maryland, on the date indicated and assigned the indicated accesεion number:

Microorqaniεm ATCC Accesεion No. Date of Depoεit

FSH5-1 ATCC 98317 February 7, 1997

FSH5-2 ATCC 98318 February 7, 1997

EpHS996 ATCC 98363 March 19, 1997 E EppDDHHllOObb ATCC 98472 June 20, 1997

The preεent invention iε not to be limited in εcope by the εpecific embodimentε deεcribed herein, which are intended as εingle illuεtrations of individual aspects of the invention, and functionally equivalent methods and components are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

International Application No: PCT/ /

MICROORGANISMS

Optional Sheet in connection with the microorganism referred to on page 90 , lines 1-10 of the description '

A. IDENTIFICATION OF DEPOSIT '

Further deposits are identified on an additional sheet '

Name of depositary institution ' American Type Culture Collection

Address of depositary institution (including postal code and country)

12301 Parklawn Drive Rockville, MD 20852 US

Date of deposit ' February 7, 1997 Accession Number ' 98317

B. ADDITIONAL INDICATIONS ' (leave blank if not applicable) This information is continued on a separate attached sheet

C. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE " «_k»_u.»- -_v-M

D. SEPARATE FURNISHING OF INDICATIONS * (leave blank ,f no. applicable)

The indications listed below will be submitted to the International Bureau later ' (Specify the general nature of the indications e g , "Accession Number of Deposit")

E. G This sheet was received with the International application when filed (to be checked by the receiving Office)

(Authorized Officer)

G The date of receipt (from the applicant) by the International Bureau "

(Authorized Officer) Form PCT/RO/134 (January 1981 ) International Application No: PCT/

Form PCT/RO/1 34 (co .)

American Type Culture Collection

12301 Parkiawn Drive Rockville, MD 20852 US

Accession No. Date of Deposit 9831 8 February 7, 1997 98363 March 19, 1997 98472 June 20, 1997

Claims

WHAT IS CLAIMED IS;

1. An isolated nucleic acid molecule comprising: a. a nucleic acid molecule encoding a polypetide comprising the amino acid sequence shown in FIG. 1 (SEQ ID NO. 12) ; b. a nucleic acid molecule encoding a poiypeptide comprising the amino acid sequence shown in FIG. 1 (SEQ ID NO. 2); or c. a nucleic acid molecule encoding a poiypeptide comprising the amino acid sequence encoded by the nucleic acid insert of the clone contained in ATCC accession No. 98317, in ATCC accession No. 98318 or in ATCC accession No. 98472.

2. The isolated nucleic acid molecule of Claim 1 wherein the nucleic acid molecule contains the nucleotide sequence shown in FIG. 2 (SEQ ID NO. 12) .

3. An isolated nucleic acid molecule which hybridizes to the complement of the nucleic acid molecule of Claim 1 and encodes a poiypeptide involved in a neuropsychiatric disorder.

4. The isolated nucleic acid molecule of Claim 3 wherein the neuropsychiatric disorder is schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective disorder or a unipolar affective disorder.

5. The isolated nucleic acid molecule of Claim 4 wherein the bipolar affective disorder is severe bipolar affective (mood) disorder, bipolar affective (mood) disorder with hypomania and major depression, or schizoaffective disorder manic type.

6. The isolated nucleic acid molecule of Claim 4 wherein the unipolar affective disorder i╬╡ unipolar major depressive disorder.

7. An isolated nucleic acid molecule which hybridizes under stringent conditions to the complement of the nucleic acid molecule of Claim 1.

8. The isolated nucleic acid molecule of Claim 3 or 7 wherein the nucleic acid molecule encodes a naturally occurring poiypeptide.

9. A nucleotide vector containing the nucleotide sequence of Claim 1, 3 or 7.

10. An expression vector containing the nucleotide sequence of Claim 1, 3 or 7 in operative association with a nucleotide regulatory sequence that controls expression of the nucleotide sequence in a host cell.

11. The expression vector of Claim 10, wherein said regulatory element is selected from the group consisting of the cytomegalovirus hCMV immediate early gene, the early or late promoters of SV40 adenovirus, the lac system, the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage A, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase, the promoters of acid phosphatase, and the promoters of the yea╬╡t ╬▒-mating factors.

12. A genetically engineered host cell that contains the nucleotide sequence of Claim 1, 3 or 7.

13. A genetically engineered host cell that contains the nucleotide sequence of Claim 1, 3 or 7 in operative a╬╡╬╡ociation with a nucleotide regulatory ╬╡equence that controls expression of the nucleotide sequence in the host cell.

14. An isolated gene product comprising: a. the amino acid sequence shown in FIG. 2 (SEQ

ID NO. 12) ; or b. the amino acid sequence encoded by the nucleic acid insert of the clone contained in ATCC acces╬╡ion No. 98317, ATCC acce╬╡sion No. 98318 or ATTC accession No. 98472.

15. An i╬╡olated gene product encoded by the nucleic acid molecule of Claim 3 or 7.

16. An antibody that immunospecifically binds the gene product of Claim 14.

17. An antibody that immunospecifically binds the gene product of Claim 15.

18. A method for diagnosing a neuropsychiatric di╬╡order in a mammal, comprising: measuring fshO╬┤ gene expression in a patient sample.

19. The method of Claim 18 wherein the neuropsychiatric disorder is schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective di╬╡order or a unipolar disorder.

20. The method of Claim 19 wherein the bipolar affective di╬╡order i╬╡ ╬╡evere bipolar affective (mood) di╬╡order, bipolar affective (mood) di╬╡order with hypomania and major depression, or schizoaffective disorder manic type.

21. The method of Claim 19 wherein the unipolar affective disorder is unipolar major depres╬╡ive disorder.

22. The method of Claim 18 in which expression is measured by detecting fshO╬┤ mRNA transcripts.

23. The method of Claim 18 in which expres╬╡ion i╬╡ mea╬╡ured by detecting f╬╡hO╬┤ gene product.

24. A method for diagnoεing a fshOδ disorder in a mammal, σompriεing: meaεuring fshOδ gene expreεεion in a patient sample.

25. The method of Claim 24 in which expression is measured by detecting f╬╡hO╬┤ mRNA transcript╬╡.

26. The method of Claim 24 in which expre╬╡sion i╬╡ mea╬╡ured by detecting fshO╬┤ gene product.

27. A method for diagnosing a neuropsychiatric disorder in a mammal, comprising: detecting a fshO╬┤ gene mutation contained in the genome of the mammal.

28. The method of Claim 27 wherein the neuropsychiatric di╬╡order is schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective disorder or a unipolar disorder.

29. The method of Claim 28 wherein the bipolar affective disorder is severe bipolar affective (mood) di╬╡order, bipolar affective (mood) di╬╡order with hypomania and major depression, or schizoaffective disorder manic type.

30. The method of Claim 28 wherein the unipolar affective disorder is unipolar major depressive disorder.

31. A method for diagno╬╡ing a fshO╬┤ disorder in a mammal, compri╬╡ing: detecting a fshO╬┤ gene mutation contained in the genome of the mammal.

32. A method for identifying a compound capable of modulating a f╬╡hO╬┤ activity, comprising: a. contacting a compound to a cell that expres╬╡e╬╡ a f╬╡hO╬┤ gene; b. mea╬╡uring the level of fshO╬┤ gene expre╬╡╬╡ion in the cell; and c. comparing the level obtained in (b) to fshOS gene expres╬╡ion level obtained in the absence of the compound; such that if the level obtained in (b) differs from that obtained in the absence of the compound, a compound capable of modulating a fshO╬┤ activity ha╬╡ been identified.

33. The method of Claim 32 wherein the compound increases the level of fshO╬┤ gene expression.

34. The method of Claim 32 wherein the compound decreases the level of fshO╬┤ gene expression.

35. The method of Claim 32 in which expression of the fshO╬┤ gene is detected by measuring fshO╬┤ mRNA transcript╬╡ .

36. The method of Claim 32 in which expression of the fshO╬┤ gene is detected by measuring fshO╬┤ gene product.

37. The method of Claim 32 wherein the compound is a small organic molecule.

38. A method for identifying a compound capable of treating a neuropsychiatric disorder, comprising: a. contacting a compound to a cell that expresses a f╬╡hO╬┤ gene; b. measuring the level of f╬╡hO╬┤ gene expres╬╡ion in the cell; and c. comparing the level obtained in (b) to f╬╡hO╬┤ gene expression level obtained in the absence of the compound; such that if the level obtained in (b) differs from that obtained in the absence of the compound, a compound capable of treating a neuropsychiatric disorder has been identified.

39. The method of Claim 38 wherein the neuropsychiatric di╬╡order i╬╡ schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective disorder or a unipolar disorder.

40. The method of Claim 39 wherein the bipolar affective di╬╡order i╬╡ ╬╡evere bipolar affective (mood) di╬╡order, bipolar affective (mood) di╬╡order with hypomania and major depre╬╡sion, or schizoaffective disorder manic type.

41. The method of Claim 39 wherein the unipolar affective disorder is unipolar major depressive disorder.

42. The method of Claim 38 wherein the compound increa╬╡e╬╡ the level of f╬╡hO╬┤ gene expression.

43. The method of Claim 38 wherein the compound decrease╬╡ the level of f╬╡hO╬┤ gene expression.

44. The method of Claim 38 in which expression of the fshO╬┤ gene is detected by measuring f╬╡hO╬┤ mRNA tran╬╡cript╬╡.

45. The method of Claim 38 in which expression of the fshO╬┤ gene is detected by measuring fshO╬┤ gene product.

46. The method of Claim 38 in which the compound is a small organic molecule.

47. A method for treating a neuropsychiatric disorder in a mammal comprising administering to the mammal a compound that modulates the synthe╬╡is, expression or activity of a mammalian f╬╡hO╬┤ gene or f╬╡hO╬┤ gene product so that symptoms of the disorder are ameliorated.

48. The method of Claim 47 wherein the neuropsychiatric di╬╡order i╬╡ ╬╡chizophrenia, attention deficit di╬╡order, a ╬╡chizoaffective di╬╡order, a bipolar affective disorder or a unipolar disorder.

49. The method of Claim 48 wherein the bipolar affective disorder is severe bipolar affective (mood) disorder, bipolar affective (mood) disorder with hypomania and major depres╬╡ion, or ╬╡chizoaffective di╬╡order manic type.

50. The method of Claim 47 wherein the unipolar affective disorder is unipolar major depressive disorder.

51. The method of Claim 47 wherein the compound increases the synthesis, expression or activity of a mammalian f╬╡hO╬┤ gene or fshO╬┤ gene product.

52. The method of Claim 51 wherein the compound comprises the nucleic acid molecule of Claim 1, 3 or 7.

53. The method of Claim 51 wherein the compound is a small organic molecule.

54. The method of Claim 47 wherein the compound decreases the synthe╬╡is, expression or activity of a mammalian f╬╡hO╬┤ gene or f╬╡hO╬┤ gene product.

55. The method of Claim 54 wherein the compound provides an antisense or ribozyme molecule that blocks tran╬╡lation of f╬╡hO╬┤ mRNA╬╡.

56. The method of Claim 54 wherein the compound provide╬╡ a nucleic acid molecule that i╬╡ complementary to a fshOS gene and block╬╡ f╬╡hO╬┤ tran╬╡cription via triple helix formation.

57. The method of Claim 54 wherein the compound i╬╡ a ╬╡mall organic molecule.

58. An i╬╡olated nucleic acid molecule which hybridizes to the complement of the nucleic acid molecule of Claim 1 and encodes a poiypeptide involved in a fshO╬┤ disorder.

59. A method for treating a fshO╬┤ disorder in a mammal comprising administering to the mammal a compound to the mammal that modulates the synthesis, expression or activity of a mammalian f╬╡hO╬┤ gene or fshO╬┤ gene product so that symptoms of the disorder are ameliorated.

60. The method of Claim 59 wherein the compound increases the synthesis, expression or activity of a mammalian fshO╬┤ gene or fshO╬┤ gene product.

61. The method of Claim 60 wherein the compound comprises the nucleic acid molecule of Claim 1, 3 or 7.

62. The method of Claim 60 wherein the compound is a small organic molecule.

63. The method of Claim 59 wherein the compound decrea╬╡e╬╡ the ╬╡ynthe╬╡is, expres╬╡ion or activity of a mammalian fshO╬┤ gene or fshO╬┤ gene product.

64. The method of Claim 63 wherein the compound provide╬╡ an anti╬╡en╬╡e or ribozyme molecule that block╬╡ tran╬╡lation of f╬╡hO╬┤ mRNA╬╡.

65. The method of Claim 63 wherein the compound provides a nucleic acid molecule that is complementary to a fshOδ gene and blockε fshOδ tranεσription via triple helix formation.

66. The method of Claim 63 wherein the compound i╬╡ a ╬╡mall organic molecule.

67. A method of treating a neurop╬╡ychiatric di╬╡order re╬╡ulting from a mutation in a fshO╬┤ gene, in a mammal, compri╬╡ing ╬╡upplying the mammal with a nucleic acid molecule that encode╬╡ an unimpaired fshO╬┤ gene product ╬╡uch that an unimpaired f╬╡hO╬┤ gene product is expres╬╡ed and ╬╡ymptoms of the disorder are ameliorated.

68. The method of Claim 67 wherein the neuropsychiatric disorder is schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective disorder or a unipolar disorder.

69. The method of Claim 68 wherein the bipolar affective disorder is severe bipolar affective (mood) disorder, bipolar affective (mood) disorder with hypomania and major depression, or schizoaffective disorder manic type.

70. The method of Claim 68 wherein the unipolar affective disorder is unipolar major depressive disorder.

71. The method of Claim 67 in which a nucleic acid molecule encoding the unimpaired fshO╬┤ protein, contained in a pharmaceutically acceptable carrier, is administered to the mammal .

72. The method of Claim 71 in which the carrier is a DNA vector, a viral vector, a liposome or lipofectin.

73. The method of Claim 67 in which the nucleic acid encoding an unimpaired fshO╬┤ protein i╬╡ introduced into the brain of the mammal.

74. A method of treating a f╬╡hO╬┤ di╬╡order re╬╡ulting from a mutation in a f╬╡hO╬┤ gene in a mammal, compri╬╡ing supplying the mammal with a nucleic acid molecule that encodes an unimpaired f╬╡hO╬┤ gene product such that an unimpaired f╬╡hO╬┤ gene product i╬╡ expressed and symptoms of the disorder are ameliorated.

75. The method of Claim 74 in which a nucleic acid molecule encoding an unimpaired fshO╬┤ protein, contained in a pharmaceutically acceptable carrier, is administered to the mammal.

76. The method of Claim 75 in which the carrier is a DNA vector, a viral vector, a liposome or lipofectin.

77. A method of treating a neuropsychiatric di╬╡order re╬╡ulting from a mutation in a f╬╡hO╬┤ gene in a mammal, compri╬╡ing supplying the mammal with a cell comprising a nucleic acid molecule that encodes an unimpaired f╬╡hO╬┤ gene product such that the cell expresses unimpaired fshO╬┤ gene product and symptoms of the neuropsychiatric disorder are ameliorated.

78. The method of Claim 77 wherein the neuropsychiatric disorder i╬╡ ╬╡chizophrenia, attention deficit di╬╡order, a ╬╡chizoaffective di╬╡order, a bipolar affective disorder or a unipolar disorder.

79. The method of Claim 78 wherein the bipolar affective disorder is severe bipolar affective (mood) di╬╡order, bipolar affective (mood) di╬╡order with hypomania and major depre╬╡╬╡ion, or ╬╡chizoaffective di╬╡order manic type.

80. The method of Claim 78 wherein the unipolar affective di╬╡order i╬╡ unipolar major depre╬╡sive disorder.

81. The method of Claim 77 in which the cell is engineered ex vivo to expres╬╡ an unimpaired fshOS protein.

82. The method of Claim 77 in which the cell i╬╡ contained in a carrier.

83. The method of Claim 77 in which a nucleic acid molecule encoding an unimpaired fshO╬┤ protein, contained in a pharmaceutically acceptable carrier, i╬╡ admini╬╡tered to the mammal.

84. The method of Claim 83 in which the carrier is a DNA vector, a viral vector, a liposome or lipofectin.

85. A method of treating a fshO╬┤ di╬╡order re╬╡ulting from a mutation in a fshO╬┤ gene in a mammal, comprising supplying the mammal with a cell comprising a nucleic acid molecule that encodes an unimpaired f╬╡hO╬┤ gene product such that the cell expresses unimpaired fshO╬┤ gene product and symptoms of the disorder are ameliorated.

86. The method of Claim 85 in which the cell is engineered ex vivo to express an unimpaired fshO╬┤ protein.

87. The method of Claim 85 in which the cell is contained in a carrier.

88. The method of Claim 85 in which a nucleic acid molecule encoding an unimpaired fshO╬┤ protein, contained in a pharmaceutically acceptable carrier, is administered to the mammal.

89. The method of Claim 85 in which the carrier is a DNA vector, a viral vector, a liposome or lipofectin.

90. A method of mapping a human chromosome 18q region spanning DS18S1121 and 18SS30 chromosomal markers comprising identifying, aligning and detecting f╬╡hO╬┤ polymorphism╬╡ within the 18q region.

91. An i╬╡olated nucleic acid molecule which hybridize╬╡ to the complement of the nucleic acid molecule of Claim 1 and encode╬╡ a poiypeptide involved in an oxidative stres╬╡ di╬╡order.

92. The i╬╡olated nucleic acid molecule of Claim 91 wherein the oxidative ╬╡tress disorder is autoimmunity, inflammation, ischemia, head trauma, cataracts, ╬╡troke, Parkinson's disea╬╡e, Alzheimer's disease, or amyotrophic lateral sclero╬╡is.

93. An isolated gene product encoded by the nucleic acid molecule of Claim 91.

94. A nucleotide vector containing the nucleotide sequence of Claim 91.

95. A genetically engineered host cell that contains the nucleotide sequence of Claim 91.

96. A method for diagnosing an oxidative stre╬╡╬╡ di╬╡order in a mammal, compri╬╡ing: mea╬╡uring fshO╬┤ gene expression in a patient sample.

97. A method for diagno╬╡ing an oxidative ╬╡tress disorder in a mammal, comprising: detecting a fshO╬┤ gene mutation contained in the genome of the mammal.

98. A method for identifying a compound capable of modulating oxidative stress, comprising: a. contacting a compound to a cell that expres╬╡e╬╡ a f╬╡hO╬┤ gene; b. measuring a level of oxidative stres╬╡ expre╬╡sed by the cell; and c. comparing the level obtained in (b) to a level of oxidative stre╬╡╬╡ obtained in the absence of the compound; such that if the level obtained in (b) differ╬╡ from that obtained in the absence of the compound, a compound capable of modulating oxidative ╬╡tres╬╡ ha╬╡ been identified.

99. The method of Claim 98 wherein the compound increases the level of oxidative stre╬╡╬╡.

100. The method of Claim 98 wherein the compound decreases the level of oxidative stress.

101. The method of Claim 98 wherein the compound is a small organic molecule.

102. A method for treating an oxidative stress disorder in a mammal comprising administering to the mammal a compound that modulates the synthesis, expression or activity of a mammalian f╬╡hO╬┤ gene or fshO╬┤ gene product so that symptoms of the disorder are ameliorated.

103. A method of treating an oxidative stress disorder resulting from a mutation in a fshO╬┤ gene in a mammal, comprising ╬╡upplying the mammal with a cell comprising a nucleic acid molecule that encodes an unimpaired fshO╬┤ gene product ╬╡uch that the cell expre╬╡ses unimpaired f╬╡hO╬┤ gene product and symptoms of the oxidative stre╬╡╬╡ di╬╡order are ameliorated.

104. An i╬╡olated nucleic acid molecule comprising an intronic sequence of a fshO╬┤ gene.

105. The isolated nucleic acid molecule of Claim 104 compri╬╡ing an intron/exoh border.

106. The isolated nucleic acid molecule of Claim 104 comprising a nucleotide sequence of intronic sequence of Figure 3 (SEQ ID NO: 12) or complements thereof.

107. An isolated nucleic acid molecule compri╬╡ing an allelic variant of a polymorphic region of a fshO╬┤ gene, which allelic variant differ╬╡ from the allelic variant ╬╡et forth in SEQ ID NO: 12

108. A method for ╬╡electing an effective drug to admini╬╡ter to an individual having a di╬╡ea╬╡e or condition re╬╡ulting from a fshO╬┤ di╬╡order, comprising determining the identity of an allelic variant of at least one polymorphic region of the fshO╬┤ gene of the individual.

109. The method of Claim 108 , wherein the disease or condition is a neuropsychiatric disorder.

110. The method of Claim 109, wherein the neuropsychiatric disorder is schizophrenia, attention deficit disorder, a schizoaffective di╬╡order, a bipolar affective di╬╡order or a unipolar di╬╡order.

111. The method of Claim 108, wherein the disease or condition is an oxidative stress disorder.

112. The methods of Claim 111, wherein the oxidative stres╬╡ di╬╡order is autoimmunity, inflammation, ischemia, head trauma, cataracts, ╬╡troke, Parkin╬╡on'╬╡ di╬╡ea╬╡e, Alzheimer '╬╡ di╬╡ea╬╡e, or amyotrophic lateral sclerosis-

113. A method for determining the identity of an allelic variant of a polymorphic region of a fshO╬┤ gene in a nucleic acid sequence obtained from a subject, comprising contacting the nucleic acid sequence with a probe or primer having a ╬╡equence complementary to the fshO╬┤ gene ╬╡equence, to thereby determine the identity of the allelic variant.

114. The method of claim 113, wherein the probe or primer i╬╡ ╬╡elected from the group con╬╡i╬╡ting of nucleic acid╬╡ having a nucleotide ╬╡equence of exlf (SEQ ID NO.16), exlr (SEQ ID NO.17), ex2Af (SEQ ID NO.18), ex2Ar (SEQ ID NO.19), ex2Bf (SEQ ID NO.20), ex2Br (SEQ ID NO.21), ex2Cf (SEQ ID NO.22), ex2Cr (SEQ ID NO.23), ex2Df (SEQ ID NO.24) or ex2Dr (SEQ ID NO.25) .