WO1999003874A1 - cDNA AND AMINO ACID SEQUENCES OF THE HUMAN LIVER CYTOSOLIC BETA-GLUCOSIDASE - Google Patents

Abstract

The primary structure of human liver cytosolic β-glucosidase (CBG) and its encoding DNA sequence is provided. Assays for this enzyme as a marker of ischemic liver injury in liver transplantation are described.

Description

CDNA AND AMINO ACID SEQUENCES OF THE HUMAN LIVER CYTOSOLIC BETA-GLUCOSIDASE

BACKGROUND OF THE INVENTION

The present invention relates to the identification of the primary structure of cytosolic β-glucosidase (CBG) (Sequence ID1) of the human liver and the nucleotide sequence encoding for the complete human liver CBG protein (Sequence ID2) . The invention further relates to inducible recombinant expression vectors for the production of expression constructs capable of expressing recombinant polypeptides comprising all or part of the a ino acid sequence of the human liver CBG protein, and also to the human liver CBG protein or polypeptides expressed by these constructs.

The structure is particularly useful as a starting material for the production of monoclonal antibodies (MAbs) specific for this enzyme (e.g., antibodies not cross-reactive with other human β-glucosidases, antibodies not cross-reactive with other mammalian β-glucosidases, or antibodies not cross- reactive with other mammalian proteins) . Diagnostic immunoassays based on such (human liver CBG antigen) / (anti-human liver antibody) pairs are especially contemplated for quantitation of serum levels of human liver CBG in relevant clinical applications, such as the diagnosis of acute ischemic injury to the liver, for which human liver CBG is a marker. Clinical therapies based on the availability of CBG MAbs according to the invention include conjugates of high-specificity human liver CBG monoclonal antibodies and enzyme for enzymatic cleavage and activation of therapeutics such as glycosylated prodrugs at the liver; several therapeutic systems of this type are described in U.S. 5,561,119 to Jacquesy ei al. , issued October 1, 1996.

The structural information provided herein permits the identification of active sites on the described human liver CBG, particularly catalytically and antigenically active sites, for isolation and use in appropriate applications. 1. Field of Art

Mammalian β-glucosidases are hydrolases found in mammalian tissues and cells such as the bowel and liver, which (de) activate their substrates by deglucosylation. While some of their specific in vivo catalytic activities are known or have been surmised from in vitro experiments, the larger roles of these enzymes in mammalian metabolic process has not been well- elaborated. For example, the small β-D-glucosides widely distributed in mammalian dietary plants are known in vitro substrates for these enzymes and at least some of their in vivo bioactivity (such as hormonal or antioxidant activity) apparently is dependent on removal of their β-D-glycosyl moieties by B- glucosidases. Several xenobiotic β-D-glucosides are toxic to mammals (amygdalin, prunasin, vicine) ; these particular glycosides have been shown to be hydrolyzed by liver β- glucosidase in vitro. The function of human cytoplasmic (cytosolic) beta-glucosidase in the etiology of Gaucher's disease has been questioned (but apparently not yet resolved) following the observation of elevated levels and low activity of this enzyme in a case of type 1 Gaucher's disease (J.Biol.Chem. , December 25, 1981: Daniels, e± aL. : "Purification and characterization of a cytosolic broad specificity beta- glucosidase from human liver.") .

In sum, reports of cohesive approaches to the elucidation of β-glucosidase activity in mammals are few, and very little clinically useful information about mammalian, especially human, β-glucosidase activity has been generated, owing in good part to the lack of basic information on the structures of these enzymes and the resultant lack of tools for their study.

2. Discussion of Related Art β-glucosidases have been purified from various mammalian tissues and cells, including porcine jejunal mucosa

(J.Biol.Chem. , December 19, 1997: McMahon, et &1. , "Cytosolic pyridoxine-beta-D-glucoside hydrolase from porcine jejunal mucosa."); human leukocytes (Clin. Chi .Acta , July 16, 1993: Forsyth e_t al. , "Variable expression of leukocyte cytosolic broad-specificity beta-glucosidase activity") ; and guinea pig liver (Biochem. J. , November 1, 1996: Hayes, et al. , "Primary structure of the cytosolic beta-glucosidase of guinea pig liver.", incorporated herein by reference) . At least four human beta-glucosidases are known: Lysosomal glucocerebrosidase, non- lysosomal glucocerebrosidase, cytosolic broad-specificity beta- glucosidase, and lysosomal EMG lc-ase (Biochim Biophys Acta, October 7, 1996: Mikhaylova e_fc al. , "The enzymatic hydrolysis of 6-acylamino-r-methylumbelliferyl-beta-D-glucosides : identification of a novel human acid beta-glucosidase.") . Cytosolic β-glucosidase was isolated from the human liver in the early 1980' s, and characterized as having a mw of about 53 kDa, a pi of 4.5-4.6 , and a pH optimum between 5 and 6. The isolate was reported to have a broad specificity for sugars, no demonstrable ability to hydrolyze glucocerebroside, and a lack of cross-reactivity with antiglucocerebroside antibodies (J. Biol. Chem. , December 25, 1981: Daniels et al. , "Purification and characterization of a cytosolic broad specificity beta- glucosidase from human liver.", incorporated herein by reference) . Cytosolic CBG from guinea pig liver has been sequenced, as has its encoding gene (Biochem. J. 1996, op.cit. ) .

BRIEF DESCRIPTION OF THE DRAWING

The sole Figure graphically illustrates increases in serum CBG activity in four liver transplant recipients after transplantation marking of acute reperf sion liver injury. (One patient received two transplants, livers #1 and #2.)

SUMMARY OF THE INVENTION

The invention comprises a recombinant protein according to Sequence ID 1, infra. _f or a polypeptide or oligopeptide portion thereof. The invention further comprises a gene according to Sequence ID 2, infra. , or a polynucleotide or oligonucleotide portion thereof. The invention additionally comprises inducible recombinant expression vectors for the production of expression constructs expressing the protein of Sequence ID 1 or a selected polypeptide portion thereof. The invention also comprises recombinant antigenic polypeptide portions of the recombinant protein according to Sequence ID 1, and monoclonal antibodies reactive with these antigenic domains and specific to this protein.

The invention further comprises the inventors • discovery that serum human liver CBG activity is a clinical marker of hepatocyte injury in liver transplantation, and also comprises assays predicated on this discovery for monitoring reperfusion liver injury in transplant recipients and for prognosticating incipient transplant failure. The invention additionally comprises highly specific im unoassays for human liver CBG, particularly in human tissue and serum samples, employing the above-described enzyme-specific monoclonal antibodies, and therapies based on immunoenzyme conjugates.

DETAILED DESCRIPTION OF THE INVENTION

1. Cloning of Human Liver CBG cDNA

Clones were obtained by selection of primers for production of a PCR product that would easily clone into the chosen plasmid expression vectors and allow ready production of the protein encoded by the foreign DNA. Amplification was by RT- PCR (reverse transcriptase-polymer chain reaction) from total human liver RNA. The sequence of the cDNA of human liver cytosolic β-glucosidase was determined by sequencing the cloned PCR products.

The initial step in the cloning of the human liver cDNA was the identification of novel PCR primers derived from the cDNA sequence of the guinea pig CBG that amplified the DNA regions of interest and allowed the cloning of the complete sequence of human liver DNA. These primers (below) are novel in two ways. First, they have not been used or described previously. Second, they were designed specifically for the purpose of amplifying a sequence of DNA closely related to, but not identical with, guinea pig CBG DNA. Their application required the use of experimentally derived conditions which were optimized for this objective. The final result was the cloning of human liver CBG cDNA to form cDNA inserts (cDNA from PCR ligated to plasmid expression vector) for subcloning into a host cell. Primers

5 • -ttaccgcttttctatttcctgg 5 • -gggctcatttatggtgatcc 5 ' -gtggaaggaggctgggat 5 ^■ -ctgtgccaggctctggc

The primers for PCR were derived from the regions of the guinea pig liver enzyme which were most homologous with other β-glucosidases. Two initial PCR products were obtained using primers derived from the guinea pig cDNA sequence. These two overlapping PCR products were identified as correct by their nucleotide sequences, which coded for a single open reading frame having very high sequence identity with the guinea pig cytosolic β-glucosidase. The 5¹ and 3" ends of the cDNA were obtained by the RACE procedure, as previously performed for the guinea pig cDNA sequence, as described in Biochem. J. 1 November 1996, op.cit. _f incorporated herein by reference. The RACE method ("rapid amplification of cDNA ends") is described in Methods Enzym. 218 : 340-356, 1993, incorporated herein by reference.

Many methods for cloning cDNA are known in the art, and are adaptable to the production of the human liver CBG cDNA inserts described herein, and to the preparation of expression constructs for the enzyme.

The human liver CBG has 79% nucleotide similarity and 83% amino acid similarity to guinea pig CBG. This degree of difference between the guinea pig and human forms is more than sufficient to develop antibodies to distinguish the two enzymes by processes well-known in the art. It furthermore shows that detailed comparisons of the recombinant forms of the two enzymes will likely reveal subtle enzymatic differences between these enzymes, as well. cDNA inserts according to the invention (plasmid expression vectors ligated with human liver CBG cDNA) have been prepared for deposit with the American Type Culture Collection, 12301 Parklawn Drive, Bethesda, MD, USA in accordance with the terms and conditions of the Budapest Treaty. 2. Cytosolic β-Glucosidase (CBG) Assays

Currently the assay for serum CBG is an enzymatic method based on substrate activation which has been optimized over the last 15 years. For specificity, this assay relies upon unique reaction conditions under which the activity of CBG is greatest and the activity of other known β-glucosidases is minimal. While this method is presently accepted as adequate for basic research studies, as more different β-glucosidases are identified in human tissues, the ability of the assay to distinguish between different enzymes with similar catalytic properties will likely be decreased. This will be increasingly important if human liver CBG becomes a widely used marker of transplanted liver injury. Accordingly, the invention provides an enzyme-specific immunoassay for serum CBG. Monoclonal antibody specific to human liver CBG is used to bind and isolate CBG from serum samples. The isolated CBG is then quantitated using standard methods. Typically, the immunoassay is used in conjunction with the conventional enzymatic assay for confirmation of results of the latter assay. The ability to produce human liver CBG monoclonal antibody, which provides the specificity in the assay, is completely dependent on the disclosure herein of the unique amino acid sequence of this enzyme and its unique cDNA sequence according to the invention.

3. Cytosolic β-glucosidase as a marker of reperfusion injury in liver transplantation.

A. Methods and Materials:

The activities of β-glucosidase and standard clinical liver enzymes were compared with each patient's clinical course to determine whether β-glucosidase provides sensitive data on injury sustained by the donor liver during the transplant operation. Subjects were identified from all patients selected for liver transplantation at the University of New Mexico (Albuquerque, NM USA) over an 18 month period. Subjects were identified from patients scheduled for liver transplant, and enrolled when a local donor was identified. Controls were identified from patients scheduled for non- laparoscopic cholecystectomy.

A maximum of 6 serum samples per patient was drawn. Since this β-glucosidase assay required no more than 0.5 ml of serum or plasma, efforts were made to use serum or plasma from samples drawn for clinically indicated tests when the timing of the blood drawing coincided with the protocol. Samples were taken according to the following schedule: (1) 24 hours or less prior to recipient hepatectomy; (2) 2, 4, 8, 12, 24, 48, and 72 hours after graft reperfusion; (3) a single sample from the donor prior to donor hepatectomy; and (4) a sample of the effluent from the donor liver (e.g. from the hepatic and portal veins) after storage but prior to placement in the liver. After obtaining informed consent, the activity of CBG was measured in serum prior to and after liver transplantation in four patients.

B. Results:

The mean CBG activity in recipient serum prior to transplantation was 0.8 U/ml (range: 0.6-1.2). After reperfusion, the increase in serum CBG activity ranged from 13 - 17-fold over baseline for livers #1 and #4, which were in optimal condition. Liver #2 experienced a prolonged period of cold and warm ischemia, and yielded a 92-fold increase in CBG after reperfusion, while liver #3 was found to have substantial steatosis at harvest and a 29-fold increase in CBG activity. After the typical rapid increase after reperfusion, CBG activities declined to baseline within 12 hours after reperfusion. The sole exception was Liver #1: at 12 hours post reperfusion CBG activity increased 110-fold, which heralded the acute onset of hepatic artery thrombosis; the liver then failed. (This patient then received Liver #2.) Liver #5 was unremarkable. The CBG activity at reperfusion for this liver was minimal and the post-operative course was benign. Corresponding elevations in ALT activity were seen after each transplant, although the peak activities were not reached until 24-36 hours after reperfusion. The data directly reflected ischemic injury; CBG activity was not increased under liver rejection conditions. One patient died of unrelated causes shortly after transplantation; the remaining transplants were regarded as a success as of 2 to 3 months post-op.

C. Conclusion:

The data in the above studies shows that, in the context of orthotopic liver transplantation, cytosolic β- glucosidase elevations in the serum represent acute liver injury. In liver transplantation, the donor liver experiences an extended period of anoxia between the time of its removal from the donor's circulation and the establishment of perfusion in the recipient. While major technical advances have been made in graft organ preservation and in minimizing the effects of reperfusion injury, the nearly immediate ischemic insult of reperfusion remains a major cause of primary graft dysfunction. Consequently, human liver CBG proves to be an early and sensitive biochemical marker of the status of the graft. The accuracy and reliability of the assay is at least partially attributable to the inventors' discovery that human liver CBG is not expressed in the bowel and is probably unique to hepatocytes. Assay results facilitate intervention prognosis, and monitoring of the post-operative course of transplant recipients.

4. Human Liver CBG and cDNA Sequences

Sequence ID1: Amino acid sequence of human liver cytosolic β- glucosidase

Met Ala Phe Pro Ala Gly Phe Gly Trp Ala Ala Ala Thr Ala Ala Tyr 1 5 10 15

Gin Val Glu Gly Gly Trp Asp Ala Asp Gly Lys Gly Pro Cys Val Trp 20 25 30

Asp Thr Phe Thr His Gin Gly Gly Glu Arg Val Phe Lys Asn Gin Thr 35 40 45

Gly Asp Val Ala Cys Gly Ser Tyr Thr Leu Trp Glu Glu Asp Leu Lys 50 55 60

Cys lie Lys Gin Leu Gly Leu Thr His Tyr Ser Phe Ser Leu Ser Trp 65 70 75 80

Ser Arg Leu Leu Pro Asp Gly Thr Thr Gly Phe lie Asn Gin Lys Gly

85 90 95

lie Asp Tyr Tyr Asn Lys lie lie Asp Asp Leu Leu Lys Asn Gly Val 100 105 110

Thr Pro lie Val Thr Leu Tyr His Phe Asp Leu Pro Gin Thr Leu Glu 115 120 125

Asp Gin Gly Gly Trp Leu Ser Glu Ala lie lie Glu Ser Phe Asp Lys 130 135 140

Tyr Ala Gin Phe Cys Phe Ser Thr Phe Gly Asp Arg Val Lys Gin Trp 145 150 155 160

lie Thr lie Asn Glu Ala Asn Val Leu Ser Val Met Ser Tyr Asp Leu

165 170 175 Gly Met Phe Pro Pro Gly lie Pro His Phe Gly Thr Gly Gly Tyr Gin 180 185 190

Ala Ala His Asn Leu lie Lys Ala His Ala Arg Ser Trp His Ser Tyr 195 200 205

Asp Ser Leu Phe Arg Lys Arg Gin Lys Gly Met Val Ser Leu Ser Leu 210 215 220

Phe Pro Ala Arg Leu Glu Pro Ala Asp Pro Asn Ser Val Ser Asp Gin 225 230 235 240

Glu Ala Ala Lys Arg Ala lie Thr Phe His Leu Asp Leu Phe Ala Lys

245 250 255

Pro lie Phe lie Asp Gly Asp Tyr Pro Glu Val Val Lys Ser Gin lie 260 265 270

Ala Ser Met Ser Gin Lys Gin Gly Tyr Pro Ser Ser Arg Leu Pro Glu 275 280 285

Phe Thr Glu Glu Glu Lys Lys Met lie Lys Gly Thr Ala Asp Phe Phe 290 295 300

Ala Val Gin Tyr Tyr Thr Thr Arg Leu lie Lys Tyr Gin Glu Asn Lys 305 310 315 320

Lys Gly Glu Leu Gly Thr Leu Gin Asp Ala Glu lie Glu Phe Phe Pro

325 330 335

Asp Pro Ser Trp Lys Asn Val Asp Trp lie Tyr Val Val Pro Trp Gly 340 345 350

Val Cys Lys Leu Leu Lys Tyr lie Lys Asp Thr Tyr Asn Asn Pro Val 355 360 365 lie Tyr lie Thr Glu Asn Gly Phe Pro Gin Ser Asp Pro Ala Pro Leu 370 375 380

Asp Asp Thr Gin Arg Trp Glu Tyr Phe Arg Gin Thr Phe Gin Glu Leu 385 390 395 400

Phe Lys Ala lie Gin Leu Asp Lys Val Asn Leu Gin Val Tyr Cys Ala

405 410 415

Trp Ser Leu Leu Asp Asn Phe Glu Trp Asn Gin Gly Tyr Ser Ser Arg 420 425 430

Phe Gly Leu Phe His Val Asp Phe Glu Asp Pro Ala Arg Pro Arg Val 435 440 445

Pro Tyr Thr Ser Ala Lys Glu Tyr Ala Lys lie lie Arg Asn Asn Gly 450 455 460

Leu Glu Ala His Leu 465

Sequence ID2 : Complete cDNA sequence of human liver cytosolic β- glucosidase, including 49 bases of 5 ' untranslated region and 650 bases of 3 ' untranslated region , with an additional 19 bases of the poly-A tail .

gtgctctgct tctggcagct gaagatccca gtagacagct tcttaaacca tggctttccc 60 tgcaggattt ggatgggcgg cagccactgc agcttatcaa gtagaaggag gctgggatgc 120 agatggaaaa ggcccttgtg tctgggacac atttactcat cagggaggag agagagtttt 180 caagaaccag actggcgatg tagcttgtgg cagctacact ctatgggagg aagatttgaa 240 atgtatcaaa cagcttggat tgactcatta ctcgttctct ctttcctggt cacgtctgtt 300 acctgatggg acaacaggtt tcatcaacca gaaaggaatt gattattaca acaagatcat 360 cgatgatttg ttaaaaaatg gcgttactcc cattgtgacc ctctaccact ttgatttgcc 420 tcagacttta gaagaccaag gaggttggtt gtcagaggca atcattgaat cctttgacaa 480 atatgctcag ttttgcttca gtacctttgg ggatcgtgtc aagcagtgga tcaccataaa 540 tgaagctaat gttctttctg tgatgtcata tgacttaggt atgtttcctc atgccagatc 600 tcactttggg actggaggtt atcaggcagc tcataatttg attaaggctc atgccagatc 660 ctggcacagc tatgattcct tatttcgaaa aaggcagaaa ggtatggtgt ctctatcact 720 ttttcccgct cggttggaac cagcagatcc caactcagtg tctgaccagg aagctgctaa 780 aagagccatc actttccatc tggatttatt tgctaaaccc atattcatcg atggtgatta 840 tcctgaagtt gtcaagtctc agattgcctc catgagtcaa aagcaaggct atccatcatc 900 gaggcttcca gaattcactg aagaagagaa gaaaatgatc aaaggcactg ctgatttttt 960 tgctgtgcaa tattatacaa ctcgcttaat caagtaccag gagaacaaga aaggagaact 1020 aggtactctc caggatgcgg aaattgaatt ttttccagat ccatcttgga aaaatgtgga 1080 ttggatctac gtggtaccat ggggagtatg taaactactg aaatatatta aggatacata 1140 taataaccct gtaatttaca tcactgagaa tgggtttccc cagagtgacc cagcgcctct 1200 tgatgacact caacgctggg agtatttcag acaaacattt caggaactgt tcaaagctat 1260 ccaacttgat aaagtcaatc ttcaagtata ttgtgcgtgg tctcttctgg ataactttga 1320 gtggaaccag ggatacagca gccggtttgg tctcttccac gttgattttg aagacccagc 1380 tagaccccga gtcccttaca catcggccaa ggaatatgcc aagatcatcc gaaacaatgg 1440 ccttgaagca catctgtagg caagatggct gagaaataca ggagaggcgt ctgcttttgg 1500 aaaggaaatc tgctttggtg atgatctttc aggcaatctc aacgttactt ctttaatcaa 1560 tatttaatat caatggatct gtgattaaaa ggtctgaata tgtaatgcct cgtgaagtat 1620 ttaataatgg cctttatttg tatttggatc aatgaggttt ttaaaaaaaa tggaagagaa 1680 aaccactaac cttgattttt gtattgcaaa atcagataga cctggaaaca taaatttaaa 1740 tccttagaca tttttctaga aaaaaatgca aagtttataa agatgataca accatgattt 1800 gcaactgtaa caggagacca tttattataa gcgtacctgt tttgtgaagc ttaattattc 1860 tgattccata agctgttttt gcttaggtga tccactgcca tgtgatccat aatttttcta 1920 cataaaaaat caagttaaaa agtcacatta tacagttatg cattcatttc aacaaaatag 1980 tgaattgata atctacttgt taatatattc ggcccatatt ttgtgtgttt ggacaaggta 2040 catctccctt ttgcctaatg aacttttgaa aaataataaa ataatagaat aaattagact 2100 ttgaatggca aaaaaaaaaa aaaaaaaa 2128

Sequence ID3 : Translated region of the CBG cDNA sequence (ID2) together with its corresponding encoded amino acid sequence (ID1) . This sequence region rush from base number 50 thru base number 1456, and includes all the amino acids. The stop codon begins at base number 1457.

atggctttccctgcaggatttggatgggcggcagccactgcagcttatcaagtagaagga 109 M A F P A G F G W A A A T A A Y Q V E G ggctgggatgcagatggaaaaggcccttgtgtctgggacacatttactcatcagggagga 169 G W D A D G K G P C V W D T F T H Q G G gagagagttttcaagaaccagactggcgatgtagcttgrggcagctacactctatgggag 229 E R V F K N Q T G D V A C G S Y T L W E gaagatttgaaatgtatcaaacagcttggattgactcattactcgttctctctttcctgg 289 E D L K C I K Q L G L T H Y S F S L S W tcacgtctgttacctgatgggacaacaggtttcatcaaccagaaaggaattgattattac 349 S R L L P D G T T G F I N Q K G I D Y Y

Aacaagatcatcgatgatttgttaaaaaatggggttactcccattgtgaccctctaccac 409 N K I I D D L L K N G V T P I V T L Y H tttgatttgcctcagactttagaagaccaaggaggttggtggtcagaggcaatcattgaa 469 F D L P Q T L E D Q G G W L S E A I I E tcctttgacaaatatgctcagttttgcttcagtacctttggggatcgtgtcaagcagtgg 529 S F D K Y A Q F C F S T F G D R V K Q W atcacca aaatgaagctaatgttctttctgtgatgtcatatgacttaggtatgtttcct 589 I T I N E A N V L S V M S Y D L G M F P ccgggtatccctcactttgggactggaggttatcaggcagctcataatttgattaaggct 649 P G I P H F G T G G Y Q A A H N L I K A catgccagatcctggcacagctatgattccttatttcgaaaaaggcagaaaggtatggtg 709 H A R S W H S Y D S L F R K R Q K G M V tctctatcactttttcccgctcggttggaaccagcagatcccaactcagtgtctgaccag 769 S L S L F P A R L E P A D P N S V S D Q gaagctgctaaaagagccatcactttccatctggatttatttgctaaacccatattcatc 829 E A A K R A I T F H L D L F A K P I F I gatggtgattatcctgaagttgtcaagtctcagattgcctccatgagtcaaaagcaaggc 889 D G D Y P E V V K S Q I A S M S Q K Q G tatccatcatcgaggcttccagaattcactgaagaagagaagaaaatgatcaaaggcact 949

Y P S S R L P E F T E E E K K M I K G T gctgatttttttgctgtgcaatattatacaactcgcttaatcaagtaccaggagaacaag 1009 A D F F A V Q Y Y T T R L I K Y Q E N K aaaggagaactaggtactctccaggatgcggaaattgaattttttccagatccatcttgg 1069 K G E L G T L Q D A E I E F F P D P S W aaaaatgtggattggatctacgtggtaccatggggagtatgtaaactactgaaatatatt 1129 K N V D W I Y V V P W G V C K L L K Y I aaggatacatataataaccctgtaatttacatcactgagaatgggtttccccagagtgac 1189 K K T Y N N P V I Y I T E N G F P Q S D ccagcgcctcttgatgacactcaacgctgggagtatttcagacaaacatttcaggaactg 1249 P A P L D D T Q R W E Y F R Q T F Q E L ttcaaagctatccaacttgataaagtcaatcttcaagtatattgtgcgtggtctcttctg 1309 F K A I Q L D K V N L Q V Y C A W S L L gataactttgagtggaaccagggatacagcagccggtttggtctcttccacgttgatttt 1369 D N F E W N Q G Y S S R F G L F H V D F gaagacccagctagaccccgagtcccttacacatcggccaaggaatatgccaagatcatc 1429 E D P A R P R V P Y T S A K E Y A K I I cgaaacaatggccttgaagcacatctg 1456

R N N G L E A H L

Claims

WHAT IS CLAIMED IS:

1. Recombinant cDNA according to Sequence ID 2 or a polynucleotide or oligonucleotide portion thereof.

2. Human liver cytosolic ╬▓-glucosidase (CBG) or a polypeptide or oligopeptide portion thereof according to Sequence ID 1.

3. The human liver CBG of Claim 2, encoded by bases 50 to 1456 of the recombinant cDNA of Sequence ID 2.

4. An antigenic polypeptide or oligopeptide portion of the human liver CBG of Claim 2.

5. An antibody to an antigenic polypeptide or oligopeptide according to Claim 4.

6. An antibody according to Claim 5, which is a monoclonal antibody.

7. A cDNA insert comprising an expression vector ligated to recombinant cDNA according to Sequence ID 2 or a polynucleotide or oligonucleotide portion thereof.

8. The cDNA insert of Claim 7 wherein the expression vector is a plasmid.

9. An immunoassay for detecting human liver CBG in a sample comprising contacting the sample with an antibody specific to human liver and detecting antigen/antibody complex.

10. The immunoassay of Claim 9, wherein the antibody is a monoclonal antibody.

11. The immunoassay of Claim 9, wherein the Sample is a serum sample.

12. The immunoassay of Claim 9, wherein the Sample is a tissue sample.

13. A method for evaluating ischemic liver injury in human liver transplantation comprising quantitating the activity of human liver CBG in the serum of the recipient.

14. The method of Claim 13, wherein human liver CBG activity is quantitated in an enzymatic assay and confirmed in an immunoassay according to Claim 9.