WO1998056953A1 - Procedes de detection de cellules thyroidiennes - Google Patents

Procedes de detection de cellules thyroidiennes Download PDF

Info

Publication number
WO1998056953A1
WO1998056953A1 PCT/US1998/011934 US9811934W WO9856953A1 WO 1998056953 A1 WO1998056953 A1 WO 1998056953A1 US 9811934 W US9811934 W US 9811934W WO 9856953 A1 WO9856953 A1 WO 9856953A1
Authority
WO
WIPO (PCT)
Prior art keywords
thyroid
cell
cells
seq
nucleotides
Prior art date
Application number
PCT/US1998/011934
Other languages
English (en)
Inventor
Michael A. Levine
Matthew D. Ringel
Original Assignee
Johns Hopkins University School Of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University School Of Medicine filed Critical Johns Hopkins University School Of Medicine
Priority to AU78305/98A priority Critical patent/AU7830598A/en
Publication of WO1998056953A1 publication Critical patent/WO1998056953A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966—Animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to the field of thyroid endocrinology, in particular thyroid cancer therapy and monitoring.
  • the present invention relates to an assay useful for monitoring individuals for presence of viable thyroid tissue.
  • the present invention relates to a RT-PCR assay for thyroid-specific mRNA transcripts in peripheral blood samples, the presence of which transcripts indicates the presence of circulating thyroid cells. In patients who have undergone thyroidectomy, for example as a treatment for thyroid malignancy, presence of functional thyroid cells indicates the persistence or recurrence of disease.
  • TSH thyroid-stimulating hormone
  • thyroid cancer affects a relatively young population, with most patients in their 40's and 50's. Thus, in this country an estimated 1 88,000 individuals are monitored for tumor recurrence or progression of persistent disease, as either may occur many years after initial treatment (National Cancer Institute Fact Book, U.S. Department of Health and Human Services, Public Health Service, National Institutes of Health, 1 993; Robbins et al.. 1 991 r Ann. Int. Med. r 1 1 5(2): 1 33-147). Techniques currently utilized to detect recurrent or residual thyroid cancer include periodic total body iodine radioisotope ( 131 l) scanning and immunoassay of serum concentrations of thyroglobulin protein.
  • Tg serum thyroglobulin
  • thyroid cancers produce variant forms of Tg that escape detection by standard Tg immunoassays, and thus yield falsely low values of serum Tg (Olivieri et al., 1 991 , Thyroidology, 3: 1 3-1 6) .
  • Radioimmunoassay (RIA) of serum Tg and measurements of I 131 indicate the recurrence of cancer indirectly, because a positive result requires that the function of thyroid cells be observable; in addition, the cells must be differentiated in order to synthesize Tg and to concentrate 131 l, as these cellular activities are typical only of mature, stimulated thyroid epithelial cells. As a result, the utility of such tests is limited by the functional status of the thyroid cells to be detected.
  • the drawbacks of current methodology would be overcome by an assay that more directly detects the presence of thyroid cells, that detects thyroid cells that are not fully differentiated or not normally functional, and that would be easily performed with widely available laboratory equipment, and without the necessity of exposing the patient to the dangers and discomfort of thyroid hormone withdrawal.
  • a further advantage would be an assay that could be performed using an easily obtained peripheral blood sample and that would be more sensitive than currently available immunoassays and would not be susceptible to artifacts that confound standard assays.
  • the present invention provides a method for the detection of the presence of thyroid epithelial cells in a patient, comprising the step of detecting a transcript of a thyroid specific gene in a sample of reverse-transcribed total RNA of cells of blood, wherein detection is indicative of the presence of thyroid epithelial cells.
  • Another aspect of the invention is a method for monitoring in a recovering thyroid cancer patient the recurrence of disease, comprising the step of detecting in a sample of reverse-transcribed total RNA of cells of blood a transcript of a thyroid-cell-specific gene, wherein the cells of blood are obtained from a recovering thyroid cancer patient and wherein detection of such a transcript is indicative of the recurrence of disease.
  • reverse-transcribed RNA and “reverse- transcribed total RNA” refer to DNA which is produced by the method in which an mRNA template is primed for second-strand nucleic acid synthesis by hybridization of an oligonucleotide primer, which synthesis is then carried out using the enzyme reverse transcriptase.
  • DNA is referred to as complementary DNA (cDNA).
  • total refers to cDNA which is produced by a synthesis reaction in which hybridization of the oligonucleotide primer to the mRNA template is not limited by sequence specificity to a particular transcript, but instead may prime all, or nearly all (e.g. greater than 90%, preferably greater than 95%, and most preferably greater than 99%) of the mRNA.
  • oligonucleotide primer refers to a nucleic acid molecule 6 to 1 00 nucleotides or ribonucleotides in length, preferably 10 to 40 nucleotides in length, most preferably 1 5 to 30 nucleotides in length, which is used to prime an enzymatic nucleic acid synthesis reaction.
  • oligonucleotide primer may anneal either to a sequence of a particular gene of interest, or to a sequence common to many genes; in the latter case, the term “oligonucleotide primer” may refer to a pool of nucleic acid molecules wherein each molecule has the same sequence (e.g., oligo dT or another sequence which is shared among many genes), or wherein the molecules of the pool differ in sequence from one another (e.g., a pool of random oligonucleotides).
  • the sequence to which an oligonucleotide primer or oligonucleotide probe, as defined below, anneals is termed a "site", also as defined below.
  • thyroid-specific preferably refers to that which is expressed or otherwise found or produced only in cells of thyroid tissue, particularly in thyroid epithelial cells, but may also include a gene, mRNA transcript or protein which is expressed in thyroid cells or tissue and is additionally expressed in one or a plurality of other cell or tissue types, which plurality does not encompass all cell types of a human or other subject mammal. It is contemplated that when the term “thyroid-specific” refers to a gene, mRNA or protein which is expressed or otherwise found or produced in tissues in addition to thyroid tissue, the number of additional tissues typically will be small (e.g., 1 to 5) .
  • the term “gene” refers to a nucleic acid sequence of a human or other mammal which is transcribed, and includes exons and introns.
  • exon refers to a portion of a gene, which portion is selected from the group that includes protein coding sequences, 5'- untranslated sequences and 3'-untranslated sequences of a gene.
  • intron refers to a non-coding portion of a gene which is excised from between adjacent exons during post-transcriptional processing of an mRNA molecule. Such splicing occurs at the 5' and 3' ends of an intron, such that the 3' end of the exon upstream of an intron is joined to the
  • nucleic acid refers to DNA and RNA, which may be either single- or double-stranded and may be either linear or circular.
  • the reverse-transcribed total RNA is from a cell lysate of cells isolated from peripheral blood.
  • peripheral blood refers to blood which is drawn from a vessel (e.g. a vein) that does not drain from the tissue of interest, in this case, thyroid tissue.
  • Peripheral blood which is advantageously used according to the invention includes, but is not limited to, blood which is drawn from a brachial or femoral vein.
  • the invention encompasses an assay for the presence of thyroid epithelial cells in a peripheral blood sample from a patient, performed by lysing the cells of the blood sample, isolating RNA from the lysed cells of the sample and detecting thyroid-cell-specific transcripts in the RNA.
  • thyroid cells are detected by the method comprising:
  • DNA and proteins are removed from the cell lysate prior to precipitating the said total RNA.
  • the RNA analysis comprises subjecting the RNA to reverse transcription and the polymerase chain reaction (RT-PCR), wherein a first strand cDNA transcript is prepared from mRNA, followed by PCR amplification of all or a specific fraction of the resulting cDNA.
  • PCR is advantageously directed at amplification of thyroid-specific transcripts, that is, cDNA encoding protein products that are specific to living thyroid tissue, such as thyroglobulin (Tg), thyroid peroxidase (TPO), the sodium iodide symporter (NIS), Pax-8, thyroid transcription factor 1 (TTF-1 ) and thyroid transcription factor 2 (TTF-2).
  • Tg thyroglobulin
  • TPO thyroid peroxidase
  • NIS sodium iodide symporter
  • Pax-8 thyroid transcription factor 1
  • TTF-1 thyroid transcription factor 2
  • TTF-2 thyroid transcription factor 2
  • a most sensitive assay utilizes a reverse transcriptase reaction that is primed with oligo-dT or random oligonucleotides to optimally synthesize a pool of cDNA.
  • the reverse transcription will be primed with random hexanucleotides so as to create a heterogeneous pool of cDNA transcripts that is representative of the population of mRNA molecules in thyroid cells, allowing for the subsequent PCR amplification of multiple thyroid-specific transcripts.
  • a PCR amplification of the cDNA is primed with pairs of oligonucleotides that anneal to sequences unique to thyroid-cell-specific gene exons and that each oligonucleotide of the pair of primer oligonucleotides anneals to sequences in a different exon of the thyroid-cell-specific gene than does the other, such that one or more introns are present between the exons.
  • This protocol allows for the generation of DNA fragments after PCR of cDNA that are smaller than the size of DNA fragments that would be generated should contamination with genomic DNA occur.
  • Another aspect of the present invention is a method for the detection of the presence of thyroid epithelial cells in a patient, comprising providing a sample of reverse-transcribed RNA from ceils of blood of a patient, performing a polymerase chain reaction (PCR) to amplify thyroid-cell-specific transcripts present in the reverse-transcribed RNA, wherein the PCR is primed with oligonucleotides that hybridize to a unique pair of sites comprising a first site and a second site in a thyroid-cell-specific gene and wherein the first and second sites are present in two different exons of the gene, such that their predicted PCR product spans one or a plurality of introns, and, performing a detection step to detect such a PCR product, wherein detection of the PCR product is indicative of the presence of thyroid epithelial cells.
  • PCR polymerase chain reaction
  • the sample comprises reverse-transcribed total RNA.
  • the term "site" refers to a nucleic acid sequence present in a gene, mRNA transcript or cDNA, which sequence is long enough to permit specific hybridization of an oligonucleotide primer or probe (i.e., hybridization under stringent conditions) yet sufficiently short to allow for the exclusion of highly repetitive nucleic acid sequences; such a sequence is usefully from 6 to 100 nucleotides in length, preferably from 10 to 40 nucleotides in length, and most preferably from 1 5 to 30 nucleotides in length.
  • stringent conditions refers to salt concentrations of less than about 1 M, more usually less than about 500 mM and preferably less than about 200 mM.
  • Hybridization temperatures range from as low as 0°C to greater than 22°C, greater than about 30°C, and (most often) in excess of about 37°C. Longer fragments may require higher hybridization temperatures for specific hybridization.
  • the combination of parameters is more important than the absolute measure of any one alone.
  • the term "unique" refers to the presence of such a pair of sites only in the thyroid-specific gene of interest, insofar as such information is known.
  • a pair of primer sequences (and, hence, the sites to which they bind) are tested empirically for uniqueness in a biological sample (e.g., a blood sample) comprising the transcript from the organism prior to use of the primer pair in the methods of the invention.
  • a single band of the size predicted from prior knowledge of the relevant mRNA sequence, either alone or accompanied by a single larger band resulting from amplification of the corresponding genomic DNA sequence comprising one or more intronic regions, is indicative of uniqueness of the sites to the gene of interest.
  • biological sample refers to a whole organism or a subset of its tissues, cells or component parts (e.g. body fluids, including but not limited to blood, serum, plasma, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen) .
  • body fluids including but not limited to blood, serum, plasma, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen.
  • Biological sample further refers to a homogenate, lysate or extract prepared from a whole organism or a subset of its tissues, ceils or component parts, or a fraction or portion thereof.
  • biological sample refers to a medium, such as a nutrient broth or gel in which an organism has been propagated, which contains cellular components, such as nucleic acid molecules. Most preferred in the present invention is a biological sample which comprises peripheral blood of a human.
  • the invention futher encompasses a method for the detection of the presence of thyroid-cell-specific mRNA transcripts in a patient, comprising the steps of providing a sample of reverse-transcribed total RNA from cells of blood, performing a polymerase chain reaction (PCR) to amplify thyroid-cell-specific transcripts present in the sample, wherein the PCR is primed with oligonucleotides that hybridize to a unique pair of sites comprising a first site and a second site in a thyroid-cell-specific gene and wherein the first and second sites are present in two different exons of the gene, such that their predicted PCR product spans one or a plurality of introns, and, performing a detection step to detect a PCR product which is thyroid-cell-specific, wherein detection of such a PCR product is indicative of the presence of thryoid-cell-specific mRNA transcripts in the patient.
  • PCR polymerase chain reaction
  • the invention additionally provides a method for monitoring in a recovering thyroid cancer patient the recurrence of disease, comprising the steps of providing a sample of reverse transcribed RNA from cells of blood, wherein the cells are obtained from a recovering thyroid cancer patient, performing a polymerase chain reaction (PCR) to amplify thyroid-cell-specific transcripts present in the sample, wherein the PCR is primed with oligonucleotides that hybridize to a unique pair of sites comprising a first site and a second site in a thyroid-cell-specific gene and wherein the first and second * sites are present in two different exons of the gene, such that their predicted PCR product spans one or a plurality of introns, and, performing a detection step to detect a PCR product, wherein detection of a PCR product is indicative of the recurrence of disease in the patient.
  • PCR polymerase chain reaction
  • the cells of blood are obtained from whole blood.
  • the cells of blood are obtained from a fraction of whole blood enriched for one or a plurality of cell types.
  • such a fraction is isolated by centrifugation and is the erythrocyte fraction.
  • the fraction is isolated by cell sorting.
  • cell sorting is performed using an antibody or plurality of antibodies recognizing an epitope or plurality of epitopes specific to epithelial cells, which become selectively enriched in the cell fraction so isolated.
  • the antibody is anti-cytokeratin.
  • the epithelial cells are thyroid epithelial cells. It is preferred that the antibody is selected from the pair including anti- thyroglobulin and anti-thyroid-stimulating-hormone-receptor, and highly preferred that the antibody is anti-thyroid-stimulating-hormone-receptor.
  • the RNA or the total RNA is tested to detect a thyroid-cell-specific transcript encoding a protein selected from the group that includes thyroglobulin (Tg) and the sodium iodide symporter (NIS) and the detection is effective to detect the presence of differentiated thyroid cells.
  • Tg thyroglobulin
  • NIS sodium iodide symporter
  • the RNA or total RNA is tested to detect said thyroid-cell- specific transcripts selected from the group encoding Tg, Pax-8 and TTF-1 , and said detection is effective to detect the presence of undifferentiated- or poorly- differentiated thyroid cells.
  • providing of a reverse-transcribed sample comprises the step of performing a reverse transcription of mRNA of cells of blood from the patient. It is preferred that the reverse transcription is primed with primers selected from the group that includes oligo-dT and random oligonucleotides. It is also preferred that the oligonucleotides are hexanucleotides.
  • the thyroid-cell-specific gene encodes a protein selected from the group comprising thyroglobulin (Tg), thyroid peroxidase (TPO), Pax-8, thyroid transcription factor 1 (TTF-1 ) and thyroid transcription factor 2 (TTF-2) and the sodium iodide symporter (NIS), more preferably, the thyroid-cell-specific gene encodes a protein selected from the group comprising Tg, Pax-8, TTF-1 and NIS, and, most preferably, the thyroid-cell-specific gene encodes Tg.
  • Tg thyroglobulin
  • TPO thyroid peroxidase
  • Pax-8 thyroid transcription factor 1
  • TTF-2 thyroid transcription factor 2
  • NIS sodium iodide symporter
  • thyroid-cell-specific gene encoding Tg is to be amplified is the use of a PCR primer pair comprising: mdr ⁇ : 5'-TGTGAGCTGCAGAGGGAAACGGCC-3' [SEQ ID NO: 1 , nucleotides 1 41 through 1 64], and mdr7: 5'-ATACACCTCCATCCCCTCTGCGTCCACACA-3' [SEQ ID NO: 1 , reverse complement of nucleotides 459 through 488], or, alternatively, a primer pair comprising:
  • PCR primer pair comprising the following:
  • PCR primer pair comprising:
  • the thyroid-cell-specific gene encodes NIS
  • the PCR primer pair comprising:
  • the above methods comprise the step, after the step of detecting a PCR product which is thyroid-cell-specific, of performing a measurement to quantitate the amount of the product so detected.
  • the measurement comprises use of a fluorometric oligonucleotide probe specific for one or more of the PCR products produced from the recited thyroid-cell-specific transcripts.
  • oligonucleotide probe refers to a nucleic acid molecule having the properties of an oligonucleotide primer, as defined above, with the exception that it is complexed to a label (e.g., a fluorescent, chemiluminescent, radioactive or chromogenic molecule) and hybridized to a target nucleic acid molecule for the purpose of detecting such a molecule.
  • a label e.g., a fluorescent, chemiluminescent, radioactive or chromogenic molecule
  • Most useful are oligonucleotide probes which hybridize to a sequence which is found only in the gene or gene product which is to be detected.
  • the fluorometric oligonucleotide is labeled at its 5' end with a dye selected from the group that includes 6-carboxy-fluorescein (FAM), tetrachloro-6-carboxy-fluorescein (TET), 2,7-dimethoxy-4,5-dichloro-6- carboxyfluorescein (JOE) and hexachloro-6-carboxy-fluorescein (HEX) .
  • FAM 6-carboxy-fluorescein
  • TET tetrachloro-6-carboxy-fluorescein
  • HEX hexachloro-6-carboxy-fluorescein
  • the thyroid-cell-specific transcript is that which encodes Tg.
  • the fluorometric oligonucleotide probe comprises the following nucleic acid sequence:
  • the thyroid-cell-specific transcript is that which encodes NIS.
  • the fluorometric oligonucleotide probe comprises the following nucleic acid sequence:
  • a final aspect of the present invention is a method for the detection of the presence of thyroid epithelial cells in a human, comprising the steps of using a cell-sorting procedure to separate a cell fraction comprising the thyroid epithelial cells from a sample of blood of the human, and performing a detection step to detect the thyroid epithelial cells in the fraction.
  • the human is a recovering thyroid cancer patient.
  • the cell-sorting procedure comprises magnetic cell sorting
  • the cell-sorting procedure employs an antibody directed against a thyroid-cell-specific antigen, and most preferred that the thyroid-cell-specific antigen is the human thyrotropin receptor.
  • the present invention is useful for monitoring the recovery of individuals treated for thyroid disorders, such as thyroid carcinoma, with complete thyroidectomy.
  • the method is also useful in any situation where extremely sensitive detection of any residual living thyroid tissue in an individual or a biological sample is desired.
  • the method of the present invention is much more sensitive than current methods in which antibodies are used to detect thyroid cell proteins or which are based on iodine metabolism.
  • the method can make use of a small sample of whole blood and avoids the necessity and danger to the patient of withdrawal of thyroid hormone to induce hypothyroidism and consequent release of TSH.
  • the method is able to detect recurrence of abnormal thyroid tissue, e.g., thyroid tumors having poorly differentiated or undifferentiated thyroid epithelial cells.
  • FIG. 1 is a schematic diagram illustrating the effect of thyroid stimulating hormone (TSH) on thyroid functions, such as cell proliferation, iodine uptake, transcription of thyroid-cell-specific genes and the production and release of thyroid hormone, which subsequently inhibits TSH release in a negative feedback loop.
  • Figure 2 shows ethidium bromide staining of RT-PCR products derived from two thyroid mRNA dilution series. Approximate numbers of thyroid cells per ml of blood are indicated.
  • Fig. 2A a positive thyroid control (Thy) is included, as well as two reverse-transcription-negative PCR controls (Thy and Ly) derived from thyroid and lymphocyte cells.
  • Thy a positive thyroid control
  • Thy and Ly reverse-transcription-negative PCR controls
  • Figure 3 presents Tg RT-PCR results from normal subjects and recovering thyroid cancer patients. Iodine uptake scan results are indicated (1 , normal control patient; 2, uptake in thyroid bed; 3, no uptake in thyroid bed; 4, metastases; 5, no metastases). Reverse-transcribed samples ( + ) as well as negative controls in which samples were not reverse transcribed (-) are presented. Negative reverse transcription (RT) and PCR controls performed on water are indicated (H 2 0) . Ethidium bromide staining is shown above the corresponding Southern blot.
  • Figure 6 presents the direct detection of thyroid cells in human peripheral blood.
  • the present invention relates to a novel method for detecting living thyroid tissue in a patient or a biological fluid such as a blood sample or even a cell culture suspected of containing thyroid cells.
  • the method is especially useful where sensitive detection of any living thyroid epithelial cells is critical.
  • the method of the present invention may be applied in any circumstance where detection of thyroid cells is important, the most important application of the method is in detection of residual living thyroid tissue in individuals who have undergone therapeutic thyroidectomy, for instance as a treatment for thyroid cancer.
  • the method will be described in more detail below with special reference to this therapeutic context, however it will be understood by persons skilled in this art that additional applications may be devised by following the principles described herein.
  • the method involves isolation of total RNA from peripheral blood drawn from a patient and reverse transcription of the RNA to create a pool of cDNA molecules, from which selected thyroid-cell-specific cDNA transcripts are amplified using PCR, followed by detection of the amplified thyroid-specific transcripts.
  • a thyroid-specific transcript is one that is expressed in thyroid epithelial cells, but (generally) not in other cell types.
  • the thyroid specificity of a gene can be assayed by conventional methods, for example by subtractive analysis:
  • mRNA is prepared from a candidate tissue (say, the thyroid gland) and transcripts common to it and other cell types are removed by
  • thyroid stimulatory hormone receptor gene (TSHr; Genbank accession number M3221 5), which is also expressed in lymphocytes, the sodium iodide symporter gene [SEQ ID NO: 4], expressed in salivary cells, gastric mucosa and other tissues at low levels, Pax-8 [SEQ ID NO: 2], the transcript of which is found in renal and pulmonary tissue, TTF-1 [SEQ ID NO: 3], which is transcribed in lungs and TTF-2, which is expressed in the anterior pituitary.
  • TSHr thyroid stimulatory hormone receptor gene
  • SEQ ID NO: 4 the sodium iodide symporter gene
  • Pax-8 the transcript of which is found in renal and pulmonary tissue
  • TTF-1 [SEQ ID NO: 3] which is transcribed in lungs
  • TTF-2 which is expressed in the anterior pituitary.
  • thyroglobulin and NIS genes are advantageous to use sequences of the thyroglobulin and NIS genes according to the invention, since those genes are efficiently expressed in all differentiated thyroid cells; however, it is sometimes necessary to apply the methods of the invention to the detection of poorly-differentiated or undifferentiated thyroid cells.
  • These cells are known to express Pax-8, TTF-1 and TTF-2 in many cases; of these, Pax-8 and TTF-1 are well characterized at the molecular level, and so can be utilized as an alternative to Tg. While the expression of neither gene is restricted to cells of the thyroid epithelium, expression of this combination of genes is uniquely thyroid-specific, which is sufficient to prevent false positive results that might result from the use of either alone.
  • Example 1 we have compared the accuracy of Tg detection using the present invention to that of conventional Tg immunoassays on a group of thyroid cancer patients both on and off of thyroid hormone therapy.
  • the thyroid-specific mRNA RT-PCR assay of the present invention provides a highly sensitive assay for monitoring the course of treatment and recovery of thyroid disease patients while advantageously limiting the number of patients who must unnecessarily undergo dangerous thyroid hormone withdrawal to monitor for disease recurrence.
  • RNA is obtained from a patient or biological sample.
  • RNA is prepared from a small sample of human blood.
  • RT reverse transcription
  • the RNA is converted to first strand cDNA, which is relatively stable and is a suitable template for a PCR reaction.
  • the cDNA template of interest is amplified using PCR.
  • sequences are selected from within coding regions of the gene of interest such that they will anneal specifically to unique sites.
  • Each of the two primers in a pair is designed such that it will anneal to a unique exon and such that one or more introns are present between the two exons. Therefore, the predicted PCR product will be larger if amplified from genomic DNA than it would be if amplified from cDNA, thereby providing a rigorous control to detect amplification of genomic DNA that might contaminate a PCR component.
  • RT-PCR has been used to detect the presence of micro-metastases by amplification of various cell-type specific mRNA transcripts from peripheral blood.
  • prostate specific antigen that of prostate specific antigen
  • the sensitivity and specificity of this test compared to clinically utilized immunometric tests is estimated to be 70-90%.
  • RT-PCR approach involves a second round of amplification performed on a PCR-amplified DNA
  • RNA isolation from whole blood appears to be more effective than RNA isolation from the mononuclear cell layer. This may be related to the density or "stickiness" of malignant thyroid epithelial cells. Although most epithelial cells appear to sediment with mononuclear cells in a polysucrose gradient, we performed RT-
  • RNA from the mononuclear cell fraction would be likely to decrease the sensitivity of the assay relative to the use of whole blood or the erythrocyte fraction.
  • cDNA complementary DNA
  • the sensitivity of our assay may be further improved by the application of cell-sorting technology to the enrichment of thyroid epithelial cell populations within blood samples, making earlier detection of cancer recurrence possible.
  • cell-sorting technology to enrich for circulating epithelial carcinoma cells such as colon cancer cells, breast cancer cells and prostate cancer cells, but not thyroid cancer cells, in peripheral blood (Wong et al., 1 995, Br. J. Surg., 82: 1 333-1 337; Griwatz et al., 1 995, J. Immunol. Melt 1 83(2): 251 -265; Dobrovic, 1 997, BioTechniques, 22: 100-104) .
  • Preferred among these techniques is magnetic cell sorting (MACS Magnetic Cell
  • Magnetic cell sorting Systems Milletenyi Biotec, Auburn, CA. This technique utilizes ferromagnetic beads conjugated with cell-specific monoclonal antibodies to separate specific cell populations from whole blood. The enriched population can then be evaluated by RT-PCR following cell lysis. These systems allow for a 1 0,000 fold enrichment of cells so that as few as one cell in 1 0 7 can be enriched to one in 10 3 cells. Although this technique has been used to detect circulating prostate cancer cells and breast cancer cells in patients with documented metastatic disease, these enrichment techniques have not been previously applied to patients with thyroid cancer. Magnetic cell sorting is carried out by first treating whole blood or buffy coat layers with saponin or other suitable detergents to lyse erythrocytes.
  • Cells are fixed with formaldehyde, washed, and incubated with ferromagnetic beads to which a specific antibody has been bound. When the antibody binds to its target, that cell becomes labeled.
  • the bound cells are enriched relative to other cells by passing the cells through columns containing powerful magnetic gradients. This yields a specific cell population that can be further analyzed by either immunological or RT-PCR techniques.
  • a thyroid cell-specific antibody such as an antibody recognizing the TSH receptor, may advantageously be used for this enrichment step. Circulating thyroid cells may also be isolated selectively by incubating
  • Taq DNA polymerase Each time the primers anneal to their complementary sequence, Taq DNA polymerase is activated, it cleaves off the fluorescent reporters by its 5' nuclease activity and does not digest the free reporter. The reporters, now free of the quenchers, fluoresce. The color change is proportional to the amount of each specific product and is measured by fluorometer; therefore, the amount of each color can be measured and the RT-PCR product can be quantified at the end of each PCR cycle. Thus, the product amount at any particular PCR cycle and the cycle at which the specific product is identified (threshold cycle) can be determined for each sample.
  • the PCR reactions can be performed in 96 well plates so that many patient samples can be processed and measured simultaneously.
  • the TaqmanTM system has the additional advantage of not requiring gel electrophoresis and allows for quantification when used with a standard curve.
  • a synthetic DNA template For quantitation of Tg mRNA in peripheral blood, a synthetic DNA template can be created having a similar size and with sequences matching the thyroid-cell- specific gene primers on the ends, allowing for competitive RT-PCR.
  • 20 competitor may be prepared using known methods, such as the PCR MIMICTM construction kit (Clontech, Palo Alto, CA) to create a similar-sized DNA fragment with Tg PCR primers on the 5' and 3' ends that can be separated from amplified Tg cDNA by gel electrophoresis.
  • the double stranded competitor DNA product is made by PCR amplification of a heterologous DNA fragment using composite oligonucleotide primers containing sequences specific to either end of the MIMIC DNA sequence 3' to Tg 5'-specific sequences. This allows for amplification of the competitor DNA with Tg sequences on the ends.
  • the quantity of DNA is determined by standard methods, and dilutions are made to use in competitive PCR. A standard curve is created by addition of varying amounts of competitor
  • PCR products may be electrophoresed on polyacrylamide gels and quantified by laser densitometry following Southern blot or by performing radio-labeled PCR using [ ⁇ 32 P] dCTP.
  • the different-sized products may be quantified fluorometrically, if primers are labeled with fluorometric dyes, using an automated DNA sequencer.
  • concentration of Tg cDNA reverse transcribed from peripheral blood is equal to the amount of competitor DNA added that results in equivalent Tg and competitor PCR products.
  • Another method by which to quantify the amount of thyroid-cell-specific mRNA in blood is by "spiking" negative whole blood samples with known amounts of human thyrocytes to create a standard curve of number of thyroid cells/ml of whole blood.
  • a template standard curve can be linearized byusing the threshold cycle rather than the final amount of product as the data points.
  • Such a quantitative assay is important for the monitoring of disease progression and for uses in other thyroid disorders, such as autoimmune thyroiditis or Graves' Disease (see end of Example 4, below) . For this procedure, estimation of the number of cells per ml of whole blood, standards
  • thyroid tissue is washed and minced in cold Hanks' calcium and magnesium-free balanced salt solution (HBS) and digested with dispase ( 1 mg/ml) and collagenase (1 00 lu/ml; Boehringer Mannheim, Indianapolis, IN) in 10 ml HBS at 37°C for 1 hour with gentle pipette disruption every 1 5 minutes.
  • HBS Hanks' calcium and magnesium-free balanced salt solution
  • RNA isolation and RT-PCR are performed as above for each sample, and the reaction product is quantified either by laser densitometry after autoradiography, or by either of the techniques described above.
  • double-stranded cDNA is ligated into a vector that contains sequences for RNA polymerase start sites (e.g., SP6, T3 or T7), which can be selected for transfection by ampicillin sensitivity, and is suitable for single-stranded DNA (e.g., pGEM ® -3Z Vector; Promega, Madison, Wl).
  • RNA polymerase start sites e.g., SP6, T3 or T7
  • single-stranded DNA e.g., pGEM ® -3Z Vector; Promega, Madison, Wl.
  • the correct identity and orientation of the cDNA in the plasmid is confirmed by direct sequencing.
  • the plasmid is linearized by restriction digestion at a site near the 3' end of the cDNA, and sense RNA is synthesized using RNA polymerase (Riboprobe Combination System ® ; Promega) . Specific amounts of Tg RNA, or another thyroid-specific RNA of interest, are added
  • the method of the present invention may advantageously be performed in a single tube reaction for reverse transcription of RNA and specific amplification of thyroid-specific transcripts.
  • This system utilizes two enzymes, AMV reverse transcriptase to prepare first strand cDNA, and the thermostable Tfl DNA polymerase for second strand cDNA synthesis and subsequent DNA amplification, with an optimized single buffer system that permits RT-PCR to be performed in one step. This simplifies the assay and minimizes the chance for contamination during preparation of a separate PCR reaction.
  • Commercial kits such as the AccessTM RT- PCR system (Promega; Madison, Wl) conveniently assemble all materials (except primers) necessary to carry out the method in this way.
  • the single-tube RT-PCR assay according to this technique has been used herein to amplify Tg mRNA from thyroid tissue and has been optimized for peripheral blood samples.
  • rTth polymerase Perkin Elmer, Foster City, CA
  • rTth polymerase Perkin Elmer, Foster City, CA
  • PCR product detection has been performed both by polyacrylamide gel electrophoresis and ethidium bromide staining and also by performing the PCR reaction in a 96-well plate in combination with the fluorescent detection system described above. Utilization of the fluorescent detection system in the one-tube system allows for the simple addition of RNA to a well containing the buffer, enzymes, dNTPs, primers and the detection probe
  • the method of this invention provides a clinically useful assay utilizing RT-PCR to detect thyroid-specific cellular functions.
  • the method provides a useful diagnostic tool with which to monitor the progression or recurrence of cancer of the thyroid without causing undue suffering for the patient being evaluated.
  • This assay can be adapted to yield quantitative data on thyroid activity that does not require labor-intensive detection methods such as gel electrophoresis and is, therefore, well-suited to use in hospital laboratories.
  • PCR primers capable of amplifying transcripts of abnormal, poorly differentiated or undifferentiated thyroid cells such as primers based on the coding sequences for PAX-8, TTF-1 or TTF-2, the method can be made sensitive to rare forms of thyroid cancer.
  • the method will be performed using primers for the amplification of two or more thyroid-specific transcripts. Most preferably, the method will be performed with primers to detect Tg, NIS and PAX-8.
  • the method can be performed with good sensitivity using whole blood; however, we have identified in sedimented blood a fraction to which thyroid epithelial cells preferentially segregate, namely, the erythrocyte layer, and accordingly sensitivity of the method can be enhanced by preparing mRNA from this cell fraction and/or through the application of other cell-sorting technologies.
  • the specifics of the inventive techniques are set forth in the following examples, which are meant to illustrate, but in no way limit the scope of, the invention.
  • Example 1 An experiment was conducted to detect the presence of circulating thyroid cells in patients with metastatic disease. After obtaining informed consent, 3 ml of peripheral venous blood was removed by standard phlebotomy from each of 77 post-surgical thyroid cancer patients. Sixty-eight of the 77 patients were evaluated during thyroid hormone suppression therapy. Thirty five of these patients had no evidence of residual or recurrent disease on most recent radioiodine scan performed after thyroid hormone withdrawal. Another 1 9 displayed neck uptake of radioiodine within the thyroid bed, which is indicative of eutopie (normal) thyroid tissue or cancer.
  • Each blood sample was immediately placed in a 50 ml sterile conical polypropylene tube containing 1 8 ml of TRIzol LS, an RNA extraction buffer (BRL, Life Technologies, Gaithersburg, MD), and 3 ml of diethylprocarbazine (DEPC, Sigma, St. Louis, MO) treated water; care was taken to mix the blood thoroughly in the TRIzol after addition to the tube. After initial centrifugation at 3400 RPM at
  • RNA purity and concentration were determined by spectrophotometric analysis of UV absorption at 260 nm and 280 nm.
  • RNA integrity was confirmed by amplification of lnterleukin-2 cDNA or G ⁇ s cDNA; therefore, it was ensured that any negative result subsequently observed on a test sample could be ascribed to a lack of that specific mRNA and not to degradation of the pool of mRNA or failure of the reverse transcription reaction.
  • Tg cDNA was amplified using oligonucleotide primers that span both the second and third Tg introns to inhibit amplification of genomic DNA and to provide a control by which amplification of genomic DNA, were it to occur, would be made obvious due to the size increase in the PCR product.
  • These primers were as follows; mdr ⁇ (exon 2): 5'-TGTGAGCTGCAGAGGGAAACGGCC-3' [SEQ ID NO: 1 , nucleotides 1 41 through 1 64], and mdr7 (exon 4): 5'-ATACACCTCCATCCCCTCTGCGTCCACACA-3' [SEQ ID NO: 1 , reverse complement of nucleotides 459 through 488].
  • Primer sequences were designed using the OLIGOTM Version 3.4 software package, which selects candidate regions within a given sequence that are optimized for annealing efficiency, for the likelihood that they will each prime only a
  • Oligonucleotide synthesis was performed on a Cyclone Plus DNA Synthesizer (Milligen/Biosearch, a division of Millipore; Bedford, MA). PCR was performed using 2 ⁇ l of the cDNA, 25 pmol of each Tg oligonucleotide primer (mdr ⁇ and mdr7), 2.5 ⁇ l of 10X PCR buffer 1 (Perkin-Elmer, Foster City, CA), 0.4 ⁇ l of 1 .25 ⁇ M dNTP, 0.1 5 ⁇ l of Taq DNA polymerase (Perkin Elmer, Foster City, CA) and deionized water to a total volume of 25 ⁇ l.
  • membranes were prehybridized at 42°C for at least 3 hours in a shaking water bath in a buffer containing 48% formamide, 4.8X SSC, 20 mM Tris, pH 7.6, 1 X Denhart's solution, 1 % SDS and 100 ⁇ g/ml heparin sulfate supplemented with 200 ⁇ g/ml denatured sheared salmon sperm DNA. 1 0
  • Tg internal oligonucleotide probe 27 pmoles of a Tg internal oligonucleotide probe were labeled using 32 P dATP (Amersham, Arlington Heights, IL) and T 4 polynucleotide kinase (BRL, Life Technologies, Gaithersburg, MD), and purified by chromatography using DE-52 (Whatman, Maidstone, England) Sephadex. Incorporated radioactivity was determined by analysis of an aliquot of the purified probe by liquid scintillation counting. The sequence of this probe, mdr ⁇ , is:
  • FIG. 2A shows ethidium bromide staining of RT-PCR products amplified from a dilution series of thyroid mRNA added to lymphoblastoid RNA derived from normal subjects
  • Figure 2B shows the results of a similar experiment in which thryoid mRNA was added to total RNA isolated from a athyreotic patient. Reverse transcriptase negative controls were performed for each sample and cDNA integrity was confirmed in parallel reactions in which either of the leukocyte-expressed transcripts Gas or IL-2 were amplified.
  • Tg RT-PCR and Tg-IRMA Optiquant assay; Kronus, San Juan Capistrano, CA
  • results were compared to most recent 13l l scan results and serum Tg immunoassay values determined after thyroid hormone withdrawal.
  • the 131 l scan results served as the "gold standard" against which the relative efficiencies of Tg RT-PCR and Tg-IRMA could be gauged, although in a clinical setting, such scan results are ordinarily assessed and used in combination with Tg immunoassay results.
  • Serum TSH concentration was also measured in an ultrasensitive assay (3rd generation THS; Nichols, San Juan Capistrano, CA) . Patients were considered to have residual normal or malignant thyroid tissue if the iodine uptake was greater than 0.01 % within the neck or metastatic uptake was demonstrated.
  • 29 assay detects the presence of normal and malignant cells and does not yield false negative results when significant thyroid tissue is present.
  • RT-PCR was negative in 80% of 35 patients tested on L- thyroxine therapy and in 75% of 8 patients tested after thyroid hormone withdrawal, while Tg-IRMA yielded negative results in 94% of 35 patients on L-T4 and in 88% of patients evaluated off of the drug. These may represent increased sensitivity of RT-PCR over radiographic scan, i.e. detection of thyroid activity in patients testing negative by current methods.
  • Tg mRNA RT-PCR assay Three mi of whole blood was used for the Tg mRNA RT-PCR assay, meaning that no additional phlebotomy was needed for the patients, as they would routinely have serum TSH and Tg-IRMA measured at those times. There were no specific gender or race requirements for patients enrolled in this study. The efficacy of the RT-PCR assay was compared to that of serum Tg- IRMA in identifying positive patients.
  • both Tg-IRMA and RT-PCR detected the presence of thyroid cells in all four patients with metastases; however, during L-thyroxine therapy, Tg-IRMA failed to detect the presence of cancer cells in two of these same patients, whereas RT-PCR once again correctly identified all four as having evidence of disease.
  • EXAMPLE 3 We are creating a mixed pool of reverse transcripts from cells of the peripheral blood and, in general, specifically amplifying Tg cDNA to detect thyroid
  • Tg transcripts 31 cells in that population; however, the expression of Tg transcripts is usually limited to differentiated thyroid cancers. Poorly-differentiated thyroid tumors that no longer express Tg often retain expression of three other relatively thyroid-specific transcripts, Pax-8 (a homeobox protein) and thyroid transcription factors 1 and 2 (TTF-1 and TTF-2)(Fabbro et al., 1 994, Cancer Res., 54: 4744-4749). While Pax-
  • TTF-1 in lungs and TTF-2 in the anterior pituitary gland
  • thyroid cells are the only known cells that express Pax-8 in combination with either TTF-1 or TTF-2 (Fabbro et al., supra). It is, therefore, desirable to examine these transcripts, which may be more useful than Tg in monitoring patients with poorly-differentiated thyroid carcinoma, and whose cDNA's can be amplified readily from the pool resulting from our random primed- reverse transcription.
  • TTF-2 is poorly defined and since expression of Pax-8 and TTF-1 are preserved in most thyroid tumors, including those with poorly-differentiated phenotypes (Fabbro et al., supra), we have used TTF-1 in conjunction with Pax-8.
  • Primer sequences were derived from the cDNA of Pax-8 and TTF-1 that span gene introns to exclude genomic DNA amplification. PCR conditions were optimized using RNA isolated from a normal thyroid gland and from two poorly- differentiated thyroid carcinoma cell lines (WRO and ARO, provided by Dr. R. Juillard, U.C.L.A., Los Angeles, CA) using TRizol LS as described above.
  • WRO and ARO poorly- differentiated thyroid carcinoma cell lines
  • Peripheral blood samples were obtained from patients with differentiated thyroid cancer as well as those with poorly-differentiated thyroid cancer and RT-PCR was performed as outlined above, including Southern blot analysis with internal oligonucleotide probes and sequencing of representative samples.
  • ARO and WRO cell lines were grown in RPMI 1 640 medium with 10% fetal bovine serum in 1 50 cm 2 culture dishes kept in a humidified incubator at 37°C in 5% C0 2 for use as controls.
  • PCR was performed using 2 ⁇ l of the cDNA, 25 pmol of each Tg oligonucleotide primer (mdr59 and mdr60), 2.5 ⁇ l of 10x PCR buffer 1 (Perkin-Elmer, Foster City, CA), 0.4 ⁇ l of 1 .25 ⁇ M dNTP, 0.1 5 ⁇ l of Taq
  • DNA polymerase Perkin Elmer, Foster City, CA
  • deionized water to a total volume of 25 ⁇ l.
  • Mineral oil was overlaid and the reaction was placed in a programmable thermal cycler with the following program; initial denaturation at 94°C for 4 minutes, then 39 cycles consisting of denaturation (94°C for 1 minute), annealing (50°C for 1 minute), and extension (72°C for 1 minute). Final extension was for 4 minutes at 72°C.
  • Appropriate reverse transcriptase negative controls were performed for RT-PCR of each RNA sample.
  • mdr56 (exon 1 ) : 5' GCAACGGCAACCTGGGCAACA 3' [SEQ ID NO: 3, nucleotides 601 through 621 ], and mdr57 (exon 2) : 5' TGTCCTTGGCCTGGCGCTTCA 3' [SEQ ID NO: 3, reverse complement of nucleotides 988 through 1008].
  • Pair 2 sense: 5' CGATGAGTCCAAAGCACACG 3' [SEQ ID NO: 3, nucleotides 356 through 365], and antisense: 5 * TTTGCCGTCTTTCACCAGGA 3' [SEQ ID NO: 3, reverse complement of nucleotides 1 1 26 through 1 1 45]
  • Pair 3 5' ACCAGGACACCATGAGGAAC 3' [SEQ ID NO: 3, nucleotides 640 through 659], and
  • Example 1 we determined the sensitivity of the assay by adding different amounts of thyroid gland RNA to 0.9 ⁇ g of RNA isolated from of lymphoblasts. We were able to detect Pax-8 mRNA using a "non-nested" protocol with the addition of as little as 3 ng of thyroid RNA, which corresponds to approximately 300 thyroid cells per ml of blood; in some experiments, the sensitivity has been as high as 1 00 cells/ml. A single band of the correct size (0.44 kb) was observed when the product was electrophoresed, indicating good primer selection. The sensitivity of this assay is approximately 10-fold lower than
  • the detection of thyroid-cell-specific transcripts yields a positive or negative result regarding the recurrence of thyroid cancer in patients who have undergone thyroidectomy in the course of cancer treatment.
  • this procedure indicates that mRNA is present above the lowest detection threshold for a given transcript and primer pair; however, it does not offer a reliable indication as to the extent to which the disease has recurred.
  • This example demonstrates the application of quantitative PCR to the measurement of thyroid-cell-specific transcripts in the blood of recovering thyroid cancer patients.
  • the results of quantitive PCR data for the Tg (1 5 patients) and NIS (1 3 of the same 1 5 patients) transcripts are provided herein. It is expected that results of monitoring of the NIS transcript level in a patient taking thyroid hormone may provide a clinical predictor of whether he or she is likely to have iodine-avid tissue on diagnostic thyroid hormone withdrawal 131 l scan or respond to 131 l therapy.
  • the quantitative RT-PCR assay system which is disclosed herein entailed amplification of reverse transcripts from peripheral blood of patients followed by amplification of thyroid-cell-specific transcripts, both as described above, followed by detection of the transcripts by hybridization of a fluorometrically-labeled oligonucleotide probe complementary to a site internal to (within) the amplified sequence and detection of the bound label with a PRISMTM 7700 Fluorometric Detection System (Applied Biosystems, Foster City, CA).
  • PCR was performed using Amplitaq Gold (Applied Biosystems); after incubation at 50°C and an initial denaturation at 94°C for 10 minutes, 40 cycles of a two-step PCR were performed, each consisting of a denaturation step (1 minute, 94°C) and an annealing/extension step at 60°C for 1 minute. All samples Tg samples were run in triplicate, while NIS samples were run once.
  • the intron-spanning PCR amplification primers employed were 5' GTGCCAACGGCAGTGAAGT 3" [SEQ ID NO: 1 , nucleotides 262 through 280], and
  • the PCR amplification primer pair used for NIS amplification comprised:
  • the Tg detection probe was 5' ACAGACAAGCCACAGGCCGTCCT 3' [SEQ ID NO: 1 , nucleotides 299 through 321 ]. This probe was labeled with the 6- carboxy-fluorescein (FAM) reporter dye.
  • FAM 6- carboxy-fluorescein
  • a second probe which is useful in Tg detection is 5' CCCTTCGTCCCTGTGAGCTGCA 3' [SEQ ID NO: 1 , nucleotides 1 30 through 1 51 ], which may be labeled FAM, or with another reporter dye, as indicated below.
  • the NIS detection probe was 5' CGGGGACTCCAGGCAGATCTTCG 3' [SEQ ID NO: 4, reverse complement of nucleotides 1 21 8 through 1 240], which was also labeled with FAM for these experiments.
  • a second probe labeled with tetrachloro-6-carboxy-fluorescein (TET) is being tested for sensitivity.
  • fluorescent dyes are currently available for use, which additionally include 2,7-dimethoxy-r,5-dichloro-6-carboxyfluorescein (JOE) and hexachloro-6-carboxy-fluorescein (HEX).
  • multiple thyroid-cell-specific transcripts may be amplified from the mixed pool of transcripts and detected.
  • non-specific primers e.g., random oligonucleotides, or oligo-dT
  • multiple thyroid-cell-specific transcripts may be amplified from the mixed pool of transcripts and detected.
  • the use of different fluorescent dyes for different primer pairs enables the simultaneous monitoring of two or more transcripts; the number of different transcripts which may be detected at one time is limited only by the number of available dyes which fluoresce at different wavelengths.
  • Simulataneous assay i.e., in a single reaction
  • of multiple transcripts allows for monitoring of changes in the relative abundance of thyroid- cell-specific transcripts in a patient over time, which may provide information as to the progress of the disease.
  • Thyroid cell standard curves Thyroid cell standard curves:
  • Normal thyroid total RNA is mixed with whole blood total RNA from an assay-negative athyreotic patient, as determined from background data. Relative amounts of cells are determined using the assumptions that there are approximately 1 0 g of total RNA in a mammalian ceil and approximately 5000 leukocytes/mm 3 in whole blood (approximately 5 x 10 6 /ml). After mixing the RNA, RT-PCR is performed, and signal resulting from hybridization to a labeled probe is quantitated.
  • normal thyroid cells obtained by dispersion of cells from discarded remnants of normal thyroid tissue obtained at the time of surgery are added to 1 mi of whole blood from an athyreotic patient and total RNA is isolated and assayed as above. Reactions are, in either case, performed in triplicate. The precision of signal detected for cell number or RNA molecule copy number are examined with a 95% confidence interval.
  • the threshold cycle is the number of PCR cycles necessary for the amount of thyroid-cell-specific product to generate a detectable signal (i.e., the detection threshold for the measuring device.
  • Tg detection reactions were performed in triplicate, and an average of the three runs was calculated; the raw data from these experiments is presented in Table 3.
  • the raw data for the NIS assays, of which only a single run was performed per patient, are shown in Table 4.
  • the quantitative RT-PCR assay of the invention exemplified in this Example is of use in other clinical situations requiring precise quantitation of thyroid-specific products (e.g., thyroglobulin); at present, such assays are performed by conventional immunological methods.
  • Tg immunoassays are used to differentiate between endogenous hyperthyroidism that is associated with elevated or normal serum thyroglobulin concentrations and exogenous (thyrotoxicosis factitia) hyperthyroidism that is associate with suppressed endogenous thyroid function and, thus, low serum Tg concentrations.
  • the quantitative Tg RT-PCR described herein has potential utility in this type of a clinical scenario.
  • alterations in detectable circulating Tg mRNA may correlate with the efficacy of therapy as measured by the cure rate from hyperthyroidism or by the reduction in thyroid gland size or volume.
  • Example 5 As stated above, the serum of certain individuals contains antibodies directed against thyroglobulin. When such individuals require monitoring for the recurrence of thyroid cancer, thyroglobulin radioimmune assay (Tg-RIA) is an unacceptable option, as its results are ambiguous; therefore, the discovery of an alternative monitoring method is an imperative, rather than a preferred means of avoiding the side-effects of hormone therapy withdrawal.
  • Tg-RIA thyroglobulin radioimmune assay
  • results, which are presented herein in this Example provide a second means by which recovering thyroid cancer patients may be monitored for the recurrence of disease without withdrawal from thyroid hormone therapy and, additionally, represent the first direct observation of circulating thyroid cells in the blood by any method.
  • Ficoll-Hypaque gradients were used to fractionate whole blood samples, and were able to amplify thyroglobulin mRNA from the erythrocyte cell pellet, but not from either the mononuclear cell or plasma fractions (data not shown). Consequently, we subjected whole blood from two normal subjects to cell sorting using an anti-thyrotropin receptor antibody and magnetic bead separation (MACS, as described above), a technique previously used to identify circulating tumor cells in patients with other malignancies (Wong et al., 1 995, supra; Griwatz et al., 1 995, supra).
  • Erythrocytes were lysed by addition of five milliliters of a solution containing 1 55 mM NH 4 CI, 1 0 mM KHC0 3 , and 0.1 mM EDTA. Erythrocyte ghosts were removed by centrifugation at 300 x g at room temperature. The pellet was washed twice by resuspension in 1 0 mis of buffer (5 mM EDTA, 0.5% BSA) and centrifugation. Approximately 1 0 7 cells were resuspended in 100 ⁇ l of a 1 : 1 00 dilution of monoclonal antibody directed against the human thyrotropin receptor
  • NCL-TSH-R2 Novacastra, Burlingame, CA
  • NCL-TSH-R2 Novacastra, Burlingame, CA
  • the cells were washed in 1 0 ml of buffer and were resuspended in 100 ⁇ l of a 1 :5 dilution of polyclonal goat-anti-mouse IgG conjugated to paramagnetic microbeads (Miltenyi Biotec, Sunnyvale, CA).
  • the bead/cell mixture was incubated at 4°C for 1 5 minutes, and then applied to magnetic separating columns (mini-
  • Isolated cells were collected onto glass microscope slides by centrifugation, air-dried, and washed with Tris-buffered saline. Slides were incubated with a
  • the isolated cells were further characterized immunocytochemically using anti-thyroglobulin antiserum, and disclosed approximately three thyroglobulin- staining epithelioid cells per milliliter of blood (Fig. 6).
  • NAME LEVINE, MICHAEL A.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Pathology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un dosage sensible servant à détecter dans un échantillon sanguin (provenant d'un patient, par exemple) des transcrits géniques spécifiques de la thyroïde, un résultat de détection positif indiquant la présence de cellules de l'épithélium thyroïdien dans ledit échantillon. Le dosage de l'invention convient pour la dépistage d'un cancer thyroïdien récurrent chez des patients déjà traités pour cette maladie par une ablation de la thyroïde. A la différence des méthodes de dosage courantes, qui provoquent des douleurs et exposent le patient à des risques en ce qu'elles lui imposent d'abandonner un régime thérapeutique post-opératoire de substitution aux hormones thyroïdiennes, la technique de l'invention conserve sa réactivité sans causer ces traumatismes au patient, tout en étant insensible aux anticorps antithyroglobuliniques circulants, présents dans les dosages classiques chez 10 à 25 % des patients.
PCT/US1998/011934 1997-06-10 1998-06-09 Procedes de detection de cellules thyroidiennes WO1998056953A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU78305/98A AU7830598A (en) 1997-06-10 1998-06-09 Methods for thyroid cell detection

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US4914497P 1997-06-10 1997-06-10
US60/049,144 1997-06-10

Publications (1)

Publication Number Publication Date
WO1998056953A1 true WO1998056953A1 (fr) 1998-12-17

Family

ID=21958271

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/011934 WO1998056953A1 (fr) 1997-06-10 1998-06-09 Procedes de detection de cellules thyroidiennes

Country Status (2)

Country Link
AU (1) AU7830598A (fr)
WO (1) WO1998056953A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003010337A1 (fr) * 2001-07-23 2003-02-06 Masaaki Oka Systeme d'evaluation pour predire une recurrence de cancer
WO2006020837A2 (fr) * 2004-08-11 2006-02-23 The Cleveland Clinic Foundation Methode permettant de detecter le cancer de la thyroide
EP2402758A2 (fr) 2005-09-19 2012-01-04 Veridex, LLC Procédés et matériaux pour identifier l'origine d'un carcinome d'origine primaire inconnue
EP2518166A2 (fr) 2005-05-20 2012-10-31 Veridex, LLC Dosage moléculaire par aspiration de la thyroïde au moyen d'une aiguille fine
RU2485517C2 (ru) * 2011-12-13 2013-06-20 Федеральное Государственное Бюджетное Учреждение "Московский Научно-Исследовательский Онкологический Институт Им. П.А. Герцена Министерства Здравоохранения И Социального Развития России" Способ диагностики степени злокачественного рака щитовидной железы
WO2021263080A1 (fr) * 2020-06-25 2021-12-30 The Johns Hopkins University Panel de biomarqueurs spécifiques au cancer de la thyroïde

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
DATABASE MEDLINE 1 January 1900 (1900-01-01), KOZNIK Z, ET AL: "HUMAN PAIRED BOX HOMEOTIC PROTEIN (PAX8) MRNA, COMPLETE CDS.", XP002911502, Database accession no. L19606 *
DITKOFF B. A., ET AL.: "DETECTION OF CIRCULATING THYROID CELLS IN PERIPHERAL BLOOD.", SURGERY, MOSBY, INC., US, vol. 120., no. 06., 1 December 1996 (1996-12-01), US, pages 959 - 965., XP002911499, ISSN: 0039-6060, DOI: 10.1016/S0039-6060(96)80041-9 *
GELMINI S., ET AL.: "QUANTITATIVE POLYMERASE CHAIN REACTION-BASED HOMOGENEOUS ASSAY WITH FLUOROGENIC PROBES TO MEASURE C-ERBB-2 ONCOGENE AMPLIFICATION.", CLINICAL CHEMISTRY., AMERICAN ASSOCIATION FOR CLINICAL CHEMISTRY, WASHINGTON, DC., vol. 43., no. 05., 1 May 1997 (1997-05-01), WASHINGTON, DC., pages 752 - 758., XP002911500, ISSN: 0009-9147 *
GRIWATZ C., ET AL.: "AN IMMUNOLOGICAL ENRICHMENT METHOD FOR EPITHELIAL CELLS FROM PERIPHERAL BLOOD.", JOURNAL OF IMMUNOLOGICAL METHODS., ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM., NL, vol. 183., 1 January 1995 (1995-01-01), NL, pages 251 - 265., XP002911501, ISSN: 0022-1759, DOI: 10.1016/0022-1759(95)00063-G *
MALTHIERY Y., LISSITZKY S.: "PRIMARY STRUCTURE OF HUMAN THYROGLOBULIN DEDUCED FROM THE SEQUENCE OF ITS 8448-BASE COMPLEMENTARY DNA.", FEBS LETTERS., ELSEVIER, AMSTERDAM., NL, vol. 165., 1 January 1987 (1987-01-01), NL, pages 491 - 498., XP002911503, ISSN: 0014-5793 *
SAIARDI A., ET AL.: "CLONING AND SEQUENCE ANALYSIS OF HUMAN THYROID TRANSCRIPTION FACTOR 1.", BIOCHIMICA ET BIOPHYSICA ACTA., ELSEVIER, NL, vol. 1261., 1 January 1995 (1995-01-01), NL, pages 307 - 310., XP002911504, ISSN: 0006-3002 *
SMANIK P. A., ET AL.: "CLONING OF THE HUMAN SODIUM IODIDE SYMPORTER.", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 226., no. 06., 1 January 1996 (1996-01-01), US, pages 339 - 345., XP002911505, ISSN: 0006-291X, DOI: 10.1006/bbrc.1996.1358 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003010337A1 (fr) * 2001-07-23 2003-02-06 Masaaki Oka Systeme d'evaluation pour predire une recurrence de cancer
CN100398663C (zh) * 2001-07-23 2008-07-02 霍夫曼-拉罗奇有限公司 用于预测癌症复发的评定体系
US7747389B2 (en) 2001-07-23 2010-06-29 F. Hoffmann-La Roche Ag Scoring system for the prediction of cancer recurrence
US8655597B2 (en) 2001-07-23 2014-02-18 F. Hoffmann-La Roche Ag Scoring system for the prediction of cancer recurrence
WO2006020837A2 (fr) * 2004-08-11 2006-02-23 The Cleveland Clinic Foundation Methode permettant de detecter le cancer de la thyroide
WO2006020837A3 (fr) * 2004-08-11 2006-09-28 Cleveland Clinic Foundation Methode permettant de detecter le cancer de la thyroide
EP2518166A2 (fr) 2005-05-20 2012-10-31 Veridex, LLC Dosage moléculaire par aspiration de la thyroïde au moyen d'une aiguille fine
EP2402758A2 (fr) 2005-09-19 2012-01-04 Veridex, LLC Procédés et matériaux pour identifier l'origine d'un carcinome d'origine primaire inconnue
RU2485517C2 (ru) * 2011-12-13 2013-06-20 Федеральное Государственное Бюджетное Учреждение "Московский Научно-Исследовательский Онкологический Институт Им. П.А. Герцена Министерства Здравоохранения И Социального Развития России" Способ диагностики степени злокачественного рака щитовидной железы
WO2021263080A1 (fr) * 2020-06-25 2021-12-30 The Johns Hopkins University Panel de biomarqueurs spécifiques au cancer de la thyroïde

Also Published As

Publication number Publication date
AU7830598A (en) 1998-12-30

Similar Documents

Publication Publication Date Title
US11156613B2 (en) Detection of cancer by elevated levels of bcl-2
EP2341344B1 (fr) Procédé de diagnostic d'une maladie polykystique des reins
KR20130027059A (ko) 방광암 검출용 소변 표지
AU2005272696A1 (en) Method of detecting thyroid cancer
US20180238890A1 (en) Methods and materials for detection, diagnosis and management of ovarian cancer
US7807785B2 (en) Androgen regulated prostate specific nucleic acids
WO2013106747A2 (fr) Méthodes et compositions pour le traitement et le diagnostic du cancer de la thyroïde
KR101945348B1 (ko) 혈액 내 chi3l1 발현 수준을 이용한 정상압 수두증 진단용 조성물과 진단 마커 검출 방법
US8143010B2 (en) Prostate-specific polypeptide PAMP and encoding nucleic acid molecules
Grammatopoulos et al. Measurement of thyroglobulin mRNA in peripheral blood as an adjunctive test for monitoring thyroid cancer
WO1998056953A1 (fr) Procedes de detection de cellules thyroidiennes
JP3677210B2 (ja) 前立腺がんを診断し、モニターし、そして病期決定する新規な方法
Karavitaki et al. Molecular staging using qualitative RT-PCR analysis detecting thyreoglobulin mRNA in the peripheral blood of patients with differentiated thyroid cancer after therapy
KR102163550B1 (ko) 방광암 검출용 소변 표지
JP2004085305A (ja) 癌の診断方法
EP1573031A2 (fr) Molecules d'acide nucleique regulees par l'androgene et proteines codees
KR20200117050A (ko) 방광암 검출용 소변 표지
MX2008010297A (en) Detection of cancer by elevated levels of bcl-2

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1999503100

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA