MXPA00008949A - METHODS AND COMPOSITIONS FOR DIAGNOSING AND TREATING CHROMOSOME-18p RELATED DISORDERS - Google Patents

Abstract

The present invention relates to the mammalian HKNG1 gene, a gene associated with bipolar affective disorder (BAD) in humans. The invention relates, in particular, to methods for the diagnostic evaluation, genetic testing and prognosis of HKNG1 neuropsychiatric disorders including schizophrenia, attention deficit disorder, a schizoaffective disorder, a bipolar affective disorder or a unipolar affective disorder.

Description

METHODS AND COMPOSITIONS FOR DIAGNOSIS AND TREATMENT OF DISORDERS RELATED TO THE CROMOSOMA 18p This document is a continuation in part of the North American application No. 09 / 236,134, filed on January 22, 1999, which claims priority in accordance with 35 U.S.C. § 119 (e) (1) of provisional application No. 60 / 078,044 filed on March 16, 1998, of provisional application No. 60 / 088,312 filed on June 5, 1998, and provisional application no. . 60 / 106,056 filed on October 28, 1998, all of them being incorporated herein by reference in their entirety. 1. INTRODUCTION The present invention relates, first, to the HKNG1 gene which is shown here to be associated with disorders related to the central nervous system, for example, neuropsychiatric disorders, particularly bipolar affective disorder and schizophrenia and with disorders related to myopia . This invention includes recombinant DNA molecules and the cloning of vectors comprising HKNG1 gene sequences, and host cells and non-human host organisms engineered in such a manner as to contain such DNA molecules and cloning vectors. The present invention also relates to HKNG1 gene products, and to antibodies directed against such HKNG1 gene products. The present invention also relates to methods for using the HKNG1 gene and gene product, including drug screening assays, and diagnostic and therapeutic methods for the treatment of HKNG1 mediated disorders, including HKNG1-mediated neuropsychiatric disorders such as bipolar affective disorder , as well as myopia disorders mediated by HKNG1 such as autosomal dominant myopia of early onset. 2. BACKGROUND OF THE INVENTION There are only a few psychiatric disorders in which the clinical manifestations of the disorder can be correlated with demonstrable defects in the structure and / or function of the nervous system. Well-known examples of these disorders include Huntington's disease, which can be traced to a mutation in a single gene and in which neurons degenerate in the stria, and Parkinson's disease, in which dopaminergic neurons degenerate into the striae pathway. black The great majority of psychiatric disorders, however, probably involve subtle and / or undetectable changes, at cellular and / or molecular levels, in the structure and function of the nervous system. This lack of detectable neurological defects distinguishes "neuropsychiatric" disorders such as schizophrenia, attention deficit disorder, schizoaffective disorder, bipolar affective disorders, or unipolar affective disorder of neurological disorders in which anatomical or biochemical pathologies are evident. Therefore, the identification of the causative defects and neuropathologies of neuropsychiatric disorders are required in order to allow physicians to evaluate and prescribe appropriate treatments to cure or ameliorate the symptoms of these disorders. One of the most prevalent and potentially destructive neuropsychiatric disorders is bipolar affective disorder (BAD), also known as bipolar mood disorder (BP) or manic-depressive illness, characterized by episodes of high mood (mania) and depression (Goodwin et al., 1990, Manic Depressive Illness, Oxford University Press, New York). The most severe and clinically distinct forms of BAD are BP-I (severe bipolar affective disorder (mood)), which affects 2-3 million people in the United States of America, and SAD-M (schizoaffective disorder of the manic type). They are characterized by at least one complete episode of mania, with or without episodes of major depression (defined by low mood, or depression, with associated disorders in rhythmic behaviors such as sleep, food, and sexual activity). BP-I frequently co-segregates in families with more etiologically heterogeneous syndromes, such as, for example, unipolar affective disorder such as, for example, unipolar major depressive disorder (MDD), which is a more broadly defined phenotype (Freimer and Reus, 1992, in The Molecular and Genetic Basis of Neurological Disease, (the molecular and genetic basis of neurological disease), Rosenberg, et al., eds., Butterworths, New York, pages 951-965; Mclnnes and Freimer, 1995, Curr. Opin. Genet Develop., 5, 376-381). BP-I and SAD-M are severe mood disorders that are often difficult to distinguish between them on a cross-sectional basis, follow similar clinical courses, and segregate together in family studies (Rosenthal et al., 1980, Arch. General Psychiat. 37 804-810, Levinson and Levitt, 1987, Am. J. Psychiat., 144, 415-426, Goodwin et al., 1990, Manic Depressive Illness, (Manic Depressive Disorder), Oxford, University Press, New York). Accordingly, methods for distinguishing neuropsychiatric disorders such as these are required in order to effectively diagnose and treat individuals suffering from such disorders. Nowadays, individuals are typically evaluated for BAD using the criteria established in the most current version of the Diagnostic and Statistical Manual of Mental Disorders (DSM) of the Psychiatric Association of the Americas. While many drugs have been used to treat individuals diagnosed with BAD, including lithium salts, carbamazepine and valproic acid, none of the drugs available today is adequate. For example, pharmacological treatments are effective in only about 60-70% of individuals diagnosed with BP-I. Furthermore, it is currently impossible to predict which pharmacological treatment will be effective, for example in particular in individuals affected by BP-I. Usually, when the diagnosis is made, the affected individuals are prescribed one drug after another until they find an effective drug. An early prescription of an effective pharmacological treatment, therefore, is a critical factor for several reasons, including the avoidance of extremely dangerous manic episodes, the risk of progressive deterioration if effective treatments are not found, and the risk of significant side effects of the current treatments. The existence of a genetic component for BAD is strongly supported by segregation analysis and studies with twins (Bertelson et al., 1977, Br. J. Psychiat, 130, 330-351, Freimer and Reus, 1992, in The Molecular and Genetic Basis of Neurological Disease, (the molecular and genetic basis of neurological disease), Rosenberg, et al., Eds., Butterworths, New York, pages 951-965; Country, et al., 1992, Arch. Gen. Psychiat. , 703-708). Efforts to identify the chromosomal location of genes that may be involved in BP-I, however, have obtained discouraging results to the extent that reports of relationship between BP-I and markers on chromosomes X and 11 could not be replicated independently or confirmed in the reanalyses of original lineages, which indicates that with studies of ADB relationship, even extremely high results in individual locuses can be false positives (Barón, et al., 1987, Nature 326, 289-292; Egeland, et al., 1987, Nature 32 5, 783-787, Kelsoe, et al., 1989, Nature 342, 238-243, Baron, et al., 1993, Nature Genet, 3, 49-55). Recent research has suggested the possible location of BAD genes on chromosomes 18p and 21q, but in both cases the proposed candidate region is not well defined and there is no unequivocal support for any of these locations (Berrettini, et al., 1994, Proc. Nati, Acad Sci USA 91,5918-5921, Murray, et al-, 1994, Science 265, 2049-2054, Pauls, et al., 1995, Am. J. Hum. Genet. 57, 636- 643; Maier, et al., 1995, Psych. Res. 59, 7-15; Straub, et al., 1994, Nature Genet., 8, 291-296). Gene mapping for common diseases that are believed to be caused by multiple genes, such as BAD, can be complicated due to the typically imprecise definition of phenotypes, due to the etiological heterogeneity, and due to uncertainty as to the mode of genetic transmission of the disease trait. With neuropsychiatric disorders there is an even greater ambiguity to distinguish individuals that carry an affected genotype from genetically unaffected individuals. For example, we can define an affected phenotype for BAD by including one or more of the broad groupings of diagnostic classifications that constitute the mood disorders: BP-I, SAD-M, MDD, as well as bipolar effective disorder (mood) with hypo anía and major depression (BP-II). Thus, one of the major difficulties that psychiatric psychiatrists face is the uncertainty regarding the validity of phenotype designations, since clinical diagnoses are based only on clinical observation and subjective reports. Likewise, with complex traits such as neuropsychiatric disorders, it is difficult to genetically map the genes that cause trait because of the following: (1) the phenotypes of neuropsychiatric disorders do not show classical recessive or dominant Mendelian inheritance patterns attributable to a single genetic locus, (2) there may be incomplete penetration, that is, individuals who inherit a predisposition allele may not manifest the disease; (3) a phenocopy phenomenon can occur, that is, individuals who do not inherit a predisposition allele can nevertheless develop the disease due to environmental causes or random causes; (4) genetic heterogeneity may exist, in which case mutations in any of several genes may result in identical phenotypes. Despite these difficulties, however, the identification of the chromosomal location, sequence and function of genes and gene products responsible for causing neuropsychiatric disorders such as for example bipolar affective disorders is of great importance for genetic counseling, diagnosis and treatment of individuals in affected families. 3- COMPENDIUM OF THE INVENTION The present invention, first, to the discovery, identification, and characterization of novel nucleic acid molecules associated with disorders and processes related to the central nervous system, for example, human neuropsychiatric disorders such as schizophrenia, deficit disorder of attention, schizoaffective disorder, dysthymic disorder, major depressive disorder, and bipolar affective disorder (BAD), including severe bipolar affective disorder (mood) (BP-I), bipolar affective disorder (mood) with hypomania and major depression (BP-II) ). The invention also relates to the discovery, identification and characterization of proteins encoded by such nucleic acid molecules, or by degenerate variants, for example allelic or homologous thereof. The invention also relates to the discovery, identification and characterization of novel nucleic acid molecules associated with human myopia or short sight, such as, for example, early autosomal dominant myopia, as well as the discovery, identification and characterization of encoded proteins. by such nucleic acid molecules or by degenerate variants thereof. Particularly, the nucleic acid molecules of the present invention represent, first, nucleic acid sequences corresponding to the gene referred to herein as HKNG1. As demonstrated in the examples presented below in sections 6, 8 and 14, the HKNG1 gene is associated with disorders related to the human central nervous system, for example, neuropsychiatric disorders, particularly, BAD. The HKNG1 gene is associated with other human neuropsychiatric disorders as well, such as schizophrenia. As demonstrated in the example presented below in section 14, the HKNG1 gene is also associated with human myopia, such as autosomal dominant early onset myopia. In addition to the positive correlation between mutations within the HKNG1 gene and individuals exhibiting symptoms of ADB, described in section 6 and section 8, the present invention is also based, in part, on the discovery by applicants of the novel HKNG1 cDNA sequences. The discovery by the applicants of said cDNA sequences has led to the elucidation of the genomic structure of HKNG1 (i.e., intron / exon not translated upstream and not translated downstream) and to the discovery of full length variants of HKNG1. or alternatively spliced, and the polypeptides encoded by such variants. These discoveries are described in sections 7 and 10 below. The discovery by the applicants of such cDNA sequences has also led to the elucidation of novel mammalian HKNG1 sequences (e.g., guinea pigs and bovines), and to the discovery of novel allelic variants and polymorphisms of such sequences. These discoveries are described in section 10 below. The invention encompasses nucleic acid molecules comprising the following nucleotide sequences: (a) nucleotide sequences (eg, SEQ ID NOS: 1, 3, 5, 6, 36, and 37) comprising a human HKNG1 gene and / or encode a human HKNG1 gene product (e.g., SEQ ID NO: 2; SEQ ID NO: 4), as well as allelic variants, homologs and orthologs thereof, including nucleotide sequences (eg, SEQ ID NOS: 38, 40, 42, 44, and 46-48) encoding gene products. HKNG1 non-human (eg, SEQ ID NOS: 39, 41, 43, 45, and 49); (b) nucleotide sequences comprising the novel HKNG1 sequences disclosed herein that encode mutants of the HKNG1 gene product wherein sequences encoding all or a portion of one or more of the HKNG1 domains is removed or altered, or fragments of the same; (c) nucleotide sequences encoding fusion proteins comprising a gene product HKNG1 (eg, SEQ ID NO: 2; SEQ ID NO: 4), or a portion fused to a heterologous polypeptide; and (d) nucleotide sequences within the HKNG1 gene, as well as chromosome 18p nucleotide sequences flanking the HKNG1 gene, which can be used, for example, as primers, in the methods of the invention to identify and diagnose individuals at risk of present a disorder mediated by HKNG1 or that show a disorder mediated by HKNG1, such as BAD or schizophrenia, or to diagnose individuals at risk of presenting a form of myopia such as autosomal dominant myopia of early onset or presenting said form of myopia. The nucleic acid molecules of (a) to (d), supra, may include, but are not limited to, cDNA, genomic DNA, and RNA sequences. The invention also encompasses the expression products of the nucleic acid molecules presented in the list above; that is, peptides, proteins, glycoproteins and / or polypeptides encoded by the nucleic acid molecules of HKNG1 above. The compositions of the present invention also encompass agonists and antagonists of the HKNG1 gene product, including small molecules (such as small organic molecules), and macromolecules (including antibodies), as well as nucleotide sequences that can be employed to inhibit gene expression. HKNG1 (for example, antisense and ribozyme molecules, and gene replacement or regulatory sequence constructs), or to enhance the expression of the HKNG1 gene (for example, expression constructs that place the HKNG1 gene under the control of a promoter system) strong) . The compositions of the present invention further include cloning vectors and expression vectors containing the nucleic acid molecules of the invention, as well as hosts that have been transformed with such nucleic acid molecules, including cells genetically engineered to contain the acid molecules. nucleic acid of the invention, and / or cells genetically engineered to express the nucleic acid molecules of the invention.

In addition to the host cells and cell lines, the hosts also include transgenic non-human animals (or its progeny), particularly non-human mammals, which have been manipulated to express a transgene of HKNG1, or "knocked out" that have been manipulated so as not to express HKNG1. The non-human transgenic animals of the present invention include animals engineered to express a transgene of HKNG1 at higher or lower levels than normal wild-type animals. The transgenic animals of the invention also include animals engineered to express a mutant variant or polymorphism of a HKNG1 transgene associated with a HKNG1 mediated disorder, eg, a neuropsychiatric disorder mediated by HKNG1, such as BAD and schizophrenia, or alternatively, a myopia disorder such as autosomal dominant myopia of early onset. The transgenic animals of the present invention further include the progeny of such genetically engineered animals. The invention further relates to methods for the treatment of HKNG1-mediated disorders in a subject, such as for example HKNG1-mediated neuropsychiatric disorders and HKNG1-mediated myopia disorders, where such methods comprise the administration of a compound that modulates the expression of a HKNG1 gene and / or the synthesis or activity of a HKNG1 gene product in such a way that the symptoms of the disorder are improved. The invention further relates to methods for the treatment of HKNG1-mediated disorders in a subject, such as for example HKNG1-mediated neuropsychiatric disorders and HKNG1-mediated myopia disorders, resulting from HKNG1 gene mutations or aberrant levels of expression or activity of HKNG1. HKNG1, wherein such methods comprise the delivery to the subject of a nucleic acid molecule encoding an unaffected HKNG1 gene product such that an unaffected HKNG1 gene product is expressed and the symptoms are ameliorated. The invention also relates to methods for the treatment of HKNG1-mediated disorders in a subject, such as for example HKNG1-mediated neuropsychiatric disorders and HKNG1-mediated myopia disorders resulting from mutations of the HKNG1 gene or aberrant levels of expression or activity, wherein such methods comprise the delivery to the subject of a cell comprising a nucleic acid molecule encoding an unaffected HKNG1 gene product such that the cell expresses the unaffected HKNG1 gene product and symptoms of the disorder are improved . The invention also encompasses pharmaceutical formulations and methods for the treatment of disorders mediated by HKNG1, including neuropsychiatric disorders, such as BAD and schizophrenia, and myopia disorders, such as early autosomal dominant myopia, involving the HKNG1 gene. In addition, the present invention focuses on methods using the nucleic acid sequences of HKNG1, chromosome 18p nucleotide sequences flanking the human HKNG1 gene and / or HKNG1 gene product sequences to map the region of chromosome 18p, and for the diagnostic evaluation, genetic test and prognosis of a disorder mediated by HKNG1, such as a neuropsychiatric disorder mediated by HKNG1 or a myopia disorder mediated by HKNG1. For example, in one embodiment, the invention relates to methods for diagnosing HKNG1-mediated disorders, wherein such methods comprise the measurement of HKNG1 gene expression in a patient sample, or the detection of a HKNG1 polymorphism or mutation in HKNG1. the genome of a mammal, including a human being, which is suspected to have such a disorder. In one embodiment, nucleic acid molecules encoding HKNG1 can be employed as diagnostic hybridization probes or as primers for diagnostic polymerase chain reaction analysis for the identification of HKNG1 gene mutations, allelic variations and regulatory defects in the HKNG1 gene that correlate with neuropsychiatric disorders such as BAD or schizophrenia. The invention further relates to methods for identifying compounds that 'modulate the expression of the HKNG1 gene and / or the synthesis or activity of the HKNG1 gene products, including therapeutic compounds, which reduce or eliminate the symptoms of HKNG1-mediated disorders, including neuropsychiatric disorders mediated by HKNG1 such as BAD and schizophrenia. Particularly, cellular and non-cellular assays are described which can be used to identify compounds that interact with the HKNG1 gene product, for example, which modulate the activity of HKNG1 and / or bind to the HKNG1 gene product. Such cell-based assays of the present invention employ cells, cell lines, or manipulated cells or cell lines that express the HKNG1 gene product. In one embodiment, such methods comprise contacting a compound with a cell that expresses a HKNG1 gene, measuring the expression level of the HKNG1 gene, expression of gene product or gene product activity, and comparing this level with the HKNG1 gene expression level, expression of gene product or gene product activity produced by the cell in the absence of the compound, such that if the level obtained in the presence of the compound differs from the level obtained in its absence, it has identified a compound that modulates the expression of the HKNG1 gene and / or the synthesis or activity of the HKNG1 gene products. In another embodiment, such methods comprise contacting a compound with a cell that expresses a HKNG1 gene and also comprises a reporter construct whose transcription is dependent, at least in part, on HKNG1 expression or activity. in a modality of this type, the transcript level of the reporter construct is measured and compared with the level of reporter transcription in the cell in the absence of the compound. If the level of reporter transcription obtained in the presence of the compound differs from the level of transcription obtained in its absence, we have identified a compound that modulates the expression of HKNG1 or genes involved in pathways related to HKNG1 or signal transduction. In another embodiment, such methods comprise administering a compound to a host, such as a transgenic animal, that expresses a transgene of HKNG1 or a transgene of mutant HKNG1 associated with a disorder mediated by HKNG1, such as a neuropsychiatric disorder, (for example, BAD or schizophrenia), or to an animal, for example, a knockout animal, that does not express HKNG1, and by measuring the expression level of the HKNG1 gene, gene product expression, product activity of gene, or symptoms of a disorder mediated by HKNG1, such as for example neuropsychiatric disorder mediated by HKNG1 (for example, BAD or schizophrenia). The measured level is compared with the level obtained in a host not exposed to the compound, so that if the level obtained when the host is exposed to the compound differs from the level obtained in a host not exposed to the compound, a compound that has been identified has been identified. modulates the expression of the mammalian HKNG1 gene and / or the synthesis or activity of mammalian HKNG1 gene products, and / or the symptoms of a HKNG1-mediated disorder such as a neuropsychiatric disorder (eg, BAD or schizophrenia).

The present invention also relates to pharmacogenomic or pharmacogenetic methods for selecting an effective drug for administering to an individual having a HKNG1-mediated transient. Such methods are based on the detection of genetic polymorphisms in the HKNG1 gene or variations in HKNG1 gene expression caused, for example, by altered methylation, differential splicing, or post-trans-national modification of the HKNG1 gene product that can affect the safety and efficacy of a therapeutic agent. As briefly discussed above, the present invention is based, in part, on the genetic and physical mapping of the HKNG1 gene to a specific portion of the short arm of human chromosome 18 that is associated with human neuropsychiatric disorders, particularly bipolar affective disorder. These results are described in the example presented below in section 6. The invention is also based on the elucidation of the nucleotide sequence of HKNG1, amino acid sequence and expression pattern, in accordance with that described in the example presented below , in section 7. The invention is further based on the identification of specific mutations and / or polymorphisms within the HKNG1 gene that correlate positively with neuropsychiatric disorders, particularly, BAD, in accordance with that described in the example presented below in section 8. These mutations include a point-discovered mutation in an individual affected by BAD that is absent from the corresponding wild-type nucleic acid derived from unaffected individuals and linkage disequilibrium from three markers that show co-segregation with a population of individuals with BAD This mutation is a single base mutation that results in a mutant HKNG1 gene product comprising the substitution of a lysine residue by the wild type glutamic acid residue at amino acid position 202 of HKNG1 of the polypeptide of SEQ ID NO: 2, or the amino acid residue 184 of HKNG1 of the polypeptide of SEQ ID NO: 4. These mutations also include the mutations discovered in schizophrenic patients and patients affected by BAD that are presented with details in figures 5A-5B. 3.1. DEFINITIONS As used herein, the following terms will be used in the form of the following abbreviations. BAC, artificial bacterial chromosomes BAD, bipolar affective disorder (s) BP, bipolar mood disorder BP-I, bipolar mood disorder (mood) severe BP-II, bipolar disorder (mood) with hypomania and depression higher bp, base pair (s) EST, expressed sequence marker HKNG1, new Hong Kong 1 lod gene, logarithm odds MDD, unipolar major depressive disorder ROS, species that react with oxygen RT-PCR, reaction In SSCP reverse transcriptase polymerase chain, single chain conformational polymorphism SAD-M, manic type schizoaffective disorder SSTTSS, YAC sequence labeled site, yeast artificial chromosome The term "HKNG1 mediated disorders" includes disorders involving a aberrant level of HKNG1 gene expression, gene product synthesis and / or gene product activity in relation to levels found in clinically normal individuals and / or in relation to the levels enco In a population whose level represents a baseline, an average level of HKNGl. While we do not wish to be limited to any particular mechanism, it must be understood that the symptoms of disorder may be caused, for example, either directly or indirectly, by such aberrant levels. Alternatively, it should be understood that such aberrant levels can, either directly or indirectly, ameliorate symptoms of disorder, (for example, as in cases in which aberrant levels of HKNG1 suppress the symptoms of disorders caused by mutations within a second. gen). Disorders mediated by HKNG1 include, for example, disorders of the central nervous system (CNS). Central nervous system disorders include, without limitation, knowledge and neurodegenerative disorders such as Alzheimer's disease, senile dementia, Huntington's disease, amyotrophic lateral sclerosis, and Parkinson's disease, as well as Gilles de la Tourette syndrome, disorders of autonomic function such as hypertension and sleep disorders, as well as neuropsychiatric disorders including, but not limited to, schizophrenia, schizoaffective disorder, attention deficit disorder, dysthymic disorder, major depressive disorder, mania, obsessive-compulsive disorder, disorders for use of psychoactive substance, anxiety, panic, as well as bipolar affective disorder, for example, severe bipolar affective mood (mood) (BP-I), bipolar affective mood (mood) with hypomania and major depression (BP-II). Additional central nervous system related disorders include, for example, disorders listed in the Diagnostic and Statistical Manual of Mental Disorders (DSM) of the American Psychiatric Association, the most current version of which is incorporated herein by reference in its whole. The term "HKNG1-mediated processes" includes processes that are dependent and / or responsive, either directly or indirectly, to gene expression levels of HKNG1, gene product synthesis and / or gene product activity. Such processes may include, but are not limited to, neurodevelopmental, neural, and autonomic development processes such as pain, appetite, long-term memory, and short-term memory. 4. BRIEF DESCRIPTION OF THE FIGURES Figure LA-IB: the nucleotide sequence of human HKNG1 cDNA (SEQ ID NO: 1) is shown in the lower line. The upper line represents the full-length amino acid sequence of human HKNG1 polypeptide (SEQ ID NO: 2) encoded by the human HKNG1 cDNA sequence. The nucleotide sequence encoding SEQ ID NO: 2 corresponds to SEQ ID NO: 5. Figure 2A-2B: Nucleotide sequence of an alternately spliced human HKNG1 variant, known as HKNG1-V1 (SEQ ID NO: 3) is depicted in the bottom line. The amino acid sequence derived from the human HKNG1 gene product (SEQ ID NO: 4) encoded by this alternately spliced cDNA variant is shown in the top line. The nucleotide sequence encoding SEQ ID NO: 4 corresponds to SEQ ID NO: 6. Figure 3A-3R: genomic sequence of the human HKNG1 gene (SEQ ID NO: 7). The exons are represented in bold letters and the 3 'and 5' UTRs (non-translated regions) are underlined. Figure 4: summary of in situ hybridization analysis of distribution of HKNG1 mRNA in normal human brain tissue. Figures 5A-5B: polymorphisms of HKNG1 relative to the wild-type sequence of HKNG1. These polymorphisms were isolated from a collection of schizophrenic patients of mixed ethnicity from the United States of America (Figure 5A) and from a collection of BAD from San Francisco (Figure 5B). Figure 6A-6B: nucleotide sequence of the RT-PCR products for HKNG1-V2 (Figure 6 A; SEQ ID NO: 36) and HKNG1-V3 (Figure 6B; SEQ ID NO: 37). Figure 7: the cDNA sequence (SEQ ID NO: 38) and the predicted amino acid sequence (SEQ ID NO: 39) of the HKNG1 ortholog from guinea pig gphkngl815. FIG. 8. The cDNA sequence (SEQ ID NAME) and predicted amino acid sequence (SEQ ID NO: 41) of gphkng 7b, an allelic variant of the guinea pig HKNG1 ortholog gphkngl815. FIG. 9. The cDNA sequence (SEQ ID NO: 42) and the predicted amino acid sequence (SEQ ID NO: 43) of gphkng 7c, an allelic variant of the guinea pig HKNG1 ortholog gphkngl815. FIG. 10. The cDNA sequence (SEQ ID NO: 4) and the predicted amino acid sequence (SEQ ID NO: 45) of gphkng 7d, an allelic variant of the guinea pig HKNG1 ortholog gphkngl815. FIG. 11. The cDNA sequence (SEQ ID NO: 46) and the predicted amino acid sequence (SEQ ID NO: 49) of the allelic variant bhkngl of the ortholog of bovine HKNG1. FIG. 12. The cDNA sequence (SEQ ID NO: 47) and the predicted amino acid sequence (SEQ ID NO: 49) of the allelic variant bhkng2 of the bovine HKNG1 homologue. FIG. 13. The cDNA sequence (SEQ ID NO: 48) and the predicted amino acid sequence (SEQ ID NO: 49) of the allelic variant bhkng3 of the bovine HKNG1 homologue. FIG. 14A-B. Alignments of a guinea pig HKNG1 cDNA (FIG 14A) and predicted amino acid sequences (FIG 14B) for gphkngl815, gphkng 7b, gphkng7c, and gphkng 7d. FIG. 15. Alignments of the cDNA sequences of the allelic variants of bovine HKNG1 bhkngl, bhkng2, and bhkng3. FIG. 16. Alignments of the amino acid sequences of human HKNG1 (hkng_aa), bovine (bhkngl_aa) and guinea pig (gphkngl815_aa). FIG. 17. Alignments of the human HKNG1 protein sequences; top row: the protein sequence of mature secreted HKNG1 (SEQ ID NO: 51); second row: form 1 of immature HKNG1 protein (IPF1; SEQ ID NO: 2); third row: form 2 of immature HKNG1 protein (IPF2; SEQ ID NO: 64); bottom row: protein form 3 of immature HKNG1 (IPF3; SEQ ID N0: 4). FIG. 18. The cDNA nucleotide sequence of HKNG1D7 splicing variant of human HKNG1 (SEQ ID NO: 21) is shown in the bottom row. The top row represents the full-length amino acid sequence of human HKNG1D7 polypeptide (SEQ ID NO: 66) encoded by the human HKNG1D7 cDNA sequence. 5. DETAILED DESCRIPTION OF THE INVENTION 5.1. THE HKNG1 GENE Nucleic acid molecules of HKNG1 are described in the section. Unless otherwise indicated, the term "HKNG1 nucleic acid" refers collectively to the sequences described herein. A human HKNG1 cDNA sequence (SEQ ID NO: 2) encoding the full length amino acid sequence (SEQ ID NO: 2) of the HKNG1 polypeptide is shown in Figure 1A-1B. The human HKNG1 gene encodes a secreted polypeptide of 495 amino acid residues, as shown in Figure 1A-1B, and SEQ ID N0: 2. The nucleotide sequence of the cDNA portion corresponding to the coding sequence for HKNG1 (SEQ ID NO: 2) is shown as SEQ ID NO: 5. The HKNG1 sequences of the present invention also include splice variants of the sequences of HKNG1 described here. For example, an alternately spliced human HKNG1 cDNA sequence, known as HKNG1-V1 (SEQ ID NO: 3) encoding a human HKNG1 variant gene product (i.e., the gene product HKNG1-V1) is shown in 2A-2B. This splicing variant of a human HKNG1 gene encodes a secreted polypeptide of 477 amino acid residues, as shown in Figures 2A-2B and in SEQ ID NO:. The nucleotide sequence of the cDNA portion corresponding to the coding sequence for HKNG1 (SEQ ID NO: 4) is shown in SEQ ID NO: 6. Another alternately spliced human HKNG1 cDNA sequence (SEQ ID NO: 65) , known as HKNG1D7, encodes a second variant gene product of HKNG1 (the gene product HKNG1D7) which is shown in Figure 18. The splicing variant of the human HKNG1 gene encodes the variant polypeptide shown in Figure 18 (SEQ ID NO. : 66). The genomic structure of the human HKNG1 gene has been elucidated and is shown in Figures 3A-3R, with the exons of HKNG1 indicated in bold letters and the untranslated regions 5 'and 3' indicated by underlining. The wild type genomic sequence of the HKNG1 gene is shown in Figures 3A-3R and SEQ ID NO: 7. Non-human homologs or orthologs of mammalian orthologs are also provided, such as, for example, of the human HKNG1 sequences discussed above. . Specifically, a guinea pig cDNA sequence (SEQ ID NO: 36), known herein as gphkngl815, encoding the full-length amino acid sequence (SEQ ID NO: 39) of a guinea pig HKNG1 orthologue appears in FIG. 7. This guinea pig cDNA sequence encodes a gene product of 466 amino acid residues as shown in FIG. 7 and in SEQ ID NO: 39. Allelic variants of this ortholog of HKNG1 from guinea pigs, known as gphkng7b, gphkng7c, and gphkng7d (SEQ ID NOS: 40, 42, and 44, respectively), appear in Figures 8- 10, respectively. The allelic variants gphkng7b, gphkng7c, and gphkng 7d each encode variants of the HKNG1 gphkngl815 gene product from guinea pigs containing deletions of amino acids 16, 92, and 93, respectively, as shown in Figures 8-10 , in SEQ ID NOS: 41, 43, and 45, respectively, and in the sequence alignment in Figure 14B. Orthologous cDNA sequences of bovine HKNG1 (SEQ ID NOS: 46-48), known herein as bhkngl, bhkng2, and bhkng3, and each encoding the same bovine ortholog gene product appear in Figures 11-13, respectively . The allelic variants of bovine HKNG1 encode the same gene product, ie, a protein of 465 amino acids, as shown in Figures 11-13, and in SEQ ID NO: 49. The nucleic acid molecules of HKNG1 gene of The present invention includes: (a) nucleotide sequences and fragments thereof (eg, SEQ ID NOS: 1, 3, 5, 6, 7, 36, 37, and 65) which encode a product of the HKNG1 gene (per example, SEQ ID NOS: 2, 4, and 66) as well as homologs, orthologs, and allelic variants of such sequences and fragments (e.g., SEQ ID NO: 38, 40, 42, 44, and 46-48) encoding HKNGl homologous or orthologous gene products (eg, SEQ ID NO: 39, 41, 43, 45, and 49); (b) nucleotide sequences encoding one or more functional domains of the HKNG1 gene product include, without limitation, nucleic acid sequences encoding a signal sequence domain, or one or more clusterin domains in accordance with that described in Section 5.2 below; (c) nucleotide sequences comprising HKNG1 gene sequences from untranslated regions upstream, intronic regions, and / or untransferred regions downstream or fragments thereof from the nucleotide sequences of HKNG1 in (a) above; (d) nucleotide sequences comprising the novel HKNG1 sequences disclosed herein that encode mutants of the HKNG1 gene product wherein the whole of a part of one or more of the domains is removed or altered, as well as fragments thereof; (e) nucleotide sequences encoding fusion proteins comprising a gene product HKNG1 (eg, SEQ ID NO: 2, 4, 39, 41, 43, 45, 49, and 65), or a portion thereof fused on a heterologous polypeptide; and (f) nucleotide sequences (e.g., primers) within the HKNG1 gene, and chromosome 18p nucleotide sequences flanking the HKNG1 gene that can be used as part of the methods of the invention to identify and diagnose individuals who are at risk of presenting a disorder mediated by HKNG1, such as BAD or myopia, or showing that disorder. The nucleotide sequences of HKNG1 of the present invention further include nucleotide sequences corresponding to the nucleotide sequences of (a) - (f) above where one or more of the exons or fragments thereof have been removed. In a preferred embodiment, the nucleotide sequences of HKNG1 of the invention is a sequence wherein the exon corresponding to exon 7 of SEQ ID NO: 7, or a fragment thereof, has been removed. The nucleotide sequences of HKNGl of the invention also include nucleotide sequences having an identity of nucleotide sequences of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or more with the nucleotide sequences of HKNG1 from (a) - (f) above. The nucleotide sequences of HKNG1 of the invention further include nucleotide sequences encoding polypeptides having an amino acid sequence identity of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98 %, or more with the polypeptides encoded by the nucleotide sequences of HKNG1 of (a) - (f), for example, SEQ ID NOS: 2, 4, 39, 41, 43, 45, 49, and 66 above. To determine the percent identity of two amino acid sequences or two nucleic acids, the sequences are aligned for optimal comparison purposes (for example, spaces can be introduced into a first amino acid sequence or nucleic acids for optimal alignment with a second sequence of amino acids or nucleic acids). The amino acid or nucleotide residues at corresponding amino acid positions or at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied with the same amino acid or nucleotide residue as the corresponding position in the second sequence, then the molecules are identical in this position. The percentage of identity between two sequences is a function of the number of identical positions shared by the sequences (ie, the identity percentage = number of identical positions that are spliced / total number of positions x 100%). In one embodiment, the two sequences have the same length. The determination of the percentage of identity between two sequences can also be achieved using a mathematical algorithm. A preferred, non-limiting example of an algorithm used for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Nati Acad.

Sci. USA 87: 2264-2268, modified as in Karlin and Altschul (1993) Proc. Nati Acad. Sci. USA 90: 5873-5877. Said algorithm is incorporated in the NBLAST and XBLAST programs of Altschul, et al., (1990) J. Mol. Biol. 215: 403-410. Searches of nucleotides with BLAST can be carried out with an NBLAST program, result = 100, word length = 12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. Searches of protein with BLAST can be carried out with the XBLAST program, result = 50, word length = 3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain alignments with spaces for comparison purposes, a BLAST with conformance spaces can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402. Alternatively, PSI-BLAST can be used to carry out a repetitive search that detects distant relationships between molecules (Id.). When using BLAST, BLAST with spaces, and PSI-BLAST programs, the default parameters of the respective programs (for example, XBLAST and MBLAST) can be used (see http: //www.ncbi .nlm.nih.gov). Another preferred, non-limiting example of a mathematical algorithm used for the comparison of sequences is the algorithm of Myers and Miller (1988) CABIOS 4: 11-17. said algorithm is incorporated into the ALIGN program (version 2.0) that is part of the GCC sequence alignment programmatic package. When the ALIGN program is used to compare amino acid sequences, a PAM120 waste weight table, a space length penalty of 12, and a space penalty of. The percentage of identity between the sequences can be determined using techniques similar to the techniques described above with or without allowing spaces. When the percent identity is calculated, only exact matches are typically counted. The nucleotide sequences HKNG1 of the present invention further include: (a) any nucleotide sequence that hybridizes with a nucleic acid molecule of HKNG1 of the invention under stringent conditions, for example, hybridization with DNA bound to filter in 6x sodium chloride / sodium citrate (SSC) at a temperature of approximately 45 ° C followed by one ovarian wash in 0.2xSSC / 0.1% SDS at a temperature of approximately 50-65 ° C, or (b) under highly stringent conditions, eg, hybridization on nucleic acid attached to filter in 6xSSC at a temperature of about 45 ° C, followed by one or more washings in O.lxSSC / 0.2% SDS at a temperature of about 68 ° C, or under other hybridization conditions that are apparent to those skilled in the art ( see, for example, Ausubel FM et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York, on pages 6.3.1-6.3.6 and 2.10 .3). Preferably, the nucleic acid molecule of HKNG1 that hybridizes to the nucleotide sequence of (a) and (b), above, is a molecule comprising the complement of a nucleic acid molecule encoding a HKNG1 gene product. In a preferred embodiment, the nucleic acid molecules comprising the nucleotide sequences of (a) and (b), above, encode gene products, eg, gene products functionally equivalent to a HKNG1 gene product. Functionally equivalent HKNG1 gene products include naturally occurring HKNG1 gene products present in the same species or in different species. In one embodiment, HKNG1 gene sequences in non-human species are mapped to syngeneic chromosome regions with the location on human chromosome 18p within which human HKNG1 is located. Functionally equivalent HKNG1 gene products also include gene products that retain at least one of the biological activities of the HKNG1 gene products, and / or that are recognized by antibodies and bind to antibodies (polyclonal or monoclonal) directed against the HKNG1 gene products. Among the nucleic acid molecules of the invention are deoxyoligonucleotides ("oligos") that hybridize under strict or highly stringent conditions to the nucleic acid molecules of HKNG1 described above. In general, for probes between 14 and 70 nucleotides in length, at melting temperature (TM) it is calculated using the formula: Temperature (° C) = 81.5 + 16.6 (log [monovalent cation (molar)]) +0.41 (% G + C) - (500 / N) where N is the length of the probe. If the hybridization is carried out in a solution containing formamide, the melting temperature is calculated using the equation Tm (° C) = 81.5 + 16.6 (monovalent logfcations (molar)]) +0.41 (% G + C) - ( formamide at 0.61%) - (500 / N) where N is the length of the probe. In general, hybridization is carried out at a temperature of about 20-25 degrees below Tm (for DNA-DNA hybrids) or 10-15 degrees below Tm (for RNA-DNA hybrids). Exemplary highly stringent conditions may refer, for example, to washing in 6xSSC / 0.05% sodium pyrophosphate at a temperature of 37 ° C (for oligos of approximately 14 bases), 48 ° C (for oligos of approximately 17 bases), 55 ° C (for oligos of approximately 20 bases), and 60 ° C (for oligos of approximately 23 bases). These nucleic acid molecules can encode or act as anti-sense molecules, useful, for example, in the regulation of the HKNG1 gene, and / or as anti-sense primers in amplification reactions of nucleic acid sequences of the HKNG1 gene. In addition, such sequences can be used as part of ribozyme and / or triple helical sequences, which is also useful for the gene regulation of HKNG1. In addition, such molecules can be used as components of diagnostic methods, whereby, for example, the presence of a particular HKNG1 allele involved in a HKNG1-related disorder can be detected, for example, a neuropsychiatric disorder, such as BAD. . Fragments of nucleic acid molecules of HKNG1 can have a length of at least 10 nucleotides. In alternative embodiments, the fragments may have 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more contiguous nucleotides in length. Alternatively, the fragments may comprise sequences encoding 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450 or more contiguous amino acid residues of the HKNG1 gene products. Fragments of the nucleic acid molecules of HKNG1 may also refer to exons or introns of HKNG1, and, in addition, may refer to portions of coding regions of HKNG1 that encode domains (eg, clusterin domains.) Of gel products. HKNG1 The nucleotide sequences of HKNG1 of the invention can be easily obtained, for example, by standard sequencing and the sequence provided herein As will be appreciated by those skilled in the art, DNA sequence polymorphisms of a HKNG1 gene would exist within a population of individual organisms (eg, within a human population) Such polymorphisms may exist, for example, between individuals within a population due to natural allelic variations Such polymorphisms include polymorphisms that lead to changes in the amino acid sequence. An allele is one of a group of genes that occurs alternately at a given genetic locus. or used herein, the term "allelic variant" refers to a nucleotide sequence that occurs at a given locus or refers to a gene product encoded by this nucleotide sequence. Such natural allelic variations can typically result in a variation of 1-5% in the nucleotide sequence of a given gene. Alternative alleles can be identified by sequencing the gene of interest in several different individuals. This can be easily accomplished by the use of hybridization probes to identify the same genetic locus in several individuals. As used here, the term "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding a polypeptide of the invention. The term may also include nucleic acid molecules comprising upstream intron / exon sequences and structures. With respect to the allelic variants of HKNG1, each and every one of these variations of nucleotides and resulting polymorphisms or nucleic acid variations which are the result of a natural allelic variation of the HKNG1 gene are within the scope of the present invention. Such allelic variants include, but are not limited to, variants that do not alter the functional activity of the HKNG1 gene product. Variants include, but are not limited to, variants comprising polymorphisms summarized in Figures 5A-B and a variant encoding a polypeptide of HKNG1 in length comprising a substitution of an amino acid of lysine at amino acid residue 202 in the polypeptide of HKNG1 shown in Figures 1A-1B and SEQ ID NO: 2 or amino acid residue 184 of HKNG1 of the polypeptide of SEQ ID NO: 4. In relation to the cloning of additional allelic variants of the human HKNG1 gene and homologs and orthologs of other species (e.g., guinea pig, cow, mouse), the isolated HKNG1 gene sequences disclosed herein can be labeled and used to screen a cDNA library constructed from mRNA obtained from appropriate cells or tissues ( example, brain or retinal tissues) derived from the organism of interest (eg, guinea pig, cow, and mouse). The hybridization conditions employed should generally be of a lower level of strictness when the cDNA library is derived from an organism different from the type of organism from which the tagged sequence was derived, and can be determined routinely on the basis of , for example, in the relative relationship of target and reference organisms. Alternatively, the tagged fragment can be used to screen a genomic library derived from the organism of interest, again, using appropriately stringent conditions. Appropriately strict conditions are well known to those skilled in the art as discussed above, and vary predictably according to the specific organisms from which the library and tagged sequences are derived. For guidance on these conditions, see, for example, Sambrook, et al., 1989, Molecular Cloning, A Laboratory Manual (Molecular Cloning, a Laboratory Manual), second edition, Cold Spring Harbor Press, N.Y.; and Ausubel, et al., 1989-1999, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y., both incorporated herein by reference in their entirety. In addition, an allelic variant of the HKNG1 gene can be isolated, for example, from human nucleic acid, by carrying out a polymerase chain reaction using two sets of degenerate oligonucleotide primers designed based on the amino acid sequences within the HKNG1 gene product disclosed here. The quenched for the reaction may be cDNA obtained by reverse transcription of mRNA prepared from, for example, human or non-human cell lines or tissue which is known or suspected to express a mutant or a mutant HKNG1 gene allele. wild (such as brain cells, including brain cells from individuals who have BAD). In one embodiment, the allelic variant is isolated from an individual who has a disorder mediated by HKNG1. Such variants are described in the following examples. The polymerase chain reaction product can be subcloned and sequenced to ensure that the amplified sequences represent the sequences of a nucleic acid sequence of the HKNG1 gene. The polymerase chain reaction fragment can then be used to isolate a full length cDNA clone by several methods. For example, the amplified fragment can be labeled and used to screen a bacteriophage cDNA library. Alternatively, the labeled fragment can be used to isolate genomic clones through screening from a genomic library. The polymerase chain reaction technology can also be used to isolate full-length cDNA sequences. For example, RNA can be isolated, following standard procedures, from an appropriate cell source or tissue source (i.e., a source of which is known or suspected to express the HKNG1 gene, such as tissue samples) brain obtained through biopsy or post-mortem). A reverse transcription reaction can be performed on the RNA using an oligonucleotide primer specific for the 5 'end of the fragment amplified for the initiation of first strand synthesis. The resulting RNA / DNA hybrid can then be "queued" with guanines using a standard terminal transferase reaction, the hybrid can be digested with RNase H, and the second strand synthesis can be initiated with a poly-C initiator. Thus, cDNA sequences upstream of the amplified fragment can be easily isolated. For a discussion of cloning strategies that may be employed, see, for example, Sambrook et al., 1989, supra, or Ausubel et al., Supra. A cDNA can be isolated from an allelic variant, eg, mutant, of the HKNG1 gene, for example, by the use of polymerase chain reaction, a technique well known to those skilled in the art. In this case, the first strand of cDNA can be synthesized by hybridizing an oligo-dT oligonucleotide onto mRNA isolated from the tissue of which it is known or suspected to be expressed in an individual putatively carrying a mutant HKNG1 allele, and by extending the new chain with reverse transcriptase. The second strand of cDNA is then synthesized using an oligonucleotide that hybridizes specifically to the 5 'end of the normal gene. Using these two primers, the product is then amplified by PCR, cloned into an appropriate vector, and then subjected to DNA sequence analysis through methods well known to those skilled in the art. By comparing the DNA sequence of the mutant HKNG1 allele with the DNA sequence of the normal HKNG1 allele, the mutation (s) responsible for the loss or alteration of the function of the mutant HKNG1 gene product It can be determined. Alternatively, a genomic library can be constructed using DNA obtained from an individual that is suspected or known to carry a mutant HKNG1 allele, or a cDNA library can be constructed using RNA from a tissue from which it knows or is suspected to express an allele of mutant HKNG1. An unaffected HKNG1 gene or any suitable fragment thereof can then be labeled and used as a probe to identify the corresponding mutant HKNG1 allele in such libraries. Clones containing the mutant HKNG1 gene sequences can then be purified and subjected to sequence analysis according to methods well known to those skilled in the art. In addition, an expression library can be constructed using cDNA synthesized from, for example, RNA isolated from a tissue which is known or suspected to express a mutant HKNG1 allele in an individual of which one suspects or is known that carries the mutant allele. In this way, gene products made by the putatively mutant tissue can be expressed and screened using standard antibody screening techniques in combination with antibodies prepared against the normal HKNGl gene product, in accordance with what is described below in section 5.3. (For screening techniques, see, for example, Harlow and Lane, eds., 1988, "Antibodies: A Laboratory Manual.", Cold Spring Harbor.) In cases in which a mutation of HKNG1 results in a gene product expressed with altered function (eg, as a result of a missense mutation or frame exchange), a polyclonal set of antibodies product of HKNG1 gene will probably cross-react with the HKNG1 gene product mutant: Library clones detected through their reaction with such labeled antibodies can be purified and subjected to sequence analysis according to methods well known to those skilled in the art.HKNG1 mutations or polymorphisms can be further detected using techniques Polymerase Chain Reaction Amplification The primers can be routinely designed to amplify regions of splicing of the entire sequence of HKNG1, including the regulatory region of promoter. In one embodiment, primers are designed such that they span the exon-intron boundaries such that regions of coding can be screened for the presence of mutations. Exemplary initiators for exon analysis of HKNG1 are given in table 1, section 5.6, below. The invention also includes nucleic acid molecules, preferably DNA molecules, which complement the nucleotide sequences of the preceding paragraphs. In certain embodiments, the nucleic acid molecules of the invention are present as part of nucleic acid molecules that comprise nucleic acid sequences that do not contain heterologous sequences (e.g., cloning vector or expression vector). In other embodiments, the nucleic acid molecules of the invention additionally encompass vector sequences, for example, cloning vectors or expression vectors. 5.2 HKNG1 GENE PROTEIN PRODUCTS HKGN1 gene products or peptide fragments thereof can be prepared for various uses. For example, such gene products or peptide products thereof, can be used for the generation of antibodies, in diagnostic assays or for the identification of other cellular or extracellular gene products involved in the regulation of HKGN1 mediated disorders, by example, neuropsychiatric disorders, such as BAD. The HKGN1 gene products of the present invention include, but are not limited to, human HKGN1 gene products, e.g., polypeptides comprising the amino acid sequences depicted in Figures 1A-1B, 2A-2B, 17, and 18 (ie, SEQ ID NO: 2, 4, 51 and 66). The HKGN1 gene products also include non-human HKGN1 gene products (such as bovine or guinea pigs). These include, but are not limited to, polypeptides comprising the amino acid sequences presented in Figures 7-13 (ie, SEQ ID NO: 39, 41, 43, 45 and 49). A gene product HKNG1 sometimes referred to as "a HKNG1 protein" or "HKNG1 polypeptide", includes the gene products encoded by the HKNG1 gene sequences presented in Figures 1A-1B, 2A-2B, 17-13, 17 , and 18, as well as gene products encoded by other human allelic variants and non-human variants of HKNG1 that can be identified by the methods described herein. Among such variants of the HKNG1 gene product are gene products comprising amino acid residues of HKNG1 encoded by polymorphisms illustrated in Figure 5A and 5B. Such variants of gene products also include a variant of the HKNG1 gene product illustrated in Figure 1 (SEQ ID NO: 2) where the amino acid residue Lys202 is mutated into a glutamic acid residue. Such HKNG1 gene product variants also include a variant of the HKNG1 gene product illustrated in Figure 2 (SEQ ID NO: 4) where the amino acid residue Lysl84 is mutated into a glutamic acid residue. In addition, HKNG1 gene products may include proteins that represent functionally equivalent gene products. Functionally equivalent gene products may include, for example, gene products encoded by one of the nucleic acid molecules of HKNG1 described in section 5.1, above. In preferred embodiments, such functionally equivalent HKNG1 gene products are naturally occurring gene products. Functionally equivalent HKNG1 gene products also include gene products that retain at least one of the biological activities of the HKNG1 gene products described above and / or that are recognized by antibodies and bind to antibodies (polyclonal or monoclonal) directed against products of the HKNGl gene. An equivalent HKNG1 gene product may contain deletions, including internal deletions, additions, including additions that provide fusion proteins, or substitutions of amino acid residues within and / or adjacent to the amino acid sequence encoded by the HKNG1 gene sequences described above. , in section 5.1. generally, the removals will be removals of single amino acid residues, or removals of no more than 2, 3 ', 4, 5, 10 or 20 amino acid residues, either contiguous or non-contiguous. In general terms the additions or substitutions, other than additions that provide providing fusion proteins will be additions or substitutions of unique amino acid residues, or additions or substitutions of not more than about 2, 3, 4, 5, 10 or 20 amino acid residues, either contiguous or non-contiguous. Preferably, these modifications result in a "silent" change insofar as the change produces a HKNG1 gene product with the same activity as the HKNG1 gene product illustrated in Figures 1A-1B, 2A-2B, 17- 13, or 17. Amino acid substitutions can be made based on the similarity of polarity, charge, solubility, hydrophobicity, and / or the amphipathic nature of the residues involved. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged amino acids (acids) include aspartic acid and glutamic acid. Alternatively, when an alteration of function is desired, added (s), removal (s), or alteration (s). Non-conservative (s) can produce altered HKNG1 gene products, including with reduced activity. Such alterations may, for example, alter one or more of the biological functions of the HKNG1A gene product. Furthermore, such alterations can be selected in such a way as to generate more suitable HKNG1 gene products for expression, increase, etc. In the selected host cells. For example, cysteine residues can be removed or substituted by another amino acid residue in order to eliminate disulfide bridges. As another example, altered HKNG1 gene products can be manipulated such that they correspond to variants of the HKNG1 gene product associated with neuropsychiatric disorders mediated by HKNG21 such as BAD. Such altered HKNG1 gene products include, but are not limited to, HKNG1 proteins or peptides comprising the substitution of a lysine residue for the wild-type glutamic acid residue at the amino acid position 202 of HKNG1 in FIGS. 1B (SEQ ID NO: 2) or at amino acid position 184 (SEQ ID NO: 4) in Figures 2A-2B. Protein fragments of HKNG1 and / or HKNG1 peptides comprise at least the number of contiguous amino acid residues necessary to represent an epitope fragment (i.e., it can be recognized by an antibody directed with the HKNG1 protein). For example, such protein fragments or peptides comprise at least about 8 contiguous HKNG1 amino acid residues from a full-length HKNG1 protein. In alternative embodiments, the protein fragments of HKNG1 and peptides of the invention may comprise about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450 or more contiguous amino acid residues of a HKNG1 protein. Peptides and / or proteins corresponding to one or several domains of the HKNG1 protein as well as fusion protein wherein a protein of HKNG1, or a portion of a protein of HKNG1, such as a truncated HKNG1 protein or peptide or a protein domain of HKNG1, fused with an unrelated protein are also within the scope of this invention. Such proteins and peptides can be designed based on the nucleotide sequence of HKNG1 disclosed in section 5.1 above and / or based on the amino acid sequence of HKNG1 disclosed in the section. Fusion proteins include, but are not limited to, IgFc fusions that stabilize the HKNG1 protein or peptide and prolong half-life in vivo; or fusions with any amino acid sequence that allows the fusion protein to be anchored on the cell membrane; or fusions with an enzyme, fluorescent protein, luminescent protein, or a marker or peptide epitope protein that provide a marker function. The HKNG1 protein, the HKNG1 protein sequences described above may include a domain comprising a signal sequence that targets the HKNG1 gene product for secretion. As used herein, the signal sequence includes a peptide of at least about 15 or 20 amino acid residues in length that occur at the N-terminus of secretory and membrane-bound proteins and that contain at least about 70% of hydrophobic amino acid residues. such as alanine, leucine, isoleucine, phenylalanine, proline, tyrosine, tryptophan, or valine. In a preferred embodiment, a signal sequence contains at least about 10 to 40 amino acid residues, preferably from about 19 to 34 amino acid residues, and has at least about 60 to 80%, more preferably 65 to 75%, and especially at least about 70% of hydrophobic residues. A signal sequence serves to direct a protein containing said sequence to a lipid dicate. In one embodiment, a protein of HNKNG1 contains a signal sequence at about amino acids 1 to 49 of SEQ ID NO: 2. In another embodiment, a HKNG1 protein contains a signal sequence at about amino acids 30 to 49 of SEQ ID NO: 2. In another embodiment, a protein of HKNG1 contains a signal sequence at amino acid residues 1 to 39 approximately of SEQ ID NO: 4. In another embodiment, a protein of HKNG1 contains a signal sequence in the residues of amino acids 12 to 31 approximately of SEQ ID NO: 4. the signal sequence is dissociated during processing of the mature protein. A signal sequence of a polypeptide of the present invention can be used to facilitate the secretion and isolation of the secreted protein or other proteins of interest. Signal sequences are typically characterized by a nucleus of hydrophobic amino acids generally dissociated from the mature protein during secretion at one or more dissociation events. Such signal peptides contain processing sites that allow the dissociation of the signal sequence from the mature proteins as they pass through the secretory pathway. Thus, the invention relates to the HKNG1 polypeptides having a signal sequence (ie, "immature" polypeptides), as well as to the HKNG1 signal sequences themselves and the HKNG1 polypeptides in the absence of the signal sequences ( that is, the "mature" HKNG1 dissociation products). It is also understood that the HKNG1 polypeptides may further comprise polypeptides comprising any signal sequence having the characteristics described above and a mature HKNG1 polypeptide sequence. In one embodiment, a nucleic acid sequence encoding a signal sequence of the present invention can be joined to an expression vector to a protein of interest, such as a protein usually not secreted or usually difficult to isolate for other reasons . The signal sequence directs the secretion of the protein, as for example, from a eukaryotic host in which the expression vector is transformed, and the signal sequence is subsequently or concurrently dissociated. The protein can then be easily purified from the extracellular medium by methods recognized in the art. Alternatively, the signal sequence can be linked to the protein of interest using a sequence that facilitates purification such as for example a GST domain. The HKNG1 protein sequences described above may also include one or more domains comprising a clusterin domain, ie, domains that are identical or substantially homologous (i.e., having an identity of 65%, 75%, 80%, 85%, 90%, 95% or more) to the domain corresponding to amino acid residues 134-160 either to amino acid residues 334-362 of SEQ ID NO: 2, or to the domain corresponding to the amino acid residues 105-131 or amino acid residues 305-333 of SEQ ID NO: 39, either to the domain corresponding to amino acid residues 105-131 or to amino acid residues 304-332 of SEQ ID NO: 49. Preferably, such domains comprise cysteine amino acid residues at positions corresponding to the conserved cysteine residues of the clusterin domains SEQ ID NO: 2, 39 or 49. Particularly, protein sequences of HKNG1 described above may also include one to ovaries of the Domin ios that comprise a conserved cysteine domain. This domain corresponds, for example, to the cysteine domain corresponding to Cysl34, Cysl45, Cysl48, Cysl58 and Cysl60; or Cys334, Cys 344, Cys351, Cys354 and Cys362 of SEQ ID NO: 2. In an alternative embodiment, a conserved cysteine domain corresponds to one or more of the domains of SEQ ID NO: 39 comprising Cysl05, Cysll6, Cysll9 , Cysl24 and Cysl31; or Cys305, Cys315, Cys322, Cys325 and Cys 333. In another alternative embodiment, a conserved cysteine domain corresponding to one or more of the domains of SEQ ID NO: 49: comprising Cysl05, Cyslld, Cysll9, Cysl24 and Cysl31; or Cys314, Cys321, Cys324 and Cys 332. Finally, the HKNG1 proteins of the present invention also include protein sequences of HKNG1 where domains encoded by one or several exons of the cDNA sequence, or fragments, have been removed. In the particularly preferred embodiment, the HKNG1 proteins of the present invention are proteins in which the domain (s) corresponding to these domains encoded by exon 7 of SEQ ID NO: 7, or fragments thereof , they have been removed. The HKNG1 polypeptides of the present invention may further comprise post-translational modifications, including, but not limited to, glycosylations, acetylations, and mirisalations. The HKNG1 gene products, peptide fragments and fusion proteins can be reduced by recombinant DNA technology using well known techniques. Accordingly, methods for the preparation of HKNG1 gene products, polypeptides, peptides, fusion peptide and fusion polypeptides of the invention by expression of nucleic acid containing HKNG1 gene sequences are described herein. Methods well known to those skilled in the art can be employed to construct expression vectors containing appropriate HKNG1 gene product coding sequences and transcription and translation control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic technique, and genetic recombination in vivo. See, for example, the techniques described in Sambrook et al., 1989, supra, and Ausubel, et al., 1989, supra. Alternatively, RNA capable of encoding HKNG1 gene product sequences can be chemically synthesized using, for example, synthesizers. See, for example, the techniques described in "Oligonucleotide Synthesis" (Oligonucleotide synthesis), 1984 Gait, ed., IRL Press, Oxford. Various host-vector expression systems may be employed to express the coding sequences of HKNG1 gene products of the invention. Such host-vector expression systems represent vehicles through which the coding sequences of interest can be produced and subsequently purified, but also represent cells that can, when transformed or transfected with the appropriate nucleotide coding sequences, present the HKNG1 gene product of the invention in situ. They include, without limitation, microorganisms such as bacteria (eg, E. coli B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA expression vectors or cosmid DNA containing product coding sequences of the HKNG1 gene; yeast (eg, Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing the product coding sequences of the HKNG1 gene; insect cell system infected with recombinant virus expression vectors (e.g., baculovirus) containing the HKNG1 gene product coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV, tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing product coding sequences of HKNG1 gene; or mammalian cell systems (eg, COS, CHO, BHK, 293, 3T3) containing recombinant expression constructs containing promoters derived from the genome of mammalian cells (eg, metallothionein promoters), or from of mammalian viruses (eg, the late adenovirus promoter; the 7.5K vaccinia virus promoter). In bacterial systems, numerous expression vectors can be advantageously selected according to the intended use for the HKNG1 gene product being expressed. For example, when a large amount of such proteins must be produced, for the generation of pharmaceutical compositions of HKNG1 gene product or to prepare antibodies for HKNG1 gene products, for example, vectors that direct the expression of high levels of Easily purified fusion protein products may be desirable. Such vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2: 1791), wherein the product coding sequence of HKNG1 gene can be individually linked to the vector in frame with the LacZ coding region in such a way that a fusion protein is produced; pIN vectors (Inouye and Inouye, 1985, Nucleic Acids Res. 13: 3101-3109; Van Heeke and Schuster, 1989, J. Biol. Chem. 264: 5503-5509); and similar. PGEX can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can be easily purified from cells used by adsorption on glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed in such a way that they include factor Xa protease or thrombin dissociation sites in such a way that the cloned target gene product can be released from the GST portion. In an insect system, califorphic autograph, nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The coding sequence of HKNG1 gene products can be cloned individually into non-essential regions (eg, the polyhedrin gene) of the virus and placed under the control of the AcNPV promoter (eg, the polyhedrin promoter). Successful insertion of the HKNG1 gene product coding sequence will result in the deactivation of the polyhedrin gene and the production of non-occluded recombinant virus (i.e., virus lacking the protein coat encoded by the polyhedrin gene). Recombinant viruses are then used to infect Spodoptera frugiperda cells where the inserted gene is expressed. See, (for example, Smith et al., 1983 J. Virol. 46: 584; Smith, U.S. Patent No. 4,215,051). In mammalian host cells, a large number of virus-based expression systems can be employed. In cases where an adenovirus is used as an expression vector, the HKNG1 gene product coding sequence of interest can be ligated onto an adenovirus transcription / translation control complex, eg, the tripartite and late promoter leader sequence. . This chimeric gene can then be inserted into the adenovirus genome through in vitro or in vivo recombination. Insertion in the non-essential region of the viral genome (eg, the El region or the E3 region) will result in a viable recombinant virus capable of expressing a HKNG1 gene product in infected hosts. (See, for example, Logan and Shenk, 1984, Proc. Nati, Acad. Sci. USA 81: 3655-3659). Specific start signals are also required for the efficient translation of inserted HKNG1 gene product coding sequences. These signals include the ATG start codon and adjacent sequences. In cases where an entire HKNG1 gene includes its own start colon and adjacent sequences, it is inserted into the appropriate expression vector, additional translational control signals may not be required. However, in cases in which a portion only a portion of the HKNG1 gene coding sequence is inserted, exogenous translation control signals must be provided, including perhaps ATG start codon. In addition, the starting colon must be in phase with the reading frame of the desired coding sequence in order to ensure the translation of the whole insert, these exogenous translation control signals and start codons can be of various origins both natural as synthetic. The efficiency of expression can be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (See Bittner, et al., 1987, Methods in Enzymol, 153: 516-544). In addition, a host cell strain can be selected which modulates the expression of the inserted sequences or modifies and processes the gene product in the desired form. Such modifications (eg, glycosylation) and processing (eg, dissociation) of protein products may be important for the function of the protein. Different host cells have specific mechanisms and characteristics for processing and post-transnational modification of proteins and gene products. Appropriate cell lines or appropriate host systems may be selected in order to ensure the correct modification and processing of the foreign protein expressed. For this purpose, eukaryotic host cells possessing the cellular machinery can be employed for the proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product. Such mammalian host cells include, but are not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, and WI38. For the long-term high yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express the HKNG1 gene product can be manipulated. Instead of employing expression vectors containing viral origins of replication, host cells can be transformed with controlled DNA by means of appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc. .) and a selectable marker. After the introduction of foreign DNA, manipulated cells can grow for 1-2 days in an enriched medium and then are switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to selection and allows the cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method can be used profitably to manipulate cell lines expressing the HKNG1 gene product. Such manipulated cell lines can be especially useful in the screening and evaluation of compounds that affect the endogenous activity of the HKNG1 gene product. Numerous selection systems can be employed, including, but not limited to, thymidine kinase genes from herpes simplex viruses (Wingler, et al., 1977 Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska and Szybalski, 1962, Proc. Nati, Acad. Sci. USA 48: 2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22: 817) in tk ", hgprt" or "aprt" cells, respectively. antimetabolites as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wingler, et al., 1980, Proc. Nati, Acad. Sci. USA 77: 3567; O'Hare, et al., 1981 Proc. Nati Acad. Sci. USA 78: 1527); gp, which confers resistance to mycophenolic acid (Mulligan and Berg, 1981, Proc Nati Acad Sci USA 78: 2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981 J. Mol. Biol. 150: 1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30: 147). Alternatively, the expression characteristics of an endogenous HKNG1 gene within a cell line or microorganisms can be modified by inserting a regulatory element of heterologous DNA into the genome of a stable cell line or cloned microorganism such that the element The regulatory framework is operatively linked to the endogenous HKGN1 gene. For example, an endogenous HKNG1 gene normally "transcriptionally silent", i.e., a HKNG1 gene not normally expressed, or expressed only at very low levels in a cell line or microorganism can be activated by the insertion of a regulatory element that is capable of promoting the expression of a gene product normally expressed in this cell line or microorganism. Alternatively, a transcriptionally silent endogenous HKNG1 gene can be activated by inserting a promiscuous regulatory element that functions in several cell types.

A heterologous regulatory element can be inserted into a stable cell line or cloned microorganism such that it is operatively linked to an endogenous HKNG1 gene, employing techniques, such as homologous focused recombination, which are well known to those skilled in the art. subject matter, and described, for example, in Chappel, U.S. Patent No. 5,272,071; PCT publication No. WO 91/06667, published May 16, 1991. Alternatively, any fusion protein can be easily purified by the use of an antibody specific for the fusion protein being expressed. For example, a system described by Janknecht, et al. Allows easy purification of non-denatured fusion proteins expressed in human cell lines (Janknecht, et al., 1991, Proc. Nati, Acad. Sci. USA 88: 8972-8976). This system, the gene of interest is subcloned into a vaccinia recombination plasmid in such a way that the open reading frame of the gene is translationally fused with an amino terminal marker consisting of six histidine residues. Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni2 + nitriloacetic acid-agarose columns and proteins, labeled with histidine are selectively eluted with imidazole-containing buffers.

The HKNG1 gene products can also be expressed in transgenic animals. Animals of any species, including, but not limited to, mice, rats, rabbits, guinea pigs, pigs, micro-nerds, goats, sheep, cows and non-human primates, for example, baboons, monkeys, and chimpanzees can be used to generate animals transgenic by HKNGl. The term "transgenic," as used herein refers to animals that express HKNG1 gene sequences from a different species (e.g., mice that express human HKNG1 gene sequences) as well as animals that have been genetically engineered to overexpress sequences of endogenous HKNG1 gene (ie, of the same species) or animals that have been genetically engineered to stop expressing endogenous HKNG1 gene sequences (i.e., "knockout" animals), and their progeny. Any known technique can be used to introduce a gene transgene HKNG1 into animals in order to produce the founder lines of transgenic animals. Such techniques include, but are not limited to, pronuclear microinjection (Hoppe and Wagner, 1989, U.S. Patent No. 4,873,191); gene transfer mediated by retroviruses in germ lines (Van der Putten, et al., 1985, Proc Nati Acad Sci USA 82: 6148-6152); focus of genes in embryonic stem cells (Thompson, et al., 1989, Cell 56: 313-321); embryo electroporation (Lo, 1983, Mol. Cell. Biol. 3: 1803-1814); and sperm-mediated gene transfer (Lavitrano et al., 1989, Cell 57: 717-723) (for a review of these techniques see Gordon, 1989, Transgenic Animáis, Intl. Rev. Cytol. 115, 171-229). Any known technique can be used to produce clones of transgenic animals that contain a HKNG1 transgene, for example, nuclear transfer in enucleated oocytes from nuclei originating from embryonic, fetal or grown adult cells induced to quiescence (Campbell, et al., 1996, Nature 380: 64-66; Wil ut, et al., Nature 385: 810-813). The present invention offers transgenic animals that carry a transgene of HKNG1 in all its cells, as well as animals that carry the transgene in some cells but not in all its cells, i.e. mosaic animals. The transgene can be integrated as a single transgene or in concatamers, for example, head-head tandems or head-tail tandems. The transgene can be selectively introduced into a particular type of cell and activated in said particular cell type following, for example, the teachings of Lasko et al. (Lasko et al., 1992 Proc. Nati, Acad. Sci. USA 89: 6232-6236). The regulatory sequences required for said specific activation for cell type will depend on the particular cell type of interest and will be apparent to those skilled in the art.

When it is desired to integrate the HKNG1 transgene into the chromosomal site of the endogenous HKNG1 gene, the gene approach is preferred. Briefly, when such a technique is to be employed, vectors containing some nucleotide sequences homologous to the endogenous HKNG1 gene are designed for the purpose of integrating, through homologous recombination with chromosomal sequences, into the nucleotide sequences of the endogenous HKNG1 gene and upsetting its function. The transgene can also be selectively introduced into particular types of cells, thus deactivating the endogenous HKNG1 gene only in this type of cells following, for example, the teachings of Gu, et al. (Gu, et al., 1994, Science 265, 103-106). The regulatory sequences required for such specific deactivation for cell type will depend on the particular cell type of interest, and will be apparent to those skilled in the art. Once the transgenic animals are generated, the expression of the recombinant HKNG1 gene can be assayed using standard techniques. Initial sieving can be achieved by means of a Southern blot analysis or polymerase chain reaction techniques to analyze animal tissues in order to test whether the integration of the transgene has already been carried out. The level of mRNA expression of the transgene in the tissues of the transgenic animals can also be evaluated by techniques including, but not limited to, Northern blot analysis of tissue sample obtained from the animal, in situ hybridization analysis, and RT. -PCR (reverse transcriptase polymerase chain reaction). Tissue samples expressing the HKNG1 gene can also be evaluated immunocytochemically using antibodies specific for the transgene product of HKNG1. HKNG1 proteins can be used, for example, to treat disorders related to the central nervous system, for example, neuropsychiatric disorders. Such HKNG1 gene products include, but are not limited to, soluble derivatives such as peptides or polypeptides corresponding to one or more domains of the HKNG1 gene product, particularly HKNG1 gene products, modified in such a way that they are removed from one or more hydrophobic domains. . Alternatively, antibodies to the HKNG1 protein or anti-idiotypic antibodies that mimic the HKNG1 gene product (including the Fab fragments) antagonists or agonists can be used to treat neuropsychiatric disorders involving HKNG1. In another approach, nucleotide constructs encoding said HKNG1 gene products can be employed for the purpose of genetically manipulating host cells to express such HKNG1 gene products in vivo; these genetically engineered cells can function as "bioreactors" in the body by providing a contiguous flow of HKNG1 gene product, HKNG1 peptides, soluble HKNG1 polypeptides. 5.3. ANTIBODIES FOR DS GEN HKNG1 PRODUCTS Methods for the production of antibodies capable of specifically recognizing one or more epitopes of HKNG1 gene product or epitopes of conserved variants or peptide fragments of the HKNG1 gene products are described. In addition, the invention encompasses antibodies that specifically recognize mutant forms of HKNG1. The terms "specifically bind" and "specifically recognize" refer to antibodies that bind to HKNG1 gene product epitopes with a greater refinement than their binding to non-HKNG1 epitopes (eg, random). Such antibodies may include, but are not limited to, polyclonal antibodies, mclnoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') fragments, fragments produced by a Fab expression library, antibodies anti-idiotypic (anti-Id) and binding fragments with epitopes of any of the foregoing, including the polyclonal and monoclonal antibodies described in section 12 below. Such antibodies can be used, for example, in the detection of a HKNG1 gene product in a biological sample and can, therefore, be used as part of a diagnostic or prognostic technique whereby patients can be evaluated to determine abnormal levels of HKNG1 gene products, and / or to determine the presence of abnormal forms of such gene products. Said antibodies can also be used in combination, for example, with screening screens for compounds, in accordance with what is described below in section 5.8 for the evaluation of the effect of the test compounds on the levels and / or activity of the product. HKNGl gene. In addition, such antibodies can be used in combination with the gene therapy techniques described below, in section 5.9.2, for example to evaluate normal and / or manipulated HKNG1 expression cells prior to their introduction into the patient. Anti-HKNG1 gene product antibodies can be further employed in methods to inhibit the abnormal activity of the HKNG1 gene product. Thus, such antibodies can be used, therefore, as part of methods of treatment for a neuropsychiatric disorder mediated by HKNG1, such as BAD or schizophrenia. For the production of antibodies against a HKNG1 gene product, several host animals can be immunized by injection with a HKNG1 gene product, or a portion thereof. Such host animals may include, but are not limited to, rabbits, mice and rats, just to name a few. Various adjuvants can be used to increase the immune response, depending on the host species, including, but not limited to, complete or incomplete Freund's adjuvant, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (Bacillus Calmette-Guerin) and Corynebacterium parvu. Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigen, such as for example HKNG1 gene product, or an antigenic functional derivative thereof. For the production of polyclonal antibodies, host animals such as those described above can be immunized by injection with a HKNG1 gene product supplemented with adjuvants also described above. Monoclonal antibodies that are homogeneous populations of antibodies to a particular antigen, can be obtained through any technique that offers the production of antibody molecules through continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique of Kohier and Milstein, (1975, Nature 256: 495-497).; and U.S. Patent No. 4,376,110), the hybridoma technique of human B cells (Kosbor et al., 1983, Immunology Today 4:72, Cole et al., 1983, Proc. Nati. Acad. Sci. USA 80: 2026- 2030), and the EBV hybridoma technique (Colé et al., 1985, Monoclonal Antibodies And Cancer Therapy, (monoclonal antibodies and cancer therapy), Alan R. Liss, Inc., pages 77-96). Such antibodies can be of any kind of immunoglobulin including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma that produces the mAb of this invention can be cultured in vitro or in vivo. The production of high titers of mAbs in vivo makes this the currently preferred production method. In addition, production techniques of "chimeric antibodies" (Morrison, et al., 1984, Proc. Nati, Acad. Sci., 81: 6851-6855; Neuberger, et al., 1984, Nature 312: 604-608; Takeda, et al., 1985, Nature, 314 : 452-454) by splicing genes from the mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be employed. A chimeric antibody is a molecule in which different portions are derived from different animal species such as those having a variable region derived from murine mAb and a human immunoglobulin constant region. (See, for example, Cabilly et al., U.S. Patent No. 4,816,567, and Boss et al., U.S. Patent No. 4,816,397, which are hereby incorporated by reference in their entirety). In addition, techniques for the production of humanized antibodies have been developed. (See, for example, Queen, U.S. Patent No. 5,585,089, which is incorporated herein by reference in its entirety). A variable region of light or heavy chain of immunoglobulin consists of a region of "structure" interrupted by three hypervariable regions, known as complementarily determining regions. { CDRs). The magnitudes of the region of structure and of CDRs have been precisely defined (see, "Sequences of Proteins of Immunological Interest", (Protein sequences of immunological interest), Kabat, E. et al., American Department of Human Services and of Health (1983)). Briefly, humanized antibodies are antibody molecules from non-human species that have one or more CDRs from the non-human species and a structure region from a human immunoglobulin molecule. Alternatively, techniques described for the production of single chain antibodies (U.S. Patent No. 4,946,778; Bird, 1988, Science 242: 423-426; Huston, et al., 1988, Proc. Nati. Acad. Sci. USA 85: 5879- 5883; and Ward, et al., 1989, Nature 334: 544-546) can be adapted to produce single chain antibodies against HKNG1 gene products. Single chain antibodies are formed by binding heavy and light chain fragments of the Fv region through an amino acid bridge resulting in a single chain polypeptide. Antibody fragments that recognize specific epitopes can be generated by known techniques. For example, such fragments include, but are not limited to: F (ab ') 2 fragments, which can be produced by digestion of pepsin from the antibody molecule and Fab fragments, which can be generated by reducing the bridges of disulfide fragments of F (ab ') 2- Alternatively, Fab expression libraries can be constructed (Huse, et al., 1989, Science 246: 1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. 5.4. USES OF HKNG1 GEN SEQUENCES, GEN PRODUCTS, AND ANTIBODIES Several applications of HKNG1 gene sequences, HKNG1 gene products, including peptide fragments and fusion proteins, and antibodies directed against HKNG1 gene product and peptide fragments are described. thereof. Such applications include, for example, chromosome 18p mapping, prognostic evaluation and diagnosis of HKNG1-mediated disorders, including disorders related to the central nervous system, for example, neuropsychiatric disorders, such as BAD or schizophrenia, modulation of processes related to HKNG1, and the identification of subjects with a predisposition to such disorders, in accordance with what is described below in section 5.5. In addition, such applications include methods for the treatment of disorders mediated by HKNG1, such as BAD or schizophrenia, in accordance with what is described below, in section 5.9, and for the identification of compounds that modulate the expression of the HKNG1 gene and / or the synthesis or activity of the HKNG1 gene product, in accordance with what is described below, in section 5.8. Such compounds can include, for example, other cellular products involved in processes such as mood regulation and in disorders mediated by HKNG1, for example, neuropsychiatric disorders such as BAD or schizophrenia. These compounds can be used, for example, in the improvement of disorders related to HKNG1 and for the modulation of processes mediated by HKNG1. Uses of HKNG1 gene sequences, HKNG1 gene products including peptide fragments and fusion proteins thereof, and antibodies directed against HKNG1 gene products and / or peptide fragments thereof also include prognostic evaluation and diagnosis of a myopia disorder mediated by HKNG1 such as early dominant autosomal myopia, methods for the treatment of a myopia disorder mediated by HKNG1, and for the identification of compounds that modulate the expression of HKNG1 gene and / or the synthesis or activity of the HKNG1 gene product and could therefore be used in the improvement of a myopia mediated by HKNG1 as for example autosomal dominant myopia of early onset. In fact, such methods are substantially identical to the methods described below in sections 5.5, 5.8, and 5.9 for the diagnosis and treatment of disorders mediated by HKNG1. 5.5 DIAGNOSIS OF MIDDLE DISORDERS BY HKNG1 Several methods can be used for the evaluation of diagnosis and prognosis of disorders mediated by HKNG1, for example, neuropsychiatric disorders and for the identification of subjects who have a predisposition for said disorders. Such methods may employ, for example, reagents such as the nucleotide sequences of the HKNG1 gene described in sections 5.1, and antibodies directed against HKNG1 gene products including peptide fragments thereof, in accordance with that described above in section 5.3. . Specifically, such reagents can be used, for example, for: (1) detection of the presence of HKNG1 gene mutations or detection of subexpression or overexpression of the HKNG1 gene relative to wild-type HKNG1 expression levels; (2) detection of overabundance or sub-abundance of HKNG1 gene product relative to the abundance of wild-type HKNG1 gene products; and (3) the detection of an aberrant level of HKNG1 gene product activity in relation to activity levels of wild-type HKNG1 gene product.

The nucleotide sequences of the HKNG1 gene can be used, for example, to diagnose a neuropsychiatric disorder mediated by HKNG1 using, for example, the mutation / polymorphism detection techniques of HKNG1 described above in section 5.1 and in section 5.6 below. Mutations at numerous different genetic loci can lead to phenotypes related to neuropsychiatric disorders. Ideally, the treatment of patients suffering from said neuropsychiatric disorder will be designed to focus on the particular genetic loci that contain the mutation mediating the disorder. Genetic polymorphisms have been related to differences in pharmacological effectiveness. Therefore, the identification of alterations in the gene HKNG1, protein or regions that flank the gene, can be used in pharmacogenetic methods to optimize therapeutic pharmacological treatments. In one embodiment of the present invention, therefore, alterations, ie, polymorphisms, of the HKNG1 gene or the protein encoded by the genes comprising such polymorphisms, are related to an efficacy, tolerance or toxicity of the drug or drugs, and they can be employed in pharmacogenomic methods to optimize therapeutic pharmacological treatments, including therapeutic pharmacological treatments related to one of the disorders described herein, for example, disorders mediated by HKNG1 such as schizophrenia and BAD. Such polymorphisms can be used, for example, to refine drug design by decreasing the incidence of adverse events in drug tolerance studies, for example, by identifying subpopulations of patients of individuals who respond or do not respond to therapy Particular pharmacological study in efficacy studies, where the subpopulations have a polymorphism of HKNG1 associated with the response or non-response to the drug. The pharmacogenomic methods of the present invention may also offer tools to identify new pharmacological targets for designing drugs and to optimize the use of existing drugs, for example, to increase the response rate to a drug and / or to identify and exclude non-responders. of certain pharmacological treatments (for example individuals having a polymorphism of particular HKNGl associated with non-response or a response inferior to pharmacological treatment) or to decrease the undesirable side effects of certain pharmacological treatments and / or to identify and exclude individuals with a remarkable susceptibility to such side effects (for example, individuals having a particular HKNG1 polymorphism associated with an undesirable side effect to pharmacological treatment). In one embodiment of the present invention, polymorphisms in the HKNG1 gene sequence or flanking said sequences, or variations in the expression of the HKNG1 gene, or activity, for example, variations due to altered methylation, differential splicing, or post-modification The translational product of the HKNG1 gene can be used to identify an individual who has a disease or condition that results from a disorder mediated by HKNG1 and therefore define the most effective and safest pharmacological treatment. Assays such as those described herein can be used to identify such polymorphisms or variations in the expression or activity of the HKNG1 gene. Once a polymorphism in the HKNG1 gene or in a flank sequence in linkage disequilibrium with an allele causing the disorder, or a variation in the expression of the HKNG1 gene in an individual, an appropriate pharmacological treatment can be prescribed to the individual. For the detection of mutations or polymorphisms of the HKNG1 gene, any nucleated cell can be used as the initial source for genomic nucleic acid. For the detection, expression of HKNG1 gene or product of HKNG1 gene, any type of cell or tissue in which the HKNG1 gene is expressed can be used. Nucleic acid-based detection techniques are described below in section 5.6. Peptide detection techniques are described below in section 5.7. The methods described herein can be effected, for example, by the use of pre-packaged diagnostic kits. The invention thus also encompasses kits for detecting the presence of a polypeptide or nucleic acid of the invention in a biological sample (ie, a test sample). Such kits can be used, for example, to determine whether a patient is suffering from or at risk of increasing the development of a disorder associated with an allele causing disorder, or aberrant expression or aberrant activity of a polypeptide of the invention (e.g. a central nervous system disorder, including neuropsychiatric disorder such as BAD or schizophrenia For example, the kit may comprise a compound or labeled agent capable of detecting the polypeptide or mRNA or DNA or HKNG1 gene sequences, for example, encoding the polypeptide In a biological sample, the kit may further comprise a means for determining the amount of the polypeptide or mRNA in the sample (e.g., an antibody that binds to the polypeptide or an oligonucleotide probe that binds to the DNA or mRNA encoding the polypeptide Kits can also include instructions to observe that the patient under study has a disorder or is in risk of developing a disorder associated with aberrant expression of the polypeptide if the amount of the polypeptide or mRNA encoding the polypeptide is above or below a normal level, or if the DNA correlates with the presence of a HKNG1 allele which causes a disorder. For antibody-based kits, the kit may comprise, for example: (1) a first antibody (eg, fixed on a solid support) that binds to a polypeptide of the invention; and, optionally, (2) a different second antibody that binds either the polypeptide or the first antibody and is conjugated to a detectable agent. For kits based on oligonucleotides, the kit may comprise, for example: (1) an oligonucleotide (eg, an identifiably labeled oligonucleotide) that hybridizes to a nucleic acid sequence encoding a polypeptide of the invention, or ( 2) a pair of primers, such as, for example, the primers mentioned in Table 1, useful for amplifying the nucleic acid molecule encoding a polypeptide of the invention.

The kit may also comprise, for example, one or more buffering agents, preservatives, or protein stabilizing agents. The kit may also comprise components necessary to detect the detectable agent (e.g., an enzyme or a substrate). The kit may also contain a control sample or a series of control samples that can be tested and compared with the test sample. Each component of the kit is usually enclosed within a single container and all the various containers are contained within a single pae together with instructions to observe whether the subject tested has a disorder associated with polymorphisms that correlate with alleles that cause related disorders with HKNG1 and / or aberrant levels of mRNA, polypeptides or HKNG1 activity, or else is at risk of developing such disorders. 5.6. DETECTION OF NUCLEIC ACID MOLECULES OF HKNG1 Several methods can be used to screen for the presence of specific mutations or polymorphisms of the HKNG1 gene (including polymorphisms flanking the HKNG1 gene) and to detect and / or assay levels of nucleic acid sequences of HKNG1. HKNGl. Mutations or polymorphisms within the HKNG1 gene or flanking said gene can be detected by the use of several techniques. The nucleic acid of any nucleated cell can be used as the starting point for such assay techniques, and can be isolated in accordance with standard procedures for the preparation of nucleic acid well known to those skilled in the art. HKNG1 nucleic acid sequences can be used in hybridization or amplification assays of biological samples in order to detect abnormalities involving the structure of the HKNG1 gene, including dot mutations, insertions, deletions, inversions, translocations, chromosomal rearrangements. Such assays may include, but are not limited to, southern analysis, single-chain conformational polymorphism (SSCP) analysis, and polymerase chain reaction analysis. Diagnostic methods for the detection of mutations or polymorphisms specific to the HKNG1 gene may involve, for example, contacting and incubation of nucleic acids obtained from a sample, for example, derived from a patient sample or from another cell source suitable with one or several labeled nucleic acid reagents including recombinant DNA molecules, cloned genes or degenerate variants thereof, such as described in section 5.1, above, under favorable conditions for the specific fusion of these reagents on their sequences complementary to the HKNG1 gene or flanking said gene. The diagnostic methods of the present invention also encompass contacting and incubation of nucleic acids for the detection of mutations or polymorphisms of individual nucleotides of the HKNG1 gene. Preferably, these nucleic acid reagent sequences within the HKNG1 gene or chromosome 18p nucleotide sequences flanking the HKNG1 gene are 15 to 30 nucleotides in length. After incubation, all unfused nucleic acids are removed from the hybrid nucleic acid: HKNGl molecule. The presence of nucleic acids that have been hybridized, if such a molecule eventually exists, is then detected. Using said detection scheme, the nucleic acid from the type of cell or tissue of interest can be immobilized, for example, on a solid support such as a membrane, or a plastic surface, such as a microtiter plate. or polystyrene beads. In this case, after incubation, the unfused, labeled nucleic acid reagents of the type described in section 5.1 are easily removed. Detection of labeled HKNG1 nucleic acid reagents, merged, remaining is achieved using standard techniques well known to those skilled in the art. The HKNG1 gene sequences on which the nucleic acid reagents have been fused can be compared to the expected fusion pattern from a normal HKNG1 gene sequence in order to determine if a mutation of the HKNG1 gene is present. In a preferred embodiment, mutations or polymorphisms of HKNG1 can be detected by the use of a microassay of nucleic acid sequences of HKNG1 immobilized on a substrate or "gene flake" (see, for example Cronin, et al., 1996, Human Mutation 7: 244-255). Alternative diagnostic methods for the detection of nucleic acid molecules specific for HKNG1 gene (or flank sequences of HKNG1) in patient samples or other appropriate cell sources, may involve its amplification, for example, by chain reaction of polymerase, (the experimental modality presented in Mullis, 1987, US Patent No. 4,683,202), followed by analysis of the amplified molecules using techniques well known to those skilled in the art such as, for example, the techniques mentioned in the above list. The resulting amplified sequences can be compared with the expected sequences if the amplified nucleic acid contained only normal copies of the HKNG1 gene in order to determine if there is a mutation or polymorphism of the HKNG1 gene in linkage disequilibrium with a HKNG1 allele that causes a disease . Among the preferred HKNG1 nucleic acid sequences for such diagnostic screening assays related to amplification are oligonucleotide primers that amplify the exon sequences of HKNG1. The sequences of such oligonucleotide primers are, therefore, preferably derived from EKNG1 introns sequences in such a way that the entire exon, or coding region, can be analyzed in accordance with what is discussed above. Pairs of primers useful for the amplification of exons of HKNG1 are derived preferably from adjacent introns. Suitable primer pairs can be selected such that each of the 11 exons of HKNG1 is amplified. Initiators for the exon amplification of HKNGl can be routinely designed by a person with certain knowledge in the art by using the sequences of exons and introns of HKNG1 presented in Figures 3A-3R. By way of non-limiting example, Table 1 below presents a list of primers and primer pairs that can be used for the amplification of each of exons 1 to 11 of human HKNG1. In this table, a pair of primers appears for each exon consisting of a direct initiator derived from the sequence of introns upstream of the exon to be amplified, and a reverse primer derived from the sequence of intror.es downstream of the exon to be amplified. For exons greater than about 300 base pairs in length, ie, exons 4 and 7, two pairs of primers are shown in the list (marked 4a, 4b, 7a and 7b). Each of the primer pairs can therefore be used as part of a standard polymerase chain reaction in order to amplify a single exon of HKNG1 (or portion thereof). The primer sequences are presented in a 5 'to 3' orientation. Table 1 Sequence of Initiators cggggttggtttccacc (SEQ ID NO: 8) direct gcgaggagagaaatctggg (SEQ ID NO: 9) reverse tgctcactactttgcagtgttc (SEQ ID NO: 10) direct tgagatcgtgtcactgcattct (SEQ ID NO: 11) reverse gtaaatctcaaaatgttgggttaatag (SEQ ID NO: 12) direct ctaactcttcttetateattactc (SEQ ID NO: 13) reverse 4A tgtttattgtgtgtgtctgctgtg (SEQ ID NO: 14) direct ggacaaccaacatgcaaacag (SEQ ID NO: 15) reverse 4B cccaggtgttttcaattgatgc (SEQ ID NO: 16) direct agcagttttgtccttccaagtg (SEQ ID NO: 17) reverse gtgttttgtaatctgatcagatctc (SEQ ID NO: 18) direct gcagtatttctggtccagatc (SEQ ID NO: 19) back 6 ggtgcacatagatcatgaaatgg (SEQ ID NO: 20) direct taagctgaaataggtgccttaag (SEQ ID NO: 21) reverse 7A tttattccatttctgtcccctac (SEQ ID NO: 22) direct aaggctcagttaggtctgtatc (SEQ ID NO: 23) reverse 7B caggagttttaacgtcttcagac (SEQ ID NO: 24) direct gactcagaaatgtctaccatttc (SEQ ID NO: 25) reverse 8 tgtctccacttcttcaaagtgc (SEQ ID NO: 26) direct caaaatgtacctgagaacttaaag (SEQ ID NO: 27) reverse 9 cacctccaagtttcatggac (SEQ ID NO: 28) direct caaggtatgcacgtgtcatttc (SEQ ID NO: 29) back gaatgtgtattgggatttagtaaac (SEQ ID NO: 30) direct ttgagaattaactattcctgtcaac (SEQ ID NO: 31) reverse 11 ccatcctggacttttactcc (SEQ ID NO: 32) direct ctttcctgcaactgtgtttattg (SEQ ID NO: 33) reverse Each pair of primers above can be used to generate an amplified sequence of approximately 300 base pairs. This is especially desirable in cases where sequence analysis is performed using SSCP gel electrophoretic methods, to the extent that such procedures function optimally using sequences of approximately 300 base pairs or less. Additional nucleic acid sequences of HKNG1 that are preferred for such amplification-related analyzes are the sequences that will detect the presence of a polymorphism of HKNG1 that differs from the sequence of HKNG1 presented in Figures 3A-3R. Such polymorphisms include polymorphisms that represent mutations associated with a neuropsychiatric disorder mediated by HKNG1 such as BAD or schizophrenia. For example, a single base mutation identified in the example presented in section 8, below, results in a mutant HKNG1 gene product comprising the substitution of a lysine residue by the wild-type glutamic acid residue at the position of amino acid 202 of the amino acid sequence of HKNG1 illustrated in Figures 1A-1B (SEQ ID NO: 2) or at amino acid position 184 of the amino acid sequence of HKNG1 illustrated in Figures 2A-2B (SEQ ID NO: 4). Such polymorphisms also include polymorphisms that correlate with the presence of a neuropsychiatric disorder mediated by HKNG1, for example, polymorphisms that are in linkage disequilibrium with HKNG1 alleles that cause disorders. Amplification techniques are well known to those skilled in the art and can be used routinely in relation to initiators such as those presented in the list in Table 1 above. In general, the hybridization conditions can be the following. In general, for probes between 14 and 70 nucleotides in length, the melting temperature TM is calculated using the formula: Tm (0C) = 81.5 + 16.6 (log [monovalent cations]) +0.41 (% G + C) - (500 / N) where N is the length of the probe. If hybridization is carried out in a solution containing formamide, the melting temperature is calculated using the equation Tm (° C) = 81.5 + 16.6 (log [monovalent cations]) +0.41 (% G + C) - (0.61) % formamide) - (500 / N) where N is the length of the probe. In addition, well-known genotype determination techniques can be carried out to identify individuals carrying mutations of the HKNG1 gene. Such techniques include, for example, the use of restriction fragment length polymorphisms (RFLPs), which involve sequence variations at one of the recognition sites for the specific restriction enzyme employed. In addition, improved methods for analyzing DNA polymorphisms, which can be used for the identification of mutations specific for HKNG1 gene, have been described that capitalize the presence of variable members of short, tandem repeated DNA sequences between the restriction enzyme sites. . For example, Weber (U.S. Patent No. 5,075,217) describes a DNA marker based on polymorphisms of block lengths of short tandem repeats of (dC-dA) n- (dG-dT) n. The average separation of the blocks (dC-dA) n- (d G-dT) n is estimated between 30, 000 and 60,000 bp. Markers are closely spaced presenting a high frequency co-inheritance, and are extremely useful in identifying genetic mutations such as mutations within the HKNG1 gene, and diagnosing diseases and disorders related to HKNG1 mutations. Likewise, Caskey et al. (U.S. Patent No. 5,364,759) discloses a DNA profile determination assay for detecting repeat sequences of short tri and tetranucleotides. The process includes the extraction of the DNA of interest such as the HKNG1 gene, the amplification of the extracted DNA, and the labeling of the repetition sequences to form a genotypic map of the individual's DNA. Other methods well known in the art can be used to identify individual nucleotide polymorphisms (SNPs), including biallelic SNPs or biallelic markers having two alleles, both present at a relatively high frequency in a population. Conventional techniques for detecting SNPs include, for example, conventional point absorption analysis, single chain conformational polymorphism analysis (SSCP) (see, for example, Orita et al., 1989, Proc. Nati. Acad. Sci. USA 86 : 2766-2770), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis, non-matching dissociation detection, and other routine techniques well known in the art (see, for example, Sheffield et al., 1989, Proc. Nati, Acad Sci 86: 5855-5892, Grompe, 1993, Nature Genetics 5: 111-117). Alternative preferred methods for detecting and mapping SNPs involve microsequencing techniques where a SNP site in a target DNA is detected by a single nucleotide primer extension reaction (see, for example, Goelet et al., PCT Publication No. W092 / 15712; Mundy, U.S. Patent No. 4,656,127; Vary and Diamond, U.S. Patent No. 4,851,331; Cohen et al., PCT Publication No. WO91 / 02087; Chee et al., PCT Publication No. W095 / 11995; Landegren et al. , 1988, Science 241: 1077-1080, Nicerson et al., 1990, Proc. Nati, Acad. Sci. USA, 87: 8923-8927, Pastinen et al., 1997, Genome Res. 7: 606-614; Pastinen. et al., 1996, Clin Chem. 42: 1391-1397, Jalanko et al., 1992, Clin. Chem. 38: 39-43; Shumaker et al., 1996, Hum. Mutation 7: 346-354; Caskey et al., PCT Publication No. WO 95/00669). The level of expression of the HKNG1 gene can also be tested. For example, RNA from a cell or tissue type which is known or suspected to express the HKNG1 gene, such as the brain, can be isolated and tested using hybridization or polymerase chain reaction techniques such as those described. above. The isolated cells may be derived from cell culture or from a patient. The analysis of cells taken from culture may be a necessary step in the evaluation of cells to be used as part of a gene therapy technique based on cells, or alternatively, to test the effect of compounds on the expression of the HKNG1 gene. Such analyzes may reveal both quantitative and qualitative aspects of the expression pattern of the HKNG1 gene, including the activation or deactivation of HKNG1 gene expression. In one embodiment of such a detection scheme, a cDNA molecule is synthesized from an RNA molecule of interest (eg, by reverse transcription of the RNA molecule into cDNA). A sequence within cDNA is then used as the annealing for a nucleic acid amplification reaction, such as for example amplification reaction in polymerase chain reaction, or the like. The nucleic acid reagents employed as synthesis initiation reagents (e.g., primers) in reverse transcription and the nucleic acid amplification steps of this method are selected from the nucleic acid reagents of the HKNG1 gene described in section 5.1. Preferred lengths of such nucleic acid reagents are at least 9-30 nucleotides. To detect the amplified product, the nucleic acid amplification can be carried out using radioactively or non-radioactively labeled nucleotides. Alternatively, sufficient amplified product can be prepared in such a way that the product can be visualized by standard ethidium bromide staining or else by the use of another suitable method of nucleic acid staining.

Furthermore, it is possible to carry out said HKNG1 gene expression assays "in situ", that is, directly on tissue sections (fixed and / or frozen) of patient tissue obtained from biopsies or resections, in such a way that nucleic acid purification is not required. Nucleic acid reagents such as those described in section 5.1. can be used as probes and / or primers for these procedures in situ (see, for example, Nuovo G.J. 1992, "PCR In Situ Hybridization: Protocols and Applications" (in situ hybridization in polymerase chain reaction: protocols and applications), Raven Press, NY). Alternatively, if a sufficient amount of the appropriate cells can be obtained, a standard Northern analysis can be performed to determine the level of mRNA expression of the HKNG1 gene. 5.7. DETECTION OF GENE PRODUCTS HKNG1 Antibodies directed against unaffected or mutated HKNG1 gene products or conserved variants or peptide fragments thereof, discussed above in section 5.3, can also be used as diagnostic and prognostic agents for HKNG1 mediated disorder , for example, a neuropsychiatric disorder such as 'BAD or schizophrenia. Such methods can be used to detect abnormalities in the level of product synthesis of HKNG1 gene or expression, or abnormalities in the structure, temporal expression, and / or physical location of HKNG1 gene products. The antibodies and immunoassay methods described herein have, for example, important applications in vitro in evaluating the efficacy of treatments for HKNGl-mediated disorders. Antibodies, or fragments of antibodies, such as those described below, can be used to screen potentially therapeutic compounds in vitro in order to determine their effects on HKNG1 gene expression and production of HKNG1 gene product. Compounds that have beneficial effects on a disorder mediated by HKNG1, for example, BAD or schizophrenia. In vitro immunoassays can also be used, for example, to evaluate the efficacy of a cell-based gene therapy for a HKNG1 mediated disorder, for example, a neuropsychiatric disorder such as BAD or schizophrenia. Antibodies directed against HKNG1 gene products can be used in vitro to determine, for example, the level of HKNG1 gene expression that is achieved in genetically engineered cells to produce HKNG1 gene product. In the case of intracellular HKNG1 gene products, said evaluation is preferably carried out using cell or extracts. Said analysis will allow a detection of the number of transformed cells necessary to achieve therapeutic efficacy in vivo, as well as the optimization of the gene replacement protocol. The tissue or type of cell to be analyzed will generally include those of which it is known or suspected to express the HKNG1 gene. The methods of protein isolation employed herein may be, for example, those described in Harlow and Lane (1988, "Antibodies: A Laboratory Manual", (antibodies: a laboratory manual), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) . The isolated cells may be derived from cell culture or from a patient. Analysis of cells taken from a culture may be a necessary step in the evaluation of cells to be used as part of a cell-based gene therapy technique or, alternatively, to test the effect of compounds on the expression of the HKNG1 gene. Preferred diagnostic methods for the detection of HKNG1 gene products, conserved variants or peptide fragments thereof may involve, for example, immunoassays wherein the HKNG1 gene products or conserved variants or peptide fragments are detected by their interaction with an antibody specific for anti-HKNGl gene product. For example, antibodies, or fragments of antibodies, such as those described above in section 5.3, can be used to quantitatively or qualitatively detect the presence of HKNG1 gene products or conserved variants or peptide fragments thereof. This can be achieved, for example, by immunofluorescence techniques employing a fluorescently labeled antibody (see below, this section) coupled with microscopic detection of light, flow cytometric, or fluorimetric. Such techniques are especially preferred in the case of HKNG1 gene products that are expressed on the surface of the cell. The antibodies (or fragments thereof) useful in the present invention can also be used histologically, as in immunofluorescence or immunoelectron microscopy for in situ detection of conserved variants of HKNG1 gene or peptide fragments thereof. In situ detection can be achieved by removing a histological sample from a patient and applying there a labeled antibody that binds to a rTs polypeptide. The antibody (or fragment) is preferably applied by applying the labeled antibody (or fragment) to a biological sample. By using a procedure of this type, it is possible to determine not only the presence of the HKNG1 gene product, conserved variants or peptide fragments but also their distribution in the examined tissue. Using the present invention, persons with certain skill in the art will readily recognize that any of several histological methods (such as staining procedures) can be modified in order to achieve in situ detection of a HKNG1 gene product. Immunoassays for HKNG1 gene products, conserved variants, or peptide fragments thereof typically comprise the incubation of a sample such as for example a biological fluid, a tissue extract, freshly harvested or used cells of cells in the presence of detectably labeled antibody capable of identifying a HKNG1 gene product, conserved variants or peptide variants thereof and detecting the bound antibody by any of several well-known techniques. The biological sample may come into contact with a solid phase support or vehicle or immobilized on said solid phase support or carrier, such as, for example, nitrocellulose, which can immobilize cells, cellular particles or soluble proteins. The support can then be washed with any suitable buffer followed by treatment with the specific antibody of detectably labeled HKNG1 gene product. The solid phase support can then be washed with the buffer a second time in order to remove the unbound antibody. The amount of label bound on the solid support can then be detected by conventional means.

By "solid phase carrier or vehicle" is meant any carrier capable of binding an antigen or an antibody. Well-known carriers or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the vehicle can be either soluble to some extent or insoluble for the purposes of the present invention. The support material can have virtually any possible structural configuration insofar as the coupled molecule can be bound on an antigen or antibody. Thus, the support configuration can be spherical, as in the case of a bead, or cylindrical as in the case of the internal surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat, such as a sheet, test strip, etc. Preferred supports include polystyrene beads. Those skilled in the art will know numerous other vehicles to bind antibody or antigen or they will be able to determine these vehicles by the use of routine experiments. One way in which the antibody specific for HKNG1 gene product can be detectably labeled is by linking said antibody with an enzyme, as for example for use in an enzyme immunoassay (EIA) (Voller, A., "The Enzyme Linked Immunosorbent Assay (ELISA)" (Enzyme Linked Immunosorbent Assay), 1978, Diagnostic Horizons 2: 1-7, Microbiological Associates Quarterly Publication, Walkersville, MD); Voller, A. Et al., 1978, J. Clin. Pathol. 31: 507-520; Butler, J.E., 1981 Meth. Enzymol. 73: 482-523; Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton, FL; Ishikawa, E. et al., (Eds.), 1981, Enzyme Immunoassay, Kgaku Shoin, Tokyo). The enzyme bound on the antibody will react with an appropriate substrate, preferably a chromogenic substrate in such a way that a chemical portion is produced that can be detected, for example, by spectrophotometric, fluorimetric or visual means. Enzymes that can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-esteroidisomerase, yeast alcohol dehydrogenase, α-glycerophosphate, dehydrogenase, triosophosphate isomerase, horseradish peroxidase, phosphatase alkaline, asparaginase, glucose oxidase, β-galactosidase, ribonuclease, urease, caralase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. Detection can be achieved by calorimetric methods that employ a chromogenic substrate for the enzyme. Detection can also be achieved by visual comparison of the magnitude of the enzymatic reaction of a substrate compared to standards prepared in a similar manner. Detection can also be achieved by employing any of several other immunoassays. For example, by radiolabeling the antibodies or antibody fragments, it is possible to detect HKNG1 gene products by the use of a radioimmunoassay (RIA) (see, for example, Weinttraub, B., Principies of Radioimmunoassays, Radioimmunoassays), seventh training course on radioligand testing techniques, The Endocrine Society, March, 1986). The radioactive isotope can be detected by such means as the use of a gamma counter or scintillation counter or by autoradiography. It is also possible to label the antibody with a fluorescent compound. When the fluorescently labeled antibody is exposed to a light of an appropriate wavelength, its presence can be detected due to fluorescence. Among the most frequently used fluorescent marker compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine. The antibody can also be detectably labeled using metals that fluoresce such as 15Eu, or others from the Lanthanide series. These metals can be fixed on the antibody using metal chelation groups such as diethylenetriaminpentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA). The antibody can also be detectably labeled by coupling said antibody to a chemiluminescent compound. The presence of the antibody in a chemiluminescent manner is then determined by detecting the presence of the luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, acridinium ester, imidazole, acridinium salt and oxalate ester. In the same way, a bioluminescent compound can be used to label the antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems where a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of the luminescence. Important bioluminescent compounds for marking purposes are luciferin, luciferaza and aequorin. 5.8. SCREENING TEST FOR COMPOUNDS THAT MODEL THE ACTIVITY OF THE HKNG1 GENE The following assays are designed to identify compounds that bind on a HKNG1 gene product, compounds that bind on proteins, or portions of proteins that interact with a HKNG1 gene product, modulating compounds, for example, interfere with the interaction of a HKG1 gene product with proteins and compounds that modulate the activity of the HKNG1 gene (i.e., they modulate the level of expression of the HKNG1 gene and / or modulate the level of activity of the product. of HKNG1 gene). Assays can be further employed which identify compounds that bind compounds over regulatory sequences of the HKNG1 gene (eg, promoter sequences).; see, for example, Platt, 1994, J. Biol. Chem. 269, 28558-28562), and which can modulate the expression level of the HKNG1 gene. such compounds can include, but are not limited to, small organic molecules such as those that can cross the blood-brain barrier, penetrate and / or enter an appropriate cell and affect the expression of the HKNG1 gene or some other gene involved in a regulatory pathway. HKNGl. Methods for the identification of proteins of this type are described below in section 5.8.2. such proteins may be involved in mood control and / or regulation. In addition, among these compounds are compounds that affect the level of expression of the HKNG1 gene and / or product activity of the HKNG1 gene and that can be used in the therapeutic treatment of disorders mediated by HKNG1, for example, neuropsychiatric disorders such as BAD and schizophrenia as described, then in section 5.9. The compounds may include, but are not limited to, such peptides, for example soluble peptides, including, but not limited to, Ig-tail fusion peptides, and members of random peptide libraries; see, for example, Lam et al., 1991 Nature 354: 82-84; Houghten, et al., 1991, Nature 354: 84-86), and molecular library derived from combination chemistry consisting of amino acids in D and / or L configuration, phosphopeptides (including, without limitation, members of targeted phosphopeptide libraries, random or partially degenerate, see, for example, Songyang, et al., 1993, Cell 72: 767-778), antibodies (including, but not limited to, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain antibodies) , and fragments of the expression library of FAb, F (ab ') 2 and FAb and epitope binding fragments thereof), and small organic or inorganic molecules. Such compounds may further comprise compounds in particular drugs or members of family classes of drugs which are known to ameliorate the symptoms of a HKNG1 mediated disorder, for example, a neuropsychiatric disorder such as BAD or schizophrenia.

Such compounds include families of antidepressants such as lithium salts, carbamazepine, valproic acid, lysergic acid diethylamide (LSD), p-chlorophenylalanine, p-propyldopacetamide dithiocarbamate derivatives, such as, for example, FLA 63; anti-anxiety drugs, for example, diazepam; monoamine oxidase (MAO) inhibitors, for example, iproniazide, clorgiline, phenelzine and isocarboxazide; biogenic amine absorption blockers, for example, tricyclic antidepressants such as desipramine, imipramine and amitriptyline; inhibitors of serotonin reuptake, for example, fluoxetine; antipsychotic drugs such as phenothiazine derivatives (for example, chlorpromazine (torazine) and trifluoropromazine), butyrophenone (e.g., haloperidol (Haldol)), thioxanthene derivatives (e.g., chlorprothixene), and dibenzodiazepine (e.g., clozapine); benzodiazepines; dopamine agonists and antagonists for example, L-DOPA, cocaine, amphetamine, α-methyl tyrosine, reserpine, tetrabenazine, benztropine, pargiline; agonists and noradrenergic antagonists for example, clonidine, phenoxybenzamine, phentolamine, tropolone. Compounds identified through assays such as those described herein may be useful, for example, to elaborate the biological function of the HKNG1 gene product and to improve neuropsychiatric disorders mediated by HKNG1, such as BAD and schizophrenia. Tests to prove the effectiveness Í04 of compounds identified for example by techniques such as those described in sections 5.8.1-5.8.3, are discussed below, in section 5.8.4. 5.8.1. IN VITRO SIZING TESTS FOR COMPOUNDS LINKING WITH THE HKNG1 GEN PRODUCT In vitro systems can be designed to identify compounds capable of binding to the HKNG1 gene products of the invention, the compounds identified can be useful, for example, in the Activity modulation of unaffected and / or mutant HKNG1 gene products, may be useful in the elaboration of the biological function of the HKNG1 gene product, may be employed in screening to identify compounds that disrupt the gene product interactions of normal HKNG1 or they can in turn upset such interactions. The principle of assays to identify compounds that bind with the HKNG1 gene product and the test compound under conditions and for a sufficient time to allow the two components to interact and bind, thus forming a complex that can be removed and / or detect it in the reaction mixture. These tests can be carried out in several ways. For example, a method for carrying out such an assay includes the anchoring of a HKNG1 gene product or a test substance on a solid support and the detection of HKNG1 gene product complexes / test compound formed on the support solid at the end of the reaction. In one embodiment of said method, the gene product HKNG1 can be anchored on a solid support and the test compound, which is not anchored can be labeled, either directly or indirectly. In practice, microtitration plates are conveniently used as the solid support. The anchored component can be immobilized by covalent or non-covalent fixations. A non-covalent fixation can be achieved simply by coating the solid surface with a solution of the protein and by drying. Alternatively, an immobilized antibody, preferably a monoclonal antibody, specific for the protein to be immobilized can be used to anchor the protein on the solid surface. The surfaces can be prepared in advance and stored. In order to carry out the test, the non-immobilized component is added to the coated surface containing the anchored component. After the reaction is finished, the unreacted components are removed (eg, by washing) under conditions such that the formed complexes remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be achieved in several ways. When the previously uninnovated component is pre-marked, the detection of the immobilized marker on the surface indicates that complexes were formed. When the non-immobilized component is not pre-marked, an indirect marker can be used to detect complexes on the surface; for example, using a labeled antibody specific for the previously non-immobilized component (the antibody, in turn, can be labeled directly or indirectly with a labeled anti-Ig antibody Alternatively, a reaction can be carried out in a liquid phase, the products of the reaction can be separated from the unreacted components, and the complexes can be detected, for example, by using an immobilized antibody specific for the HKNG1 gene product or the test compound for anchoring complexes formed in solution, and a labeled antibody specific for the other component of the complex possible to detect anchored complexes 5.8.2 TESTING FOR PROTEINS THAT INTERACT WITH GENE PRODUCT HKNG1 any suitable method to detect interaction is protein-protein can be used to identify interactions product of HKNG1-protein gene Among the traditional methods that can be used are the coi nimoprecipitation, cross-linking and copurification through gradients or chromatographic columns. By employing procedures such as these, proteins can be identified, including intracellular proteins that interact with HKNG1 gene products. Once isolated, a protein of this type can be identified and can be used in combination with standard techniques to identify proteins with which it interacts. For example, at least a portion of the amino acid sequence of a protein that interacts with the HKNG1 gene product can be determined using techniques well known to those skilled in the art, such as by the Edman degradation technique ( see, for example Creighton, 1983, "Proteins: Structures and Molecular Principles" (Proteins: Structures and Molecular Principles), "WH Freeman &Co., NY pages 34-39.) The amino acid sequence obtained can be used as a guide for the generation of ribonucleotide mixtures that can be used to screen gene sequences encoding such proteins.Screening can be carried out, for example, by standard hybridization or polymerase chain reaction techniques. Mixtures of olinucleotides and screening are well known, (see, for example, Ausubel, supra, and 1990, "PCR Protocols: A Guide to Methods and Application s, "(Polymerase Chain Reaction Protocols: a guide for methods and applications) Innis, et al., eds. Academic Press, Inc., New York). In addition, methods that result in the simultaneous identification of genes encoding the protein that interacts with a HKNG1 gene product can be employed. These methods include, for example, probing of expression libraries with labeled HKNG1 gene products, using HKNG1 gene products in a manner similar to the well known antibody probe technique of? Gtll libraries. A method that detects protein interactions in vivo, the two-hybrid system is described with details for illustration only and not for limitation. A version of that system has been described in (Chien et al., 1991, Proc. Nati, Acad. Sci. USA, 88: 9578-9582) and is commercially available in Clontech (Palo Alto, CA). In summary, using such a system, plasmids encoding two hybrid proteins are constructed: one protein consists of the DNA binding domain of a transcription activator protein fused to the HKNG1 gene product and the other protein consists of the activating the transcription activator protein fused to an unknown protein encoded by a cDNA that has been recombined in this plasmid as part of a cDNA library. The DNA binding domain fusion plasmid and the cDNA library are transformed into a strain of the Saccharomyces yeast containing a reporter gene (e.g., HBS or LacZ) whose regulatory region contains the transcription activator binding site. Any of the hybrid proteins alone can not activate the transcription of the reporter gene: the hybrid DNA strand domain protein can not because it does not provide the activation function, and the activation domain hybrid protein can not because it can not locate the activator binding sites. The activation of the two hybrid proteins reconstitutes the functional activator protein and results in the expression of the reporter gene, which is detected for the reporter gene product. The two-hybrid system or related methodologies can be used to screen activation domain libraries for proteins that interact with the "bait" gene product. By way of example and not by way of limitation, the HKNG1 gene products can be used as the bait product. Total genomic sequences or cDNA sequences are fused to the DNA encoding an activation domain. This library and a plasmid encoding a hybrid of a HKNG1 gene product fused onto the DNA binding domain are cotransformed into a yeast reporter strain and the resulting transformants are screened to determine those expressing the reporter gene. For example, a banding HKNG1 gene sequence, such as the open reading frame of the HKNG1 gene, can be cloned into a vector such that it translationally fuses on the DNA encoding the DNA binding domain of the protein. GAL4. These colonies are encoded and the reporter gene expression library plasmids are isolated. DNA sequencing is then used to identify the proteins encoded by the plasmids in the library. A cDNA library of the cell line from which proteins that interact with a product of the HKNG1 bait gene should be detected can be made using methods routinely practiced in the art. According to the particular system described herein, for example, cDNA fragments can be inserted into a vector such that they are translationally fused over the transcription activation domain of GAL4. Said library can be cotransformed with the fusion plasmid of the HKNG1 bait-GAL4 gene in a yeast strain containing a LacZ gene driven by a promoter containing a GAL4 activation sequence. A cDNA encoded protein, fused to a transcription activation domain of GAL4 that interacts with a product of the HKNG1 bait gene will reconstitute an active GAL4 protein and consequently will boost expression of the HIS3 gene. Colonies expressing HIS3 can be detected by their growth in petri dishes containing medium based on semisolid agar without histidine. The cDNA can then be purified from these strains and used to produce and isolate the interaction protein with bait HKNG1 gene product by using techniques practiced routinely in the art. 5.8.3. TESTS FOR COMPOUNDS THAT INTERFERE WITH THE INTERACTION OF GENE MACROMOLECULUM OF HKNG1 GENE OR POTENTIATE SUCH INTERACTION The HKNG1 gene products can, in vivo, interact with one or several macromolecules, including, intracellular macromolecules, for example, proteins. Such macromolecules can include, but are not limited to, nucleic acid molecules and these proteins identified through methods such as those described above in sections 5.8.1-5.8.2. for the purposes of this commentary the macromolecules are known here as "link partners". Compounds that disrupt the binding of HKNG1 gene product with a binding partner may be useful for regulating the activity of the HKNG1 gene product especially mutant HKNG1 gene products. Such compounds can include, but are not limited to, molecules such as peptides, and the like according to what is described, for example, in section 5.8.2 above. The basic principle of a test system used to identify compounds that interfere with the interaction or potentiate such interaction between the HKNG1 gene product and a binding partner or link partners includes the preparation of UNAM reaction mixture containing the gene product. HKNG1 and the liaison partner in conditions and for a sufficient time to allow the two to interact and unite to form a complex. In order to test a compound for determining its inhibitory activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound may be initially included in the reaction mixture or may be added subsequently to the addition of the HKNG1 gene product and its binding partner. Control reaction mixture is incubated without the test compound either with a compound which is known not to block complex formation. The formation of any complex between the HKNG1 gene product and the binding partner is detected later. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound indicates that the compound interferes with the interaction of the HKNG1 gene product and the binding partner. In addition, the complex formation within the reaction mixtures containing the test compound and the normal HKNG1 gene product can also be compared with the formation of complexes within the reaction mixtures containing the test compound and a gene product. HKNG1 mutant. This comparison may be important in cases in which it is desirable to identify compounds that disrupt the mutant but not normal mutant HKNG1 gene product interactions. In order to test a compound for potentiation activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound may be initially included in the reaction mixture, or may be added subsequently to the addition of the HKNG1 gene product and its binding partner. Control reaction mixtures are incubated without the test compound or with a compound which is known not to block the formation of complexes. The formation of any complex between the HKNG1 gene product and the binding partner is then detected. The increased formation of a complex in the reaction mixture containing the test compound, but not in the control reaction, indicates that the compound increases and therefore potentiates the interaction of the HKNG1 gene product and the binding partner. In addition, the formation of complexes within the reaction mixtures containing the test compound and the normal HKNG1 gene product can also be compared to the formation of complexes within the reaction mixtures containing the test compound and a product of mutant HKNG1 gene. This comparison may be important in cases in which it is desirable to identify compounds that increase the mutant but not normal mutant HKNG1 gene product interactions. In alternative modalities, the above assays can be performed using a reaction mixture containing the product of HKNG1 ge, a binding partner, and a third that disrupts or increases the binding of HKNG1 gene product to the binding partner. The reaction mixture is prepared and incubated in the presence and absence of the test compound, in accordance with that described above, and the formation of any complex between the HKNG1 gene product and the binding partner is detected. In this embodiment, the formation of a complex in the reaction mixture containing the test compound but not in the control reaction indicates that the test compound interferes with the ability of the second compound to upset the HKNG1 gene product link. with your link partner. Tests for compounds that interfere with the interaction of HKNG1 gene products and binding partners or enhance such interaction can be carried out in a heterogeneous format or in a homogeneous format. Heterogeneous assays involve the anchoring of either the HKNG1 gene product or the binding partner on a solid support and the detection of complexes formed on the solid support at the end of the reaction. In homogeneous tests, the entire reaction is carried out in a liquid phase. In any approach, the order of addition of reagents may vary to obtain different information about the compounds being tested. For example, test compounds that interfere with the interaction between the HKNG1 gene products and the binding partners, or enhance such interaction, for example, by competition, can be identified by carrying out the reaction in the presence of the test substance.; that is, by adding the test substance to the reaction mixture before or simultaneously with the HKNG1 gene product and interactive intracellular binding partner. Alternatively, test compounds that disrupt preformed complexes, for example, compounds having higher binding constants that displace one of the components of the complex, can be tested by adding the test compound to the reaction mixture after the formation. of the complexes. Below we briefly describe the various formats. In the heterogeneous assay system, any of the HKNG1 gene product or the interactive binding partner, is anchored on a solid surface, while the non-anchored species is labeled, either directly or indirectly. In practice, microtiter plates can be conveniently used. The anchored species can be immobilized by covalent or non-covalent fixations. Non-covalent attachment can be achieved simply by coating the solid surface with a solution of the HKNG1 gene product or binding partner and by drying. Alternatively, an immobilized antibody specific for the species to be anchored can be used to anchor the species on the solid surface. The surfaces can be prepared in advance and stored. In order to carry out the assay, the partner of the immobilized species is added to the coated surface with or without the test compound. After the reaction is finished, the unreacted components are removed (eg, by washing), and the complexes formed can remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be achieved in several ways. When the non-immobilized species is pre-marked, detection of the immobilized marker on the surface indicates that complexes were formed. When the non-immobilized species is not pre-marked, an indirect marker can be used to detect complexes anchored on the surface; for example, using a labeled antibody specific for the initially non-immobilized species (the antibody, in turn, can be labeled directly or indirectly with a labeled anti-Ig antibody.) Depending on the order of addition of the reaction components, they can be detected test compounds which inhibit the formation of complexes or which disrupt the preformed complexes Alternatively, the reaction can be carried out in a liquid phase, in the presence or absence of the test compound, the products of the reaction can be separated from the components without react, and the complexes can be detected, for example, by using an immobilized antibody specific for one of the binding components to anchor any complex formed in solution, and a labeled antibody specific for the other partner to detect the anchored complexes. According to the order of addition of the reagents to the liquid phase, sec can identify test compounds. to inhibit complex formation or to disrupt preformed complexes. In the alternative embodiment of the invention, a homogeneous assay can be employed. In this approach, a pre-formed complex of the HKNG1 gene product and the interactive link partner is prepared where any of the HKNG1 gene product or its binding partner is marked, but the signal generated by the marker is turned off due to the formation of complex (see, for example, US Pat. No. 4,109,496 to Rubenstein which employs this approach for immunoassays). The addition of a test substance that competes with one of the species of the preformed complex and displaces one of said species will result in the generation of a signal above the bottom. In this way, test substances can be identified which disrupt the interaction of the HKNG1 gene product / link partner. In another embodiment of the invention, the same techniques can be employed using fragments of peptide corresponding to the binding domains of the HKNG1 product and / or binding partner (in cases where the binding partner is a protein) instead of one or both of the full-length proteins. Any number of methods routinely practiced in the art can be employed to identify and isolate the binding sites. These methods include, but are not limited to, mutagenesis of the gene encoding one of the proteins and screened to upset the binding in a coinmunoprecipitation assay. Compensation mutations in the gene encoding the second species in the complex can be selected. A sequence analysis of the genes encoding the respective proteins will reveal the mutations corresponding to the region of the protein involved in the interactive link. Alternatively, a protein can be anchored on a solid surface using methods described in this section above, and allowed to react and bind to its labeled binding partner, which has been treated with a proteolytic enzyme such as trypsin. After washing a short, labeled peptide comprising the binding domain can remain associated with the solid material, which can be isolated and identified by amino acid sequencing. Likewise, once the gene encoding the segments is manipulated to express peptide fragments of the protein it can be tested to determine its binding activity and purified or synthesized. For example, and not by way of limitation, a HKNG1 gene product can be anchored onto a solid material in accordance with that described above, in this section, by creating a GST-HKNG1 fusion protein and allowing it to bind with glutathione beads. agarose. The binding partner can be labeled with a radioactive isotope, for example 35S, and dissociated with a proteolytic enzyme such as for example trypsin. Dissociation products can be added to the anchored GST-HKNG1 fusion protein and their binding can be allowed. After removal of unbound peptide, a labeled bound material representing the binding partner domain can be eluted, purified, and analyzed for amino acid sequence by well-known methods. Peptides identified in this way can be produced synthetically or produced using recombinant DNA technology. 5.8.4. TESTS FOR IDENTIFICATION OF COMPOUNDS THAT IMPROVE A DISORDER MEASURED BY HHKNG1 compounds, including, but not limited to, binding compounds identified through assay techniques such as those described above in sections 5.8.1-5.8.4, may be tested to determine their ability to ameliorate symptoms of a HKNG1-mediated disorder, eg, a central nervous system related disorder, such as a neuropsychiatric disorder, including schizophrenia and affective disorder (mood) dipolar, including affective disorder (mood) Severe bipolar disorder (BP-I), bipolar affective mood (mood) with hypomania and major depression (BP-II), and myopia disorders. It will be noted that the assays described herein can identify compounds that affect HKNG1 activity either by affecting gene expression in HKNG1 or by affecting the level of the HKNG1 gene product. For example, compounds involved in another step can be identified in the pathway in which the HKGN1 gene and / or the HKNG1 gene product is involved and, by affecting this, the effect of HKNG1 on the development of a gene can be modulated. disorder mediated by HKNGl. Such compounds can be used, for example, as part of a therapeutic method for the treatment of the disorder. Next, we describe cell-based assays and animal model-based assays for the identification of compounds that have such ability to ameliorate the symptoms of a HKNG1 mediated disorder., for example a neuropsychiatric disorder, such as BAD or schizophrenia. First, cell-based systems can be used to identify compounds that can act to ameliorate the symptoms of a HKNG1 mediated disorder. Such cell systems may include, for example, recombinant or non-recombinant cell, for example, cell lines that express the HKNG1 gene. By using such a cell system, cells expressing HKNG1 can be exposed to a compound which is suspected of having an ability to ameliorate symptoms of a HKNG1-mediated disorder, for example, a neuropsychiatric disorder, for example BAD or schizophrenia, in a sufficient concentration and for a sufficient time to express said improvement of said symptoms in the exposed cells. After exposure, the cells can be assayed for alterations in the expression of the HKNG1 gene, for example, by the assay of cells used for transcripts of HKNG1 mRNA (by Northern analysis) or for gene products. HKNG1 expressed by the cells; Compounds that modulate the expression of the HKNG1 gene are excellent candidates as therapeutic agents. In addition, animal-based systems or models for a HKNG1-mediated disorder, eg, a neuropsychiatric disorder, eg, transgenic mice that contain a human or altered form of the HKNG1 gene, can be used to identify compounds capable of ameliorating the symptoms of the disorder. . Such animal models can be used as test substrates for the identification of drugs, pharmaceutical agents, therapies and interventions. For example, animal models may be exposed to a compound suspected of having the ability to ameliorate the symptoms, at a concentration and for a time sufficient to cause such improvement of said symptoms of a HKGN1 mediated disorder. The response of the animals to the exposure can be monitored by evaluating the inversion of the symptoms of the disorder. Regarding the intervention, any treatment that reverses any aspect of symptoms of HKNG1-mediated disorder should be considered as candidates for human therapeutic intervention in these disorders. Dosages of test agents can be determined by derivation of dose-response curves, in accordance with what is documented in section 5.10.1, below. 5.9. COMPOUNDS AND METHODS FOR THE TREATMENT OF MIDDLE DISORDERS BY HKNG1 Methods and compositions are described below in which a HKNG1 mediated disorder described herein, for example, a neuropsychiatric disorder mediated by HKNG1, such as BAD or schizophrenia, should be treated. For example, such methods may comprise the administration of compounds that modulate the expression of a mammalian HKNG1 gene and / or the synthesis or activity of a mammalian HKNG1 gene product (eg, a recombinant HKNG1 gene product) in such a manner. that symptoms of the disorder improve. Alternatively, in cases in which disorders mediated by HKNG1 result from mutations of the HKNG1 gene, such methods may comprise supplying the patient with a nucleic acid molecule encoding an unaffected HKNG1 gene product in such a manner that a gene product. HKNG1 unaffected is expressed and the symptoms of the disorder are improved. In another embodiment of methods for the treatment of HKNG1-mediated disorders resulting from HKN1 gel mutations, such methods may comprise supplying the patient with a cell comprising a nucleic acid molecule encoding an unaffected HKNG1 gene product. so that the cell expresses the unaffected HKNG1 gene product and the symptoms of the disorder are improved. In cases in which a loss of function of normal HKNG1 gene products results in the development of a disorder mediated by HKNG1, an increase in the activity of the HKNG1 gene product would facilitate progress towards an asymptomatic state in individuals presenting a deficient level of HKNG1 gene expression and / or HKNG1 gene product activity. Methods for increasing the expression or synthesis of HKNG1 may include, for example, methods such as those described below, in section 5.9.2. Alternatively, symptoms of neuropsychiatric disorders mediated by HKNG1 can be improved by the administration of a compound that increases the level of expression of the HKNG1 gene and / or activity of the HKNG1 gene product. Methods for inhibiting or reducing the level of synthesis or expression of HKNG1 gene products may include, for example, methods such as those described in section 5.9.1. In one embodiment of treatment methods, the compounds administered comprise compounds, particularly drugs, that ameliorate the symptoms of a disorder described herein as a neuropsychiatric disorder, such as BAD or schizophrenia. Such compounds include drugs within the families of the antidepressants such as lithium salts, carbamazepine, valproic acid, lysergic acid diethylamide (LSD), p-chlorophenylalanine, derivatives of said p-propyldopacetamide carbamate, eg, FLA 63; anti-anxiety drugs, for example, diazepam; monoamine oxidase (MAO) inhibitors, for example, iproniazide, clorgiline, phenelzine and isocarboxazide; biogenic amine absorption blockers; for example, tricyclic antidepressants such as desipramine, imipramine and amitriptyline; inhibitors of serotonin reuptake, for example, fluoxetine; antipsychotic drugs such as phenothiazine derivatives (e.g., chlorpromazine (thoracine) and trifluoropromazine)), butyrophenones (e.g., haloperidol (Haldol)), thioxanthene derivatives (e.g., chlorprothixene), and dibenzodiazepines (e.g., clozapine); benzodiazepines; dopamine agonists and antagonists, for example, L-DOPA, cocaine, amphetamines, α-methyl-tyrosine, reserpine, tetrabenazine, benzotropin, pargyline; agonists and noradrenergic antagonists for example, clonidine, phenoxybenzamine, phentolamine, tropolone. In another embodiment, symptoms of a disorder described herein, for example, a neuropsychiatric disorder mediated by HKNG1 such as BAD or schizophrenia, can be improved by protein therapy methods of HKNG1, for example, by decreasing or increasing the level and / or the activity of HKNG1 using the HKNG1 protein, fusion protein, and peptide sequences described in section 5.2, above, or by the administration of proteins or protein fragments (eg, peptide) that interact with a HKNG1 gene or either a HKNG1 gene product and thus inhibiting or enhancing its activity.

Said protein therapy may include, for example, administration of a functional HKNG1 protein or fragments of a HKNG1 protein (e.g., peptides) that represent functional HKNG1 domains. In one embodiment, fragments of HKNG1 or peptides representing a functional HKNG1 binding domain are administered to an individual in such a manner that the peptides bind to a binding protein of HKNG1, eg, a HKNG1 receptor. Such fragments or peptides can serve to inhibit the activity of HKNG1 in an individual by competition with binding of HKNG1 on the binding protein and consequently inhibition of the binding of HKNG1 on the binding protein, thereby improving the symptoms of a disorder described herein. Alternatively, such fragments or peptides can increase the activity of HKNG1 in an individual by mimicking the function of HKNG1 in vivo, thereby improving the symptoms of a disorder described herein. The proteins and peptides that can be employed in the methods of the present invention include synthetic proteins and peptides (eg, chemically synthesized or recombinant), as well as naturally occurring proteins and peptides. The proteins and peptides may have naturally occurring and non-naturally occurring amino acid residues (eg, D-amino acid residues), and / or one or more non-peptide bonds (eg, imino, ester, hydrazide, semicarbazide and azo bonds). . The proteins or peptides may also contain additional chemical groups (ie, functional groups) present at the amino and / or carboxy terminals in such a way that, for example, the stability, bioavailability, and / or inhibitory activity of the peptide is improved. Exemplary functional groups include hydrophobic groups (e.g., carbobenzoxyl, dansyl, and t-butyloxycarbonyl groups), an acetyl group, a 9-fluorenylmethoxycarbonyl group, and macromolecular carrier groups (e.g., lipid-fatty acid conjugates, polyethylene glycol, or carbohydrates) including groups of peptides. 5.9.1. APPROACHES OF ANTI-SENTÍDO INHIBITORIO, RIBOZIMA AND TRIPLE HELIX In another modality, symptoms of neuropsychiatric disorders mediated with HKNG1 can be improved by decreasing the expression level of HKNG1 gene and / or activity of HKNG1 gene products by using sequences of HKNG1 gene in combination with well-known anti-sense methods, "knocked out" of gene, ribozyme and / or triple helix in order to decrease the expression level of HKNG1 gene. Among the compounds that may have the ability to modulate the activity, expression or synthesis of the HKNG1 gene, including the ability to improve the symptoms of a neuropsychiatric disorder mediated by HKNG1, such as BAD or schizophrenia, are anti-sense molecules , ribozyme, and triple helix. Such molecules can be designed to reduce or inhibit the activity of the unaffected target gene, or, if appropriate, mutant. Techniques for production and use of such molecules are well known to those skilled in the art. Anti-sense DNA and RNA molecules act to directly block the translation of mRNA by hybridizing with the focused mRNA and preventing the translation of protein. Anti-sense approaches involve the design of oligonucleotides that are complementary to a target gene mRNA. The anti-sense oligonucleotides will bind with the complementary white gene mRNA transcripts and will prevent translation. Absolute complementarity is not required even when it is preferred. A "complementary" sequence with a portion of an RNA, as mentioned herein, refers to a sequence that has sufficient complementarity to be able to hybridize with the RNA to form a stable duplex; in the case of double-stranded anti-sense nucleic acids, a single strand of the duplex DNA can be tested in this way, or the triple formation can be tested. The ability to hybridize depends on both the degree of complementarity and the length of the anti-sense nucleic acid. Usually, the greater the length of the nucleic acid of hybridization, the greater the number of mismatch with an RNA can contain and continue to form a stable duplex (or triples, depending on the case). One skilled in the art can determine the tolerable degree of mismatch by using standard procedures to determine the melting point of the hybridized complex. In one embodiment, complementary oligonucleotides with non-coding regions of the HKNG1 gene could be employed in an anti-sense approach to inhibit the translation of endogenous HKNG1 mRNA. Anti-sense nucleic acids should be at least 6 nucleotides in length and are preferably oligonucleotides that are within a range of 6 to about 50 nucleotides in length. In specific aspects, the oligonucleotide has at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides. Regardless of the choice of the target sequence, it is preferred that in vitro studies be performed first to quantify the ability of the anti-sense oligonucleotide to inhibit gene expression. It is preferred that these studies employ controls that distinguish between anti-sense gene inhibition and non-specific biological effects of the oligonucleotides. It is also preferred that these studies compare the levels of target RNA or protein with the levels of an internal control RNA or protein. Additionally, it is contemplated that the results obtained using the anti-sense oligonucleotide are compared with the results obtained using the control oligonucleotide. It is preferred that the control oligonucleotide be approximately the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differ from the anti-sense sequence by no more than necessary to avoid specific hybridization on the target sequence. The oligonucleotides may be DNA or chimeric mixtures or derivatives or modified reactions thereof, single chain or double chain. The oligonucleotide may be modified in the base portion, sugar portion, or phosphate structure, for example, to improve the stability of the molecule, hybridization, etc. The oligonucleotide can include other adjoining groups such as peptides (for example, to target host cell receptors in vivo), or agents that facilitate transport across the cell membrane (see, for example, Letsinger, et al., 1989 , Proc. Nati, Acad. Sci. USA 84: 648-652; PCT publication no. WO88 / 09810, published December 15, 1988), or the blood-brain barrier (see, for example, PCT publication No. WO89 / 10134, published April 25, 1988), hybridization-activated dissociation agents ( see, for example, Krol et al., 1988, BioTechniques 6: 958-976) or intercalation agents (see, for example, Zon, 1988, Pharm.Res .: 5: 539-549). For this purpose, the oligonucleotide may be conjugated to another molecule, for example, a peptide, hybridization-activated cross-linking agent, transport agent, hybridization activated dissociation agent, etc. The anti-sense oligonucleotide may contain at least one of the modified base portions selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylnosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil , 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl ester of uracil-5-oxyacetic acid, uracil-5-oxyacetic acid (v), 5-me til-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine. The anti-sense oligonucleotide may also comprise at least one modified sugar portion selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose. In another embodiment, the anti-sense oligonucleotide comprises at least one modified phosphate structure selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphoniamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analogous to it In another embodiment, the anti-sense oligonucleotide is an α-anomeric oligonucleotide. An α-anomeric oligonucleotide forms double-stranded specific hybrids with complementary RNA where, unlike the usual β units, the chains are parallel to one another (Gautier, et al., 1987, Nucí Acids Res. 15: 6625-6641 ). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue, et al., 1987, Nucí Acids Res. 15: 6131-6148), or a chimeric RNA-DNA analogue (Inoue, et al., 1987, FEBS Lett. 215: 327-330). The oligonucleotides of the present invention can be synthesized by standard methods known in the art, for example, by the use of an automated DNA synthesizer (such as those commercially available from Biosearch, Applied Biosistems, etc.). As examples, phosphorothioate oligonucleotides can be synthesized by the method of Stein, et al. (1988, Nucí Acids Res. 16: 3209), methylphosphonate oligonucleotides can be prepared by using glass polymer supports with controlled pores (Sarin, et al., 1988, Proc. Nati. Acad. Sci. USA 85 : 7448-7451), etc. While antisense nucleotides complementary to the target gene coding region sequence could be employed, nucleotides complementary to the transcribed untranslated region are especially preferred. Anti-sense molecules must be administered to cells that express the target gene in vivo. Several methods have been developed to deliver anti-sense DNA or RNA to cells; for example, anti-sense molecules can be injected directly into the tissue site, or modified anti-sense molecules, designed to target the desired cells (e.g., anti-sense linked to polypeptides or antibodies that specifically bind to receptors or antigens expressed on the surface of the target cell) can be administered systematically. A preferred approach for achieving sufficient intra-sense anti-sense concentrations to suppress the translation of endogenous .RNAs employs a recombinant DNA construct wherein the anti-sense oligonucleotide is placed under the control of a strong poly III or pol III promoter. The use of said construct to transfect target cells in the patient will result in the transcription of sufficient quantities of single chain RNAs that form complementary base pairs with the endogenous target gene transcripts to thereby prevent translation of the target gene mRNA. . For example, a vector can be introduced, for example, in such a way that it has been absorbed by a cell and in such a way as to direct the transcription of an anti-sense RNA. Said vector can remain episomal or it can be integrated chromosomally, insofar as it can be transcribed to produce the desired anti-sense RNA. Such vectors can be constructed by standard recombinant DNA technology methods in the art. The vectors can be plasmids, viral, or other types known in the art, used for the replication and expression of mammalian cells. The expression of the sequence encoding the anti-sense RNA can be through any promoter known in the art to act on mammalian cells, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include, but are not limited to: the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290: 304-310), the promoter contained in the 3 'end repeat of the Rous sarcoma virus (Yamamoto, et al., 1980, Cell 22: 787-797; the herpes thymidine kinase promoter (Wagner, et al., 1981, Proc. Nati, Acad. Sci. USA 78: 1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296). : 39-42), etc. Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct that can be introduced directly into the tissue site. Alternatively, viral vectors that selectively infect the desired tissue may be employed, in which case administration may be achieved by another route (eg, systemically). Ribozyme molecules designed to catalytically dissociate transcripts from target gene mRNAs can also be employed to prevent translation of target gene mRNA and, consequently, expression of the target gene product. (See, for example, PCT International Publication WO90 / 11364, published October 4, 1990; Sarver, et al., 1990, Science 247, 1222-1225). Ribozymes are enzymatic RNA molecules capable of catalyzing the specific dissociation of RNA. (For a review, see, Rossi, 1994, Current Biology 4: 469-471). The mechanism of action of ribozyme includes the specific hybridization of sequences of the ribozyme molecule on complementary white RNA, followed by an event of endonucleotide dissociation. The composition of the ribozyme molecules must include one or more sequences complementary to the mRNA of the target gene, and must include the well-known catalytic sequence responsible for the dissociation of mRNA. For this sequence, see, for example, US Patent no. 5,093,246, which is incorporated herein by reference in its entirety. While ribozymes dissociating the mRNA can be employed in site-specific recognition sequences for the purpose of destroying white gene mRNA, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes dissociate mRNAs at locations indicated by the flanking regions that form base pairs complementary to the target mRNA. The only one is that the white mRNA has the following sequence of two bases: 5'-UG-3 '. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Myers, 1995, Molecular Biology and Biotechnology: A Comprehensive Desk Reference (Molecular Biology and Biotechnology: A Full Desktop Reference), VCH Publishers , New York, (see especially figure 4, page 833) and Hasseloff and Gerlach, 1988, Nature, 334: 585-591, which is incorporated herein by reference in its entirety. Preferably, the ribozyme is manipulated in such a way that the dissociation recognition site is located near the 5 'end of the target gene mRNA, ie, to increase the efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts. The ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes") such as occurs naturally in thermophilic Tetrahymena (known as IVS, or IVS L-19 RNA), and which has been extensively described. by Thomas Cech et al. (Zaug, et al., 1984, Science, 224: 574-578; Zaug and Cech, 1986, Science, 231: 470-475; Zaug, et al., 1986, Nature, 324: 429- 433, published international patent application No. WO88 / 04300 by University Patents Inc, Been and Cech, 1986, Cell, 47: 207-216). The Cech-type ribozymes have an active site of eight base pairs that hybridizes to a target RNA sequence after the dissociation of the target RNA. The invention encompasses the Cech-type ribozymes that focus on active site sequences of eight base pairs present in the target gene. As in the anti-sense approach, ribozymes can be composed of modified oligonucleotides (eg, for improved stability, focus, etc.) and must be administered to cells expressing the target gene in vivo. A preferred method for administration includes the use of a DNA construct that "encodes" the ribozyme under the control of a strong constitutive pol III or pol II promoter such that the transfected cells produce sufficient quantities of the ribozyme to destroy the messages of endogenous white gene and inhibit translation. Since the ribozymes, unlike anti-sense molecules, are catalytic, a lower intracellular concentration is required for efficiency. Endogenous white gene expression can be reduced by deactivating or "knocking out" the target gene or its promoter using focused homologous recombination (eg, see Smithies, et al., 1985, Nature 317: 230-234).; Thomas and Capecchi, 1987, Cell 51: 503-512; Thompson, et al., 1989, Cell 5: 313-321; each of which is incorporated herein by reference in its entirety). For example, a mutant non-functional white gene (or a totally unrelated DNA sequence) flanked by DNA homologue of the endogenous target gene (either the coding regions or the regulatory regions of the target gene) can be used, with or without selectable marker and / or negative selectable marker, to transfect cells expressing the target gene in vivo. The insertion of the DNA construct through focused homologous recombination results in the deactivation of the target gene. Such approaches are especially suitable in the agricultural field where modifications to ES cells (embryonic mothers) can be used to generate offspring of animals with an inactive target gene (for example, see Thomas and Capecchi, 1987 and Thompson, 1989, supra). However, this approach can be adapted for use in humans provided that the recombinant DNA constructs are administered or focused directly to the required site in vivo using appropriate viral vectors. Alternatively, expression of an endogenous target gene can be reduced by approaching deoxyribonucleotide sequences complementary to the regulatory region of the target gene (i.e., the target gene promoter and / or enhancers) in order to form triple helix structures that prevent transcription of the target gene in target cells in the body. (See, generally, Helene, 1991 Anticancer Drug Des., 6 (6): 569-584; Helene, et al., 1992, Ann., NY Acad. Sci., 660: 27-36; and Maher, 1992, Bioassays 14 (12): 807-815). The nucleic acid molecules to be used in triple helix formation for the inhibition of transcription must be single chain and composed of deoxynucleotides. The base composition of these oligonucleotides should be designed to promote triple helix formation through Hoogsteen base pairing rules, which generally require large segments of either purines or pyrimidines in a chain of a duplex. The nucleotide sequences may be based on pyrimidine, which will result in TAT and CGC + triplets in the three associated chains of the resulting triple helix. The pyrimidine-rich molecules provide a base complementary to a purine-rich region of a single strand of the duplex in an orientation parallel to said strand. In addition, nucleic acid molecules can be selected rich in purine, for example, which contain a segment of G residues. These molecules form a triple helix with the DNA duplex that is rich in GC pairs, where the majority of the residues of purine are located in a single chain of the focused duplex, resulting in triplets GGC in the three chains in the triples. Alternatively, potential sequences that can be targeted for triple helix formation can be increased by creating what is known as a "backscatter" nucleic acid molecule. The back-up molecules are synthesized in alternating form 5 '-3', 3 '-5', in such a way that they are coupled with a chain of one duplex first and then with the other, eliminating the need for a large segment either of purines or pyrimidines in a chain of a duplex. In cases in which the anti-sense, ribozyme, and / or triple helix molecules described herein are used to inhibit the expression of a mutant gene, it is possible that the technique can reduce or inhibit transcription so efficiently (triple helix ) and / or translation (anti-sense, ribozyme) of mRNA produced by normal white gene alleles that may arise the possibility that the concentration of normal white gene products present may be lower than necessary for a normal phenotype. In such cases, to ensure maintenance of substantially normal levels of target gene activity, nucleic acid molecules that encode and express white gene polypeptides that exhibit normal white gene activity can be introduced into cells through gene therapy methods such as those described below, in section 5.9.2 that do not contain sequences susceptible to any treatment of anti-sense, ribozyme or triple helix are employed. Alternatively, in cases in which the target gene encodes an extracellular protein, it may be preferable to co-administer a normal target gene protein in order to maintain the required level of target gene activity. Anti-sense, ribozyme and triple helix DNA and RNA molecules of the present invention can be prepared by any known method for the synthesis of DNA and RNA molecules according to what is discussed above. Techniques for the chemical synthesis of oligodeoxyribonucleotides and oligoribonucleotides well known in the art are included, for example, chemical synthesis of solid phase phosphoramidite. Alternatively, RNA molecules can be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, anti-sense cDNA constructs that synthesize anti-sense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into the cell lines. 5.9.2. GENE REPLACEMENT THERAPY Nucleic acid sequences of the HKNG1 gene, described above in section 5.1, can be used to transfer nucleic acid sequences of recombinant HKNG1 to cells and express said sequences in recipient cells. Such techniques can be used, for example, in cell labeling or para. the treatment of a neuropsychiatric disorder mediated by HKNG1. Such treatment can take the form of gene replacement therapy. Specifically, one or several copies of a normal HKNG1 gene or a portion of the HKNG1 gene that directs the production of HKNG1 gene products that has a normal HKNG1 gene function, can be inserted into the appropriate cells within a patient, using vectors that include , not limited to adenoviruses, adeno-associated viruses, and retrovirus vectors, in addition to other particles that introduce DNA into cells, such as for example liposomes. Since the HKNG1 gene is expressed in the brain, such gene replacement therapy techniques should be able to deliver HKNG1 gene sequences to these cell types within patients. Thus, in one embodiment, techniques well known to those skilled in the art (see, for example, PCT publication No. WO89 / 10134, published April 25, 1988) can be used to allow HKNG1 gene sequences to cross the Blood-brain barrier quickly and supply the sequences to cells in the brain. As for the administration and capable of crossing the blood-brain barrier, viral vectors are preferred, for example those described above. In another embodiment, delivery techniques include direct administration, for example, by stereotactic administration of said HKNG1 gene sequences to the site of the cells in which the HKNG1 gene sequences are to be expressed. Additional methods that can be used to increase the overall level of HKNG1 gene expression and / or activity of HKNG1 gene products include the use of focused homologous recombination methods, discussed in section 5.2, above, to modify the expression characteristics of an endogenous HKNG1 gene in a cell or microorganism by inserting a heterologous DNA regulatory element such that the inserted regulatory element is operatively linked to the endogenous HKNG1 gene in question. The focused homologous recombination can therefore be used to activate the transcription of an endogenous HKNG1 gene that is "transcriptionally silent" ie, not normally expressed or normally expressed at very low levels, or to increase the expression of a normally expressed endogenous HKNG1 gene. In addition, the overall level of HKNG1 gel expression and / or activity of HKNG1 gene products can be increased by the introduction of appropriate HKNG1 expressing cells, preferably autologous cells, into a patient in positions and numbers sufficient to ameliorate the symptoms of a neuropsychiatric disorder mediated by HKNGl. Such cells can be either recombinant or non-recombinant.

Among the cells that can be administered to increase the overall level of expression of the HKNG1 gene in a patient are normal cells, preferably brain cells, which express the HKNG1 gene. Alternatively, cells, preferably autologous cells, can be manipulated to express HKNG1 gene sequences, and can then be introduced into a patient at appropriate positions to ameliorate the symptoms of a neuropsychiatric disorder mediated by HKNG1. Alternatively, cells expressing an unaffected HKNG1 gene and coming from an individual corresponding to MHC may be employed, and may include, for example, brain cells. The expression of the HKNG1 gene sequences is controlled by the appropriate gene regulatory sequences to allow said expression in the necessary cell types. Said gene regulation sequences are well known to those skilled in the art. Such cell-based gene therapy techniques are well known to those skilled in the art, see, for example, Anderson, U.S. Patent No. 5,399,349. When the cells to be administered are not autologous cells, they can be administered using well known techniques that prevent a host immune response against the introduced cells. For example, the cells can be introduced in the encapsulated form which, while allowing the exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognized by the host immune system. In addition, compounds such as those identified through techniques described above in section 5.8, which can modulate the activity of HKNG1 gene product can be administered using standard techniques well known to those skilled in the art. In cases in which the compounds to be administered must involve an interaction with the brain cells, the administration techniques must include well-known techniques that allow the crossing of the blood-brain barrier. 5.10. PHARMACEUTICAL PREPARATIONS AND METHODS OF ADMINISTRATION Compounds determined as affecting HKNG1 gene expression or gene product activity can be administered to a patient in therapeutically effective doses to treat or ameliorate a HKNG1-mediated disorder or modulate a HKNG1-related process described herein. . A therapeutically effective dose refers to the amount of the compound sufficient to result in an improvement of the symptoms of said disorder. 5.10.1. EFFECTIVE DOSE The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine LD50 (the lethal dose for 50% of the population), and ED50 therapeutically effective dose in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the LD50 / ED50 ratio. Compounds that show high therapeutic indices are preferred. While compounds that have toxic side effects can be used, care must be taken to design a delivery system that focuses such compounds towards the site of the affected tissue in order to minimize potential damage to uninfected cells and, consequently, reduce the effects collateral The data obtained from cell culture assays and animal studies can be used to formulate a range of dosage for use in humans. The dosage of such compounds is preferably within a range of circulating concentrations that includes the ED50 with little or no toxicity. The dosage can vary within this range depending on the dosage form used and the rainfall used. For any compound employed in the method of the present invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a range of circulating plasma concentrations that includes the IC50 (ie, the concentration of the test compound that achieves maximum mean inhibition of symptoms) in accordance with that determined in cell culture. This information can be used to determine more precisely the useful doses in humans. Plasma levels can be measured, for example, by high performance liquid chromatography. As defined herein, a therapeutically effective amount of antibody, protein, or polypeptide (ie, an effective dosage) is within a range of about 0.001 to 30 mg / kg body weight, preferably about 0.01 to 25 mg / kg. kg of body weight, more preferably from about 0.01 to 20 mg / kg of body weight, and preferably even greater than about 1 to 10 mg / kg, 2 to 9 mg / kg, 3 to 8 mg / kg, 4 a 7 mg / kg, or 5 to 6 mg / kg of body weight. The person skilled in the art will observe that several factors may influence the dosage required to effectively treat a patient, including without limiting them, the severity of the disease or disorder, previous treatments, the general health status and / or age of the patient, and other diseases present. In addition, the treatment of a subject with a therapeutically effective amount of a protein, polypeptide, or antibody may include a single treatment or, preferably, may include a series of treatments. In a preferred example, a subject is treated with antibody, protein, or polypeptide in the range of about 0.1 to 20 mg / kg body weight, once a week for about 1 to 10 weeks, preferably between 2 and 8 weeks, preferably about 3 and 7 weeks, and preferably even more during approximately 4.5, or 6 weeks. It will be appreciated that the effective dosage of antibody, protein, or polypeptide that is employed for the treatment may increase or decrease in the use of the particular treatment. Dosage changes can result and become apparent from the results of diagnostic tests in accordance with what is described here. 5.10.2. FORMULATIONS AND USE Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner employing one or more physiologically acceptable carriers or physiologically acceptable excipients. Thus, the compounds and their physiologically acceptable salts and solvates can be formulated for administration by inhalation or insufflation (either through the mouth or nose) or for oral, buccal, parenteral, rectal or topical administration. In the case of oral administration, the pharmaceutical compositions may take the form, for example, of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agent (for example, pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropylmethylcellulose).; fillers (for example, lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (for example, magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agent (for example, lauryl sulphate sodium). The tablets can be coated by methods well known in the art. Liquid preparations for oral administration can take the form, for example, of solutions, syrups or suspensions, or they can be presented as a dry product for constitution with water or another suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (for example, sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (for example, lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oil esters, ethyl alcohol or fractionated vegetable oils), and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavors, colorants, and sweetening agents as appropriate. Preparations for oral administration can be suitably formulated to provide a controlled release of the active compound. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by inhalation, the compounds for use in accordance with the present invention are conveniently supplied in the form of an aerosol-type spray presentation from presentation under spray pressure, with the use of a suitable driving agent, for example , dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of an aerosol under pressure, the dosing unit can be determined by supplying a valve to provide a measured quantity. Capsules and cartridges for example of gelatin for use in an inhaler or insufflator can be formulated in such a way as to contain a mixture of powder of the compound and a suitable powder base such as for example lactose or starch. The compounds can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the active ingredient may be in the form of powder for constitution with a suitable vehicle, eg, sterile, pyrogen-free water, before use. The compounds can also be formulated in rectal compositions such as suppositories or retention enemas, for example, containing conventional suppository bases such as cocoa butter or other glycerides. In certain embodiments, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area requiring treatment. This can be achieved, for example, without limitation, local infusion during surgical intervention, topical application, for example, in combination with the bandage of a wound after surgical intervention, by injection, by means of a catheter, by means of a suppository, by means of an implant, said implant is made of a porous, non-porous or gelatinous material, including membranes such as sialastic membranes, or fibers. In one embodiment, administration can be by direct injection into the site (or anterior site) of a malignant tumor or neoplastic or pre-neoplastic tissue. For topical application, the compounds can be combined * with a vehicle in such a way that an effective dosage is administered based on the desired activity. A topical formulation for the treatment of some of the ocular disorders mentioned above (eg, myopia) Consists of an effective amount of the compounds in an ophthalmologically acceptable carrier, eg, buffered saline, mineral oil, vegetable oils such as corn oil. or peanut oil, petrolatum, Miglyol 182, alcoholic solutions, or liposomes or liposome-like products. Any of these compositions may also include preservatives, antioxidants, antibiotics, immunosuppressants, and other biologically or pharmaceutically effective agents that do not exert a negative effect on the compound. In addition to the formulations described previously, the compounds can also be formulated as a depot type preparation. Said long-acting formulations can be administered by implant (for example subcutaneous or intramuscular implant) or by intramuscular injection. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as poorly soluble derivatives, for example, as a poorly soluble salt . The compositions may have a presentation, if desired, in a dispensing device or package containing one or more unit dosage forms containing the active ingredient. The package may comprise, for example, sheet metal or plastic, such as a blister pack. The dispensing device or packaging may be accompanied by instructions for its administration. 6. EXAMPLE: THE HKNG1 GENE OF CROMOSOMA 18 IS ASSOCIATED WITH THE NAEUROPSIQUIÁTRIC BAD DISORDER In the example presented in this section, studies are described that define a narrow interval of approximately 27 kb in the short arm of human chromosome 18 that is associated with the BAD neuropsychiatric disorder. The interval is shown to be within the gene known here as the HKNG1 gene. 6.1. MATERIALS AND METHODS 6.1.1. LIABILIZATION OF BONDING They were performed using DNA from a population sample of patients with neuropsychiatric disorder (BP-I). The population sample and LD techniques were in accordance with that described in Escamilla et al., 1996, Am J. Med. Genet. 67: 244-253. The current LD study takes advantage of the collection of additional population sample and the additional physical markers identified through the physical mapping techniques described below. 6.1.2. ARTIFICIAL YEAST CHROMOSOME MAPPING (YAC) For physical mapping, yeast artificial chromosomes (YACs) containing human sequences were mapped in the region under analysis based on publicly available maps (Cohen et al., 1993, C.R. Acad. Sci. 316: 1484-1488). The YACs were ordered and contig reconstructed by performing mapping with short marker, standard (STS) sequence content with microsatellite markers and non-polymorphic STSs available from databases surrounding the genetically defined candidate region. 6.1.3. ARTIFICIAL BACTERIAL CHROMOSOME MAPPING (BAC) STSs from the short arm of human chromosome 18 were used to screen a human BAC library (Research Genetics, Huntsville, AL). The end of the BACs were cloned or sequenced directly. The end sequences were used to amplify the following BACs that are spliced. From each BAC, additional microsatellites were identified. Specifically, randomly cut libraries were prepared from splicing BACs within the defined genetic range. The BAC DNA was cut with a nebulizer (CIS-US Inc., Bedford, MA). Fragments within a size range of 600 to 1000 base pairs were used for the production of sub-libraries. Microsatellite sequences of the sub-libraries were identified by corresponding microsatellite probes. The sequences around said repeats were obtained in order to allow the development of polymerase chain reaction primers for genomic DNA. 6.1.4. RADIATION HYBRID MAPPING (RH) Standard HR mapping techniques were applied to a Stanford RH G3 mapping panel (Researh Genetics, Huntsville, Al) in order to order all of the microsatellite markers and non-polymorphic STSs in the region under analysis. 6.1.5. SEQUENCING OF SAMPLES Randomly cut libraries were prepared from all BACs within the defined genetic region. Approximately 9,000 subclones were sequenced within the region of approximately 940 kb containing the BAD interval were sequenced with vector primers in order to achieve an 8-fold sequence overture of the region. All sequences were processed through an automatic sequence analysis duct that evaluated quality, removed vector sequence and masked repetitive sequences. The resulting sequences were then compared with public DNA and protein databases using BLAST algorithms (Altschul, et al., 1990, J. Molec. Biol., 215: 403-410). All sequences were combined using Sequencher 3.0 (Gene Code Corp.) and PHRED and PHRAP (Phill Green, Washington University) in a single 340 kb DNA fragment. 6.2. RESULTS Genetic regions involved in human genes of bipolar affective disorder (BAD) have been previously reported as being mapped in the portions of the long (18q) and short (18p) arms of the human chromosome 18. { Freimer et al., 1996, Neuropsychiat. Genet 67: 254-263; Freimer et al., 1996, Nature Genetics 12: 436-441; and Mclnnis et al., Proc. Nati Acad. Scie. USES. 93: 13060-13065). High-resolution physical mapping using YAC, BAC and RH techniques In order to provide the precise order of genetic markers necessary for LD mapping and linkage and to guide the development of new microsatellite markers for finer mapping, a map was developed High resolution physicist of the candidate region of the short arm of human chromosome 18 using YAC, BAC and RH techniques. For this physical mapping, YACs were first mapped on the region of chromosome 18 in the process of analysis. Using the YAC contig mapped as a structure, the region from the publicly available markers covering the 18p region was also mapped and combined with BACs. Sub-libraries of said combined BACs were built, from which sequences of microsatellite markers were identified and sequenced. To ensure the development of an accurate physical map, the technique of hybrid radiation mapping (RH) was applied independently to the region under analysis. RH was used to sort all microsatellite markers and non-polymorphic STSs in the region. Thus, the high-resolution physical map finally constructed was obtained using data from the HR mapping and STS content mapping. Linkage disequilibrium Before attempting to identify gene sequences, a study was conducted to further narrow the region of the neuropsychiatric disorder. Specifically, a link imbalance (LD) analysis was performed using samples and techniques in accordance with what is described in section 6.1, above, which take advantage of the additional physical markers identified through the physical mapping techniques described below. Initial analysis of LD narrowed the interval that is related to ADB disorders to a 340 kb region of 18p. BAC clones within this region of newly identified neuropsychiatric disorder were analyzed to identify specific genes within the region. A combination of sample sequencing, transcription mapping analysis and cDNA selection were employed to arrange sequences in tentative transcription units, i.e., tentatively delineating gene coding sequences within this genomic region of interest. Subsequent LD analyzes further narrowed the BAD region to 18p at a narrow interval of approximately 27 kb. This was achieved by identifying the maximum shared haplotype between affected individuals using additional markers. A statistical analysis of the entire 18p candidate region indicated that the 27 kb haplotype was significantly elevated in frequency among affected Costa Rican individuals (LOD = 2.2; p = 0.0005). It was found that this newly identified narrow range was completely mapped within one of the transcription units identified in accordance with that described above. The gene corresponding to this transcription unit is known here as the HKNG1 gene. Thus, the results of the mapping analyzes presented in this section demonstrate that the HKNG1 gene of human chromosome 18 is associated with the BAD neuropsychiatric disorder. The analysis of the ADB interval indicated that the chromosomal interval associated with the BAD disease of 27 kb identified in the linkage disequilibrium studies is within a genomic region of approximately 60 kb that contains a sequence known as GS 642 or a gene of rod photoreceptor protein (RPP) (Shimizu-Matsumoto, A. et al., 1997, Invest. Ophthamol, Vis. Sci. 38: 2576-2585). 7. EXAMPLE: SEQUENCE AND CHARACTERIZATION OF THE HKNG1 GENE As demonstrated in the example presented in section 6 above, the HKNG1 gene is involved in the BAD neuropsychiatric disorder. The results presented in this section further characterize the HKNG1 gene and gene product. Particularly, isolation of additional cDNA clones and analysis of cDNA and genomic sequences revealed both the amino acid sequence of full length HKNG1 and the genomic introns / exons structure of HKNG1. Particularly, the predicted amino acid sequence and nucleotides of the HKNG1 gene identified by these assays disclose novel exon sequences of HKNG1, including a novel HKNG1 protein coding sequence, discovered here. In addition, the expression of HKNG1 in human tissue, especially neural tissue, is characterized by Northern as well as in situ hybridization analysis. The results presented here are consistent with the HKNG1 gene being a gene that mediates neuropsychiatric disorders such as BAD. 7.1. MATERIALS AND METHODS Isolation of HKNG1 cDNA clone: Hybridization of a human brain and kidney cDNA library was carried out in accordance with standard techniques and a full-length cDNA clone of HKNG1 was identified. In addition, a cDNA of HKNG1 was isolated from a splice variant, in accordance with that described in section 7.2, below. Northern Blot Analysis: Northern Blot analysis procedures and standard RNA isolation techniques were followed. The HKNG1 probe employed corresponds to the complementary sequence of base pairs 1367 to 1578 ie the full-length HKNG1 cDNA sequence (SEQ ID NO: 1). Northern blots of Clontech multiple tissues were tested. Particularly, absorptions of human tissue I, human II, human III, fetal-human II, cerebral-human II and cerebral-human III of Clontech were used for this study. ANALYSIS OF IN SITU HYBRIDIZATION Standard in situ hybridization techniques were used. The HKNG1 probe employed corresponds to the complementary sequence of base pairs 910 to 1422 of the full length HKNG1 cDNA sequence (SEQ ID N0: 1). Brains for in situ hybridization analysis were obtained from McLean Hospital (The Harvard Brain Tissue Resource Center, Belmont, MA 02178). Other techniques: the remaining techniques described in section 7.2, below, were performed in accordance with standard techniques or in accordance with what was discussed in section 6.6 above 7.2. RESULTS 7.2.1. SEQUENCE OF NUCLEOTIDES AND AMINO ACIDS OF HKNG1 A human brain cDNA library was screened and a full-length clone of HKNG1 was isolated from this library, as described above. Comparing the isolated cDNA sequence with sequences in the public databases, a clone that had previously been identified as GS4642, or rod photoreceptor protein (RPP) gene was identified (GenBank accession number: D63813; Shimizu-Matsumoto , A. et al., 1997, Invest. Ophthamol, Vis. Sci. 38: 2576-2685). Even when Shimizu-Matsumoto et al. They refer to GS4642 as a full-length cDNA sequence, the isolated HKNG1 cDNA extends approximately 200 base pairs beyond the 5 'end of the identified GS4642 clone. It is important to note that the clone of HKNG1 isolated here reveals that, unlike the amino acid sequence described in Shimizu-Matsumoto et al., The amino acid sequence of full-length HKNG1 contains 29 additional amino acid residues at the N-terminus in comparison with what had previously been identified as the full-length RPP (SEQ ID NO: 64). The nucleotide sequence of full-length HKNG1. { SEQ ID NO: l) and the amino acid sequence derived from the full-length HKNG1 polypeptide (SEQ ID NO: 2) encoded by this sequence are illustrated in Figures 1A-1B. The full-length HKNG1 polypeptide was found to contain two clusterin similarity domains: clusterin cluster 1 domain corresponding to amino acid residues 134 to 160, and the clusterin 2 similarity domain which corresponds to the cluster residues. amino acids 334 to 362. Such clusterin domains are typically characterized by five shared cysteine residues. In domain 1 of clusterin, these shared cysteine residues correspond to Cysl34, Cysl45, Cysl48, Cysl58, and Cys 160. The shared cysteine residues in the clusterin 2 domain correspond to residues Cys334, Cys344, Cys351, Cys354, and Cys362. The full-length HKNG1 cDNA sequence was compared to the completed genomic contig by sequencing of randomly cut library. The exon-intron limits were identified manually by aligning the two sequences of Sequencher 3.0 and observing the conservative splice sites where the alignments end. This sequence comparison revealed that the additional cDNA sequence discovered through the isolation of the full length HKNG1 cDNA clone belongs in fact within 3 exons of HKNG1. Before isolation and analysis of the HKNG1 cDNA described here, 9 exons were predicted within the corresponding genomic sequence. As it was discovered here, however, the HKNG1 gene, in contrast, actually contains 13 exons, with the new sequence containing cDNA corresponding to a new exon 1, exdn 2 and a 5 'extension of what had previously been designated exon 1. Splice variants, discussed in section 9 below, also exist, which comprise additional 2 'and 2"exons The genomic sequence of the intron / exon structure of the HKNG1 gene appears in Figures 3A-3R. The decomposition of exons was confirmed by the perfect alignment of the cDNA sequence with the genomic sequence and by the observation of the expected splice sites that flank each of the newly discovered additional exons.The nucleotide sequence of HKNG1 was used to search databases of partial sequences of cDNA clones This search identified a partial cDNA sequence derived from IMAGE clone R61493 having similarity to the HKNG1 hu sequence The clone IMAGE R61493 was obtained and consists of a cDNA insert, the Lafmid BA vector structure, and DNA that originates from an oligo dT primer, and Hind III adapters used in the construction of the cDNA library. The Lafmid BA vector nucleotide sequence is available at the URL http://image.rzpd.de/lafmida seq.html and descriptions of the oligo dT initiator and Hind III adapters are available in the GENBANK record corresponding to the number of access R61493. The sequence of the cDNA insert revealed that the insert was derived from an alternatively spliced HKNG1 mRNA variant, known herein as HKNG1-V1. Particularly, this variant of HKNG1 is removed from exon 3 of the HKNG1 sequence of 3 full-length exons. The nucleotide sequence of this variant of HKNG1 (SEQ ID NO: 3) is shown in Figures 2A-B. The amino acid sequence encoded by the HKNG1 variant (SEQ ID NO: 3) is also shown in Figures 2A-B. Therefore, preferably, the nucleic acids of the present invention include nucleic acid molecules that comprise the nucleotide sequence of HKNG1-V1 or that encode the polypeptide encoded by HKNG1-V1 in the absence of heterologous sequences (e.g. cloning, such as Lafmid BA; oligo dT initiator, and Hind III adapter). 7.2.2. EXPRESSION OF HKNG1 GEN The HKNG1 gene expression was examined by Northern blot analysis in several human tissues. A transcript of approximately 2 kb was detected in a fetal brain, lung and kidney tissue, and in tissues of adult brain, kidney, pancreas, prostate, testes, ovary, stomach, thyroid, spinal cord, lymph node and trachea. A transcript of approximately 1.5 kb was also observed in the trachea. In addition, a larger transcript of approximately 5 kb was detected in all adult neural regions tested (ie, cerebellum, cortex, medulla, spinal cord, occipital pole, frontal lobe, temporal, putamen, amygdala, caudate nucleus, corpus callosum, hippocampus, whole brain, substantia nigra, subthalamic nucleus and thalamus). Again, this contrasts directly with a previous Northern analysis of the RPP gene, which reported that the expression was limited to the retina (Shimizu-Matsumoto, A. et al., 1997, Invest. Ophthalmal, Vis. Sci. 38: 2576- 2585). The analysis of the tissue distribution of HKNG1 was extended through an in situ hybridization analysis. Particularly, the distribution of HKNG1 mRNA in normal human brain tissue was analyzed. The results of this analysis appear in Figure 4. As summarized in Figure 4, HKNG1 is expressed throughout the brain, with transcripts located in cell types of gray matter and neurons. Finally, the expression of HKNG1 in recombinant cells demonstrates that the HKNG1 gene encodes a secreted polypeptide (s). 8. A MUTE OF WRONG SENSE WITHIN HKNG1 IS C0RRELATION WITH BAD The example presented in section 6, above, shows that the BAD disorder is mapped into a fully contained range within the HKNG1 gene of the short arm of the human chromosome 18 The gene represented in section 7, above, characterizes the HKNG1 gene and gene products. The results presented in this example concurrently support these studies by identifying a mutation within the coding region of an HKNG1 allele of an individual exhibiting a BAD disorder. Thus, the results described herein demonstrate a positive co-relationship between a mutation encoding a non-wild type HKNG1 polypeptide and the appearance of the neuropsychiatric disorder known as BAD. The results presented here, together with the results presented in section 6, above, identify HKNG1 as a gene that mediates neuropsychiatric disorders such as BAD. 8.1. MATERIALS AND METHODS Pairs of polymerase chain reaction primers flanking each exon (see table 1, above) were elaborated and used to amplify polymerase chain reaction genomic DNA isolated from normal individuals affected by BAD. The products amplified by polymerase chain reaction were analyzed using SSCP gel electrophoresis or by DNA sequencing. The DNA sequences and SSCP patterns of those affected and of the controls were compared and the variations were further analyzed. 8.2. RESULTS In order to more definitively show that the HKNG1 gene mediates neuropsychiatric disorders, particularly BAD, a study was conducted to explore whether a mutation of HKNG1 that correlates with BAD could be identified. First, an exon scan was performed on all the lln exons of the HKNG1 gene using chromosomes isolated from three affected individuals and a normal individual from a Costa Rican population used for the LD studies discussed in section 6, above. No obvious mutations were found that correlate with BAD in this analysis. Then, regions of introns of HKNG1 and 3 'untranslated within the ADB range of 27 kb were screened by SSCP and / or sequencing of all variants between 3 affected individuals and a normal individual from the same population. Approximately 60 variants were identified after the exploration of approximately two thirds of the 27 kb genomic interval, which can be genotyped and analyzed by sharing haplotypes and by LD analysis, in accordance with what has been described above, in order to identify the variants that are co-related to a bipolar affective disorder. Figure 5 shows a list of selected variants identified in this study. Examination of exons using chromosomal DNA from the general population of Costa Rica, however, successfully identified a missense mutation of HKNG1 in an individual affected by BAD who did not share the common diseased haplotype identified by the LD analysis provided above. . In particular, an exon scan was performed on exons 11-11 of the HKNG1 nucleic acid of 129 individuals from the general population affected by BAD. This analysis identified a mutation of points in the coding region of exon 7 that was not observed in individuals affected by a non-bipolar disorder. Specifically, the guanine corresponding to the nucleotide residue 604 of SEQ ID NO: 1 (or residue and nucleotides 550 of SEQ ID NO: 3) has been mutated into an adenine. The HKNG1 protein expressed from this mutated HKNG1 allele comprises replacing a lysine residue at amino acid residue 202 of SEQ ID NO: 2 (or amino acid residue 184 of SEQ ID NO: 4) instead of the wild-type glutamic acid residue. In addition, polymorphisms of HKNG1 relative to the wild-type sequence of HKNG1, and consequently represent alleles of HKNG1, were identified through the sequence analysis of the HKNG1 alleles within a collection of schizophrenic patients of mixed ethnicity from the United States. United of America and within a collection of BAD from the San Francisco area. These variants are represented in Figures 5A and 5B, respectively. A statistical analysis indicated that there were significantly more variants in the correction of mixed ethnic schizophrenic patients in the United States of America and in the San Francisco BAD collection and Costa Rican ADB samples than in a collection of 242 controls (p <; 0.05). 9. EXAMPLE: IDENTIFICATION OF ADDITIONAL HKNG1 JOINT VARIANTS This example describes the isolation and identification of three novel splice variants of the human HKNG1 gene. First, a novel HKNG1 clone was isolated from a human retinal cDNA library. This clone, which completely lacked exon 7 of the full length HKNG1 cDNA sequence, is referred to herein as HKNG1D7. Since the removal of exon 7 from the full-length sequence of HKNG1 causes an immediate change of frames, clone HKNG1D7 encodes a truncated form of the HKNG1 protein. The cDNA sequence of HKNG1D7 (SEQ ID NO: 65) is shown in Figure 18 together with the predicted amino acid sequence (SEQ ID NO: 66) of the HKNG1G7 gene product that it encodes. Two other novel splice variants, known herein as HKNG1-V2 and HKNG1-V3, were isolated and identified by the use of RT-PCR analysis to isolate additional sequences of HKNG1. The following primer sequences were used: 5'-AGTTGCGTCCCTCTCTGTTG-3 '. { SEQ ID NO: 67) 5'-GCTTCATGTTCCCGCTGTTA-3 '(SEQ ID NO: 68) These splice variants included additional exons between exons 2 and 3 of the full length HKNG1 sequence (SEQ ID N0: 1). The RT-PCR product derived from HKNG1-V2 includes a novel exon known as "exon 2 '", while the RT-PCR product derived from HKNG1-B3 includes a novel exon known as "exon 2" "7 The sequence of these novel exons are shown in Table 2. The nucleotide sequence of the HKNG1-V2 RT-PCR product containing the novel 2 'exon is shown in Figure 6A (SEQ ID NO: 36), while the RT-PCR product of HKNG1-V3 containing the novel exon 2"is shown in Figure 6B (SEQ ID NO: 37). Both exon 2 'and exon 2"are part of the 5' untranslated region of the HKNG1 cDNA Table 2 Exon 2 '5'-TTCCCTCCCTTTGGAACGCAGCGTGGGCACC (SEQ ID NO: 34) TGCAACGCAGAGACCACTGTATCCCCGGTGCAGA ATGTAATGAGTGCCTGATACATTTGCCGAATAAA CTATTCCAAGGGTTGAACTTGCTGGAAGCAAGAG AAGCACTATTCTGG-3 'Exon 2"5'-ATGGAGTCTTGCTCTCGTTGCCCAGACTGGA (SEQ ID NO: 35) GTGCACTGCTGCGATCTCAGCTCACTGCCACCTC TACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAG CCTCTCGAGTGGCTGGGACTATAG-3 '10. EXAMPLE: HKNG1 ORTHOLOGOUS IDENTIFICATION This example describes the isolation and characterization of genes in other mammalian species that are orthologous with human HKNG1. Specifically, HKNG1 sequences of guinea pig and bovine are described. 10.1. HKNG1 ORTOLOGISTS OF INDIAN CONEJILLO An odontologist of HKNG1 of guinea pig, known as gphkngl815, was isolated using RT-PCR. The sequence of .ADNc (SEQ ID NO: 38) and predicted amino acid sequence (SEQ ID NO: 39) are presented in Figure 7. Both the predicted amino acid sequence and the nucleotide sequence of gphkngl815 are similar to the sequences of amino acid and nucleotides of human HKNG1. Specifically, the ALIGNv2.0 program identified a nucleotide sequence identity of 71.5% and an amino acid sequence identity of 62.8% using standard parameters (Rating matrix: PAM120; GAP penalties: -12 / -4. to the human HKNG1 polypeptide, the predicted gphkngl815 polypeptide also contains two clusterin similarity domains corresponding to amino acid residues 105 to 131 (clusterin domain 1) and amino acid residues 305-333 (clusterin domain 2), respectively. Both domains contain the 5 conserved cysteine residues typically associated with clusterin domains.Specifically, these conserved cysteines correspond to Cysl05, Cyslld, Cysll9, Cysl24, and Cysl31 (Clusterine domain 1 similarity) and Cys305, Cys315, Cys322, Cys325, and Cys333 (similarity with clusterin dominiol) of the polypeptide sequence of gphkngl815. Three allelic variants of gphkngl815, c Onocids such as gphkng 7b, gphkng 7c, and gphkng 7d, respectively, were also identified by RT-PCR. Their nucleotide sequences [SEQ ID NO: 40 (gphkng 7b), SEQ ID NO: 42. { gphkng 7c), and SEQ ID NO: 44 (gphkng 7d)] and amino acid sequences [SEQ ID NO: 41 (gphkng 7b), SEQ ID NO: 43 (gphkng 7c), and SEQ ID NO: 45 (gphkng 7d) ] appear in figures 8 to 10, respectively. Each of these three allelic variants contains a deletion within a region homologue in exon 7 of human HKNGl. The allelic variants retain the open reading frame of the gene, however, each allelic variant contains a deletion, in relation to gphkngl815 of 16, 92 and 93 amino acid residues, respectively. An alignment of the predicted amino acid sequences of gphkngl815, gphkng 7b, gphkng 7c, and gphkng 7d are shown in Figure 14. An alignment of the predicted amino acid sequences of the human HKNG1 gene product, the guinea pig HKNG1 ortholog gphkngl815 , and the ortholog of bovine HKNG1 described in subsection 10.2 below appear in figure 16. 10.2. HKNG1 OTHOLOGISTS OF CATTLE Ovine bovine HKNG1 orthologs were also cloned by screening a cDNA library made from the combined bovine retinal tissue using a nucleotide sequence that corresponded to the complementary sequence of base pairs 910-1422 of the sequence of full-length human HKNG1 cDNA (SEQ ID NO: 1) as a probe. Three species of cDNA from independent cattle, known as bhkngl, bhkng2, and bhkng3 (SEQ ID NOS: 46 to 48, respectively) were isolated. Each of these allelic variants contains several individual nucleotide polymorphisms (SNPs). None of the SNPs results in an altered predicted amino acid sequence. Accordingly, all three bovine cDNAs encode the same predicted amino acid sequence (SEQ ID NO: 9). These SNPs apparently reflect the natural allelic variation of the combined cDNA library from which the sequences were isolated. Each of the three allelic variants of bovine HKNG1 is illustrated in figures 11 to 13, respectively, together with the predicted amino acid sequence they encode. The predicted bovine HKNG1 polypeptide also contains two clusterin similarity domains, corresponding to residues 105-131 of amino acids and residues 304-332 of amino acids respectively, of SEQ ID NO: 49. Domain 1 of clusterin contains all five Shared cysteine amino acid residues typically associated with these types of domains: Cysl05, Cysll6, Cysll9, Cysl24, and Cysl31. The clusterine domain two of the bovine HKNG1 polypeptide contains four conserved cysteine residues: Cys314, Cys321, Cys324, and Cys332. 11. PRODUCT EXPRESSION OF HKNG1 GENE HUMAN This example describes the construction of expression vectors and the successful expression of recombinant human HKNG1 sequences. Expression vectors are described for both native HKNG1 and several fusion proteins of HKNG1. 11.1 EXPRESSION OF HUMAN HKNG1: MARKER A protein vector labeled with human HKNG1 marker epitope (HKNG1: marker) was constructed by polymerase chain reaction followed by ligation into a vector for the expression of HEK 293T cells. The complete open reading frame of the full length HKNG1 cDNA sequence (SEQ ID NO: 5) was amplified by polymerase chain reaction using the following primer sequences: Primer 5 '5'-TTTTTCTGAATTCGCCACCATGAAAATTA AAGCAGAGAAAAACG-3' (SEQ ID NO: 54) Initiator 3 '5'-TTTTTGTCGACTTATCACTTGTCGTCGTC GTCCTTGTAGTCCCAGGTTTTAAAATGTTCCT TAAAATGC-3' (SEQ ID NO: 53) The 5 'primer incorporating the upstream Kozak sequences and including the upstream initiator methionine and the 3' primer including the nucleotide sequence encoding the marker epitope DYKDDDDK (SEQ ID NO: 50) followed by a codon of termination. The DNA-sequenced construct was transiently transfected in HEK 293T cells in 150 mm dishes using Lipofecta ine (GIBCO / BRL) in accordance with the manufacturer's protocol. Seventy-two hours after transfection, the serum-free conditioned medium (OptiMEM, GIBCO / BRL) was harvested and rotated and the remaining cell monolayer was used using 2 mL of lysis buffer [50 mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 0.05% SDS with a "Complete" protease cocktail (Boehringer Mannheim) diluted in accordance with the manufacturer's instructions]. The insoluble material was formed into pellets before the preparation of the SDS-PAGE samples. A conditioned medium was electroabsorbed on a PVDF membrane (Novex) after separation by SDS-PAGE on 4-20% gradient gels and probed with a polyclonal anti-M2 marker antibody (1: 500, Sigma) followed by anti sheep-mouse (1: 5000, Amersham) conjugated with horseradish peroxidase (HRP), developed using chemiluminescent reagents (Renaissance, Dupont), and exposed to an autoradiography film (Biomax MR2 film, Kodak). The marker immunoreactivity appeared as a doublet of bands that migrated by SDS-PAGE between 60 and 95 kDa in accordance with that determined by molecular weight markers Multimark (Novex) demonstrating HKNG1 protein secretion: marker. The double band indicates at least two different species with different mobilities in SDS-PAGE. Such doublets arise more frequently with post-translational modifications for the protein, such as glycosylation and / or proteolysis. Treatment of PNGase F (Oxford Glycosciences) in accordance with the manufacturer's instructions resulted in a single band of increased mobility, indicating that the two bands contain N-linked carbohydrates. When experimented in the absence of a reducing agent, mobility The relative immunoreactive bands were greater than 100 kDa relative to the same markers, indicating that the HKNG1: marker fusion proteins may be a disulfide-linked dimer or higher oligomers. 11.2 EXPRESSION OF HKNG1-V1 HUMAN: MARKER A protein vector labeled with human HKNG1-V1 marker epitope (HKNG1-V1: marker) was also constructed by polymerase chain reaction followed by ligation in an expression vector, pMET stop . The full length open reading frame of the cDNA sequence of HKNG1-V1 (SEQ ID NO: 6) was amplified by polymerase chain reaction using the following primer sequences: Initiator 5 '5 * -TTTTTCTGAATTCACCATGAGGACCTGGG ACTACAGTAAC-3' (SEQ ID NO: 54) Initiator 3 '5' -TTTTTGTCGACTTATCACTTGTCGTCGTC GTCCTTGTAGTCCCAGGTTTTAAAATGTTCCT TAAAATGC-3 »(SEQ ID NO: 53) Initiator 51 incorporated the upstream Kozak sequences and includes upstream initiator methionine. The 3 'primer included the nucleotide sequence encoding the marker epitope DYKDDDDK (SEQ ID NO: 50) followed by a stop codon. The sequenced DNA construct was transiently transfected in HEK 293T cells in 150 mm plates using Lipofectamine (GIBCO / BRL) in accordance with the manufacturer's protocol. Seventy-two hours after transfection, the serum-free conditioned medium (OptiMEM, GIBCO / BRL) was harvested and rotated and the remaining monolayer of cells was lysed using 2 mL of lysis buffer [50 mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 0.05% SDS with a "Complete" protease cocktail (Boehringer Mannheim) diluted in accordance with the manufacturer's instructions]. The insoluble material was formed into pellets before the preparation of the SDS-PAGE samples. A conditioned medium was electroabsorbed in a PVDF membrane (Novex) after separation by SDS-PAGE in 4-20% gradient gels and probed with a polyclonal anti-M2 marker antibody (1: 500, Sigma) followed by anti sheep-mouse (1: 5000, Amersham) conjugated with horseradish peroxidase (HRP), developed using chemiluminescent reagents (Renaissance, Dupont), and exposed to an autoradiography film (Biomax MR2 film, Kodak). The marker immunoreactivity appeared as a doublet of bands that migrated by SDS-PAGE between 60 and 95 kDa in accordance with that determined by molecular weight markers Multimark (Novex) demonstrating HKNG1 protein secretion: marker. When tested in the absence of a reducing agent, the relative mobility of the immunoreactive bands was greater than 100 kDa relative to the same markers, indicating that the HKNG1: marker fusion proteins may be a disulfide linked dimer or oligomers superiors 11.3.EXPRESSION OF HUMAN HKNG1: FC A fusion protein vector of human HKNG1 / hIgGIFc was constructed by polymerase chain reaction. The full length open reading frame of the full length HKNG1 cDNA (SEQ ID NO: 5) was amplified by polymerase chain reaction using the following primer sequences: 5 '5' primer -TTTTTCTCTCGAGACCATGAAAATTAAAG CAGAGAAAAACG-3 '(SEQ IS NO: 55) Initiator 3 »5 '-TTTTTGGATCCGCTGCTGCCCAGGTTTTA AAATGTTCCTTAAAATGC-3' (SEQ IS NO: 56) The 5 'primer incorporated a Kozak sequence before the methionine upstream to the amino acid residue before the retention codon. The 3 'polymerase chain reaction primer contained a 3-alanine linker at the junction of HKNG1 and the Fc domain of human IgGl, starting at the DPE residues. The genomic sequence of the Fc domain of human IgGl was ligated together with the polymerase chain reaction product into a pCDMd vector (Invitrogen, Carlsbad CA) for transient expression. The sequenced DNA construct was transiently transfected in HEK 293T cells in 150 mm plates using Lipofectamine (GIBCO / BRL) in accordance with the manufacturer's protocol. Seventy-two hours after the transfection, the serum-free conditioned medium was harvested (OptiMEM, GIBCO / BRL) and it was rotated and the remaining monolayer of cells was used using 2 mL of lysis buffer [50 • mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 0.05% SDS with a "Complete" protease cocktail (Boehringer Mannheim) diluted according to the manufacturer's instructions]. The insoluble material was formed into pellets before the preparation of the SDS-PAGE samples. A conditioned medium was electroabsorbed on a PVDF membrane (Novex) after separation by SDS-PAGE on 4-20% gradient gels and probed with an anti-Fc M2 polyclonal antibody (1: 500, Jackson ImmunoResearch Laboratories, Inc.) followed by sheep anti-mouse antibody (1: 5000, Amersham) conjugated with horseradish peroxidase (HRP), developed using chemiluminescent reagents (Renaissance, Dupont), and exposed to an autoradiography film (Biomax MR2 film, Kodak) . The immunoreactivity of Fc from human IgGl appeared as a doublet of bands that migrated by SDS-PAGE between the 148 and 60 kDa standards of the molecular weight markers Multimark (Novex) demonstrating secretion of fusion protein HKNGl: Fc. 11.4. Expression of HKNGl-Vl HUMAN: Fc A fusion protein vector HKNGl-Vl / hIgGIFc (HKNG1-Vl / hlgGlFc) can also be constructed by polymerase chain reaction. The full-length open reading frame of cDNA from HKNG1-V1 (SEQ ID NO: 6) was amplified by polymerase chain reaction using the following primer sequences: 5 '5' primer -TTTTTCTCTCGAGACCATGAGGACCTGGG ACTACAGTAAC-3 '(SEQ ID NO: 57) Initiator 3 * 5 »-TTTTTGGATCCGCTGCTGCCCAGGTTTTA AAATGTTCCTTAAAATGC-3 '(SEQ ID NO: 56) The 5 'primer incorporated a Kozak sequence before the methionine upstream to the amino acid residue before the retention codon. The 3 'polymerase chain reaction primer contained a 3-alanine linker at the junction of HKNG1 and the Fc domain of human IgGl, starting at the DPE residues. The genomic sequence of the Fc domain of human IgGl was ligated together with the polymerase chain reaction product into a pCDM8 vector for transient expression. The sequenced DNA construct was transiently transfected in HEK 293T cells in 150 mm plates using Lipofectamine (GIBCO / BRL) in accordance with the manufacturer's protocol. Seventy-two hours after transfection, the serum-free conditioned medium (OptiMEM, GIBCO / BRL) was harvested and rotated and the remaining cell monolayer was used using 2 mL of lysis buffer [50 mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 0.05% SDS with a "Complete" protease cocktail (Boehringer Mannheim) diluted in accordance with the manufacturer's instructions]. The insoluble material was formed into pellets before the preparation of the SDS-PAGE samples. A conditioned medium was electroabsorbed in a PVDF membrane (Novex) after separation by SDS-PAGE in 4-20% gradient gels and probed with an anti-human Fc polyclonal antibody (1: 500, Jackson ImmunoResearch Laboratories, Inc.) followed by sheep anti-mouse antibody (1: 5000, Amersham) conjugated with horseradish peroxidase (HRP), developed using chemiluminescent reagents (Renaissance, Dupont), and exposed to an autoradiography film (Biomax MR2 film, Kodak). Immunoreactivity of Fc from human IgGl appeared as a doublet of bands that migrated by SDS-PAGE between the 148 and 60 kDa standards of the molecular weight markers Multimark (Novex) centered approximately between 125 and 150 kDa, demonstrating mediated secretion by the signal peptide HKNG1. 11.5. EXPRESSION OF HKNG1? 7 HUMAN: Fc A fusion protein vector HKNGl? 7: hIgGlFc can also be constructed by polymerase chain reaction. The sequence of the splicing variant of HKNG1Δ7 was amplified by polymerase chain reaction amplification using exons 1 to 6 of the full-length HKNG1 cDNA sequence (SEQ ID NO: 1) as annealed with the following sequences of initiators: Initiator 5 '5' -TTTTTCTGAATTCACCATGAAGCCGCCAC TCTTGGTG-3 '(SEQ ID NO: 58) Initiator 3 '5 * -TTTTTGGATCCGCTGCGGCCTCCGTG GTCAGGAGCTTATTTTTCACAGAGGACCAGCT AG-3' (SEQ ID NO: 59) The 5 'primer incorporated a Kozak sequence upstream and including upstream initiator methionine. The 3 'primer included the first 17 nucleotides (coding) of exon 8 followed by nucleotides encoding a 3-alanine linker. The genomic sequence of the Fc domain of human IgGl was ligated together with the polymerase chain reaction product into a pCDM8 vector for transient expression. The sequenced DNA construct was transiently transfected in HEK 293T cells in 150 mm plates using Lipofectamine (GIBCO / BRL) in accordance with the manufacturer's protocol. Seventy-two hours after transfection, the serum-free conditioned medium (OptiMEM, GIBCO / BRL) was harvested and rotated and the remaining cell monolayer was used using 2 mL of lysis buffer [50 mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 0.05% SDS with a "Complete" protease cocktail (Boehringer Mannheim) diluted in accordance with the manufacturer's instructions]. The insoluble material was formed into pellets before the preparation of the SDS-PAGE samples. A conditioned medium was electroabsorbed in a PVDF membrane. { ovex) after separation by SDS-PAGE in 4-20% gradient gels and probed with a polyclonal anti-human Fc antibody (1: 500, Jackson ImmunoResearch Laboratories) followed by sheep anti-mouse antibody (1: 5000, Amersham) conjugated with horseradish peroxidase (HRP), revealed using chemiluminescent reagents (Renaissance, Dupont), and exposed to an autoradiography film (Biomax MR2 film, Kodak). The immunoreactivity of Fc from human IgGl appeared as a band that migrated by SDS-PAGE between 42 and 60 kDa of the molecular weight markers Multimark (Novex) centered approximately between 36.5 and 55.4 kDa, in relation to the molecular weight markers Mark 12 (Novek). 11.6 EXPRESSION OF NATIVE HUMAN HKNG1 An expression vector of HKNG1 was constructed by amplification by polymerase chain reaction of the human HKNG1 cDNA sequence (SEQ ID NO: 1) followed by ligation in an expression vector, pcDNA3.1 (Invitrogen , Carlsbad CA). The complete open reading frame of the HKNG1 cDNA sequence (SEQ ID NO: 5) was amplified by polymerase chain reaction using the following primer sequences: 5 '5' primer -TTTTTCTCTCGAGGACTACAGGACACAGC TAAATCC-3 '(SEQ ID NO. "60) Initiator 3 '5' -TTTTTGGATCCTTATCACCAGGTTTTAAA ATGTTCCTTAAAATGC-3 '(SEQ ID NO: 61) The 5 * initiator incorporated a Kozak sequence upstream and which includes the initiator methionine upstream. The 3f primer included a tandem pair of termination codons. The sequenced DNA construct was transiently transfected in HEK 293T cells in 150 mm plates using Lipofectamine (GIBCO / BRL) in accordance with the manufacturer's protocol. Seventy-two hours after transfection, the serum-free conditioned medium (OptiMEM, GIBCO / BRL) was harvested and rotated and the remaining cell monolayer was used using 2 mL of lysis buffer [50 mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 0.05% SDS with a "Complete" protease cocktail (Boehringer Mannheim) diluted in accordance with the manufacturer's instructions]. The insoluble material was formed into pellets before the preparation of the SDS-PAGE samples. A conditioned medium was electroabsorbed on a PVDF membrane (Novex) after separation by SDS-PAGE on 4-20% gradient gels and probed with an anti-HKNG1 polyclonal antibody (# 84, 1: 500) followed by anti-HIV antibody. sheep-mouse (1: 5000, Amersham) conjugated with horseradish peroxidase (HRP), developed using chemiluminescent reagents (Renaissance, Dupont), and exposed to an autoradiography film (Biomax MR2 film, Kodak). The immunoreactivity of HKNG1 appeared as a doublet of bands that migrated by SDS-PAGE between 60 and 90 kDa in accordance with that determined by molecular weight markers Multimark (Novex). 11.7. EXPRESSION OF NATIVE HUMAN HKNG-Vl An expression vector of human HKNG1-V1 was constructed by amplification by polymerase chain reaction of the human HKNG1-V1 cDNA sequence (SEQ ID NO: 3) followed by ligation into an expression vector, pcDNA3.1. The complete open reading frame of the HKNG1 cDNA sequence (SEQ ID NO: 6) was amplified by polymerase chain reaction using the following primer sequences: Primer 5 '5'-TTTTTCTGAATTCACCATGAAGCCGCCAC TCTTGGTG-3' (SEQ ID NO. : 62) * 5 '-TTTTTCTCTCGAGACCATGAGGACCTGGG ACTACAGTAAC-3' (SEQ ID NO: 63) Initiator 3 * 5 '-TTTTTGGATCCTTATCACCAGGTTTTAAA ATGTTCCTTAAAATGC-3' (SEQ ID NO: 61) The 5 'initiator incorporated a Kozak sequence upstream and including the initiator methionine upstream. The 3 'primer included a tandem pair of stop codons. The sequenced DNA construct was transiently transfected in HEK 293T cells in 150 mm plates using Lipofectamine (GIBCO / BRL) in accordance with the manufacturer's protocol. Seventy-two hours after transfection, the serum-free conditioned medium (OptiMEM, GIBCO / BRL) was harvested and rotated and the remaining cell monolayer was used using 2 mL of lysis buffer [50 mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 0.05% SDS with a "Complete" protease cocktail (Boehringer Mannheim) diluted in accordance with the manufacturer's instructions]. The insoluble material was formed into pellets before the preparation of the SDS-PAGE samples.

A conditioned medium was electroabsorbed in a PVDF membrane (Novex) after separation by SDS-PAGE in 4-20% gradient gels and probed with an anti-HKNGl M2 polyclonal antibody (# 84, 1: 500) followed by antibody from sheep anti-mouse (1: 5000, Amersham) conjugated with horseradish peroxidase (HRP), developed using chemiluminescent reagents (Renaissance, Dupont), and exposed to an autoradiography film (Biomax MR2 film, Kodak). The immunoreactivity of HKNG1 appeared as a doublet of bands that migrated by SDS-PAGE between 70 and 95 kDa in accordance with that determined by molecular weight markers Multimark (Novex), demonstrating the secretion mediated by the signal peptide of HKNG1. 11.8 EXPRESSION OF HUMAN HKNG FUSION PROTEIN: AP Expression vectors were also constructed for the C-terminal fusion protein of human HKNG1-alkaline phosphatase (HKNG1: AP), for the C-terminal fusion protein of human HKNG1-V1. alkaline phosphatase (HKNG1-V1: AP), and for the N-terminal fusion protein of human HKNG1-alkaline phosphatase (AP: HKNG1). The expression vector for HKNG1: AP was constructed by amplification by polymerase chain reaction followed by ligation into a vector suitable for expression in HEK 293T cells. The full-length open reading frame of human HKNG1 (SEQ ID NO: 5) was amplified by polymerase chain reaction using a 5 'primer incorporating an EcoRI restriction site followed by a Kozak sequence before the current initiator methionine. above. Primer 31 included an Xhol restriction site immediately after the final HKNGl codon. Thus, the open reading frame of the construct includes the HKNG1 signal peptide and the complete HKNG1 sequence followed by the complete sequence of human placental alkaline phosphatase. The expression vector for HKNG1-V1: AP was constructed by amplification by polymerase chain reaction followed by ligation in a pMEAP3 vector. The full-length open reading frame of human HKNG1-V1 (SEQ ID NO: 6) was amplified by polymerase chain reaction using a 5 'primer that incorporates an EcoRI restriction site followed by a Kozak sequence before the methionine. initiator upstream. The 3 'primer included an Xhol restriction site immediately after the final codon of HKNG1-V1. Thus, the open reading frame of the construct includes the HKNG1-V1 signal and the full-length HKNG1-V1 sequence followed by the complete sequence of human placental alkaline phosphatase. The expression vector for AP: human HKNG1 was constructed by amplification by polymerase chain reaction followed by ligation in an AP-TAG_3_vector reported by Cheng and Flanagan, 1994, Cell 79: 157-168. The full-length open reading frame of HKNG1 (SEQ ID NO: 5) was amplified by polymerase chain reaction using a 5 'primer that incorporates a BamH1 restriction site before the nucleotides encoding the first amino acids (i.e., APT) of the mature HKNG protein, and a 3 'primer that included an Xhol restriction site immediately after the final HKNGl codon. Thus, the open reading frame of the complete construct includes the AP signal peptide and the complete sequence of human placental alkaline phosphatase, followed by the complete sequence of HKNG1. The sequenced DNA constructs were transiently transfected in HEK 293T cells in 150 mm plates using Lipofectamine (GIBCO / BRL) in accordance with the manufacturer's protocol. Seventy-two hours after transfection, the serum-free conditioned media (OptiMEM, GIBCO / BRL) were harvested, rotated and filtered. The alkaline phosphatase activity in the conditioned media was quantified using an enzymatic assay kit (Phospa-Light, Tropix) in accordance with the manufacturer's instructions. When concentrations of alkaline phosphatase fission protein less than 2nM were observed, a conditioned medium was concentrated by centrifugation using a 30 kDa cut-off membrane. Samples of conditioned medium before and after concentration were analyzed by SDS-PAGE followed by Western blot using anti-human alkaline phosphatase antibodies (1: 250, Genzyme), and chemiluminescent detection. A band of 140 kDa was observed in concentrated supernatant of HKNG1 transfections: AP, HKNG1-V1: AP and AP: HKNGl. Samples of conditioned medium were adjusted to 10% fetal calf serum and stored at a temperature of 4 degrees C. 11.9 PURIFICATION OF HKNG1 PROTEINS MARKED WITH MARKER The secreted labeled proteins described in subsections 12.1 and 12.2 above were isolated by a one-step purification scheme employing the affinity of the marker epitope with anti-M2 marker antibodies. The conditioned media were passed on a column of M2-biotin (Sigma) / Poros streptavidin (2.1 x 30 mm, PE Biosystems). The column was then washed with PBS, pH 7.4 and the marker-labeled protein was eluted with 200 mM glycine, pH 3.0. The fraction was neutralized with 1.0 M Tris pH 8.0. The elution fractions with an absorbance of 280 nm greater than the bottom were then analyzed in SDS-PAGE gels and by Western blot. The fractions containing the marker-tagged protein were combined and dialysed in 8000 MWCO dialysis tubing against two changes of 4L PBS, pH 7.4 at a temperature of 4 degrees C with constant agitation. The exchanged cushioned material was then filtered sterile (0.2 μm, Millipore) and frozen at a temperature of -80 ° C. 11.10. PURIFICATION OF HKNG1 FC FUSION PROTEINS The secreted Fc fusion proteins described in subsections 12.3 and 12.5 above were isolated by a one-step purification scheme employing the affinity of the Fc domain of human IgGl with protein A. Conditioned media were passed in a POROS A column (4.6 x 100 mm, PerSeptive Biosystems); The column was then washed with PBS, pH 7.4 and eluted with 200 mM glycine, pH 3.0. The fraction was neutralized with 1.0 M Tris pH 8.0. A constant flow rate of 7ml / min was maintained throughout the procedure. The elution fractions with an absorbance of 280 nm greater than the bottom were then analyzed in SDS-PAGE gels and by Western blot. The fractions containing the Fc fusion protein were combined and dialysed in 8000 MWCO dialysis tubing against two changes of 4L PBS, pH 7.4 at a temperature of 4 degrees C with constant agitation. The buffered exchanged material was then sterile filtered (0.2 μm, Millipore) and frozen at a temperature of -80 ° C. 12. PRODUCTION OF ANTIBODIES ANTI-HKNG1 In the example presented in this section, the production and characterization of polyclonal antibodies is described and monoclonal antibodies directed against HKNGl. 12.1 PRODUCTION OF POLYCLONAL ANTIBODIES Polyclonal antisera were created in rabbits against each of the three peptides listed in Table 3 below. Each of the peptides was derived from the amino acid sequence HKNG1 (SEQ ID NO: 2) by standard techniques (see, particularly Harlow &Lane, 1988, Antibodies: A Laboratory Manual (Antibodies: A Laboratory Manual), Cold Spring Harbor Laboratory Press, the content of which is incorporated herein by reference in its entirety.Each of the peptides was also represented in the polypeptide sequence of HKNG1-V1 (SEQ ID NO: 4) .The antiserum was subsequently purified by affinity using the immunogens of peptide TABLE 3 Antibody Peptide / immunogen aa residues (SEQ ID NO: 2) Antibody 84 APTWKDKTAAISENLK 50-64 Antibody 85 KAIEDLPKQDK 304-314 Antibody 86 KALQHFKEHFKTW 483-495 12.2 PRODUCTION OF MONOCLONAL ANTIBODIES Monoclonal antisera were created in mice of standard techniques (see, Harlow &Lane, supra) against the fusion protein HKNG1-Fc described in section 11.3 above.The wells were screened by ELISA for to determine the binding to the fusion protein HKNG1-Fc. The wells that reacted with the Fc protein were identified by ELISA for binding to an irrelevant and discarded Fc fusion protein. The specific wells for HKNG1-Fc were tested for their immunoprecipitated capacity HKNG1-Fc and subjected to isotype analysis by standard techniques (Harlow &Lane, supra), and eight wells were selected for cloning. The isotype of the subcloned monoclonal antibodies was confirmed and appears in table 4 below. Based on the Western Blot analysis, immunoprecipitation and immunostaining data discussed in subsection 12.3 below, two monoclonal antibodies (3D17 and 4N6) were selected for large-scale production. TABLE 4 Clone Isotype 1F24 2a 1J18 2a 2020 1 3D17 1 3D24 2a 4N6 1 4016 2b 10C6 2a 12.3 WESTERN BLOT ANALYSIS AND IMMUNOPRECIPITATION OF RECOMBINANT HKNG PROTEIN The polyclonal antibodies of the eight monoclonal antibodies described in subsections 12.1 and 12.2 above were tested for determine their ability to recognize recombinant HKNG1 proteins in Western-type absorptions using standard techniques (see, particularly Harlow & La, 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press). Polyclonal antisera 84 and 85 and monoclonal antibodies 3D17 and 4N6 were able to recognize all forms of the recombinant (i.e., secreted) CCNG proteins tested (ie, HKNG1: Fc, HKNG1: marker, AP: HKNG1, and native HKNG1 ) in Western blot analysis. Table 5 indicates the ability of each monoclonal antibody to immunoprecipitate recombinant CCNG, in accordance with that evaluated by Western blot analysis of immunoprecipitates with polyclonal antisera 84 and 85. None of the polyclonal antisera could immunoprecipitate recombinant HKNG1 proteins. The eight monoclonal antibodies immunoprecipitated HKNG1: Fc. The immunoprecipitation of the other recombinant HKNG1 proteins was variable. TABLE 5 Antibody Monoclonal Protein HKNG1: Fc HKNG1: AP marker: HKNG1 HKNG1 (native) IF24 + + - / + IJ18 + - / + + / + 2020 + + 3D17 + / + + / + + / + 3D24 + 4N6 + + 4016 + + / + 10C6 + + 13. CONFIRMATION OF HKNG N TERMINAL AND DISULFIDE LINK STRUCTURE The experiments described in this section provide data identifying the N-terminus of the mature secreted human HKNG protein. The experiments also provided data that also provide data identifying disulfur binding links between amino acid residues of cysteine in the mature secreted protein. Specifically, recombinant proteins secreted from HKNG: marker, HKNG, and HKNG: Fc were produced and purified in accordance with that described in section 11 above. The mature recombinant proteins were digested with trixin, and the trixin fragments were identified and sequenced using reverse liquid phase chromatography connected with tandem electrode ionization mass spectrometry (LC / MS / MS). The N-terminus of all secreted, mature proteins tested was unambiguously identified as APTWKDKT, which corresponds to the amino acid sequence starting at alanine 50 of the amino acid sequence of HKNG1 (Figure 1; SEQ ID NO: 2) or in alanine 32 of the amino acid sequence of HKNG1-V1 (figure 2, SEQ ID NO: 4). Thus, even though the cDNA sequence of HKNG1 and HKNG1-V1 encode different amino acid sequences, the mature secreted proteins produced by these two splicing variants of the human HKNG1 gene are identical, since the alternative linkage that causes the existence of HKNG1- Vl (ie, the removal of exon 3) affects the amino acid sequence of the proteolytically dissociated signal peptide. The amino acid sequence of the mature secreted HKNG1 protein appears in Figure 17 (SEQ ID NO: 51). The HKNG protein prepared mature is also distinct from the amino acid sequence RPP disclosed by Shimizu-Matsumo et al. (1997, Invest. Ophthalmal, Vis. Sci. 38: 2576-2585). Particularly, amino acid residues 1 to 20 of the RPP amino acid sequence disclosed in Figure 3 of Shimizu-Matsumo et al, supra, correspond to the dissociated signal peptide of HKNG1-V1. The mature secreted amino acid sequence of the HKNG1 gene product is illustrated in Figure 17 (SEQ ID NO: 51). Disulfide binding junctions for eight of the three cysteine residues in the mature secreted HKNG protein were also identified from LC / MS / MS of peptides recovered from tryptic digestion of the unreduced protein. In particular, the following pairs of disulfide-linked cysteines were identified (the numbering refers to the protein HKNG1 illustrated in Figure 1: SEQ ID NO: 2): Cys 134 to Cys 145; Cys 148 to Cys 153; Cys 160 to Cys 334; And Cys 354 to Cys 362; 14. EXAMPLE: LOCATION OF HKNG mRNA AND PROTEIN EXPRESSION This example describes experiments in which the HKNG gene product is expressed in human brain and retinal tissue. Specifically, in situ hybridization experiments performed using standard techniques with a probe that corresponded to the complementary sequence of base pairs 910-1422 of the full-length HKNG1 cDNA sequence (SEQ ID NO: 1) detected messenger RNA from HKNG in the photoreceptor layer (outer nuclear layer) of the human retina in the eyes obtained from the New England Eye Bank (New England Eye Bank). The polyclonal antisera of the eight monoclonal antibodies described in section 12 above were tested for human retinal immunostaining. The polyclonal antiserum 85 and the monoclonal antibodies 1F24, 4N6 and 4016 presented immunostaining of the HKNG1 protein in the photoreceptor layer and adjacent layers of the retina. Immunostaining in these tissues with polyclonal antiserum was blocked by the peptide 85 immunogen, but not by the other two peptide immunogens (ie, 8486) confirming that the immunostaining was caused by the HKNG protein expressed in the coat. photoreceptor. The same antibodies were then used to localize the HKNG protein by immunostaining in human brain and monkey sections. The HKNG protein was observed in neurons of the cortex in the frontal cortex. Most of the pyramidal neurons in layers IV-V were immunoreactive for the HKNG protein. A subpopulation of neurons was also marked in layers I-III. The immunoreactivity of HKNG was also observed in the hippocampal pyramidal cell layer and in a small number of neurons in the stria. These data further support the fact that HKNG is a gene that mediates neuropsychiatric disorders such as BAD. In addition, the fact that HKNG is also expressed in human retinal tissue suggests that the gene also plays a role in myopia conditions. Specifically, Young et al. (1998, American Journal of Human Genetics 63: 109-119) report a strong relationship in (LOD = 9.59) for primary myopia and secondary vacular generation and retinal detachment in the telomeric region of human chromosome 18P. Through a fine mapping analysis, this candidate region has been narrowed to a 7.6C Haplotype flanked by markers D18S59 and D18S1138. { Young et al, supra). However, marker D18S59 is found within the HKNG1 gene. this fact together with the finding that HKNG is expressed at high levels in the retina strongly suggests that the HKNG1 gene is also responsible for conditions of human myopia and / or other diseases related to the eye such as primary myopia, secondary vascular degeneration , and retinal detachment. 15. EXAMPLE: IMAGING PROTEIN PRODUCTS OF THE HKNG1 cDNA SEQUENCE This section describes experiments that were performed to determine which of the two putative primer methionines encoded by both the full-length HKNG1 cDNA and the HKNG1-V1 cDNA. spliced alternatively are employed in the protein synthesis of immature HKNG1. The results indicate that both initiator methionines are employed at several levels, resulting in the production of three different forms of the immature HKNG1 protein, which are known here as form 1 of immature protein (IPF2), form 2 of immature protein (IPF2), and form 3 of immature protein (IPF3).

The full-length HKNG1 cDNA sequence illustrated in Figure 1 (SEQ ID NO: 1) as the alternately spliced HKNG1-V1 cDNA sequence illustrated in Figure 2 (SEQ ID NO: 3) encode predicted proteins that they have methionines near their predicted initiator methionines. The predicted protein sequence encoded by the full length HKNG1 cDNA sequence has a second methionine at amino acid residue number 30 of the amino acid sequence illustrated in Figure 1 (SEQ ID NO: 2). Thus, even when Figure 1 indicates that the full-length HKNG1 cDNA encodes the first immature form of the HKNG1 protein illustrated in Figure 1 (referred to herein as IPF1), the full-length HKNG1 cDNA can additionally encode a second form of immature protein (known herein as IPF2), whose sequence (SEQ ID NO: 64) is provided in the third row of the protein alignment illustrated in Figure 17. IPF2 is initiated into the methionine 30 of the protein sequence of IPF1, and is identical to the RPP polypeptide sequence presented by Shimizu-Matsumoto et al., (1997, Invest. Ophthalmol, Vis. Sci. 38: 2576-2585). In the same manner, the alternatively spliced HKNG1-V1 cDNA sequence encodes the predicted immature protein form, known herein as IPF3, illustrated in Figure 2 (SEQ ID NO: 4). However, the HKNG1-V1 cDNA can also encode another form of immature protein, identical to IPF2, which is initiated in the methionine 12 of the IPF3 protein sequence. Figure 17 illustrates an alignment of the three protein sequences of immature HKNG1 IPF1 (second row), IPF2 (third row), and IPF3 (bottom row). As explained in section 13 above, the mature HKNG1 gene product secreted by the cells expressing the HKNG1 constructs described in section 11 above, is in fact the same dissociated product (SEQ ID NO: 51), regardless of the protein of immature HKNG1 (IPF1, IPF2, or IPF3) from which it is produced. An alignment of the mature secreted HKNG1 protein is also illustrated accordingly in Figure 17 (top row). Modified expression vectors HKNG1 were constructed: marker and HKNG1-V1: marker according to that described in sections 12.1 and 12.2, respectively. However, the nucleotide sequence of full-length HKNG1 was modified, employing standard site-directed mutagenesis techniques in order to introduce an additional base pair between the upstream methionine (ie, met 1 in SEQ ID NO: 2) and downstream methionine (ie, met 30 in SEQ ID NO: 2). The nucleotide sequence of HKNG1-V1 was modified in the same manner, employing standard site-directed mutagenesis techniques, to introduce an additional base between its upstream methionine (ie, meth 1 in SEQ ID NO: 4) and current methionine. below (ie, met 12 in SEQ ID NO: 4). Thus, in both modified constructs, the C-terminal marker epitope marker was no longer in the same reading frame as the upstream methionine but was in the box with the methionine downstream. Accordingly, an exclusive translation start in the first construct methionine would result in the production of non-marker immunoreactive proteins. However, the exclusive translation start in the second methionine of a construct would cause the production of immunoreactive marker proteins. Unmodified constructs HKNG1: marker, unmodified HKNG1-V1: marker, modified HKNG1: marker, and modified HKNG1-V1: marker were transfected into cells, and their resulting gene products were harvested, absorbed in a PVDF membrane, and probed with a polyclonal anti-M2 marker antibody, and developed in accordance with the methods described in sections 12.1 and 12.2, above. Marker immunoreactivity was detected in all four samples. The unmodified expression vectors HKNG1: marker and HKNG1-V1: marker produced protein amounts of HKNG1: mature secreted marker consistent with the levels detected in sections 12.1 and 12.2 above. further, the marker immunoreactive band detected for the HKNG1 construct: modified marker was impossible to distinguish in terms of its intensity from the band detected for the HKNG1 construct: unmodified marker, indicating that the immature HKNG1 protein produced by cDNA from Full-length HKNG1 is predominantly IPF2, while IPF1 is produced by full-length HKNG1 cDNA in relatively minor amounts. The marker immunoreactive band from the HKNG1-V1: modified marker construct showed a dramatically reduced intensity compared to the band from the HKNG1-V1 construct: unmodified marker. Thus, HKNG1-V1 primarily produces the protein of immature HKNG1 IPF3, while the protein IPF2 of immature HKNG1 is produced by HKNG1-V1 in relatively smaller amounts. These results are summarized below in Table 6. Table 6 Immature protein construct prominence HKNG1 IPF1 (SEQ ID NO: 2) lower IPF2 (SEQ ID NO: 64) predominant HKNGl-Vl IPF2 (SEQ ID NO: 64) lower IPF3 ( SEQ ID NO: 4) predominant Thus, the HKNG1 gene products of the present invention include gene products corresponding to the immature protein forms IPF1 and IPF3. However, the HKNG1 gene products of the invention do not include amino acid sequences consisting of the IPF2 sequence (SEQ ID NO: 64). 16. REFERENCES CITED The present invention is not limited in its scope to the specific embodiments described herein that are intended merely to illustrate individual aspects of the invention and functionally equivalent methods and components are within the scope of the invention. In fact, various modifications to the invention, in addition to the modalities illustrated and described herein, will be apparent to those skilled in the art from the foregoing description and from the accompanying drawings. All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication or individual patent application was specifically and individually indicated as incorporated by reference.

Claims (42)

1. CLAIMS An isolated nucleic acid molecule comprising a nucleotide sequence encoding a HKNG1 gene product, comprising: (a) the amino acid sequence of SEQ ID NO: 2; (b) the amino acid sequence of SEQ ID NO: 4; (c) the amino acid sequence of SEQ ID NO: 39; (d) the amino acid sequence of SEQ ID NO: 41; (e) the amino acid sequence of SEQ ID NO: 43; (f) the amino acid sequence of SEQ ID NO: 45; (g) the amino acid sequence of SEQ ID NO: 49; or (h) the amino acid sequence of SEQ ID NO: 66.
2. The isolated nucleic acid molecule according to claim 1, wherein the isolated nucleic acid molecule comprises: (a) the nucleotide sequence of SEQ ID NO: 1, (b) the nucleotide sequence of SEQ ID NO: 3j (c) the nucleotide sequence of SEQ ID NO: 7, (d) the nucleotide sequence of SEQ ID NO: 34; or (e) the nucleotide sequence of SEQ ID NO: 35.
3. The isolated nucleic acid molecule according to claim 1, wherein the isolated nucleic acid molecule comprises: (a) the nucleotide sequence of SEQ ID NO: 38; (b) the nucleotide sequence of SEQ ID NO: 40; (c) the nucleotide sequence of SEQ ID NO: 42; or (d) the nucleotide sequence of SEQ ID NO: 44.
4. The isolated nucleic acid molecule according to claim 1, wherein the isolated nucleic acid molecule comprises: (a) the nucleotide sequence of SEQ ID NO: 46; (b) the nucleotide sequence of SEQ ID NO: 47; or (c) the nucleotide sequence of SEQ ID NO: 48.
5. An isolated nucleic acid molecule consisting of a nucleotide sequence encoding a mature HKNG1 protein having the amino acid sequence of SEQ ID NO: 5 1.
6. An isolated nucleic acid molecule that hybridizes with the complement of the nucleic acid molecule of any of claims 1-5 under highly stringent conditions comprising washing in O.lxSSC / 0.1% SDS at a temperature of 68 ° C .
7. An isolated nucleic acid molecule that hybridizes with the complement of the nucleic acid molecule of any of claims 1-5 under stringent conditions comprising washing in 0.2xSSC / 0.1% SDS at a temperature of 50 to 65 ° C .
8. The isolated nucleic acid molecule according to claim 6 or according to claim 7, wherein said isolated nucleic acid molecule encodes a functionally equivalent HKNG1 gene product.
9. A vector comprising the nucleotide sequence of any of claims 1-5.
10. A vector comprising the nucleotide sequence of any of claims 1-5 operatively associated with a regulatory nucleotide sequence that controls the expression of the nucleotide sequence in a host cell.
11. A host cell genetically engineered in such a manner as to contain the nucleotide sequence of any of claims 1-5.
12. A genetically engineered host cell for expressing the nucleotide sequence of any of claims 1-5 operatively associated with a regulatory nucleotide sequence that controls the expression of the nucleotide sequence in said host cell.
13. An isolated polypeptide comprising the amino acid sequence of a HKNG1 gene product having: (a) the amino acid sequence of SEQ ID NO: 2; (b) the amino acid sequence of SEQ ID NO: 4; (c) the amino acid sequence of SEQ ID NO: 39; (d) the amino acid sequence of SEQ ID NO: 41; (e) the amino acid sequence of SEQ ID NO: 43; (f) the amino acid sequence of SEQ ID NO: 45; or (g) the amino acid sequence of SEQ ID NO: 49; (h) the amino acid sequence of SEQ ID NO: 66.
14. An isolated polypeptide consisting of a mature HKNG1 gene product having the amino acid sequence of SEQ ID NO: 51.
15. An isolated polypeptide comprising an amino acid sequence encoded by the isolated nucleic acid molecule of claim 6 or claim 7.
16. An antibody that selectively binds to the HKNG1 gene product of any of claims 13 or 14.
17. A method for treating a disease mediated by HKNG1 in an individual, which comprises the administration to the individual of a compound that modulates the expression of a HKNG1 gene in the individual.
18. The method according to claim 17, wherein the compound inhibits or enhances the expression of a HKNG1 gene in the individual.
19. 19. The method according to claim 17, wherein the compound is a small molecule.
20. 20. The method according to claim 17, wherein the HKNG1 mediated disorder is a neuropsychiatric disorder.
21. 21. The method according to claim 17, wherein the neuropsychiatric disorder is biopolar affective disorder or schizophrenia.
22. 22. The method according to claim 17, wherein the HKNG1 gene encodes a HKNG1 gene product comprising: (a) the amino acid sequence of SEQ ID NO: 2; (b) the amino acid sequence of SEQ ID NO: 4; (c) the amino acid sequence of SEQ ID NO: 39; (d) the amino acid sequence of SEQ ID NO: 41, (e) the amino acid sequence of SEQ ID NO: 43, (f) the amino acid sequence of SEQ ID NO: 45; (g) the amino acid sequence of SEQ ID NO: 49; (h) the amino acid sequence of SEQ ID NO: 51, (i) the amino acid sequence of SEQ ID NO: 64; or (j) the amino acid sequence of SEQ ID NO: 66.
23. 23. The method according to claim 17, wherein the individual is a mammal.
24. 24. The method of claim 23, wherein the mammal is a human.
25. 25. A method for the treatment of a disorder mediated by HKNG1 in an individual, comprising administering to the individual a compound that modulates the expression or activity of a HKNG1 gene product in the individual.
26. 26. The method according to claim 25, wherein the compound inhibits or enhances the expression or activity of a HKNG1 gene product in the individual.
27. 27. The method according to claim 25, wherein the compound is a small molecule.
28. 28. The method according to claim 25, wherein the HKNG1 mediated disorder is a neuropsychiatric disorder.
29. 29. The method according to claim 28, wherein the neuropsychiatric disorder is bipolar affective disorder or schizophrenia.
30. 30. The method according to claim 25, wherein the HKNG1 gene product comprises: (a) the amino acid sequence of SEQ ID NO: 2; (b) the amino acid sequence of SEQ ID NO: 4; (c) the amino acid sequence of SEQ ID NO: 39; (d) the amino acid sequence of SEQ ID NO: 41, (e) the amino acid sequence of SEQ ID NO: 43, (f) the amino acid sequence of SEQ ID NO: 45; (g) the amino acid sequence of SEQ ID NO: 49; (h) the amino acid sequence of SEQ ID NO: 51; (i) the amino acid sequence of SEQ ID NO: 64; or (j) the amino acid sequence of SEQ ID NO: 66.
31. 31. The method according to claim 25, wherein the individual is a mammal.
32. 32. The method according to claim 31, wherein the mammal is a human being.
33. 33. A method for identifying a compound that modulates the expression of a HKNG1 gene, comprising: (a) contacting a test compound with a cell that expresses a HKNG1 gene; (b) measuring a level of expression of the HKNG1 gene in a cell; (c) comparing the expression level of HKNG1 gene in the cell in the presence of the test compound with an expression level of HKNG1 gene in the cell in the absence of the test compound, where if the level of expression of HKNG1 gene in the cell in the presence of the test compound differs from the expression level of the HKNG1 gene in the cell in the absence of the test compound, a compound that modulates the expression of a HKNG1 gene is identified.
34. 34. The method according to claim 33, wherein the HKNG1 gene encodes a HKNG1 gene product comprising: (a) the amino acid sequence of SEQ ID NO: 2; (b) the amino acid sequence of SEQ ID NO: 4; (c) the amino acid sequence of SEQ ID NO: 39; (d) the amino acid sequence of SEQ ID NO: 41; (e) the amino acid sequence of SEQ ID NO: 43j (f) the amino acid sequence of SEQ ID NO: 45; (g) the amino acid sequence of SEQ ID NO: 49; (h) the amino acid sequence of SEQ ID NO: 51, (i) the amino acid sequence of SEQ ID NO: 64; or (j) the amino acid sequence of SEQ ID NO: 66.
35. The method according to claim 34, wherein the HKNG1 gene comprises: (a) the nucleotide sequence of SEQ ID NO: 1; (a) the nucleotide sequence of SEQ ID NO 3 (a) the nucleotide sequence of SEQ ID NO 5 (a) the nucleotide sequence of SEQ ID NO 6 (a) the nucleotide sequence of SEQ ID NO 34 (a) the nucleotide sequence of SEQ ID NO 35 (a) the nucleotide sequence of SEQ ID NO 38 (a) the nucleotide sequence of SEQ ID NO 40 (a) the nucleotide sequence of SEQ ID NO 42 (a) the nucleotide sequence of SEQ ID NO 44 (a) the nucleotide sequence of SEQ ID NO: 46; (a) the nucleotide sequence of SEQ ID NO: 47; (a) the nucleotide sequence of SEQ ID NO: 48; or (a) the nucleotide sequence of SEQ ID NO: 65.
36. A method for identifying a compound that modulates the expression or activity of a HKNG1 gene product, comprising: (a) contacting a test compound with a cell that expresses a gene product HKNG1; (b) measuring a level of expression or activity of HKNG1 gene product in the cell; (c) comparing the level of expression or activity of HKNG1 gene product in the cell in the presence of the test compound with a level of expression or activity of HKNG1 gene product in the cell in the absence of the test compound, where if the level of HKNG1 gene product expression or activity in the cell in the presence of the test compound differs from the level of expression or activity of HKNG1 gene product in the cell in the absence of the test compound, a compound that modulates expression or activity is identified of a HKNG1 gene product.
37. The method according to claim 36, wherein the HKNG1 gene product comprises: (a) the amino acid sequence of SEQ ID NO: 2; (b) the amino acid sequence of SEQ ID NO: 4; (c) the amino acid sequence of SEQ ID NO: 39; (d) the amino acid sequence of SEQ ID NO: 41, (e) the amino acid sequence of SEQ ID NO: 43; (f) the amino acid sequence of SEQ ID NO: 45; (g) the amino acid sequence of SEQ ID NO: 49; (h) the amino acid sequence of SEQ ID NO: 51; or (i) the amino acid sequence of SEQ ID NO: 64.
38. A method for identifying a person who has or is at risk of developing a disorder mediated by HKNG1, comprising the step of detecting the presence or absence of a polymorphism that correlates with an allele of HKNG1 associated with the disorder, where the presence of the polymorphism indicates that the person has the HKNG1 mediated disorder or is at risk of developing the HKNG1 mediated disorder.
39. The method according to claim 38, wherein the mutation results in the production of a protein comprising an amino acid sequence that is different from the amino acid sequence of SEQ ID NO: 2 or 4.
40. 40. The method according to claim 39, wherein the mutation results in the replacement of a lysine with a glutamic acid at the amino acid residue 202 of SEQ ID NO: 2.
41. 41. The method according to claim 39, wherein the mutation results in the substitution of a lysine by a glutamic acid at amino acid residue 184 of SEQ ID NO: 4.
42. 42. The method according to claim 36, wherein the method comprises the step of analyzing the sequence of the coding region of the human HKNG1 gene by preparing the and sequencing of cDNA comprising a sequence that hybridizes under stringent conditions to the complement of a nucleotide sequence encoding the polypeptide sequence. set forth in SEQ ID NO: 2.