WO1999002699A1 - Molecules de proteine kinase kds et utilisations de ces molecules - Google Patents

Molecules de proteine kinase kds et utilisations de ces molecules Download PDF

Info

Publication number
WO1999002699A1
WO1999002699A1 PCT/US1998/014231 US9814231W WO9902699A1 WO 1999002699 A1 WO1999002699 A1 WO 1999002699A1 US 9814231 W US9814231 W US 9814231W WO 9902699 A1 WO9902699 A1 WO 9902699A1
Authority
WO
WIPO (PCT)
Prior art keywords
kds
protein
nucleic acid
seq
acid molecule
Prior art date
Application number
PCT/US1998/014231
Other languages
English (en)
Inventor
Christopher M. Pleiman
Gary L. Johnson
Original Assignee
Cadus Pharmaceutical Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cadus Pharmaceutical Corporation filed Critical Cadus Pharmaceutical Corporation
Priority to AU82966/98A priority Critical patent/AU8296698A/en
Publication of WO1999002699A1 publication Critical patent/WO1999002699A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • Certain biological functions are tightly regulated by signal transduction pathways within cells.
  • Signal transduction pathways maintain the balanced steady state functioning of a cell.
  • Disease states can arise when signal transduction in a cell breaks down, thereby removing the tight control that typically exists over cellular functions. For example, tumors develop when regulation of cell growth is disrupted enabling a clone of cells to expand indefinitely.
  • signal transduction networks regulate a multitude of cellular functions depending upon the cell type, a wide variety of diseases can result from abnormalities in such networks. Devastating diseases such as cancer, autoimmune diseases, allergic reactions, inflammation, neurological disorders and hormone-related diseases can result from abnormal signal transduction.
  • Ste 20 In the field of signal transduction, one family of protein kinases originally identified in yeast cells, the Ste 20 family, is of particular interest. This family of kinases has been expanded greatly during evolution (Hunter and Plowman. 1997. TIBS 22: 18). Ste 20 has been shown to be a target for the ⁇ subunits of the S. cerevisiae G protein linking the pheromone response pathway to transcription activation via a kinase cascade (Leberer et al. 1992. EMBO 11 :21).
  • Ste 20 is a kinase which is activated by Cdc42 and which has been shown to be upstream of STE 11 , Ste7, Fus3, and KSS 1 and the transcription factor Ste 12 in the yeast pheromone pathway (Herskowitz. 1995. Cell 80:187; Simon et al. 1995. 376:702; Ramer and Davis . 1993 Proc. NatI. Acad. Sci. USA 90:452; Errede and Levin. 1993. Curr. Opin. Cell Biol. 5:254). Other components of this yeast pheromone signal transduction pathway have also been found to have homology to mammalian proteins.
  • MAP kinase kinase has some homology to MAP kinase kinase and Fus3 and Kssl are yeast homologs of MAP kinase (MAPK) (Errede et al. supra).
  • MAPKs appear to integrate multiple intracellular signals transmitted by various second messengers and regulate the activity of enzymes and transcription factors.
  • One class is similar to Saccharomyces cerevisiae HOG1 kinase (Han et al. Science 265:808, 1994) and includes: MAPK, (also called ERKs) such as p42, p44, ERK1, ERK2.
  • the other class is closely related to yeast enzymes activated by cellular stress, the SAPKs (Kyriakis et al. Nature 369:156, 1994) and includes: JNKl, JNK2, p38, and SAPK.
  • the JNKs are thought to be responsible for phosphorylating the cJun protein and, thus, activating AP-1.
  • Rac and Cdc42 have been found to bind to and stimulate certain Ste 20 related molecules, such as the p21 -activated kinases (PAKs) of vertebrates (Zhang et al. 1995. J. Biol. Chem. 270:23934).
  • PAKs p21 -activated kinases
  • Rho and Cdc 42 are members of the Rho family of small GTP binding proteins with molecular weights of approximately 21 kD and are a key part of a signaling pathway which links cell surface receptor stimulation to JNK activation (Coso et al. Cell. 81 :1137; Manser et al. 1994. Nature 367:40; Martin et al. 1995. 14:1970).
  • Constitutively active forms of Rac and Cdc 42 have been shown activate a MAP kinase, the c-Jun kinase JNK/SAPK (c-Jun NH2- terminal kinase/stress-activated protein kinase ( Olsen et al. 1995. Science. 269:1270).
  • Rho-family of proteins regulate the organization of the actin cytoskeleton with Rac regulating actin filament accumulation at the cell surface, which produces membrane ruffling and lamellipodia, chemotaxis, and Cdc 42 stimulating the formation of filopodia.
  • Rho family member GTP-binding controls cytoskeleton functions including actin polymerization, chemotaxis, filopodia and lamellipodia formation, secretion, mitogenesis, and apoptosis.
  • Rho, Rac, and Cdc42 have also been implicated in cell cycle progression through Gl (Olsen et al. 1995. Science. 269:1270). Additionally, components of the neutrophil oxidase (p67phox and p47phox) have been described as targets for PAK's, linking them in the superoxide anion production pathway.
  • KDS KDS protein sequence related to that of Ste20
  • the KDS molecules of the present invention have kinase activity and, thus, are useful as modulating agents in regulating a variety of cellular processes.
  • the nucleotide sequence of KDS 1 and the predicted amino acid sequence of KDS 1 are shown in SEQ ID NO: 1 and 2, respectively.
  • the nucleotide sequence of KDS2 and the predicted amino acid sequence of KDS2 are shown in SEQ ID NO: 3 and 4, respectively.
  • human KDS1 indicates that a 4.6 kb mRNA transcript is expressed in all tissues in low levels, with highest levels found in spleen, testis, and prostate (tissues tested includes: spleen, thymus, prostate, testis, ovary, small intestine, colon, PBL, heart, brain, lung, liver, skeletal muscle, kidney, and pancreas).
  • Analysis of human KDS2 indicates that a 4.5 kb mRNA transcript is expressed at highest levels in lung, followed by PBLs, small intestine, spleen, and thymus.
  • isolated nucleic acid molecules e.g., cDNAs
  • isolated nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 1 or 3, or the coding region thereof, or encodes the amino acid sequence of SEQ ID NO: 2 or 4.
  • the isolated nucleic acid molecule encodes a protein which comprises an amino acid sequence at least 70 % homologous to the amino acid sequence of SEQ ID NO: 2 or 4 and having serine/threonine kinase activity.
  • the protein is at least 80 %, more preferably at least 90 %, even more preferably at least 95 % homologous to the amino acid sequence of SEQ ID NO: 2 or 4.
  • the invention provides an isolated nucleic acid molecule encoding a protein which: (i) comprises a serine-threonine rich kinase domain at least 50% identical to the kinase domain of Ste20, (ii) comprises at least five glutamine-repeat sequences, wherein each glutamine repeat sequence independently comprises the amino acid sequence Q-X ⁇ -Q (SEQ ID NO:19)or Q-X ⁇ Q-Q (SEQ ID NO:20), wherein Q is glutamine and X is any amino acid; (iii) lacks a crib consensus motif; and (iv) has kinase activity.
  • the protein comprises at least seven glutamine-repeat sequences.
  • the protein comprises at least ten glutamine-repeat sequences.
  • the invention provides an isolated nucleic acid molecule encoding a KDS protein kinase, wherein the sequence is (a) a nucleic acid sequence having the coding region of a KDS as set forth in SEQ ID 1 or 3; (b) a nucleic acid sequence having a sequence that hybridizes at high stringency to SEQ ID NO: 1 or 3 and which encodes a polypeptide having kinase activity; or (c) a nucleic acid sequence differing from the sequences of (a) and (b), which encodes a polypeptide encoded by the sequence of (a) or (b).
  • the invention also provides an isolated nucleic acid molecule at least 350 nucleotides in length which hybridizes under stringent conditions to a second nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, or the complement thereof.
  • the invention still further provides an isolated nucleic acid molecule at least 20 nucleotides in length which hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 3, or the complement thereof
  • these nucleic acid molecules comprise a naturally-occurring nucleotide sequence. Even more preferably, these nucleic acid molecules encode a protein having kinase activity.
  • Such isolated nucleic acid fragments can be used as probes and/or primers.
  • the probe/primer further includes a label, which is capable of being detected.
  • the disclosed nucleic acid molecules can be non-coding, (e.g. probe, antisense or ribozyme molecules) or can encode a functional KDS protein (e.g. a protein which specifically modulates, e.g., by acting as either an agonist or antagonist, at least one bioactivity of a human KDS protein).
  • a KDS nucleic acid molecule includes the entire coding region of SEQ ID NO: 1 or 3.
  • the subject KDS nucleic acids can include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter (for constitutive expression or inducible expression) or transcriptional enhancer sequence operatively linked to the KDS gene sequence.
  • a transcriptional promoter for constitutive expression or inducible expression
  • transcriptional enhancer sequence operatively linked to the KDS gene sequence.
  • Such regulatory sequences in conjunction with a KDS nucleic acid molecules can be useful vectors for gene expression.
  • an expression vector contains a KDS nucleic acid molecule operatively linked to a transcriptional regulatory sequence.
  • an expression vector of the present invention is capable of replicating in a cell.
  • This invention also describes host cells transfected with expression vectors
  • the method comprises culturing a host cell containing a
  • the present invention also provides for a recombinant transfection system, containing a KDS nucleic acid which is operatively linked to a transcriptional regulatory sequence, which allows for transcription in eukaryotic cells and a gene delivery composition which allows for cells to be transfected with the KDS gene.
  • the invention features isolated KDS proteins, preferably substantially pure preparations, e.g. of purified or recombinantly produced KDS proteins.
  • the protein is identical to or similar to a KDS protein represented in
  • the protein is at least about 70% homologous to a KDS protein shown in SEQ ID No. 2 or 4. More preferably, the protein is at least about 80%, 90% or 95% homologous to a KDS protein shown in SEQ ID NO: 2 or 4.
  • the KDS protein can comprise a full length protein, such as represented in SEQ ID No. 2 or 4, or it can comprise a fragment corresponding to one or more particular motifs/domains, or to arbitrary sizes, e.g., at least about 5, 10, 25, 50, 100, 150 or 200 amino acids in length.
  • the KDS protein includes a portion of a domain.
  • KDS chimeric molecules e.g. fusion proteins
  • the KDS protein can be provided as a recombinant fusion protein which includes a second protein portion, e.g., a second protein having an amino acid sequence unrelated (heterologous) to the KDS protein.
  • a fusion protein of the present invention contains a detectable label (e.g., a radiolabel) or a matrix binding domain (e.g., glutathione-S-transferase that binds to a glutathione- agarose matrix).
  • a detectable label e.g., a radiolabel
  • a matrix binding domain e.g., glutathione-S-transferase that binds to a glutathione- agarose matrix.
  • an immunogen comprising a detectable label (e.g., a radiolabel) or a matrix binding domain (e.g., glutathione-S-transferase that binds
  • the immunogen being capable of eliciting an immune response specific for a KDS protein; e.g. a humoral response, an antibody response and/or cellular response.
  • the immunogen comprises an antigenic determinant, e.g. a unique determinant, from the protein represented by SEQ ID No. 2 or SEQ ID NO: 4.
  • a still further aspect of the present invention features antibodies and antibody preparations specifically reactive with an epitope of the KDS protein.
  • the antibody specifically binds to an epitope represented in SEQ ID NO: 2 or 4.
  • Polyclonal and monoclonal an -KDS antibodies are encompassed by the invention.
  • the invention further provides methods for detecting KDS activity in a biological sample.
  • the method comprises: contacting a biological sample with an agent capable of detecting an indicator of KDS activity such that the presence of KDS activity is detected in the biological sample.
  • the agent that detects an indicator of KDS activity can detect, for example, a KDS mRNA (e.g., the agent can be a nucleic acid probe that hybridizes to a KDS mRNA).
  • the agent can detect a KDS protein (e.g., the agent can be an antibody that specifically binds to a KDS protein).
  • the method comprises contacting the cell with an agent that modulates KDS activity such that KDS activity in the cell is modulated.
  • the agent inhibits KDS activity.
  • KDS inhibitory agents include antisense nucleic acids, ribozymes and intracellular antibodies.
  • the agent stimulates KDS activity.
  • KDS stimulatory agents include nucleic acid molecules encoding active KDS proteins and the active KDS proteins themselves.
  • the agent modulates the activity of a KDS protein (e.g. , the agent can be an antibody that specifically binds to the KDS protein).
  • the agent modulates transcription of a KDS gene or translation of a KDS mRNA (e.g. , the agent can be a nucleic acid molecule having a nucleotide sequence that is antisense to the coding strand of the KDS mRNA or the KDS gene).
  • the invention provides assays, e.g., screening tests, to identify KDS modulating agents.
  • modulating agents which are inhibitors, or alternatively, potentiators, of KDS kinase activity can be identified and selected.
  • the screening assay identifies compounds that modulate the kinase activity of a KDS protein.
  • the invention provides a method comprising: providing a indicator composition comprising a KDS protein having KDS kinase activity; contacting the indicator composition with a test compound; and determining the effect of the test compound on KDS kinase activity in the indicator composition to thereby identify a compound that modulates the kinase activity of a KDS protein.
  • a statistically significant change, such as a decrease or increase, in the level of KDS kinase activity in the presence of the test compound (relative to what is detected in the absence of the test compound) is indicative of the test compound being a KDS modulating agent.
  • the indicator composition can be, for example, a cell or a cell extract.
  • KDS kinase activity is assessed by measuring autophosphorylation of the KDS protein.
  • a further aspect of the present invention provides a method of determining if a subject is at risk for a disorder characterized by at least one of (i) aberrant modification or mutation of a gene encoding a KDS protein, and (ii) mis-expression of a KDS gene.
  • detecting the genetic lesion includes ascertaining the existence of at least one of: a deletion of one or more nucleotides from a KDS gene; an addition of one or more nucleotides to the gene, a substitution of one or more nucleotides of the gene, a gross chromosomal rearrangement of the gene; an alteration in the level of a messenger RNA transcript of the gene; the presence of a non-wild type splicing pattern of a messenger RNA transcript of the gene; a non-wild type level of the protein; and/or an aberrant level of KDS protein.
  • a KDS probe of the present invention is combined with the nucleic acid of a cell and hybridization of the probe to the nucleic acid is determined.
  • the invention also features transgenic non-human animals which include a heterologous form of a KDS gene, so that expression of KDS is enhanced or induced, or which misexpress an endogenous KDS gene (e.g., an animal in which expression of one or more of the subject KDS proteins is disrupted, prevented or suppressed).
  • Figure 1 shows an alignment of Ste-20-related kinases and the primers used for amplification of KDS.
  • Figure 2 shows an alignment of KDS 1 and KDS 2.
  • Bold letters indicate identical amino acids.
  • Capital letters indicate amino acids which are similar, i.e., conserved in character.
  • Lower case letters indicate dissimilar amino acids.
  • Figure 3 shows an alignment of Ste-20-related kinases and indicates the eleven regions conserved in protein kinases.
  • the present invention relates to nucleic acid molecules, KDS proteins, antibodies immunoreactive with KDS proteins, and preparations of such compositions.
  • drug discovery assays are provided for identifying other agents which can modulate the biological function of KDS proteins.
  • modulating agents are useful in modulating signal transduction in a cell.
  • KDS modulating agents may be small organic molecules, peptides or peptidomimetics, lipids, carbohydrates, or nucleic acids.
  • the present invention provides diagnostic and therapeutic assays and reagents for detecting and treating disorders involving, for example, aberrant expression of mammalian KDS genes. Other aspects of the invention are described below or will be apparent to those skilled in the art in light of the present disclosure.
  • nucleic acid molecules that encode KDS or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes to identify AJ ⁇ S-encoding nucleic acid (e.g., KDS mRNA).
  • nucleic acid molecule is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA).
  • the nucleic acid molecule may be single-stranded or double-stranded, but preferably is double-stranded DNA.
  • an "isolated" nucleic acid molecule is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • the isolated KDS nucleic acid molecule may contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived (e.g., a human splenocyte).
  • an "isolated" nucleic acid molecule such as a cDNA molecule, may be free of other cellular material.
  • an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO: 1 or 3.
  • the sequence of SEQ ID NO: 1 corresponds to the human KDS 1 cDNA and the sequence of SEQ ID NO:3 corresponds to human KDS 2 cDNA.
  • cDNAs comprise sequences encoding the KDS protein (i.e., "the coding region", from nucleotides 346-3047 of SEQ ID NO:l or from nucleotides 323-2544 of SEQ ID NO:3), as well as 5' untranslated sequences (nucleotides 1 to 345 of SEQ ID NO:l or nucleotides 1-322 of SEQ ID NO:3) and 3' untranslated sequences (nucleotides 3048-4203 of SEQ ID NO: l or nucleotides 2545- 2594 of SEQ ID NO:3).
  • the coding region from nucleotides 346-3047 of SEQ ID NO:l or from nucleotides 323-2544 of SEQ ID NO:3
  • 5' untranslated sequences nucleotides 1 to 345 of SEQ ID NO:l or nucleotides 1-322 of SEQ ID NO:3
  • 3' untranslated sequences nucleotides 3048-4203 of S
  • the nucleic acid molecule may comprise only the coding region of SEQ ID NO: 1 or 3 (e.g., nucleotides 346-3047 or nucleotided 323- 2544, respectively).
  • the nucleic acid molecule of the invention can comprise only a portion of the coding region of SEQ ID NO: 1 or 3, for example a fragment encoding a biologically active portion of KDS .
  • biologically active portion of KDS is intended to include portions of KDS that retain the ability to phorylate substrates on serine and/or threonine residues.
  • the kinase activity of portions of KDS can be determined in standard in vitro kinase assays, for example by measuring autophosphorylation (described further below and in Example 4).
  • Nucleic acid fragments encoding biologically active portions of KDS can be prepared by isolating a portion of SEQ ID NO: 1 , expressing the encoded portion of KDS protein or peptide (e.g., by recombinant expression in vitro) and assessing the kinase activity of the encoded portion of KDS protein or peptide.
  • an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO: 2 or 4.
  • the invention encompasses nucleic acid molecules that encode biologically active portions of SEQ ID NO: 2 or 4.
  • a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:l or 3, or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein.
  • a human KDS cDNA can be isolated from, e.g., a peripheral blood cell cDNA library using all or portion of SEQ ID NO: 1 or 3 as a hybridization probe and standard hybridization techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989).
  • a nucleic acid molecule encompassing all or a portion of SEQ ID NO: 1 or 3 can be isolated by the polymerase chain reaction using oligonucleotide primers designed based upon the sequence of SEQ ID NO: 1 or 3.
  • mRNA can be isolated from normal PBLs (e.g., by the guanidinium- hiocyanate extraction procedure of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and cDNA can be prepared using reverse transcriptase (e.g., Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Russia, FL).
  • reverse transcriptase e.g., Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Russia, FL.
  • Synthetic oligonucleotide primers for PCR amplification can be designed based upon the nucleotide sequence shown in SEQ ID NO: 1.
  • primers suitable for amplification of the segment of SEQ ID NO: 1 encoding amino acid residues 22 to 149 are shown in SEQ ID NOs: 3 and 4.
  • a nucleic acid of the invention can be amplified using cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques.
  • the nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
  • oligonucleotides corresponding to a KDS nucleotide sequence can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
  • DNA sequence polymorphisms that lead to changes in the amino acid sequences of KDS may exist within a population (e.g., the human population).
  • Such genetic polymorphism in the KDS gene may exist among individuals within a population due to natural allelic variation. Any and all such nucleotide variations and resulting amino acid polymorphisms in KDS that are the result of natural allelic variation and that do not alter the functional activity of KDS are intended to be within the scope of the invention.
  • nucleic acid molecules encoding KDS proteins from other species are intended to be within the scope of the invention.
  • a KDS nucleic acid is at least about 70% homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3 or its complement.
  • a preferred embodiment of KDS nucleic acid is at least about 80%).
  • a KDS nucleic acid is at least about 90% homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3.
  • KDS nucleic acid is at least about 95% homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3. In a more preferred embodiment of KDS nucleic acid is at least about 98-99% homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3. In particularly preferred embodiments a KDS nucleic acid sequence is identical to the nucleotide sequence of SEQ ID NO: 1 or 3.
  • Nucleic acid molecules corresponding to natural allelic variants and nonhuman homologues of the human KDS cDNAs of the invention can be isolated based on their homology to the human KDS nucleic acid disclosed herein using the human cDNA, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions. Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention is at least 350 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1.
  • an isolated nucleic acid molecule of the invention is at least 20 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 3.
  • the nucleic acid is at least 300, 350, 500, or 1000 nucleotides in length for SEQ ID NO:l or 30, 50, 100, 250, or 500 nucleotides in length for SEQ ID NO:3.
  • the probe further contains a label group and can be detected, e.g. the label group can be a radioisotope, fluorescent compound, enzyme, or enzyme co-factor.
  • Probes based on the subject KDS sequences can also be used to detect transcripts or genomic sequences encoding the same or homologous proteins.
  • the probes of the present invention can also be used as a part of a diagnostic test kit for identifying cells or tissues which misexpress a KDS protein, such as by measuring a level of a ATDS-encoding nucleic acid in a sample of cells from a patient; e.g. detecting KDS mRNA levels or determining whether a genomic KDS gene has been mutated or deleted.
  • nucleotide probes can be generated from the subject KDS genes which facilitate histological screening of intact tissue and tissue samples for the presence (or absence) of AX>S-encoding transcripts.
  • the use of probes directed to KDS messages, or to genomic KDS sequences can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in certain disorders.
  • the oligonucleotide probes can help facilitate the determination of the molecular basis for a disorder which may involve some abnormality associated with expression (or lack thereof) of a KDS protein. For instance, variation in protein synthesis can be differentiated from a mutation in a coding sequence.
  • hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60 % homologous to each other typically remain hybridized to each other.
  • the conditions are such that at least sequences at least 65 %, more preferably at least 70 %, and even more preferably at least 75 % homologous to each other typically remain hybridized to each other.
  • stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
  • a preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65°C.
  • an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO: 1 or 3 corresponds to a naturally-occurring nucleic acid molecule.
  • a "naturally-occurring" nucleic acid molecule refers to an
  • RNA or DNA molecule having a nucleotide sequence that occurs in nature e.g., encodes a natural protein.
  • the nucleic acid encodes a natural vertebrate KDS.
  • the nucleic acid encodes a human KDS .
  • the nucleic acid molecule encodes a murine homologue of human KDS.
  • changes may be introduced by mutation into the nucleotide sequence of SEQ ID NO: 1 or 3, thereby leading to changes in the amino acid sequence of the encoded KDS protein, without altering the functional ability of the KDS protein.
  • nucleotide substitutions leading to amino acid substitutions at "non-essential” amino acid residues may be made in the sequence of SEQ ID NO: 1 or 3.
  • a "non-essential” amino acid residue is a residue that can be altered from the wild-type sequence of KDS (e.g., the sequence of SEQ ID NO: 2 or 4) without altering the kinase activity of KDS, whereas an "essential" amino acid residue is required for KDS kinase activity.
  • KDS amino acid residues of KDS that are strongly conserved among members of the KDS family (or among KDS molecules and other STE-20 related molecules) are predicted to be essential in KDS and thus are not likely to be amenable to alteration, for example, any of the eleven regions present in the KDS molecules that are conserved among protein kinases are not likely to be amenable to substitution.
  • These eleven conserved kinase domains are known in the art and are described in Methods in Enzymology, vol. 200 "Protein Kinases: Assays, purification, antibodies, functional analysis, cloning and expression" Hunter and Sefton, Eds. These eleven conserved regions of KDS 1 and KDS2 are illustrated in Figure 3.
  • the KDS proteins also comprise other domains, namely Q-X9-Q and Q-XJ Q-Q repeat sequences (where Q is glutamine and X is any amino acid) similar to those found in involucrin. Moreover, KDS proteins lack the crib consensus domain, I-S-X-P-(X)2_4- F-X-H-X-X-H-V-G (SEQ ID NO: 14) (Burbelo et al. 1995. J. Biol. Chem. 270:29071) found in other Ste20 related kinases, such as PAK 65. Computer analysis of the secondary structure of the carboxy-terminus of KDS 1 and KDS2 predicts that 95% of this part of the molecules is strongly ⁇ -helical.
  • Involucrin is characterized by a central segment composed of 39 tandem repeats of 10 amino acids each, which include the regularly recurring sequence EQQEGQL (SEQ ID NO: 15). Neither human KDS1 nor KDS2 contain this motif and the homology between these two proteins and involucrin is solely based on the high glutamine and glutamate composition.
  • the role of the Q-X9-Q eleven and Q-XJ Q-Q twelve amino acid repeat sequences found in the carboxy-terminus of KDS 1 and KDS2 may play a role in covalently localizing these proteins to specific sites within the cell, which may be necessary for function, and thus they may not be amenable to substitution.
  • KDS2 amino acid sequence comprises a string of glutamic acid residues shown in amino acids 378-393 of SEQ ID NO:2.
  • another aspect of the invention pertains to nucleic acid molecules encoding KDS proteins that contain changes in amino acid residues that are not essential for kinase activity , e.g., residues that are not conserved or only semi-conserved between KDS1 and KDS2.
  • KDS proteins differ in amino acid sequence from SEQ ID NO: 2 or 4 yet retain kinase activity.
  • the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least 70 % homologous to the amino acid sequence of SEQ ID NO: 2 or 4 and having a kinase activity.
  • the protein encoded by the nucleic acid molecule is at least 80 % homologous to SEQ ID NO: 2 or 4, more preferably at least 90 % homologous to SEQ ID NO: 2 or 4, even more preferably at least 95 % homologous to SEQ ID NO: 2 or 4.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the sequence of one protein for optimal alignment with the other protein).
  • the amino acid residues at corresponding amino acid positions are then compared.
  • a position in one sequence e.g., SEQ ID NO: 2 or 4
  • the molecules are homologous at that position (i.e., as used herein amino acid "homology" is equivalent to amino acid identity or similarity).
  • an amino acid residue is "similar" to another amino acid residue if the two amino acid residues are members of the same family of residues having similar side chains. Families of amino acid residues having similar side chains have been defined in the art (see, for example, Altschul et al. 1990. J. Mol. Biol.
  • 215:403 including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • Alignment strategies are well known in the art; see, for example, Altschul et al. supra for optimal sequence alignment.
  • An isolated nucleic acid molecule encoding a KDS protein homologous to the protein of SEQ ID NO: 2 or 4 can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO: 1 or 3 such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into SEQ ID NO: 1 or 3 by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non- essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta- branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic
  • a predicted nonessential amino acid residue in KDS is preferably replaced with another amino acid residue from the same side chain family.
  • mutations can be introduced randomly along all or part of a KDS coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for proteolytic activity to identify mutants that retain proteolytic activity.
  • the encoded protein can be expressed recombinantly (e.g., as described in Example 5) and the kinase activity of the protein can be determined.
  • Cos cells can be transfected with expression vectors containing portions of KDS proteins or mutant KDS proteins which have been tagged (e.g., with an HA epitope). Cells are lysed in buffer and cleared of particulate matter by centrifugation. HA-tagged protein can be immunoprecipitated onto beads and, after appropriate washing steps, the the beads are incubated in kinase buffer containing 32P[ ⁇ ATP]. After removing free ATP, samples are resolved by SDS PAGE. After blotting onto a membrane, autoradiography can be used to detect phosphorylated proteins.
  • the invention provides an isolated nucleic acid molecule encoding a KDS protein kinase, wherein the sequence is (a) a nucleic acid sequence having the coding region of a KDS as set forth in SEQ ID 1 or 3; (b) a nucleic acid sequence having a sequence that hybridizes at high stringency to SEQ ID NO: 1 or 3 and which encodes a polypeptide having kinase activity; or (c) a nucleic acid sequence differing from the sequences of (a) and (b), which encodes a polypeptide encoded by the sequence of (a) or (b).
  • the nucleic acid molecules of (a) and (b) are discussed above.
  • the invention also relates to nucleic acid sequences which comprise the coding region of SEQ ID NO: 1 or 3 or which encode KDS molecules which can be identified based on their ability to hybridize under high stringency conditions to the sequence shown in SEQ ID NO:l or 3, but may subsequently modified such that they have a differing nucleotide sequence yet still encode the same polypeptide.
  • KDS nucleic acid molecule For example, once a KDS nucleic acid molecule is identified based on hybridization to a KDS of SEQ ID NO:l or 3, modifications can be made to the third, or wobble, position of one or more codons such that the modified nucleic acid molecule still encodes a functional KDS protein (due to degeneracy of the genetic code), but may no longer hybridize to the sequence shown in SEQ ID NO:l or 3.
  • Such changes to KDS nucleic acid molecules can be made using standard techniques known in the art, for example by site directed mutagenesis or PCR-mediated mutagenesis.
  • antisense therapy refers to administration or in situ generation of oligonucleotide molecules or their derivatives which specifically hybridize (e.g. bind) under cellular conditions, with the cellular mRNA and/or genomic DNA encoding one or more of the subject KDS proteins so as to inhibit expression of that protein, e.g. by inhibiting transcription and/or translation.
  • the binding may be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix.
  • antisense refers to the range of techniques generally employed in the art, and includes any therapy which relies on specific binding to oligonucleotide sequences.
  • an antisense construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes a mammalian KDS protein.
  • the antisense construct is an oligonucleotide probe which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of a mammalian KDS gene.
  • Such oligonucleotide probes are preferably modified oligonucleotides which are resistant to endogenous nucleases, e.g.
  • nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patents 5,176,996; 5,264,564; and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) Biotechniques 6:958-976; and Stein et al. (1988) Cancer Res 48:2659-2668.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to KDS mRNA.
  • the antisense oligonucleotides will bind to the KDS mRNA transcripts and prevent translation. Absolute complementarity, although preferred, is not required.
  • a sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex. In the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Oligonucleotides that are complementary to the 5' end of the message should work most efficiently at inhibiting translation. However, sequences complementary to the 3' untranslated sequences of mRNAs may also be used. (Wagner, R. 1994. Nature 372:333). Therefore, oligonucleotides complementary to either the 5' or 3' untranslated, non-coding regions of a KDS gene could be used in an antisense approach to inhibit translation of endogenous KDS mRNA. Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
  • Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5', 3' or coding region of KDS mRNA, antisense nucleic acids should be at least about six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In certain embodiments, the oligonucleotide is at least about 10 nucleotides, at least about 17 nucleotides, at least about 25 nucleotides, or at least about 50 nucleotides.
  • in vitro studies are first performed to quantitate the ability of the antisense oligonucleotide to quantitate the ability of the antisense oligonucleotide to inhibit gene expression. It is preferred that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of oligonucleotides. It is also preferred that these studies compare levels of the target RNA or protein with that of an internal control RNA or protein. Results obtained using the antisense oligonucleotide can be compared with those obtained using a control oligonucleotide.
  • control oligonucleotide is of approximately the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differs from the antisense sequence no more than is necessary to prevent specific hybridization to the target sequence.
  • the oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. NatI. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. NatI. Acad. Sci. 84:648-652; PCT Publication No. W088/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134, published April 25, 1988), hybridization-triggered cleavage agents.
  • peptides e.g., for targeting host cell receptors in vivo
  • agents facilitating transport across the cell membrane see, e.g., Letsinger et al., 1989, Proc. NatI. Acad. Sci. U.S.
  • the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
  • antisense nucleotides complementary to the KDS coding region sequence could be used, those complementary to the transcribed untranslated region are most preferred.
  • the antisense molecules can be delivered to cells which express the KDS in vivo or in vitro.
  • a number of methods have been developed for delivering antisense DNA or RNA to cells; e.g., antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g., antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically.
  • a preferred approach utilizes a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter.
  • the use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of single stranded RNAs that will form complementary base pairs with the endogenous KDS transcripts and thereby prevent translation of the KDS mRNA.
  • a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA.
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art.
  • Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells.
  • Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive.
  • Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. NatI. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al,
  • Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct which can be introduced directly into the tissue site; e.g., the choroid plexus or hypothalamus.
  • viral vectors can be used which selectively infect the desired tissue; (e.g., for brain, herpesvirus vectors may be used), in which case administration may be accomplished by another route (e.g., systemically).
  • Ribozyme molecules designed to catalytically cleave KDS mRNA transcripts can also be used to prevent translation of KDS mRNA and expression of KDS.
  • hammerhead ribozymes The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988, Nature, 334:585-591.
  • ribozyme There are numerous potential hammerhead ribozyme cleavage sites within the nucleotide sequence of human KDS cDNA.
  • the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the KDS mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
  • Ribozymes of the present invention also include RNA endoribonucleases
  • Cech-type ribozymes such as the one which occurs naturally in Tetrahymena Thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-578; Zaug and Cech, 1986, Science, 231:470-475; Zaug, et al., 1986, Nature, 324:429-433; published International patent application No. WO 88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47:207-216).
  • the Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place.
  • the invention encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present in KDS.
  • the ribozymes can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express a KDS in vivo.
  • a preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous KDS and inhibit translation. Because ribozymes, unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
  • Endogenous KDS gene expression can also be reduced by inactivating or "knocking out" the KDS gene or its promoter using targeted homologous recombination, (e.g., see Smithies et al., 1985, Nature 317:230-234; Thomas & Capecchi, 1987, Cell 51 :503-512; Thompson et al., 1989 Cell 5:313-321; each of which is incorporated by reference herein in its entirety).
  • targeted homologous recombination e.g., see Smithies et al., 1985, Nature 317:230-234; Thomas & Capecchi, 1987, Cell 51 :503-512; Thompson et al., 1989 Cell 5:313-321; each of which is incorporated by reference herein in its entirety).
  • a mutant, non-functional KDS flanked by DNA homologous to the endogenous KDS gene (either the coding regions or regulatory regions of the KDS gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express KDS in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the KDS gene.
  • Such approaches are particularly suited in the generation of animal offspring with an inactive KDS (e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra). However this approach can be adapted for use in humans provided appropriate delivery means are used.
  • endogenous KDS gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the KDS gene (i.e., the KDS promoter and/or enhancers) to form triple helical structures that prevent transcription of the KDS gene in target cells in the body.
  • deoxyribonucleotide sequences complementary to the regulatory region of the KDS gene i.e., the KDS promoter and/or enhancers
  • Nucleic acid molecules to be used in triple helix formation for the inhibition of transcription are preferably single stranded and composed of deoxyribonucleotides.
  • the base composition of these oligonucleotides should promote triple helix formation via Hoogsteen base pairing rules, which generally require sizable stretches of either purines or pyrimidines to be present on one strand of a duplex.
  • Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC triplets across the three associated strands of the resulting triple helix.
  • the pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand.
  • nucleic acid molecules may be chosen that are purine-rich, for example, containing a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in CGC triplets across the three strands in the triplex.
  • the potential sequences that can be targeted for triple helix formation may be increased by creating a so called “switchback" nucleic acid molecule.
  • Switchback molecules are synthesized in an alternating 5'-3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizable stretch of either purines or pyrimidines to be present on one strand of a duplex.
  • the antisense oligonucleotide is an ⁇ -anomeric oligonucleotide.
  • An ⁇ -anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res.
  • KDS nucleic acids can be obtained from mRNA present in any of a number of eukaryotic cells. It should also be possible to obtain nucleic acids encoding mammalian KDS proteins of the present invention from genomic DNA from both adults and embryos. For example, a gene encoding a KDS protein can be cloned from either a cDNA or a genomic library in accordance with protocols described herein, as well as those generally known to persons skilled in the art.
  • tissue and/or libraries suitable for isolation of the subject nucleic acids include e.g., muscle, brain, spleen, or prostate cells, among others.
  • a cDNA encoding a KDS protein can be obtained by isolating total mRNA from a cell, e.g. a vertebrate cell, a mammalian cell, or a human cell, including embryonic cells. Double stranded cDNAs can then be prepared from the total mRNA, and subsequently inserted into a suitable plasmid or bacteriophage vector using any one of a number of known techniques.
  • the gene encoding a mammalian KDS protein can also be cloned using established polymerase chain reaction techniques in accordance with the nucleotide sequence information provided by the invention.
  • the nucleic acid of the invention can be DNA or RNA.
  • a preferred nucleic acid is a cDNA represented by a sequence shown in SEQ ID NO: 1 or 3.
  • RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule.
  • DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
  • RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
  • antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
  • nucleic acids of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
  • phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. NatI. Acad. Sci. U.S.A. 85:7448- 7451), etc.
  • oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis.
  • modifications to nucleic acid molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
  • a nucleic acid may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5- iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylarninomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thi
  • the subject nucleic acid may include at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • vectors containing the subject nucleic acid molecules.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication.
  • Preferred vectors are those capable of autonomous replication and/expression of nucleic acids to which they are linked.
  • Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors”.
  • expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome.
  • plasmid and “vector” are used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors which serve equivalent functions.
  • This invention also provides expression vectors containing a nucleic acid encoding a KDS protein, operatively linked to at least one transcriptional regulatory sequence.
  • "Operatively linked” is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence.
  • Transcriptional regulatory sequences are art-recognized and are selected to direct expression of the subject mammalian KDS proteins. Exemplary regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • the expression vector of the present invention is capable of replicating in a cell.
  • the expression vector includes a recombinant gene encoding a peptide having KDS bioactivity.
  • Such expression vectors can be used to transfect cells and thereby produce proteins, including fusion proteins, encoded by nucleic acids as described herein.
  • the gene constructs of the present invention can also be used as a part of a gene therapy protocol to deliver nucleic acids encoding either an agonistic or antagonistic form of one of the subject mammalian KDS proteins.
  • another aspect of the invention features expression vectors for in vivo or in vitro transfection and expression of a mammalian KDS protein in particular cell types so as to reconstitute the function of, or alternatively, abrogate the function of KDS in a tissue. This could be desirable when treating a disorder, for example, resulting from when the misexpression of KDS in a tissue.
  • non-viral methods can also be employed to cause expression of a subject KDS protein in the tissue of an animal.
  • Most nonviral methods of gene transfer rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules.
  • non- viral targeting means of the present invention rely on endocytic pathways for the uptake of the subject KDS protein gene by the targeted cell.
  • Exemplary targeting means of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.
  • the recombinant KDS genes can be produced by ligating nucleic acid encoding a KDS protein, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells, or both.
  • Expression vectors for production of recombinant forms of the subject KDS proteins include plasmids and other vectors.
  • suitable vectors for the expression of a KDS protein include plasmids of the types: pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli.
  • YEP24, YIP5, YEP51, YEP52, pYES2, and YRP17 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiae (see, for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press, p. 83, incorporated by reference herein).
  • These vectors can replicate in E. coli due the presence of the pBR322 ori, and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid.
  • drug resistance markers such as ampicillin can be used.
  • a KDS protein is produced recombinantly utilizing an expression vector generated by sub- cloning the coding sequence of one of the KDS genes represented in SEQ ID NO: 1 or 3.
  • the preferred mammalian expression vectors contain both prokaryotic sequences, to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells.
  • the pcDNAI/amp, pcDNAI/neo, pRc/CMV, ⁇ SV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells. Some of these vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells.
  • viruses such as the bovine papillomavirus (BPV-1), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells.
  • BBV-1 bovine papillomavirus
  • pHEBo Epstein-Barr virus
  • pHEBo Epstein-Barr virus
  • pHEBo Epstein-Barr virus
  • baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWl), and pBlueBac-derived vectors (such as the ⁇ -gal containing pBlueBac III).
  • the subject vectors can also include fragments of a KDS nucleic acid encoding a fragment of a KDS protein.
  • the subject vectors can be used to transfect a host cell in order to express a recombinant form of the subject KDS proteins.
  • the host cell may be any prokaryotic or eukaryotic cell.
  • a nucleotide sequence derived from the cloning of mammalian KDS proteins, encoding all or a selected portion of the full-length protein can be used to produce a recombinant form of a mammalian KDS protein in a cell.
  • Cells “host cells” or “recombinant host cells” are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
  • the present invention further pertains to methods of producing the subject KDS proteins.
  • a host cell transfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject proteins can be cultured under appropriate conditions to allow expression of the peptide to occur.
  • the cells may be harvested, lysed and the protein isolated.
  • a cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art.
  • the recombinant KDS protein can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such peptide.
  • the recombinant KDS protein is a fusion protein containing a domain which facilitates its purification, such as GST fusion protein or poly(His) fusion protein.
  • transgenic animals described in more detail below can be used to produce recombinant proteins.
  • the present invention also provides for a recombinant transfection system, including a KDS gene construct operatively linked to a transcriptional regulatory sequence and a gene delivery composition for delivering the gene construct to a cell so that the cell expresses the KDS protein.
  • the term “transfection” means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
  • "Transformation” refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of a mammalian KDS protein or, in the case of anti-sense expression from the transferred gene, the expression of a naturally- occurring form of the KDS protein is disrupted.
  • a “delivery composition” shall mean a targeting means (e.g.
  • targeting means include: sterols (e.g. cholesterol), lipids (e.g. a cationic lipid, virosome or liposome), viruses (e.g. adenovirus, adeno-associated virus, and retrovirus) or target cell specific binding agents (e.g. ligands recognized by target cell specific receptors).
  • sterols e.g. cholesterol
  • lipids e.g. a cationic lipid, virosome or liposome
  • viruses e.g. adenovirus, adeno-associated virus, and retrovirus
  • target cell specific binding agents e.g. ligands recognized by target cell specific receptors.
  • Another aspect of the invention pertains to isolated KDS proteins, and biologically active portions thereof, as well as peptide fragments suitable as immunogens to raise anti-KDS antibodies.
  • the invention provides an isolated preparation of KDS, or a biologically active portion thereof.
  • An "isolated" protein is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • the KDS protein has an amino acid sequence shown in SEQ ID NO: 2 or 4.
  • the KDS protein is substantially homologous to SEQ ID NO: 2 or 4 and retains the functional activity of the protein of SEQ ID NO: 2 or 4 yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail in subsection I above. Accordingly, in another embodiment, the KDS protein is a protein which comprises an amino acid sequence at least 60 % homologous to the amino acid sequence of SEQ ID NO: 2 or 4 and having serine/threonine kinase activity.
  • the protein is at least 70 % homologous to SEQ ID NO: 2 or 4, more preferably at least 80 % homologous to SEQ ID NO: 2 or 4, even more preferably at least 90 % homologous to SEQ ID NO: 2 or 4, and most preferably at least 95 % homologous to SEQ ID NO: 2 or 4.
  • homologs of each of the subject KDS proteins can be generated by mutagenesis, such as by discrete point mutation(s), or by truncation. For instance, mutation can give rise to homologs which retain substantially the same, or merely a subset, of the biological activity of the KDS protein from which it was derived.
  • antagonistic forms of the protein can be generated which are able to inhibit the function of the naturally occurring form of the protein, such as by competitively binding to a KDS substrate.
  • agonistic forms of the protein may be generated which are constitutively active.
  • KDS proteins may also be chemically modified to create KDS derivatives by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like.
  • Covalent derivatives of KDS proteins can be prepared by linking the chemical moieties to functional groups on amino acid sidechains of the protein or at the N-terminus or at the C-terminus of the protein.
  • Modification of the structure of the subject mammalian KDS proteins can be for such purposes as enhancing therapeutic or prophylactic efficacy, stability (e.g., ex vivo shelf life and resistance to proteolytic degradation in vivo), or post-translational modifications (e.g., to alter phosphorylation pattern of protein).
  • Such modified peptides when designed to retain at least one activity of the naturally-occurring form of the protein, or to produce specific antagonists thereof, are considered functional equivalents of the KDS proteins described in more detail herein.
  • Such modified peptides can be produced, for instance, by amino acid substitution, deletion, or addition.
  • Whether a change in the amino acid sequence of a peptide results in a functional KDS homolog can be readily determined by assessing the ability of the variant peptide to produce a response in cells in a fashion similar to the wild-type protein, or competitively inhibit such a response. Proteins in which more than one replacement has taken place can readily be tested in the same manner.
  • the instant examples provide guidance as to which amino acids are inportant for KDS kinase activity.
  • a KDS protein is encoded by a KDS nucleic acid as defined herein.
  • a KDS protein is encoded by a nucleic acid at least about 70%) homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3 or its complement.
  • a preferred embodiment of KDS protein is encoded by a nucleic acid is at least about 80%> homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3 or its complement.
  • a KDS protein is encoded by a nucleic acid at least about 90%> homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3.
  • KDS protein is encoded by a nucleic acid at least about 95%) homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3. In a more preferred embodiment of KDS protein is encoded by a nucleic acid is at least about 98- 99%o homologous to the nucleic acid sequence shown in SEQ ID NO: 1 or 3. In particularly preferred embodiments a KDS protein is encoded by a nucleic acid sequence identical to the nucleotide sequence of SEQ ID NO: 1 or 3. An isolated KDS protein may comprise the entire amino acid sequence of SEQ
  • Biologically active portions can be prepared by recombinant techniques and evaluated for kinase activity as described in detail above. Isolated peptidyl portions of KDS proteins can be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides. In addition, fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry.
  • a KDS protein of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length.
  • the fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments which can function as either agonists or antagonists of a wild-type KDS protein.
  • KDS proteins are preferably produced by recombinant DNA techniques.
  • a nucleic acid molecule encoding the protein is cloned into an expression vector (as described above), the expression vector is introduced into a host cell (as described above) and the KDS protein is expressed in the host cell.
  • the KDS protein can then be isolated from the cells by an appropriate purification scheme using standard protein purification techniques.
  • a KDS protein or polypeptide can be synthesized chemically using standard peptide synthesis techniques.
  • native KDS protein can be isolated from cells (e.g., splenocytes), for example using an an -KDS antibody (discussed further below).
  • This invention further provides a method for generating sets of combinatorial mutants of the subject KDS proteins as well as truncation mutants, and is especially useful for identifying potential variant sequences (e.g. homologs) that modulate a KDS bioactivity.
  • the purpose of screening such combinatorial libraries is to generate, for example, novel KDS homologs which can act as either agonists or antagonist, or alternatively, possess novel activities all together.
  • combinatorially-derived homologs can be generated to have an increased potency relative to a naturally occurring form of the protein.
  • KDS homologs can be generated by the present combinatorial approach to selectively inhibit (antagonize) a naturally occurring KDS.
  • mutagenesis can provide KDS homologs which are able to bind other signal pathway proteins (or DNA) yet prevent propagation of the signal, e.g. the homologs can be dominant negative mutants.
  • manipulation of certain domains of KDS by the present method can provide domains more suitable for use in fusion proteins.
  • the library of KDS variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a gene library.
  • a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential KDS sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g. for phage display) containing the set of KDS sequences therein.
  • a library of coding sequence fragments can be provided for a KDS clone in order to generate a population of KDS fragments for screening and subsequent selection of bioactive fragments.
  • a variety of techniques are known in the art for generating such libraries, including chemical synthesis.
  • a library of coding sequence fragments can be generated by (i) treating a double stranded PCR fragment of a KDS coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule; (ii) denaturing the double stranded DNA; (iii) renaturing the DNA to form double stranded DNA which can include sense/anti sense pairs from different nicked products; (iv) removing single stranded portions from reformed duplexes by treatment with SI nuclease; and (v) ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which codes for N-terminal, C-terminal and internal fragments of various sizes.
  • a wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a certain property. Such techniques will be generally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of KDS homologs.
  • the most widely used techniques for screening large gene libraries typically comprises cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected.
  • a number of assays such as the illustrative kinase assays described herein, can be used to screen large numbers of degenerate KDS sequences created by combinatorial mutagenesis techniques.
  • cell based assays can be exploited to analyze the variegated KDS library.
  • the library of expression vectors can be transfected into a cell line, such as COS cells and the kinase activity of the KDS mutants can be detected, e.g. as described in the appended examples. Plasmid DNA can then be recovered from the cells which score for inhibition, or alternatively, potentiation of a KDS activity, and the individual clones further characterized.
  • Combinatorial mutagenesis has a potential to generate very large libraries of mutant proteins, e.g., in the order of 10 ⁇ 6 molecules. Combinatorial libraries of this size may be technically challenging to screen even with high throughput screening assays.
  • recrusive ensemble mutagenesis REM
  • REM recrusive ensemble mutagenesis
  • REM is an algorithm which enhances the frequency of functional mutants in a library when an appropriate selection or screening method is employed (Arkin and Yourvan, 1992, PNAS USA 89:781 1-7815; Yourvan et al., 1992, Parallel Problem Solving from Nature, 2., In Maenner and Manderick, eds., Elsevier Publishing Co., Amsterdam, pp. 401-410; Delgrave et al., 1993, Protein Engineering 6(3):327-331).
  • the invention also provides for reduction of the mammalian KDS proteins to generate mimetics, e.g. peptide or non-peptide agents, which are able to inhibit KDS kinase activity.
  • non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al. in Peptides: Chemistry and Biology, G.R. Marshall ed.,
  • KDS fusion protein comprises a KDS protein operatively linked to a non-KDS protein.
  • a "KDS protein” refers to a protein having an amino acid sequence corresponding to KDS, whereas a “non-KDS protein” refers to a protein having an amino acid sequence which does not correspond to a KDS protein.
  • the term "operatively linked" is intended to indicate that the KDS protein and the non-KDS protein are fused in-frame to each other.
  • the non- ⁇ DS protein may be fused to the N-terminus or C- terminus of the KDS protein.
  • the fusion protein is a GST-KDS fusion protein in which the cKDS sequences are fused to the C-terminus of the GST sequences (see Example 4).
  • Such fusion proteins can facilitate the purification of recombinant KDS.
  • a KDS fusion protein of the invention is produced by standard recombinant DNA techniques.
  • DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
  • anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence
  • many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide).
  • a .KDS-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in- frame to the KDS protein.
  • KDS protein, or fragment thereof, or fusion protien can be used as an immunogen to generate antibodies that bind KDS using standard techniques for polyclonal and monoclonal antibody preparation.
  • the full-length KDS protein can be used or, alternatively, the invention provides antigenic peptide fragments of KDS for use as immunogens.
  • the antigenic peptide of KDS comprises at least 8 amino acid residues of the amino acid sequence shown in SEQ ID NO: 2 or 4 and encompasses an epitope of KDS such that an antibody raised against the peptide forms a specific immune complex with KDS.
  • the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues.
  • Preferred epitopes encompassed by the antigenic peptide are regions of KDS that are located on the surface of the protein, e.g., hydrophilic regions.
  • An exemplary immunogen, as described in Example 4, is shown in amino acids 314-442 of SEQ ID NO: 1.
  • a KDS immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen.
  • An appropriate immunogenic preparation can contain, for examples, recombinantly expressed KDS protein or a chemically synthesized KDS peptide.
  • the preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent. Immunization of a suitable subject with an immunogenic KDS preparation induces a polyclonal anti-KDS antibody response.
  • antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such as KDS.
  • the invention provides polyclonal and monoclonal antibodies that bind KDS.
  • monoclonal antibody or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of KDS. A monoclonal antibody composition thus typically displays a single binding affinity for a particular KDS protein with which it immunoreacts.
  • Polyclonal anti-KDS antibodies can be prepared as described above by immunizing a suitable subject with a KDS immunogen (see also Example 4).
  • the anti- KDS antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized KDS.
  • ELISA enzyme linked immunosorbent assay
  • the antibody molecules directed against KDS can be isolated from the mammal (e.g., from the blood) and further purified by well known techniques, such as protein A chromatography to obtain the IgG fraction.
  • antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256:495-497) (see also, Brown et al. (1981) J. Immunol 127:539-46; Brown et al. (1980) J Biol Chem 255:4980- 83; Yeh et al. (1976) PNAS 76:2927-31; and Yeh et al. (1982) Int. J.
  • an immortal cell line typically a myeloma
  • lymphocytes typically splenocytes
  • the culture supematants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds KDS.
  • Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-KDS monoclonal antibody (see, e.g., G. Galfre et al.
  • the immortal cell line e.g., a myeloma cell line
  • murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line.
  • Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell lines may be used as a fusion partner according to standard techniques, e.g., the P3-NSl/l-Ag4-l, P3-x63-Ag8.653 or Sp2/O-Agl4 myeloma lines. These myeloma lines are available from the American Type Culture Collection (ATCC), Rockville, Md. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol (“PEG"). Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed).
  • HAT medium any of a number of
  • Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supematants for antibodies that bind KDS, e.g., using a standard ELISA assay.
  • a monoclonal anti-KDS antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with KDS to thereby isolate immunoglobulin library members that bind KDS.
  • Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01 ; and the Stratagene SurfZAP ⁇ M Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al.
  • recombinant anti-KDS antibodies such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention.
  • Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in Robinson et al. International Patent Publication PCT/US86/02269; Akira, et al. European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al. European Patent Application 173,494; Neuberger et al. PCT Application WO 86/01533; Cabilly et al. U.S.
  • An anti-KDS antibody e.g., monoclonal antibody
  • An anti-KDS antibody can be used to isolate KDS by standard techniques, such as affinity chromatography or immunoprecipitation (see e.g., Example 4).
  • An anti-KDS antibody can facilitate the purification of natural KDS from cells and of recombinantly produced KDS expressed in host cells.
  • an anti- KDS antibody can be used to detect KDS protein (e.g., in a cellular lysate or cell supernatant). Detection may be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; and examples of suitable radioactive material include 195 I, 1 ⁇ 1 I, 35 S or 3 H.
  • the present invention provides for assays which can be used to screen for modulating agents, including KDS homologs, which are either agonists or antagonists of the normal cellular function of the subject KDS proteins.
  • the invention provides a method in which an indicator composition is provided which has a KDS protein having KDS kinase activity.
  • the indicator composition can be contacted with a test compound.
  • the effect of the test compound on KDS kinase activity, as measured by a change in the indicator composition can then be determined to thereby identify a compound that modulates the kinase activity of a KDS protein.
  • a statistically significant change, such as a decrease or increase, in the level of KDS kinase activity in the presence of the test compound (relative to what is detected in the absence of the test compound) is indicative of the test compound being a KDS modulating agent.
  • the indicator composition can be, for example, a cell or a cell extract.
  • KDS kinase activity is assessed by measuring autophosphorylation of the KDS protein.
  • the modulatory methods of the invention involve contacting the cell with an agent that modulates KDS activity such that KDS activity in the cell is modulated.
  • the agent may act by modulating the activity of KDS protein in the cell or by modulating transcription of the KDS gene or translation of the KDS mRNA.
  • the term "modulating" is intended to include inhibiting or decreasing KDS activity and stimulating or increasing KDS activity.
  • the agent inhibits KDS activity.
  • An inhibitory agent may function, for example, by directly inhibiting KDS kinase activity or by modulating a signaling pathway which negatively regulates KDS.
  • the agent stimulates KDS activity.
  • a stimulatory agent may function, for example, by directly stimulating KDS kinase activity, or by modulating a signaling pathway that leads to stimulation of KDS activity.
  • KDS activity is inhibited in a cell by contacting the cell with an inhibitory agent.
  • Inhibitory agents of the invention can be, for example, intracellular binding molecules that act to inhibit the expression or activity of KDS.
  • intracellular binding molecule is intended to include molecules that act intracellularly to inhibit the expression or activity of a protein by binding to the protein itself, to a nucleic acid (e.g., an mRNA molecule) that encodes the protein or to a second protein with which the first protein normally interacts (e.g., a KDS substrate).
  • intracellular binding molecules examples include antisense KDS nucleic acid molecules (e.g., to inhibit translation of KDS mRNA), intracellular anti-KDS antibodies (e.g., to inhibit the activity of KDS protein), and dominant negative mutants of the KDS protein.
  • an inhibitory agent of the invention is an antisense nucleic acid molecule that is complementary to a gene encoding KDS, or to a portion of said gene, or a recombinant expression vector encoding said antisense nucleic acid molecule.
  • antisense nucleic acids to downregulate the expression of a particular protein in a cell is well known in the art (see e.g., Weintraub, H. et ⁇ l, Antisense RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986; Askari, F.K. and McDonnell, W.M. (1996) N. Eng. J. Med. 334:316-318; Bennett, M.R.
  • An antisense nucleic acid molecule comprises a nucleotide sequence that is complementary to the coding strand of another nucleic acid molecule (e.g., an mRNA sequence) and accordingly is capable of hydrogen bonding to the coding strand of the other nucleic acid molecule.
  • Antisense sequences complementary to a sequence of an mRNA can be complementary to a sequence found in the coding region of the mRNA, the 5' or 3' untranslated region of the mRNA or a region bridging the coding region and an untranslated region (e.g., at the junction of the 5' untranslated region and the coding region).
  • an antisense nucleic acid can be complementary in sequence to a regulatory region of the gene encoding the mRNA, for instance a transcription initiation sequence or regulatory element.
  • an antisense nucleic acid is designed so as to be complementary to a region preceding or spanning the initiation codon on the coding strand or in the 3' untranslated region of an mRNA.
  • An antisense nucleic acid for inhibiting the expression of KDS protein in a cell can be designed based upon the nucleotide sequence encoding the KDS protein (e.g., SEQ ID NO: 1 or 3, or a portion thereof), constructed according to the rules of Watson and Crick base pairing.
  • an antisense nucleic acid can exist in a variety of different forms.
  • the antisense nucleic acid can be an oligonucleotide that is complementary to only a portion of a KDS gene.
  • Antisense oligonucleotides can be constructed using chemical synthesis procedures known in the art.
  • An antisense oligonucleotide can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g. phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • one or more antisense oligonucleotides can be added to cells in culture media, typically at about 200 ⁇ g oligonucleotide/ml.
  • an antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i. e. , nucleic acid transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
  • Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the expression of the antisense RNA molecule in a cell of interest, for instance promoters and/or enhancers or other regulatory sequences can be chosen which direct constitutive, tissue specific or inducible expression of antisense RNA.
  • an inducible eukaryotic regulatory system such as the Tet system (e.g., as described in Gossen, M. and Bujard, H. (1992) Proc. NatI. Acad. Sci. USA 89:5547-5551; Gossen, M. et al. (1995) Science 268:1766- 1769; PCT Publication No. WO 94/29442; and PCT Publication No. WO 96/01313) can be used.
  • the antisense expression vector is prepared as described above for recombinant expression vectors, except that the cDNA (or portion thereof) is cloned into the vector in the antisense orientation.
  • the antisense expression vector can be in the form of, for example, a recombinant plasmid, phagemid or attenuated virus.
  • the antisense expression vector is introduced into cells using a standard transfection technique, as described above for recombinant expression vectors.
  • an antisense nucleic acid for use as an inhibitory agent is a ribozyme.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region (for reviews on ribozymes see e.g., Ohkawa, J. et al. (1995) J Biochem. 118:251-258; NASAdsson, S.T. and Eckstein, F. (1995) Trends Biotechnol 11:286-289; Rossi, J.J. (1995) Trends Biotechnol. 13:301-306; Kiehntopf, M.
  • a ribozyme having specificity for KDS mRNA can be designed based upon the nucleotide sequence of the KDS cDNA.
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the base sequence of the active site is complementary to the base sequence to be cleaved in a KDS mRNA. See for example U.S. Patent Nos. 4,987,071 and 5,116,742, both by Cech et al.
  • KDS mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See for example Bartel, D. and Szostak, J.W. (1993) Science 261 : 1411-1418.
  • inhibitory agent that can be used to inhibit the expression and/or activity of KDS in a cell is an intracellular antibody specific for the KDS protein.
  • intracellular antibodies to inhibit protein function in a cell is known in the art (see e.g., Carlson, J. R. (1988) Mol. Cell Biol. 8:2638-2646; Biocca, S. et al. (1990) EMBO J. 9:101- 108; Werge, T.M. et al. (1990) FEBS Letters 274:193-198; Carlson, J.R. (1993) Proc. NatI. Acad. Sci. USA 90:7427-7428; Marasco, W.A. et al. (1993) Proc.
  • a recombinant expression vector which encodes the antibody chains in a form such that, upon introduction of the vector into a cell, the antibody chains are expressed as a functional antibody in an intracellular compartment of the cell.
  • an intracellular antibody that specifically binds the KDS protein is expressed in the cytoplasm of the cell.
  • antibody light and heavy chain cDNAs encoding antibody chains specific for the target protein of interest, e.g., KDS are isolated, typically from a hybridoma that secretes a monoclonal antibody specific for the KDS protein.
  • Hybridomas secreting anti-KDS monoclonal antibodies, or recombinant anti-KDS monoclonal antibodies can be prepared as described above.
  • a monoclonal antibody specific for KDS protein e.g., either a hybridoma-derived monoclonal antibody or a recombinant antibody from a combinatorial library
  • DNAs encoding the light and heavy chains of the monoclonal antibody are isolated by standard molecular biology techniques.
  • light and heavy chain cDNAs can be obtained, for example, by PCR amplification or cDNA library screening.
  • cDNA encoding the light and heavy chains can be recovered from the display package (e.g., phage) isolated during the library screening process.
  • Nucleotide sequences of antibody light and heavy chain genes from which PCR primers or cDNA library probes can be prepared are known in the art. For example, many such sequences are disclosed in Kabat, E.A., et ⁇ l (1991) Sequences of Proteins of
  • an intracellular antibody expression vector can encode an intracellular antibody in one of several different forms. For example, in one embodiment, the vector encodes full-length antibody light and heavy chains such that a full-length antibody is expressed intracellularly.
  • the vector encodes a full-length light chain but only the VH/CH1 region of the heavy chain such that a Fab fragment is expressed intracellularly.
  • the vector encodes a single chain antibody (scFv) wherein the variable regions of the light and heavy chains are linked by a flexible peptide linker (e.g., (Gly4Ser)3) and expressed as a single chain molecule.
  • scFv single chain antibody
  • the expression vector encoding the anti-KDS intracellular antibody is introduced into the cell by standard transfection methods, as discussed hereinbefore.
  • Yet another form of an inhibitory agent of the invention is an inhibitory form of a KDS protein, also referred to herein as a dominant negative inhibitor.
  • a dominant negative inhibitor can be a form of a KDS protein that retains the ability to interact with a substrate but that lacks one or more other functional activities, for example kinase activity, such that the dominant negative form of KDS cannot participate in normal signal transduction.
  • This dominant negative form of a KDS protein may be, for example, a mutated form of a KDS molecule.
  • Such dominant negative KDS proteins can be expressed in cells using a recombinant expression vector encoding the mutant KDS protein, which is introduced into the cell by standard transfection methods. Mutation or deletion of specific codons within the KDS-encoding cDNA can be performed using standard mutagenesis methods. The mutated cDNA is inserted into a recombinant expression vector, which is then introduced into a cell to allow for expression of the mutated KDS protein. The kinase acitivity of the mutant KDS protein can be assessed using standard kinase assays, such as those described herein.
  • KDS activity is stimulated in a cell by contacting the cell with a stimulatory agent.
  • stimulatory agents include active KDS protein and nucleic acid molecules encoding KDS that are introduced into the cell to increase KDS activity in the cell.
  • a preferred stimulatory agent is a nucleic acid molecule encoding a KDS protein, wherein the nucleic acid molecule is introduced into the cell in a form suitable for expression of the active KDS protein in the cell.
  • a KDS cDNA is first introduced into a recombinant expression vector using standard molecular biology techniques, as described herein.
  • a KDS cDNA can be obtained, for example, by amplification using the polymerase chain reaction (PCR) or by screening an appropriate cDNA library as described herein. Following isolation or amplification of KDS cDNA, the DNA fragment is introduced into an expression vector and transfected into target cells by standard methods, as described herein.
  • Other stimulatory agents that can be used to stimulate the activity of a KDS protein are chemical compounds that stimulate KDS activity in cells, such as compounds that enhance KDS kinase activity. Such compounds can be identified using screening assays that select for such compounds, as described in detail above.
  • the modulatory methods of the invention can be performed in vitro (e.g., by culturing the cell with the agent or by introducing the agent into cells in culture) or, alternatively, in vivo (e.g., by administering the agent to a subject or by introducing the agent into cells of a subject, such as by gene therapy).
  • cells can be obtained from a subject by standard methods and incubated (i.e., cultured) in vitro with a modulatory agent of the invention to modulate KDS activity in the cells.
  • PBMCs peripheral blood mononuclear cells
  • PBMCs peripheral blood mononuclear cells
  • Specific cell populations can be depleted or enriched using standard methods. For example, monocytes/macrophages can be isolated by adherence on plastic. T cells can be enriched for example, by positive selection using antibodies to T cell surface markers, for example by incubating cells with a specific primary monoclonal antibody (mAb), followed by isolation of cells that bind the mAb using magnetic beads coated with a secondary antibody that binds the primary mAb. Specific cell populations (e.g., T cells) can also be isolated by fluorescence activated cell sorting according to standard methods. Monoclonal antibodies to T cell-specific surface markers known in the art and many are commercially available. If desired, cells treated in vitro with a modulatory agent of the invention can be readministered to the subject.
  • mAb primary monoclonal antibody
  • the modulatory agent can be administered to the subject such that KDS activity in cells of the subject is modulated.
  • subject is intended to include living organisms in which an immune response can be elicited. Preferred subjects are mammals.
  • subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, goats and sheep.
  • stimulatory or inhibitory agents that comprise nucleic acids include recombinant expression vectors encoding KDS protein, antisense RNA, intracellular antibodies or dominant negative inhibitors
  • the agents can be introduced into cells of the subject using methods known in the art for introducing nucleic acid (e.g., DNA) into cells in vivo. Examples of such methods encompass both non-viral and viral methods, including:
  • Naked DNA can be introduced into cells in vivo by directly injecting the DNA into the cells (see e.g., Acsadi et al. (1991) Nature 332:815-818: Wolff et al. (1990) Science 247:1465-1468).
  • a delivery apparatus e.g., a "gene gun” for injecting DNA into cells in vivo can be used.
  • Such an apparatus is commercially available (e.g., from BioRad).
  • Cationic Lipids Naked DNA can be introduced into cells in vivo by complexing the DNA with cationic lipids or encapsulating the DNA in cationic liposomes.
  • Suitable cationic lipid formulations include N-[-l-(2,3- dioleoyloxy)propyl]N,N,N-triethylammonium chloride (DOTMA) and a 1 : 1 molar ratio of l,2-dimyristyloxy-propyl-3-dimethylhydroxyethylammonium bromide (DMRIE) and dioleoyl phosphatidylethanolamine (DOPE) (see e.g., Logan, J.J. et al. (1995) Gene Therapy 2:38-49; San, H. et al. (1993) Human Gene Therapy 4:781-788).
  • DOTMA N-[-l-(2,3- dioleoyloxy)propyl]N,N,N-triethylammonium chloride
  • DMRIE dioleoyl phosphatidylethanolamine
  • DOPE dioleoyl phosphatidylethanolamine
  • Naked DNA can also be introduced into cells in vivo by complexing the DNA to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G. and Wu, CH. (1988) J. Biol. Chem. 263:14621; Wilson et al. (1992) J. Biol. Chem. 267:963-967; and U.S. Patent No. 5,166,320). Binding of the DNA-ligand complex to the receptor facilitates uptake of the DNA by receptor-mediated endocytosis.
  • a cation such as polylysine
  • a DNA-ligand complex linked to adenovirus capsids which naturally disrupt endosomes, thereby releasing material into the cytoplasm can be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel et al. (1991) Proc. NatI Acad. Sci. USA 8:8850; Cristiano et al. (1993) Proc. NatI Acad. Sci. USA 90:2122-2126).
  • Retroviruses Defective retroviruses are well characterized for use in gene transfer for gene therapy purposes (for a review see Miller, A.D. (1990) Blood 76:271).
  • a recombinant retrovirus can be constructed having a nucleotide sequences of interest incorporated into the retroviral genome. Additionally, portions of the retroviral genome can be removed to render the retrovirus replication defective. The replication defective retrovirus is then packaged into virions which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F.M. et al.
  • retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art.
  • suitable packaging virus lines include ⁇ Crip, ⁇ Cre, ⁇ 2 and ⁇ Am. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc.
  • Retroviral vectors require target cell division in order for the retroviral genome (and foreign nucleic acid inserted into it) to be integrated into the host genome to stably introduce nucleic acid into the cell. Thus, it may be necessary to stimulate replication of the target cell.
  • Adenoviruses The genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See for example Berkner et al (1988) BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155.
  • Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus are well known to those skilled in the art.
  • Recombinant adenoviruses are advantageous in that they do not require dividing cells to be effective gene delivery vehicles and can be used to infect a wide variety of cell types, including airway epithelium (Rosenfeld et al. (1992) cited supra), endothelial cells (Lemarchand et al. (1992) Proc. NatI Acad. Sci. USA 89:6482- 6486), hepatocytes (Herz and Gerard (1993) Proc. NatI Acad. Sci. USA 90:2812-2816) and muscle cells (Quantin et al. (1992) Proc. NatI Acad. Sci. USA 89:2581-2584).
  • introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situations where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA).
  • the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al. cited supra; Haj- Ahmand and Graham (1986) J. Virol. 57:267).
  • Adeno-associated vims is a naturally occurring defective virus that requires another vims, such as an adenovims or a herpes vims, as a helper vims for efficient replication and a productive life cycle.
  • 5:3251-3260 can be used to introduce DNA into cells.
  • a variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al. (1984) Proc. NatI Acad. Sci. USA 81:6466-6470; Tratschin et al. (1985) Mol. Cell. Biol 4:2072-2081; Wondisford et al. (1988) Mol. Endocrinol 2:32-39; Tratschin et al. (1984) J. Virol. 51:611-619; and Flotte et al. (1993) J. Biol. Chem. 268:3781-3790).
  • DNA introduced into a cell can be detected by a filter hybridization technique (e.g., Southern blotting) and RNA produced by transcription of introduced DNA can be detected, for example, by Northern blotting, RNase protection or reverse transcriptase-polymerase chain reaction (RT-PCR).
  • RNA produced by transcription of introduced DNA can be detected, for example, by Northern blotting, RNase protection or reverse transcriptase-polymerase chain reaction (RT-PCR).
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • the gene product can be detected by an appropriate assay, for example by immunological detection of a produced protein, such as with a specific antibody, or by a functional assay to detect a functional activity of the gene product.
  • a modulatory agent such as a chemical compound that modulates the KDS kinase activity
  • Such compositions typically comprise the modulatory agent and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • Pharmaceutical compositions can be prepared as described herein.
  • the present invention provides a method for determining if a subject is at risk for a disorder characterized by aberrant expression of a KDS.
  • the methods can be characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by at least one of (i) an alteration affecting the integrity of a gene encoding a .KDS'-protein, or (ii) the mis- expression of the KDS gene.
  • such genetic lesions can be detected by ascertaining the existence of at least one of (i) a deletion of one or more nucleotides from a KDS gene, (ii) an addition of one or more nucleotides to a KDS gene, (iii) a substitution of one or more nucleotides of a KDS gene, (iv) a gross chromosomal rearrangement of a KDS gene, (v) a gross alteration in the level of a messenger RNA transcript of a KDS gene, (vii) aberrant modification of a KDS gene, such as of the methylation pattern of the genomic DNA, (vii) the presence of a non-wild type splicing pattern of a messenger RNA transcript of a KDS gene, (viii) a non-wild type level of a KDS-nrot in, (ix) allelic loss of a KDS gene, and (x) inappropriate post-translational modification of a KDS-nrotein.
  • the present invention such as set out
  • a nucleic acid composition which contains an oligonucleotide probe previously described.
  • the nucleic acid of a cell is rendered accessible for hybridization, the probe is exposed to nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected.
  • detection of the lesion comprises utilizing the probe/primer in a polymerase chain reaction (PCR) (see, e.g. U.S. Patent Nos.
  • the method includes the steps of (i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, (iii) contacting the nucleic acid sample with one or more primers which specifically hybridize to a KDS gene under conditions such that hybridization and amplification of the KDS-gene (if present) occurs, and (iv) detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample.
  • nucleic acid e.g., genomic, mRNA or both
  • PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
  • Alternative amplification methods include: self sustained sequence replication (Guatelli, J.C. et al., 1990, Proc. NatI. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D.Y. et al., 1989, Proc. NatI. Acad. Sci. USA 86:1173- 1 177), Q-Beta Replicase (Lizardi, P.M.
  • mutations in a KDS gene from a sample cell are identified by alterations in restriction enzyme cleavage patterns.
  • sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis.
  • sequence specific ribozymes see, for example, U.S. Patent No. 5,498,531 can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
  • any of a variety of sequencing reactions known in the art can be used to directly sequence the KDS gene and detect mutations by comparing the sequence of the sample KDS with the corresponding wild-type (control) sequence.
  • Exemplary sequencing reactions include those based on techniques developed by Maxim and Gilbert (Proc. NatI Acad Sci USA (1977) 74:560) or Sanger (Sanger et al (1977) Proc. Nat. Acad. Sci 74:5463). Any of a variety of automated sequencing procedures may be utilized when performing the subject assays (Biotechniques (1995) 19:448), including by sequencing by mass spectrometry (see, for example PCT publication WO 94/16101; Cohen et al.
  • protection from cleavage agents can be used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers, et al. (1985) Science 230: 1242).
  • cleavage agents such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine
  • cleavage agents such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine
  • mismatched bases in RNA/RNA or RNA/DNA heteroduplexes Myers, et al. (1985) Science 230: 1242).
  • mismatch cleavage starts by providing heteroduplexes formed by hybridizing (labelled) RNA or DNA containing the wild-type KDS sequence with potentially mutant RNA or DNA obtained from a tissue sample.
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digesting the mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation.
  • control DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in KDS cDNAs obtained from samples of cells.
  • DNA mismatch repair enzymes
  • the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662).
  • a probe based on a KDS sequence e.g., a wild-type KDS sequence
  • a cDNA or other DNA product from a test cell(s).
  • the duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Patent No. 5,459,039.
  • alterations in electrophoretic mobility will be used to identify mutations in KDS genes.
  • SSCP single strand conformation polymorphism
  • the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al (1985) Nature 313:495).
  • DGGE denaturing gradient gel electrophoresis
  • DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR.
  • a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265:12753).
  • oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al (1989) Proc. NatI Acad. Sci USA 86:6230).
  • Such allele specific oligonucleotide hybridization techniques may be used to test one mutation per reaction when oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labelled target DNA.
  • Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11 :238.
  • amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. NatI. Acad. Sci USA 88:189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
  • the methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a KDS gene.
  • Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary.
  • Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G.J., 1992, PCR in situ hybridization: protocols and applications, Raven Press, NY).
  • profiles may also be assessed in such detection schemes. Fingerprint profiles may be generated, for example, by utilizing a differential display procedure. Northern analysis and/or RT-PCR.
  • Antibodies directed against wild type or mutant KDS proteins may also be used in disease diagnostics and prognostics. Such diagnostic methods, may be used to detect abnormalities in the level of KDS protein expression, or abnormalities in the structure and/or tissue, cellular, or subcellular location of KDS protein. Stmctural differences may include, for example, differences in the size, electronegativity, or antigenicity of the mutant KDS protein relative to the normal KDS protein. Protein from the tissue or cell type to be analyzed may easily be detected or isolated using techniques which are well known to one of skill in the art, including but not limited to western blot analysis. For a detailed explanation of methods for carrying out western blot analysis, see Sambrook et al, 1989, supra, at Chapter 18.
  • the protein detection and isolation methods employed herein may also be such as those described in Harlow and Lane, for example, (Harlow, E. and Lane, D., 1988, “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York), which is incorporated herein by reference in its entirety.
  • the antibodies (or fragments thereof) useful in the present invention may, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of KDS proteins.
  • In situ detection may be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody of the present invention.
  • the antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample.
  • a solid phase support or carrier is used as a support capable of binding an antigen or an antibody.
  • supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite.
  • the nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention.
  • the support material may have virtually any possible stmctural configuration so long as the coupled molecule is capable of binding to an antigen or antibody.
  • the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod.
  • the surface may be flat such as a sheet, test strip, etc.
  • Preferred supports include polystyrene beads.
  • KDS modulating agents can be administered to a subject to modulate a signal transduction pathway.
  • the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such modulating agents lies preferably within a range of circulating or tissue concentrations that include the ED50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test modulating agent which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • IC50 i.e., the concentration of the test modulating agent which achieves a half-maximal inhibition of symptoms
  • levels in plasma may be measured, for example, by high performance liquid chromatography.
  • the gene delivery systems for the therapeutic KDS gene can be introduced into a patient by any of a number of methods, each of which is familiar in the art.
  • a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g. by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof.
  • initial delivery of the recombinant gene is more limited with introduction into the animal being quite localized.
  • the gene delivery vehicle can be introduced by catheter (see U.S. Patent 5,328,470) or by stereotactic injection (e.g.
  • a mammalian KDS gene such as represented in SEQ ID NO: 1 or 3, or a sequence homologous thereto can be delivered in a gene therapy construct by electroporation using techniques described, for example, by Dev et al. ((1994) Cancer Treat Rev 20:105-115).
  • the pharmaceutical preparation of the gene therapy construct can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.
  • compositions for use in accordance with the present invention may also be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.
  • the modulating agents and their physiologically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.
  • the modulating agents of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA.
  • systemic administration injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous.
  • the oligomers of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution.
  • the oligomers may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.
  • the pharmaceutical preparations may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate).
  • binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose
  • fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
  • lubricants e.g., magnesium stearate, talc or silica
  • disintegrants e.g., potato starch
  • Liquid preparations for oral administration may take the form of, for example, solutions, symps or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol symp, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid).
  • the preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
  • Preparations for oral administration may be suitably formulated to give controlled release of the active modulating agent.
  • the preparations for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluorome hane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluorome hane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluorome hane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluorome hane, trichlorofluoromethane, dichlorotetrafluoroethan
  • the modulating agents may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the modulating agents may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • the modulating agents may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • the modulating agents may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation.
  • Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration may be through nasal sprays or using suppositories.
  • the oligomers of the invention are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compositions may, if desired, be presented in a pack or dispenser device, or as a kit with instructions.
  • the composition may contain one or more unit dosage forms containing the active ingredient.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instmctions for administration.
  • the present invention also provides for transgenic animals
  • the transgenic animals produced in accordance with the present invention will include exogenous genetic material.
  • the exogenous genetic material will, in certain embodiments, be a DNA sequence which results in the production of a KDS protein (either agonistic or antagonistic), and antisense transcript, or a KDS mutant.
  • the sequence will be attached to a transcriptional control element, e.g., a promoter, which preferably allows the expression of the transgene product in a specific type of cell.
  • transgene means a nucleic acid sequence (whether encoding or antisense to one of the mammalian KDS proteins), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout).
  • a transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid.
  • a "transgenic animal” refers to any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art.
  • the nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant vims.
  • the term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA.
  • transgenic animal In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of the mammalian KDS proteins, e.g. either agonistic or antagonistic forms.
  • transgenic animals in which the recombinant KDS gene is silent are also contemplated, as for example, the FLP or CRE recombinase dependent constructs described below.
  • transgenic animal also includes those recombinant animals in which gene dismption of one or more KDS genes is caused by human intervention, including both recombination and antisense techniques.
  • non-human animals include mammalians such as rodents, non-human primates, sheep, dog, cow, chickens, amphibians, reptiles, etc. Preferred non-human animals are selected from the rodent family including rat and mouse, most preferably mouse.
  • chimeric animal is used herein to refer to animals in which the recombinant gene is found, or in which the recombinant is expressed in some but not all cells of the animal.
  • tissue-specific chimeric animal indicates that one of the recombinant mammalian KDS genes is present and/or expressed or disrupted in some tissues but not others.
  • the cell- and animal-based model systems may be used to further characterize KDS genes and proteins.
  • assays may be utilized as part of screening strategies ' designed to identify modulating agents which are capable of ameliorating disease symptoms.
  • the animal- and cell-based models may be used to identify drugs, pharmaceuticals, therapies and interventions which may be effective in treating disease.
  • One aspect of the present invention concerns transgenic animals which are comprised of cells (of that animal) which contain a transgene of the present invention and which preferably (though optionally) express an exogenous KDS protein in one or more cells in the animal.
  • a KDS transgene can encode the wild-type form of the protein, or can encode homologs thereof, including both agonists and antagonists, as well as antisense constmcts.
  • the expression of the transgene is restricted to specific subsets of cells, tissues or developmental stages utilizing, for example, cis-acting sequences that control expression in the desired pattern.
  • mosaic expression of a KDS protein can be essential for many forms of lineage analysis and can additionally provide a means to assess the effects of, for example, lack of KDS expression which might grossly alter development in small patches of tissue within an otherwise normal embryo.
  • tissue-specific regulatory sequences and conditional regulatory sequences can be used to control expression of the transgene in certain spatial patterns.
  • temporal patterns of expression can be provided by, for example, conditional recombination systems or prokaryotic transcriptional regulatory sequences.
  • target sequence refers to a nucleotide sequence that is genetically recombined by a recombinase.
  • the target sequence is flanked by recombinase recognition sequences and is generally either excised or inverted in cells expressing recombinase activity.
  • Recombinase catalyzed recombination events can be designed such that recombination of the target sequence results in either the activation or repression of expression of one of the subject KDS proteins.
  • excision of a target sequence which interferes with the expression of a recombinant KDS gene such as one which encodes an antagonistic homolog or an antisense transcript, can be designed to activate expression of that gene.
  • This interference with expression of the protein can result from a variety of mechanisms, such as spatial separation of the KDS gene from the promoter element or an internal stop codon.
  • the transgene can be made wherein the coding sequence of the gene is flanked by recombinase recognition sequences and is initially transfected into cells in a 3' to 5' orientation with respect to the promoter element.
  • inversion of the target sequence will reorient the subject gene by placing the 5' end of the coding sequence in an orientation with respect to the promoter element which allow for promoter driven transcriptional activation.
  • transgenic animals of the present invention all include within a plurality of their cells a transgene of the present invention, which transgene alters the phenotype of the "host cell” with respect to regulation of cell growth, death and/or differentiation. Since it is possible to produce transgenic organisms of the invention utilizing one or more of the transgene constmcts described herein, a general description will be given of the production of transgenic organisms by referring generally to exogenous genetic material. This general description can be adapted by those skilled in the art in order to incorporate specific transgene sequences into organisms utilizing the methods and materials described below.
  • cre/loxP recombinase system of bacteriophage PI (Lakso et al. (1992) PNAS 89:6232-6236; Orban et al. (1992) PNAS 89:6861-6865) or the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251 :1351-1355; PCT publication WO 92/15694) can be used to generate in vivo site-specific genetic recombination systems.
  • genetic recombination of the target sequence is dependent on expression of the Cre recombinase.
  • Expression of the recombinase can be regulated by promoter elements which are subject to regulatory control, e.g., tissue-specific, developmental stage-specific, inducible or repressible by externally added agents. This regulated control will result in genetic recombination of the target sequence only in cells where recombinase expression is mediated by the promoter element.
  • the activation expression of a recombinant KDS protein can be regulated via control of recombinase expression.
  • cre/loxP recombinase system to regulate expression of a recombinant KDS protein requires the constmction of a transgenic animal containing transgenes encoding both the Cre recombinase and the subject protein. Animals containing both the Cre recombinase and a recombinant KDS gene can be provided through the constmction of "double" transgenic animals. A convenient method for providing such animals is to mate two transgenic animals each containing a transgene, e.g., a KDS gene and recombinase gene.
  • One advantage derived from initially constmcting transgenic animals containing a KDS transgene in a recombinase-mediated expressible format derives from the likelihood that the subject protein, whether agonistic or antagonistic, can be deleterious upon expression in the transgenic animal.
  • a founder population in which the subject transgene is silent in all tissues, can be propagated and maintained. Individuals of this founder population can be crossed with animals expressing the recombinase in, for example, one or more tissues and/or a desired temporal pattern.
  • prokaryotic promoter sequences which require prokaryotic proteins to be simultaneous expressed in order to facilitate expression of the KDS transgene.
  • Exemplary promoters and the corresponding trans-activating prokaryotic proteins are given in U.S. Patent No. 4,833,080.
  • conditional transgenes can be induced by gene therapy-like methods wherein a gene encoding the trans-activating protein, e.g. a recombinase or a prokaryotic protein, is delivered to the tissue and caused to be expressed, such as in a cell-type specific manner.
  • a KDS transgene could remain silent into adulthood until "turned on” by the introduction of the trans- activator.
  • gene targeting which is a method of using homologous recombination to modify an animal's genome, can be used to introduce changes into cultured embryonic stem cells.
  • a KDS gene of interest e.g., in embryonic stem (ES) cells
  • ES embryonic stem
  • the gene targeting procedure is accomplished by introducing into tissue culture cells a DNA targeting constmct that includes a segment homologous to a target KDS locus, and which also includes an intended sequence modification to the KDS genomic sequence (e.g., insertion, deletion, point mutation).
  • the treated cells are then screened for accurate targeting to identify and isolate those which have been properly targeted.
  • Retroviral infection can also be used to introduce transgene into a non-human animal.
  • the developing non- human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Jaenich, R. (1976) PNAS 73:1260- 1264).
  • knock-out or dismption transgenic animals are also generally known. See, for example, Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Recombinase dependent knockouts can also be generated, e.g. by homologous recombination to insert target sequences, such that tissue specific and/or temporal control of inactivation of a KDS- gene can be controlled by recombinase sequences.
  • Animals containing more than one knockout constmct and/or more than one transgene expression construct are prepared in any of several ways.
  • the preferred manner of preparation is to generate a series of mammals, each containing one of the desired transgenic phenotypes. Such animals are bred together through a series of crosses, backcrosses and selections, to ultimately generate a single animal containing all desired knockout constmcts and/or expression constmcts, where the animal is otherwise congenic (genetically identical) to the wild type except for the presence of the knockout construct(s) and/or transgene(s).
  • the highest homology of all proteins in the database with the carboxy-terminus of human KDSl is the protein involucrin, which is characterized by a central segment composed of 39 tandem repeats of 10 amino acids each, which include the regularly recurring squence EQQEGQL. Neither human KDSl nor KDSl contain this motif and the homology between these two proteins and involucrin is solely based on the high glutamine and glutamate composition.
  • Helical wheel representations for the involucrin consensus sequence demonstrates that the combination of a 10-amino-acid repeat element and an ⁇ -helical conformation results in the uniform circumferential distribution of glutamines along the length of the helix.
  • Found within the carboxy-terminus of human KDSl and KDSl are a large number of Q-X9-Q (SEQ ID NO: 19) and Q-Xj 0 -Q (SEQ ID NO:20) repeated motifs (wherein Q is glutamine and X is any amino acid).
  • KDSl and KDSl Carboxy-terminus of KDSl are not known at this time.
  • the Q-X9-Q and Q-Xj o _ Q repeated motifs may play a role in covalently localizing these proteins to a specific site within the cell, which may be necessary for function.
  • a 4.5 Kb transcript hybridizes to the human KDS2 probe, with expression (levels from highest to lowest) observed in lung, PBL, small intestine, spleen and thymus (tissues tested includes: spleen, thymus, prostate, testis, ovary, small intestine, colon, PBL, heart, brain, lung, liver, skeletal muscle, kidney, and pancreas).
  • Rat KDSl is also expressed in low levels in all tissues tested, with highest expression observed in spleen, testis and pancreas (tissues tested includes: spleen, thymus, prostate, testis, ovary, small intestine, colon, PBL, heart, brain, lung, liver, skeletal muscle, kidney, and pancreas).
  • KDSl Fusion Proteins A DNA constmct encoding a fusion protein comprising an influenza vims hemagglutinin (HA) epitope-tag (amino acid residues YPYDVPDYA) fused to the amino-terminus of KDSl was engineered by the polymerase chain reaction (PCR).
  • the antisense oligomer contains an original Nsi I restriction site (underlined).
  • the pCMV5 vector containing the full length KDSl cDNA (pCM '5/KDS1 FL) was then cleaved with Hind III and Nsi I to liberate the amino-terminus of KDSl, and was then replaced with the HA-tagged amino-terminus to generate the vector pCMV5/HA-. S7.
  • HA-tagged kinase dead (kd) mutant of KDSl in pCMV5 was generated by a PCR knitting reaction.
  • the primer pair: sense 5'- GCAAGCTTCCATCATGTACCATATGAT GTTCCAGATTATGCTCGTAAAGGTGCTGAAG-3' (SEQ ID NO:7) and antisense 5'-GGACATCTTC ATAATTGCCACACCTCA-3' (SEQ ID NO:8) were used to generate a PCR product that contains a T to A mismatch in the AAG codon (amino acid residue 53), which converts it to an ATG (underlined, in the antisense oligomer).
  • a second PCR product was generated with the primer pair: sense 5'- GTGGCAATTA1GAAGATGTCCTATA GTG-3' (SEQ ID NO:9) and antisense 5'- AATCAATGCATGAGAATG-3' (SEQ ID NO: 10).
  • the sense oligomer of these pair contains a A to T mismatch in the sense strand to change the codon AAG (a.a. 53) to ATG (underlined).
  • One nanogram of each of these products were mixed together, boiled, and then allowed to reanneal with each other for 20 minutes at 37° C, thus forming the template of a PCR knitting reaction.
  • the sense primer 5'- GCAAGCTTCCATCATGTATCCATATGATGTTCCAGA TTATGCTCGTAAAGGGGTGCTGAAG-3' (SEQ ID NO: 7) and the antisense primer antisense 5'-AATCAATGCATGAGAATG-3' (SEQ ID NO: 10) were then added to this mix and PCR was then performed.
  • the PCR product generated by this reaction was gel purified and cleaved with the restriction enzymes Hind III and Nsi I. This fragment was then used to replace the same fragment of pCMV5/HA-AJ>S7 generating pCMV5/HA- KDSlkd.
  • a glutathione-S-transferase fusion protein comprising a KDSl protein fused to GST was prepared in E. coli.
  • the GST portion of the fusion protein was then cleaved and the KDSl protein used as an immunogen to prepare polyclonal antibodies.
  • the following primers were used to amplify the nucleic acid sequence encoding amino acids 314-442 of KDSl: sense 5'-GCGCGCGGATCCTGGAGACACG GAATGGACCC-3' (SEQ ID NO: 12) and antisense 5'- GCGCGCGAATTCAGATGCTGATTTGATCGTC-3 1 (SEQ ID NO: 13).
  • Each primer encodes a unique restriction site (underlined, Bam HI: GGATCC; Eco RI: GAATTC), which facilitated subsequent cloning.
  • the PCR products were then restricted with either BAM HI and Eco RI and ligated into the GST fusion expression vector pGEX-5X-l (Pharmacia). DNA sequence analysis was performed to confirm the accuracy of the PCR generated products.
  • PBS phosphate buffered saline
  • EXAMPLE 5 Demonstration that KDSl is Serine/Threonine Kinase
  • COS cells were transfected with either the pCMV5/HA- -7_ ⁇ S7 expression vector (encoding the wildtype W -KDSl fusion protein), the pCMV5/HA- Z ⁇ S7kd expression vector (encoding the kinase-dead HA- KDSlkd fusion protein), or the parent vector as a control. Each transfected clone was allowed to propagate the plasmid and produce protein for 72 hours.
  • the cells were then lysed in l%NP-40 lysis buffer (1ml per 10 7 cells) [1% NP-40, 150 mM NaCl, 10 mM Tris pH 7.5, 2.0 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 mM para-nitrophenylphosphate (diTris salt), 0.4 mM EDTA, 10 mM NaF, and 1 ⁇ g/ml each of aprotinin, leupeptin, and ⁇ -1-antitrypsin]. Ly sates were incubated on ice for 10 minutes and cleared of particulate nuclear/cytoskeletal components by centrifugation at 12,000 x g for 10 minutes.
  • HA epitope tagged protein was then immunoprecipitated with a combination of protein- A sepharose, rabbit anti-mouse IgG, and mouse IgG anti-HA tag.
  • the beads were washed three times in lysis buffer and twice in in vitro kinase buffer (150 mM NaCl, 10 mM Hepes pH 7.0, ImM PMSF, and 2mM Na Orthovanadate), and resuspended in 20ml of kinase buffer, and then incubated for 15 minutes at 30° C in the presence of 10 mCi of 32p[ ⁇ _ATP]. Beads were then washed twice in lysis buffer to remove free ATP and then boiled in sample buffer.
  • the region of the PVDF membrane containing the autophosphorylated KDSl was cut out and boiled it in 6.7N HCI for 1 hour. This process hydro ly sizes the protein into amino acid residues.
  • This material was lyophilized until dry and then analysed by two dimensional flat-bed electrophoresis on cellulose plates (pH 1.9 in first and pH 3.5 in the second dimension). After electrophoresis, plates were dried and reference amino acids visualized by ninhydrin staining. The positions of the phosphoamino acids were determined by autoradiography. Comparison of the autoradiograph with the ninhydrin stained plate demonstrated that both serine and threonine residues were autophosphorylated in KDSl.
  • EXAMPLE 6 Cellular Localization of KDS Molecules Fluorescent staining of resting and phytohemaglutanin (PHA) stimulated human purified T cells with KDS 1 and KDS 1 revealed significant differences in cellular localization. Both KDS 1 and KDS 1 stain in the cytoplasm of resting cells. After 2 day PHA stimulation, KDSl stains strongly in the nucleus with KDS 1 staining in the cytoplasm. This staining pattern indicates that KDSl may translocate to the nucleus.
  • PHA phytohemaglutanin

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

La présente invention a trait à des molécules KDS associées à une transduction de signal. L'invention concerne des compositions données, telles que des molécules d'acides nucléiques KDS, des protéines KDS, des anticorps immunoréactifs vis-à-vis de ces protéines KDS, et des préparations de ces compositions. Les protéines KDS selon l'invention renferment un domaine kinase apparenté au domaine kinase de la protéine de levure Ste20. En outre, les protéines KDS selon l'invention présentent une activité de kinase. Cette invention traite également de procédés de modulation des protéines KDS destinés à moduler une voie de transduction de signal dans une cellule, et d'analyses visant à identifier d'autres agents pouvant moduler la fonction biologique de ces protéines KDS.
PCT/US1998/014231 1997-07-08 1998-07-07 Molecules de proteine kinase kds et utilisations de ces molecules WO1999002699A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU82966/98A AU8296698A (en) 1997-07-08 1998-07-07 (kds) protein kinase molecules and uses related thereto

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US88951897A 1997-07-08 1997-07-08
US08/889,518 1997-07-08

Publications (1)

Publication Number Publication Date
WO1999002699A1 true WO1999002699A1 (fr) 1999-01-21

Family

ID=25395271

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/014231 WO1999002699A1 (fr) 1997-07-08 1998-07-07 Molecules de proteine kinase kds et utilisations de ces molecules

Country Status (2)

Country Link
AU (1) AU8296698A (fr)
WO (1) WO1999002699A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053076A1 (fr) * 1998-04-14 1999-10-21 Board Of Regents, The University Of Texas System Proteine kinases tao et leurs methodes d'utilisation
WO1999053036A2 (fr) * 1998-04-14 1999-10-21 Sugen, Inc. Proteines kinases apparentees a la famille de ste20
US7078182B1 (en) 1998-04-14 2006-07-18 Board Of Regents, The University Of Texas System TAO protein kinase polypeptides and methods of use therefor

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CRASY C L ET AL: "CLONING AND CHARACTERIZATION OF A HUMAN PROTEIN KINASE WITH HOMOLOGY TO STE20", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 37, 15 September 1995 (1995-09-15), pages 21695 - 21700, XP002054149 *
SUSUMU ITOH ET AL.: "Molecular cloning and characterization of a novel putative STE20-like kinase in Guinea pigs", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 340, no. 2, 15 April 1997 (1997-04-15), pages 201 - 207, XP002079735 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053076A1 (fr) * 1998-04-14 1999-10-21 Board Of Regents, The University Of Texas System Proteine kinases tao et leurs methodes d'utilisation
WO1999053036A2 (fr) * 1998-04-14 1999-10-21 Sugen, Inc. Proteines kinases apparentees a la famille de ste20
WO1999053036A3 (fr) * 1998-04-14 2000-05-11 Sugen Inc Proteines kinases apparentees a la famille de ste20
US6165461A (en) * 1998-04-14 2000-12-26 Board Of Regents, University Of Texas System Tao protein kinases and methods of use therefor
US6586242B1 (en) 1998-04-14 2003-07-01 Board Of Regents, The University Of Texas System TAO protein kinases and methods of use therefor
US6656716B1 (en) 1998-04-14 2003-12-02 Sugen, Inc. Polypeptide fragments of human PAK5 protein kinase
US6680170B2 (en) 1998-04-14 2004-01-20 Sugen, Inc. Polynucleotides encoding STE20-related protein kinases and methods of use
US7078182B1 (en) 1998-04-14 2006-07-18 Board Of Regents, The University Of Texas System TAO protein kinase polypeptides and methods of use therefor
US7153683B2 (en) 1998-04-14 2006-12-26 Board Of Regents, The University Of Texas System TAO protein kinase polypeptides and methods of use therefor

Also Published As

Publication number Publication date
AU8296698A (en) 1999-02-08

Similar Documents

Publication Publication Date Title
US6147192A (en) Tub interactor (TI) polypeptides and uses therefor
US6211334B1 (en) Cell-cycle regulatory proteins, and uses related thereto
US5800998A (en) Assays for diagnosing type II diabetes in a subject
US5807708A (en) Conservin nucleic acid molecules and compositions
JP2010004892A (ja) 新規なヒトデルタ３組成物ならびにそれらの治療および診断への使用方法
CA2285020A1 (fr) Nouvelles compositions contenant des proteines d'origine humaine delta3
US5885776A (en) Glaucoma compositions and therapeutic and diagnositic uses therefor
US5795726A (en) Methods for identifying compounds useful in treating type II diabetes
US6399760B1 (en) RP compositions and therapeutic and diagnostic uses therefor
US6221841B1 (en) General receptors for phosphoinositides and uses related thereto
US6472170B1 (en) BCL-Xy, a novel BCL-X isoform, and uses related thereto
WO1998005777A9 (fr) BCL-xη, UNE NOUVELLE ISOFORME DE BCL-x, ET UTILISATIONS ASSOCIEES
WO1997011176A2 (fr) Proteines associees a cycline kinases dependantes de la cycline ckd, et utilisations qui y sont liees
US7141543B2 (en) RIEG compositions and therapeutic and diagnostic uses therefor
WO1999002699A1 (fr) Molecules de proteine kinase kds et utilisations de ces molecules
CA2271235A1 (fr) Proteine associee au glaucome, acide nucleique correspondant et leurs utilisations diagnostiques et therapeutiques
US5994070A (en) Trio molecules and uses related thereto
WO1998046748A1 (fr) Compositions therapeutiques et dosages de diagnostic pour des affections liees a la trbp
US6475778B1 (en) Differentiation enhancing factors and uses therefor
US6008014A (en) Method of making lipid metabolic pathway compositions
US6271026B1 (en) Glaucoma compositions
US7396905B1 (en) Calcipressins: endogenous inhibitors of calcineurin, uses and reagents related thereto
WO1998009979A9 (fr) Compositions relatives a la voie metabolique lipidique et utilisations therapeutiques et diagnostiques de telles compositions
US20040142440A1 (en) Seryl transfer RNA synthetase polynucleotides and polypeptides and methods of use thereof
AU743207B2 (en) Cell-cycle regulatory proteins, and uses related thereto

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: KR

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA