WO1998044102A2 - PROCEDES SERVANT A MODULER L'APOPTOSE PROVOQUEE PAR p33ING1 - Google Patents
PROCEDES SERVANT A MODULER L'APOPTOSE PROVOQUEE PAR p33ING1 Download PDFInfo
- Publication number
- WO1998044102A2 WO1998044102A2 PCT/CA1998/000277 CA9800277W WO9844102A2 WO 1998044102 A2 WO1998044102 A2 WO 1998044102A2 CA 9800277 W CA9800277 W CA 9800277W WO 9844102 A2 WO9844102 A2 WO 9844102A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ing1
- cell
- cells
- ingl
- biological activity
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4747—Apoptosis related proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- This invention relates to a method for modulating apoptosis in cells.
- the method of modulation involves using a protein, INGl, and related proteins and peptides, nucleic acids encoding this and related proteins and peptides, and nucleic acids complementary to nucleic acids encoding p33 ING1 .
- This invention also relates to a method for determining the apoptotic characteristic of cells using oligonucleotides from the INGl gene, p33 ING1 peptides and antibodies directed against p33 ING1 peptides.
- Apoptosis is a form of programmed cell death which occurs through the activation of cell-intrinsic suicide machinery.
- the biochemical machinery responsible for apoptosis is expressed in most, if not all, cells.
- Apoptosis is primarily a physiologic process necessary to remove individual cells that are no longer needed or that function abnormally.
- Apoptosis is a regulated event dependent upon active metabolism and protein synthesis by the dying cell.
- Apoptosis plays a major role during development and homeostasis. Apoptosis can be triggered in a variety of cell types by the deprivation of growth factors, which appear to repress an active suicide response. Apoptosis is particularly important for the physiology of the immune system. Apoptosis is the mode of death of centroblasts with low affinity for antigen within germinal centers, cells killed by specific cytotoxic T lymphocytes or natural killer cells, as well as thymocytes bearing high-affinity T-cell receptors for self antigens that are clonally deleted during thymus development (negative selection).
- the morphological and biochemical characteristics of cells dying by apoptosis differ markedly from those of cells dying by necrosis.
- cells decrease in size and round up.
- the nuclear chromatin undergoes condensation and fragmentation.
- Cell death is preceded by DNA fragmentation.
- the DNA of apoptotic cells is nonrandomly degraded by endogenous calcium and magnesium-dependent endonuclease(s) inhibited by zinc ions.
- This enzyme(s) gives fragments of approx. 200 base pairs (bp) or multiples of 200 bp by cutting the linker DNA running between nucleosomes.
- apoptotic cell then breaks apart into many plasma membrane-bound vesicles called "apoptotic bodies," which contain fragments of condensed chromatin and morphologically intact organelles such as mitochondria. Apoptotic cells and bodies are rapidly phagocytosed, thereby protecting surrounding tissues from injury. The rapid and efficient clearance of apoptotic cells makes apoptosis extremely difficult to detect in tissue sections.
- necrosis is associated with rapid metabolic collapse that leads to cell swelling, early loss of plasma membrane integrity, and ultimate cell rupture. Cytosolic contents leach from the necrotic cell causing injury and inflammation to surrounding tissue. Recent studies show that multiple cytotoxic stimuli well known to cause necrosis can lead to apoptosis instead when cells are exposed to the same noxious agents at lower concentrations. This insight has led to an interest in the role of apoptosis in the pathogenesis of renal diseases that result primarily from injury to renal tubular epithelial cells. These diseases include acute and chronic renal failure from exposure of the kidney to ischemia or to cytotoxic agents. There is also an interest in the role of apoptosis in Alzheimers and other neurological diseases.
- INGl (formerly called p33 IG1 )
- INGl represents a new gene which is expressed in normal mammary epithelial cells, but expressed only at lower levels in several cancerous mammary epithelial cell lines and is not expressed in many primary brain tumors.
- the present invention is directed to a method to potentiate apoptosis in a eukaryotic cell, which method comprises selecting said eukaryotic cell; and increasing the p33 ING1 biological activity in said eukaryotic cell. It is contemplated that the p33 ING1 biological activity in said eukaryotic cell may be increased by introducing into said eukaryotic cell an effective amount of a peptide comprising p33 ING1 biological activity or by introducing into said eukaryotic cell an effective amount of an oligonucleotide which codes for a peptide comprising p33 ING1 biological activity under conditions such that a peptide comprising p33 ING1 biological activity is expressed by the cell.
- Another aspect of the invention provides a method to inhibit apoptosis of a eukaryotic cell, which method comprises selecting said eukaryotic cell; and reducing the effective quantity of p33 ING1 biological activity in said eukaryotic cell.
- the effective quantity of p33 ING1 biological activity may be reduced by administering to the cell a single-stranded oligonucleotide of at least 20 nucleotides which comprises a sequence substantially identical to the complement of the cDNA sequence of Figure 3 or by administering to the cell a double-stranded oligonucleotide which comprises a sequence substantially identical to the cDNA sequence of Figure 3 under conditions such that a nucleic acid of at least 20 nucleotides having a sequence which is substantially identical to the complement of the cDNA sequence of Figure 3 is expressed.
- the effective quantity of p33 ING1 biological activity may be reduced by inactivating the INGl gene in the cell.
- Another aspect of the invention provides a method for determining the apoptotic characteristic of a eukaryotic cell which method comprises selecting said cell; and determining the level of expression of native p33 ING1 in said cell and comparing it to the level of expression of native p33 ING1 in a non-apoptotic cell wherein an increased level of p33 ING1 expression in the cell denotes a cell having the potential to be apoptotic.
- the level of expression may be determined by exposing the cell to detectably labelled anti-INGl antibodies or by exposing the cell to a detectably labelled single-stranded oligonucleotide of at least 100 nucleotides which comprises a sequence substantially identical to the complement of the cDNA sequence of Figure 3 under conditions such that the oligonucleotide will bind to any INGl mRNA present in the cell to determine the level of expression of mRNA INGl in the cells.
- the level of expression may be determined by exposing the cell to two single-stranded oligonucleotides of from 15 to 25 nucleotides in length, wherein the first oligonucleotide binds to one region of the INGl mRNA and the second oligonucleotide binds to a sequence complementary to another region of the INGl cDNA under conditions wherein polymerase chain reaction can occur and any INGl mRNA in the cell will be amplified and labelled.
- a still further aspect of the invention provides an assay for determining the level of p33 ING1 activity in a eukaryotic cell, which assay comprises selecting the eukaryotic cell; determining the p33 ING1 biological activity in the cell; and correlating the biological activity against a curve of the p33 ING1 biological activity in certain cell types.
- a still further aspect of the invention is an isolated eukaryotic cell substantially free of p33 ING1 biological activity.
- Figures 1A to 1C illustrate the strategy and biological assays used for cloning INGl .
- Figure 2 sets forth the partial cDNA sequence of INGl (SEQ ID NO: 1) and the predicted amino acid sequence (SEQ ID NO: 2) of p33 ING1 .
- Figure 3 sets forth the complete cDNA sequence of INGl (SEQ ID NO: 9) and the predicted amino acid sequence (SEQ ID NO: 10) of p33 ING1 .
- Figures 4A to 4C illustrate the effects of P33 ING1 overexpression.
- Figure 5 illustrates the changes in p33 ING1 protein levels in breast cancer cell lines.
- Figure 5 A is a Western blot.
- Figure 5B is a picture of the coomassie-blue stained gel of Figure 5 A.
- Figure 6A illustrates Western blotting of neuroblastoma cell lines with anti- p33 ING1 antibody.
- Figure 6B illustrates a Southern blot of neuroblastoma cell line compared to a normal diploid cell strain for INGl DNA.
- Figure 6C illustrates the RT- PCR reaction on a neuroblastoma cell line compared to a control diploid fibroblast.
- Figure 7 illustrates the level of INGl mRNA in control (c) tissue, glioblastoma (GB), astrocytoma (AS) and meningioma (MN) tumors as determined by RT-PCR.
- Figures 8A and 8B illustrate the expression of INGl mRNA and p33 ING1 in proliferation competent (y) and in senescent human fibroblasts (o).
- Figure 9 illustrates the level of p33 ING1 protein through the cell cycle.
- Panel A has anti-cdk2 antibody as a positive control.
- Panel B shows the results with anti-p33 antibodies.
- Panel C shows cell cycle profile at each point as determined by FACS.
- Figure 10 illustrates the number of cells per colony of cells blocked for INGl expression.
- Figure 11 illustrates that INGl protein levels increase during serum starvation- induced apoptosis of P19 teratocarcinoma cells.
- Figure 11A shows a Western Blot of protein homogenates probed with a polyclonal antibody specific for INGl.
- Figure 11B shows a trypan blue dye exclusion assay of serum starved P19 cells infected with retroviral constructs expressing antisense INGl (aS), sense INGl (s) ,bcl-2 sense (S- bcl-2), bcl-2 antisense (aS-bcl-2) and vector only (V) constructs.
- Figure 12A illustrates a Western blot of human c-myc and INGl expression in NIH 3T3 tet-myc cells retrovirally infected with constructs containing vector (v), antisense ( ⁇ S) and sense (S) INGl constructs grown in the presence (+) or absence (-) or tetracycline.
- Figures 12B - 12D are pictures of cells having vector only (Fig. 12B), INGl antisense construct (Fig. 12C) or INGl sense construct (Fig. 12D) fixed and stained with labelled anti-INGl antibody.
- Figure 13 illustrates that expression of INGl enhances c-myc-induced apoptosis.
- Figure 13 A illustrates cell viability of NIH-3T3 tet-myc cells containing antisense ( ⁇ S), sense (S) INGl or vector only (v) constructs.
- Figure 13B illustrates the amount of DNA laddering in tet-myc cells expressing INGl sense (S) , antisense ( ⁇ S), vector (v), bcl-2 and control (c) without vector.
- Figure 13C illustrates the effect on cell viability of microinjection of GST-ING1 protein. DETAILED DESCRIPTION OF THE INVENTION
- the invention described herein relates to the discovery of a method for the modulation of apoptosis in eukaryotic cells.
- the invention also relates to a method for detecting cells having and/or lacking the potential to undergo apoptosis.
- a novel gene was isolated encoding a 33 kDa protein that is a potent inhibitor of cell growth.
- Acute expression of transfected constructs encoding p33 ING1 induced apoptosis in cells. Inhibition of translation of the mRNA for this gene prevented apoptosis in cells.
- Antibody means a molecule that binds to a known antigen.
- An “anti-p33 ING1 antibody” means an antibody molecule that binds to one or more epitopes of the p33 ING1 protein.
- Antisense and “Antisense nucleotides” means DNA or RNA constructs which block the expression of the naturally-occurring gene product. For example, in the present invention, use of a DNA construct that produces INGl antisense RNA blocks the expression of p33 ING1 by destroying or inactivating INGl mRNA.
- Apoptosis means a form of programmed cell death.
- the "apoptotic characteristic" of a cell is the ability of a cell to undergo apoptosis when exposed an apoptotic triggering event. Such events include, for example, exposure to certain toxins and/or expression of a tumorigenic gene or activation of cell surface proteins.
- Biological sample means a sample of eukaryotic cells. These cells may be part of a tissue or organ sample obtained, for example, by biopsy, or they may be individual cells, for example, blood cells or cells grown in tissue culture.
- “Cancerous cell” means a cell in or from a neoplasm. Preferably the cancerous cells is breast cancer, brain cancer, gastric cancer, hematologic neoplasms and head and neck squamous cell carcinomas.
- Breast cancer means any of various malignant neoplasms of the breast or mammary tissue.
- Brain cancer means any of various malignant neoplasms of the brain, neuroglial cells or meninges.
- Cell cycle means the cyclic biochemical and structural events occurring during growth of cells. The cycle is divided into periods called : quiescence (G 0 ), Gap j (GJ), DNA synthesis (S), Gap 2 (G 2 ), and mitosis (M).
- Cell division means mitosis, i.e., the usual process of cell reproduction.
- Code when used with reference to a nucleotide 's relation to a protein, mean the system whereby particular combinations of adjacent nucleotides control the insertion of particular amino acids in equivalent places in a protein molecule.
- “Expression” means the production of a protein or polynucleotide in the cell.
- a “eukaryotic cell” is a cell having a membrane-bound nucleus containing DNA in the form of chromosomes, either in a tissue or organ or in tissue culture. More preferably, it is a mammalian cell. “Growth” means progression through the cell cycle with the result that two daughter cells are formed from each mother cell. “Actively growing” means that state wherein cells exhibit growth and cell division.
- “Hyperplasticity” means an increase in cell number, excluding tumor formation.
- Immunohistochemistry means a method to localize a specific protein within a cell using cell sections or thin sections of a specific tissue and an antibody directed against the target protein. It is contemplated that the antibody may be directly labelled, radioactively, biotinylated or labelled with a fluorochrome. It is also contemplated that the antibody may be indirectly labelled.
- “Inactivating” a gene means rendering the gene incapable of producing an active protein normally encoded by that gene.
- Methods of inactivating a gene include, for example, deleting the gene in the cell or introducing a deletion or mutation into the gene such that the gene no longer expresses an active protein.
- cells having such inactivated genes are substantially free of the active protein.
- “In situ hybridization” means a method to identify and localize certain specific transcripts of specific genes in cells and tissue sections.
- the cells are fixed to a solid support and hybridized to a labelled nucleic acid probe complementary to the sequence to be identified.
- the probe may be directly labelled or indirectly labelled.
- Label means to incorporate into a compound a substance that is readily detected. Such substances include radioactive substances and fluorescent dyes, for example.
- Micromalian cell means a cell in or from a mammal, either in a tissue or organ or in tissue culture.
- Neoplasia means the process resulting in the formation and growth of an abnormal tissue that grows by cellular proliferation more rapidly than normal, and continues to grow after the stimuli that initiated the new growth cease.
- Neoplastic describes the abnormal tissue that grows by cellular proliferation more rapidly than normal, and continues to grow after the stimuli that initiated the new growth cease.
- Normal cell means a non-cancerous cell.
- Proliferation means growth and reproduction, i.e., division of cells.
- Actively proliferating means cells that are actively growing and reproducing.
- “Native” means the nucleic acid of a non-mutated gene or peptide sequence encoded by such a gene as found in a phenotypically normal cell.
- substantially identical means that the polynucleotide or nucleic acid of interest is able to hybridize to the complement of the known sequence under stringent conditions. Such stringent conditions preferably require at least 85% homology, more preferably the conditions require at least 90% homology and most preferably the conditions require at least 95% homology. When used in relation to peptides and proteins, “substantially identical” means that the amino acid sequence of the peptides share at least 85% homology, more preferably at least 90% homology and most preferably at least 95% homology.
- Spenescent cells means cells that are no longer actively dividing and reproducing. Such cells are typically characterized by an inability to respond to growth factors and by altered morphology including increased size and decreased saturation density in tissue culture.
- total cDNA from a normal mammary epithelial cell line [6] was hybridized independently with cDNAs from the breast cancer cell lines MCF-7, BT-483, BT-474, Hs-578T, ZR-75, MD-MB- 468, MD-MB-435 and BT-20 which were obtained from the American Type Culture Collection. Subtracted cDNA, theoretically containing sequences more highly expressed in the phenotypically normal epithelial cells, was then used as a probe to screen a normal human fibroblast cDNA library.
- cDNA clones were isolated, and their inserts were digested into fragments of 200-800 base pairs. The fragments were then recloned into the retroviral plasmid vector pLNCX [7]. After passage through the packaging line BOSC 23 [3] , retroviruses containing the isolated fragments were used to infect normal mouse mammary epithelial cells (NMuMG). The infected cells were subsequently injected into nude mice. Within 45 days, several mice developed tumors from which the cloned inserts were recovered by amplification using primers specific for pLNCX in polymerase chain reactions (PCR). Two different sequences were isolated from tumors, one of which was subsequently shown to be expressed in the antisense orientation.
- PCR polymerase chain reactions
- the antisense sequence isolated when introduced into normal fibroblast cells, consistently showed the biological effects of increased cell proliferation in soft agar and in focus forming assays (Fig. IB and Table 1).
- This 182 bp fragment represented nucleotides 781 to 963 of the cDNA shown in Figure 2 and nucleotides 942 to 1124 of Figure 3.
- This cDNA encodes a 33 kDa protein called p33 ING1 for INhibitor of Growth. This was formerly designated p33 IG1 (see U.S. Serial No. 08/569,721 which is incorporated herein by reference in its entirety).
- Regions of the p33 ING1 protein that show homology to retinoblastoma binding protein 2 were identified using the Blast program available from the National Centre for Biological Information (address: www.ncbi.nim.nih.gov).
- the INGl cDNA contains several AU-rich elements (AREs) in the 3' untranslated region of the clone ( Figure 2) which are believed to be involved in the destabilization of specific mRNAs [10].
- AREs AU-rich elements
- INGl Since the INGl gene was originally isolated by subtractive hybridization between normal and transformed epithelial cDNAs, the levels of INGl mRNA expression in different normal, breast cancer, and brain cancer cell lines were examined. Results from Northern blot analysis show that INGl is expressed at considerably lower levels (approximately 2-8 fold as estimated by scanning densitometry) in BT-20, ZR-75, MDA-MB-435 and T-47D breast cancer cells compared to MDA-MB-468 and SK-BR-3 breast cancer cells and to normal Hs68 fibroblasts. Results from reverse transcription polymerase chain reaction (RT-PCR) showed that INGl is not expressed or is expressed at very low levels in glioblastomas, astrocytomas and meningiomas.
- RT-PCR reverse transcription polymerase chain reaction
- Figure 4C shows the combined results of 5 separate experiments, which indicated that injection of the pBK vector or of pINGl- ⁇ S constructs had no appreciable effect upon the ability of injected cells to incorporate BrdU, whereas injection of pINGl-S blocked the ability of cells to enter into and proceed through S phase. Similar results were obtained in larger populations of cells that were electroporated with vector, sense and antisense construct DNAs together with a construct encoding the CD20 surface marker. Such co-transfections allowed the analysis of DNA content in cells that had taken up DNA by staining for CD20 and subsequent analysis by fluorescence activated cell sorting (FACS).
- FACS fluorescence activated cell sorting
- the CD20-expressing population co-transfected with pINGl-S had, on average, 63.1 % of cells in G0/G1 whereas those co-transfected with vector had 33.6% of cells in G0/G1 when cells were fixed and stained 48 hours after electroporation.
- p33 ING1 activity in low and high passage cells was checked. As shown in Figures 8 A and 8B, INGl expression (and the level of the p33 ING1 protein) increased several- fold when cells approached the end of their in vitro replicative lifespan. These data demonstrate that p33 ING1 is a novel inhibitor of cell growth and a candidate tumor suppressor. Additional experiments also indicate that p33 ING1 is localized in the nucleus of cells, which is consistent with p33 ING1 's functioning as a tumor suppressor. Further data showed that INGl gene is localized to the 13q33-34 chromosome region.
- p33 ING1 might play a role in the regulation of cyclin-dependent kinases (CDKs), as reported recently for the family of CDK inhibitors including pl8[ll], p21[12,13] and the candidate tumor suppressor pl6 MTS1 [8] to which a portion of the p33 ING1 sequence shows some homology, and which has been reported to be the MTS1 multiple tumor suppressor locus of human chromosome 9p21 that is inactivated in many types of human tumors [14,15].
- CDKs cyclin- dependent kinases
- p33 1NG1 -related peptides will be useful in the present invention.
- p33 ING1 its analogs and related proteins and peptides which are effective in potentiating apoptosis in eukaryotic cells are preferred.
- p33 ING1 having the amino acid sequence set forth in Figures 2 and 3, homologous amino acid sequence variants of the sequence of Figures 2 and 3 , and homologous in vitro- generated variants and derivatives of p33 ING1 , which are capable of exhibiting a biological activity in common with the p33 INGI of Figure 3.
- p33 ING1 variants having post-translational modifications, such as acetylation, glycosylation or phosphorylation.
- p33 ING1 biological activity is defined as the possession of at least one cell proliferation, cell regulatory or tumor suppressive function qualitatively in common with native p33 ING1 s.
- One example of the qualitative biological activity of p33 ING1 is its ability to inhibit cell growth as estimated by decreasing the S-phase fraction in a population of cells.
- the effective quantity of p33 ING1 biological activity is that level of p33 ING1 biological activity necessary to potentiate apoptosis.
- the methods of this invention may reduce the effective quantity to less than 50% of the p33 ING1 biological activity of normal cells more preferably less than 30% of the p33 ING1 biological activity, most preferably there will be no p33 ING1 biological activity.
- p33 ING1 immunological activity is defined herein as the possession of immunological cross-reactivity with at least one epitope of native p33 ING1 .
- Immunologically cross-reactive means that the candidate polypeptide is capable of competitively inhibiting the qualitative biological activity of the native p33 ING1 having this activity, with polyclonal antisera raised against the known active analog.
- antisera are prepared in conventional fashion by injecting goats or rabbits, for example, subcutaneously with the known active analog in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freunds.
- This invention is concerned with amino acid sequence variants of native p33 ING1 .
- Amino acid sequence variants of the p33 ING1 are prepared with various objectives in mind, including increasing the affinity of the p33 ING1 for its binding partner, facilitating the stability, purification and preparation of the p33 ING1 , modifying its biological half- life, improving therapeutic efficacy, and lessening the severity or occurrence of side effects during therapeutic use of the p33 ING1 .
- Amino acid sequence variants of p33 ING1 fall into one or more of three classes: insertional, substitutional, or deletional variants including those variations that arise from variable splicing of transcripts from the chromosomal gene. Additional variants may also be prepared by site specific mutagenesis of nucleotides in the DNA encoding the p33 ING1 , by which DNA encoding the variant is obtained, and thereafter expressing the DNA in recombinant cell culture. However, variant p33 INGI fragments having up to about 100 to 150 amino acid residues are prepared conveniently by in vitro synthesis. The amino acid sequence variants of the p33 ING1 may be predetermined variants not found in nature or naturally occurring alleles.
- the p33 ING1 variants typically exhibit the same qualitative biological activity as naturally occurring p33 ING1 .
- the p33 ING1 variants and derivatives that are not capable of exhibiting qualitative biological activity similar to native p33 ING1 may nonetheless be useful as reagents in diagnostic assays for p33 ING1 or antibodies to p33 ING1 .
- they when insolubilized in accordance with known methods, they may be used as agents for purifying anti-p33 INGi antibodies from antisera or hybridoma culture supernatants.
- immunogens for raising antibodies to p33 ING1 or as a component in an immunoassay kit (labeled so as to be a competitive reagent for native p33 ING1 or unlabeled so as to be used as a standard for the p33 ING1 assay) so long as at least one p33 ING1 epitope remains active in these analogs.
- an immunoassay kit labeled so as to be a competitive reagent for native p33 ING1 or unlabeled so as to be used as a standard for the p33 ING1 assay
- the site for introducing an amino acid variation may be predetermined, the mutation, per se, need not be predetermined.
- random or saturation mutagenesis (where all 20 possible residues are inserted) is conducted at the target codon and the expressed p33 ING1 variant is screened for the optimal combination of desired activities. Such screening is within the ordinary skill of the art.
- Amino acid insertions will usually be on the order of from about one to about ten amino acid residues; substitutions are typically introduced for single residues and deletions will range from about one to about thirty residues. Deletions or insertions preferably are made in adjacent pairs. That is, a deletion of two residues or insertion of two residues. Substitutions, deletions, insertions or any combination thereof may be introduced or combined to arrive at a final construct. Insertional amino acid sequence variants of the native p33 ING1 are those in which one or more amino acid residues extraneous to native p33 ING1 are introduced into a predetermined site in the target p33 ING1 and which displace the pre-existing residues.
- insertional variants are fusions of heterologous proteins or polypeptides to the amino or carboxyl terminus of the p33 ING1 .
- Such variants are referred to as fusions of the p33 ING1 and a polypeptide containing a sequence which is other than that which is normally found in the p33 ING1 at the inserted position.
- Several groups of fusions are contemplated for carrying out the invention described herein.
- Immunologically active p33 ING1 derivatives and fusions comprise the p33 ING1 and a polypeptide containing a non-p33 ING1 epitope.
- Such immunologically active derivatives and fusions of p33 ING1 are within the scope of this invention.
- the non- p33 ING1 epitope may be any immunologically competent polypeptide, i.e., any polypeptide which is capable of eliciting an immune response in the animal in which the fusion is to be administered, or which is capable of being bound by an antibody raised against the non-p33 ING1 polypeptide.
- Substitutional variants are those in which at least one residue in the Figure 3 sequence has been removed and a different residue inserted in its place.
- Novel amino acid sequences as well as isosteric analogs are included within the scope of this invention.
- Some deletions, insertions and substitutions will not produce radical changes in the characteristics in the p33 ING1 molecule.
- it is difficult to predict the exact effect of the substitution, deletion or insertion in advance of doing so for example, when modifying an immune epitope on the p33 ING1 protein, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. For example, a change in the immunological character of the p33 INGI protein, such as affinity for a given antibody, is measured by a competitive-type immunoassay.
- Modifications of protein properties such as redox or thermal stability, hydrophobicity, susceptibility to proteolytic degradation, or the tendency to aggregate with carriers or into multimers may be assayed by methods well known to one of skill in the art. Deletions of cysteine or other labile amino acid residues may also be desirable.
- Arg Arg may increase the oxidative stability of the p33 ING1 protein.
- Deletion or substitution of potential proteolysis sites e.g., Arg Arg, is accomplished by deleting one of the basic residues or substituting one with glutaminyl or histidyl residues.
- Covalent modifications of the p33 ING1 protein are included within the scope of the present invention. Such modifications are introduced by reacting targeted amino acid residues with an organic derivatizing agent that is capable of reacting with selected side chains or terminal amino acid residues. The resulting covalent derivatives of p33 ING1 are useful to identify residues important for p33 ING1 's biological activity, for immunoassays of the p33 ING1 or for preparation of anti-p33 ING1 antibodies for immuno- affinity purification of recombinant p33 ING1 . Such modifications are within the ordinary skill of the art and are performed without undue experimentation.
- prokaryotes are used for cloning of DNA sequences and in constructing the vectors useful in the present invention.
- E. coli HB101, DH5 ⁇ and XL 1 -blue are particularly useful. These examples are meant to be illustrative and do not limit the present invention.
- in vitro methods of cloning such as the polymerase chain reaction may be used.
- Expression hosts typically are transformed with DNA encoding the p33 ING1 protein which has been ligated into an expression vector. Such vectors ordinarily carry a replication site, although this is not necessary where chromosomal integration will occur. Expression vectors may also include marker sequences which are capable of providing phenotypic selection in transformed cells. Expression vectors also optimally will contain sequences which are useful for the control of transcription and translation. Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription which may affect mRNA expression. Expression vectors may contain a selection gene as a selectable marker. Examples of suitable selectable markers for eukaryotic cells are dihydrofolate reductase, thymidine kinase, neomycin or hygromycin.
- Antibodies to p33 ING1 may be prepared in conventional fashion [18] by injecting goats or rabbits, for example, subcutaneously with the complete p33 ING1 protein or a peptide consisting of at least 10 amino acids similar to the p33 ING1 protein in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freund's adjuvant, The anti-p33 1NG1 antibodies may be directed against one or more epitopes on p33 ING1 .
- Monoclonal antibodies against p33 ING1 can be prepared by methods known in the art [18].
- the antibodies are preferably labelled with a marker, for example, with a radioactive or fluorescent marker. It is contemplated that the antibodies would be labelled indirectly by binding them to an anti-goat or anti-rabbit antibody covalently bound to a marker compound.
- the present invention may be used to potentiate apoptosis in eukaryotic cells by increasing expression of p33 ING1 .
- the potential for apoptosis is increased by introducing into cells a drug or other agent which can increase, directly or indirectly, expression of p33 ING1 .
- Inducing apoptosis in cancer cells is of obvious importance.
- Inducing apoptosis in tissue culture cells provides a model system for studying the effects of certain drugs for triggering, reversing or halting the apoptotic pathway. Accordingly, increasing a cell's potential to enter the apoptotic pathway is useful.
- a protein or a peptide having p33 ING1 biological activity is introduced directly.
- the peptide possesses at least apoptosis modulating function qualitatively in common with native p33 ING1 .
- nucleotides coding for p33 ING1 are introduced by retroviral or other means.
- nucleotide coding for p33 ING1 comprises a nucleotide sequence which codes for a peptide having p33 ING1 biological activity.
- the oligonucleotide comprises an oligonucleotide which codes for the amino acid sequence set forth in Figure 3.
- the oligonucleotide sequence comprises a nucleotide sequence which codes for the amino acid sequence set forth in Figure 2.
- nucleotide sequence is substantially identical to the cDNA sequence of Figure 3, more preferably the sequence is substantially identical to the cDNA sequence of Figure 2 and most preferably the sequence is substantially identical to nucleotides 161 to 1143 of the cDNA sequence of Figure 3.
- Apoptosis is inhibited or substantially decreased by preventing transcription of INGl DNA and/or translation of RNA.
- This can be carried out by introducing antisense oligonucleotides of the INGl sequence into cells, in which they hybridize to the p33 ING1 -encoding mRNA sequences, preventing their further processing. It is contemplated that the antisense oligonucleotide can be introduced into the cells by introducing antisense single-stranded nucleic acid which is substantially identical to the complement of the cDNA sequence in Figures 2 or 3.
- an antisense oligonucleotide can be expressed in the cells by introducing a single- or double-stranded polynucleotide into the cell under conditions wherein a single-stranded nucleic acid sequence which is substantially identical to the complement of the cDNA sequence in Figures 2 or 3 is expressed in the cell, for example, by placing the polynucleotide in the antisense direction under the control of a strong promoter. It is contemplated that the antisense oligonucleotide introduced to the cell or expressed in the cell is at least 20 nucleotides, more preferably it is at least 50 nucleotides and most preferably it is at least 100 nucleotides in length.
- the antisense oligonucleotide sequence is substantially identical to the complement of nucleotides 942 to 1124 of the cDNA sequence set forth in Figure 3. It is also possible to inhibit expression of p33 ING1 by the addition of agents which degrade p33 ING1 .
- agents include a protease or other substance which enhances p33 ING1 breakdown in cells. In either case the effect is indirect, in that less p33 ING1 is available than would otherwise be the case.
- p33 ING1 it is also possible to inhibit expression of p33 ING1 by inactivating the gene coding for INGl in the cell. Such inactivation can occur by deleting the gene in the cell or by introducing a deletion or mutation into the gene thereby inactivating the gene.
- the gene may also be inactivated by inserting into the gene another DNA fragment such that expression of the native p33 ING1 protein does not occur.
- Methods for introducing mutations, deletions and insertions into genes in eukaryotic cells are known in the art. See, for example, U.S. Patent No. 5,464,764 which is incorporated herein in its entirety.
- the ability to inhibit apoptosis in a eukaryotic cell in tissue culture provides a model system for testing certain proteins and factors for their role in the apoptotic pathway. It also provides a model system for testing compounds suspected of being tumorigenic.
- Viral or plasmid vectors may be used to deliver various constructs to target cells in vitro or in vivo.
- viral vectors may include retroviruses, adenovirus or adenovirus-associated viruses.
- retroviruses adenovirus or adenovirus-associated viruses.
- In vitro such peptides or vectors may be administered by infection, microinjection, electroporation and by other methods known in the art.
- nucleic acids In vivo parenteral administration of the nucleic acids is preferred with subdermal or intramuscular administration most preferred. Intravenous administration or use of implanted milliosmol pumps (available from Alza) may also be used.
- the nucleic acids of the present invention may be formulated in a variety of ways.
- Aqueous solutions of the nucleic acids of the present invention may be encapsulated in polymeric beads, liposomes, nanoparticles or other injectable depot formulations known to those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.)
- the nucleic acids may also be encapsulated in a viral coat. Doses are selected to provide effective inhibition of cancer cell growth and/or proliferation.
- the methods of this invention may also be achieved by using a pharmaceutical composition comprising one or more of the following apoptosis inducing compounds: p33 ING1 , its analogs and related proteins and peptides. Doses are selected to provide effective induction of apoptosis.
- Parenteral administration of the proteins or peptides is preferred, with subdermal or intramuscular administration most preferred. Intravenous administration or use of implanted milliosmol pumps (available from Alza) may also be used.
- the proteins and peptides of the present invention may be formulated in a variety of ways.
- Aqueous solutions of the proteins or peptides of the present invention may be encapsulated in polymeric beads, liposomes, nanoparticles or other injectable depot formulations known to those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.)
- Compositions including a liquid pharmaceutically inert carrier such as water may also be considered for both parenteral and oral administration.
- Other pharmaceutically compatible liquids may also be used. The use of such liquids is well known to those of skill in the art.
- the dose level and schedule of administration may vary depending on the particular p33 ING1 -related compound(s) and/or compositions used, the method of administration, and such factors as the age and condition of the subject.
- parenteral administration is preferred, but formulations may also be considered for other means of administration such as orally, per rectum, and transdermally.
- the usefulness of these formulations may depend on the particular compound used and the particular subject receiving the p33 ING1 -related compound.
- Oral formulations of p33 ING1 -related compounds may optionally and conveniently be used in compositions containing a pharmaceutically inert carrier, including conventional solid carriers, which are conveniently presented in tablet or capsule form.
- a pharmaceutically inert carrier including conventional solid carriers, which are conveniently presented in tablet or capsule form.
- Formulations for rectal or transdermal use may contain a liquid carrier that may be oily, aqueous, emulsified or contain certain solvents suitable to the mode of administration. Suitable formulations are known to those of skill in the art. (Examples thereof may be found, for example, in Remington's Pharmaceutical Sciences, 18th Edition, 1990.)
- the present invention also has diagnostic use, since simple immunochemical staining of cells or sections of cells should give an accurate estimate of the portion of cells expressing p33 ING1 .
- diagnostic use since simple immunochemical staining of cells or sections of cells should give an accurate estimate of the portion of cells expressing p33 ING1 .
- Such a test based on the use of anti-p33 ING1 antibodies or INGl polynucleotides and other standard secondary techniques of visualization will be useful in determining the apoptotic characteristic of eukaryotic cells.
- Antibodies specifically reactive with p33 ING1 can be produced, using known methods [18].
- anti-p33 ING1 antisera can be produced by injecting an appropriate host (e.g., rabbits, mice, rats, pigs) with p33 ING1 and withdrawing blood from the host animal after sufficient time for antibodies to have been formed.
- Monoclonal antibodies can also be produced using known techniques [18].
- Such antibodies to p33 ING1 will generally be detectably labelled (e.g. , with a radioactive label, a fluorescent material, biotin or another member of a binding pair or an enzyme) by methods known in the art.
- the anti-p33 ING1 antibodies may be indirectly labelled as follows. The unlabelled primary antibody binds to the target protein. Then a secondary antibody (anti-antibody) directed against the primary antibody and tagged with a detectable label binds to the antigen-primary antibody complex.
- cells obtained from an individual or a culture are processed in order to determine the extent to which p33 ING1 is present in cells, in a specific cell type or in a body fluid. This can be determined using known techniques and an antibody specific for p33 ING1 . Comparison of results obtained from cells or a body fluid being analyzed with results obtained from an appropriate control (e.g., cells of the same type known to have normal p33 ING1 levels or the same body fluid obtained from an individual known to have normal p33 1NG1 levels) is carried out. Decreased p33 ING1 levels are indicative of an increased probability of abnormal cell proliferation or oncogenesis or of the actual occurrence of abnormal proliferation or oncogenesis.
- the levels of p33 ING1 in cancerous cells will be at least 50% less than the level of p33 ING1 in non-cancerous cells, more preferably the levels will be less than 30% of normal levels, most preferably p33 ING1 will not be expressed. Increased p33 ING1 levels are indicative of an increased probability that the cell is capable of entering the apoptotic pathway. It is contemplated that the levels of p33 ING1 in apoptotic cells will be at least 50% greater than the level of p33 ING1 in normal cells, more preferably at least 70% greater.
- a diagnostic kit could include a solid support for attaching the cell or tissue to be tested and a detectably labelled anti-p33 ING1 antibody. It is further contemplated that the anti-p33 ING1 antibody may not be labelled but the kit would additionally contain another detectably labelled antibody capable of binding to the anti- p33 ING1 antibody.
- a hybridization probe comprising RNA, INGl cDNA or INGl genomic DNA having a sequence substantially identical to Figure 3
- INGl polynucleotide may be employed as a means for determining the sequence of the INGl gene present in the genomic DNA of a given sample, or the level of INGl mRNA expressed in cells of such sample.
- Such hybridization probes will generally be detectably labelled (eg. with a radioactive label, a fluorescent label, biotin, etc). It is also contemplated that the INGl polynucleotide may be indirectly labelled by methods known in the art. It is contemplated that in situ hybridization of labelled nucleic acid to the cell will be employed to detect the presence of INGl mRNA in the cell.
- a tissue sample or cell sample can be prepared by conventional means and probed with the labelled INGl polynucleotide probe to determine the level of expression of INGl mRNA in the cells.
- the INGl polynucleotide probe may also be used to determine whether the genomic DNA from the cell sample has a mutation or rearrangement of its INGl gene by methods known in the art (i.e. PCR sequencing or restriction fragment length polymorphism analysis).
- the polynucleotide probe may also be used to determine whether the genomic DNA from the cell sample has a mutation/deletion rearrangement of the chromosome region of 13q33-34.
- the oligonucleotide probe useful in these methods may comprise at least about 20 nucleotides which sequence is substantially identical to the sequence of Figure 3 , more preferably it will comprise at least about 100 nucleotides, and most preferably it will comprise at least 400 nucleotides.
- one of the two INGl oligonucleotide primers will be substantially identical to one region of the sequence of Figure 3 and that the second oligonucleotide primer will be substantially identical to the complement of a second region of the sequence of Figure 3.
- the size of these primers is preferably from 15-25 nucleotides, more preferably from 15-20 nucleotides.
- the oligonucleotide probes and primers will be substantially identical to the coding region of the cDNA sequence of Figure 3.
- Such nucleotides can be generated synthetically by conventional means. Comparison of the results obtained from cells or a body fluid being analyzed with results obtained from an appropriate control (eg. cells of the same type known to have abnormal or native p33 ING1 or fluid from an individual known to have normal p33 ING1 ) is carried out. Decreased INGl mRNA levels are indicative of an increased probability of abnormal cell proliferation or oncogenesis or of the actual occurrence of abnormal proliferation or oncogenesis.
- the levels of INGl mRNA in cancerous cells will be at least 50% less than the level of INGl mRNA in non-cancerous cells, more preferably the levels will be less than 30% of normal levels, most preferably INGl mRNA will not be expressed. Increased INGl mRNA levels are indicative of an increased probability of cell apoptosis. It is contemplated that the levels of INGl mRNA in cells having apoptotic potential will be at least 50% more than the level of INGl mRNA in native non-senescent cells, more preferably at least 70% more than native non-senescent cells.
- the presence of a mutation/deletion in one copy of the INGl gene in a diploid cell is also indicative of an increased probability that abnormal cell proliferation will occur.
- the presence of mutations/deletions in both copies of the INGl gene is indicative of possible or actual oncogenesis.
- cDNAs from the breast cancer cell lines MCF-7, BT-483, BT-474, Hs-578T, ZR-75, MD-MB-468, MD-MB- 435 and BT-20 were also digested with Sau3A. Fragments of tester DNA (cDNA from normal epithelial cells) were ligated to "a" adaptors. Fragments of driver DNA (cDNA from breast tumor cells) were ligated to "b" adaptors. Adaptors were prepared by annealing the synthetic oligonucleotides:
- driver DNA and tester DNA was denatured, then hybridized at 66° C for 18 hours. After hybridization, mixtures were treated with Mung bean nuclease to eliminate single-stranded adaptor-derived ends from "heterozygous" hybrids (hybrids containing both a and b adaptors). Resultant double-stranded molecules were then selectively amplified by PCR using primer "a".
- amplicons were then subjected to five successive rounds of hybridization, selective degradation and PCR amplification using 40 ⁇ g of driver cDNA containing adaptors and 200 ng, 5 ng and 5 pg of tester amplicons in respective rounds. This procedure allowed for a significant enrichment of sequences that were more highly expressed in the phenotypically normal epithelial cells as determined by slot blot hybridization.
- PCR amplified DNA was recloned into the Clal site of the retroviral plasmid vector pLNCX [7] with synthetic adaptors carrying initiation codons in all reading frames.
- This library of about 10 5 clones, enriched in tumor suppressor sequences was then used for the isolation of transforming genetic suppressor elements (GSEs).
- GSEs transforming genetic suppressor elements
- retroviruses containing the isolated cDNA fragments were used to infect non-tumorigenic immortalized mouse mammary epithelial cells (NMuMG) which were subsequently injected subcutaneously into nude mice.
- NMuMG non-tumorigenic immortalized mouse mammary epithelial cells
- Subcloning into the retroviral vector, packaging into the BOSC 23 virus-packaging cell line and assays using nude mice were performed as described [3] .
- mice developed tumors from which two cDNA inserts were recovered by PCR, one of which is subsequently shown to be expressed in the antisense orientation.
- the primers used in the PCR amplification were: 5'-CCAAGCTTTGTTTACATCGATGGATG-3' (SEQ ID NO: 7) (sense); and 5'-ATGGCGTTAACTTAAGCTAGCTTGCCAAACCTAC-3' (SEQ ID NO: 8) (antisense).
- the recovered cDNA insert which was in the antisense orientation was digested with Clal and Hindlll and recloned back into the retroviral vector, pLNCX, in the same position and orientation and then tested individually in vitro.
- NMuMG cells were infected with retrovirus produced from pLNCX vector containing or not containing the INGl insert (nucleotides 942 to 1 , 124 of the ING cDNA set forth in Figure 3).
- the soft agar culture was comprised of two layers: an underlay (DMEM, 10% FCS, 0.6% agar) and an overlay (DMEM, 10% FCS, 0.3% agar).
- 5 X 10 4 cells were plated in soft agar in 10 cm plates and were left at 37 °C for 6- 7 weeks before being counted.
- 5 x 10 5 transfected NIH 3T3 cells were plated per 10 cm dish.
- pLNCX-S and pLNCX- ⁇ S represent sense and antisense orientations of the INGl cDNA insert, respectively.
- Trial Number 11 2 3 4 mean 1 2 mean pLNCX 0 0 0 0 0 9 13 11
- Panel 1 of Figure IB shows NMuMG cells infected with the retroviral vector pLNCX and panel 2 of Figure IB shows cells infected with the retroviral vector pLNCX containing the antisense INGl insert. The bar equals 1 mm.
- Panel 3 of Figure IB shows NIH 3T3 cells transfected with vector alone and panel 4 of Figure IB shows cells transfected in parallel with pLNCX containing the antisense INGl insert.
- Example 2 cDNA of INGl and Predicted Amino Acid Sequence of p33 ING1
- normal human fibroblast and HeLa cell cDNA libraries were screened with the INGl cDNA fragment from Example 1, resulting in the isolation of 11 positive clones.
- Two clones containing the largest cDNA inserts were sequenced on both strands using an Applied Biosystems automated sequencer, yielding the sequence shown in Figure 2.
- 5' RACE rapid amplification of cDNA ends
- Total cDNAs isolated following reverse transcription had the synthetic adaptor 5 '-GTAC ATATTGTCGTTAGAACGCGTAATACGCCTC ACTATAGGGA-3 ' (SEQ ID NO: 11) ligated to them and PCR reactions using nested primers from both the adaptor and the INGl gene were used to amplify the 5' ends of all RT-generated cDNAs.
- the primers used in the amplification were: 5'-CTGGATCTTCTCGTCGCC-3' (SEQ ID NO: 12) and
- 5'-AGTGCAGCATCGGCCGCTTC-3' (SEQ ID NO: 13) from the INGl sequence and: 5'-GTACATATTGTCGTTAGAACGCG-3' (SEQ ID NO: 14) and 5'-TAATACGCCTCACTATAGGGA-3' (SEQ ID NO: 15) from the adaptor sequence.
- the largest PCR products were recovered from agarose gels following electrophoresis and were subcloned and sequenced to generate the full-length sequence shown in Figure 3.
- the predicted coding region of INGl begins at nucleotide 16 and ends at nucleotide 898, as shown in Figure 3, predicting a translation product of 33,350 daltons.
- Comparison of the sequence of p33 ING1 to the available protein and nucleotide data bases showed no significant homology to any sequence encoding a known protein and very limited similarity to retinoblastoma binding protein 2 (RbBP2) [9] and to several zinc finger transcription factors.
- RbBP2 retinoblastoma binding protein 2
- Regions of the p33 ING1 protein that show homology to different members of the pl6 MTS1 family of cyclin-dependent kinase inhibitors and to retinoblastoma binding protein 2 were identified using the Blast program available from the National Centre for Biological Information (address: www.ncbi.nim.nih.gov).
- Example 3 Expression of a GST-p33 ING1 fusion protein and creation of anti-p33 polyclonal antibody
- a fragment of INGl containing nucleotides 161-1146 of Figure 3 was subcloned into the EcoRI-Xhol sites of the bacterial expression vector pGEX-4Tl (Pharmacia Biotech, Inc., Quebec, Canada) containing the glutathione-binding portion of glutathione-S-transferase (GST). Plasmids were sequenced to verify that the correct reading frame was obtained and the constructs were electroplated into E.coli XLl-Blue. Following selection, bacterial cultures were induced to express the fusion protein by the addition of 0.
- ImM isopropyl thio- galactopyranoside (IPTG) and fusion protein was purified by standard glutathione- Agarose column affinity chromatography. Eluted GST-p33 ING1 fusion protein was dialyzed and used in immunogen in female New Zealand white rabbits. After four boosters, rabbits were bled and their serum tested for reactivity against the fusion protein. All animals showed reactivity and the bleeds showing the highest titer were chosen for subsequent use in Western blot, immunoprecipitation and immunofluorescence protocols.
- NMuMG (lane 1) and ZR-75 (lane 2) cell lines were tested.
- Preincubation of antibodies with GST-p33 ING1 fusion protein blocked recognition of p33 ING1 in a parallel blot using lysates from the same cells (lanes 3 and 4).
- lysates were prepared from control NMuMG cells and from NMuMG cells infected with antisense INGl (pLCNX- ⁇ S) that had grown and formed colonies in semi-solid medium.
- pLCNX- ⁇ S antisense INGl
- a Western blot of lysates from NMuMG cells infected with pLNCX vector (lane 5) or pLNCX vector containing antisense INGl insert (lane 6) by the method set out above is shown in Figure 1C. Results of the Western blot analysis showed that chronic expression of antisense construct reduced the expression of the endogenous INGl gene by approximately 90% compared to control parental cells.
- Example 5 Effects of p33 ING1 Overexpression Isolation of a DNA fragment that was capable of inducing foci and growth in soft agar when expressed in the antisense orientation, suggested that the cellular role of INGl might be to negatively regulate growth.
- part of the INGl cDNA was cloned into the mammalian expression vector pBK (Stratagene, Aurora, Ontario Canada) in the sense orientation (pINGl-S).
- This construct and the plasmid vector both of which contain neomycin resistance genes and a cytomegalovirus (CMV) promoter, were transfected into human breast cancer (Hs578T) and normal fibroblast (Hs68) cells. Following growth for 3 weeks in medium containing G418, plates were fixed and stained with Coomassie Brilliant Blue to identify surviving colonies. A large number of stable transformants were recovered from cells transfected with vector whereas very few colonies were visible in plates of cells transfected with the sense orientation of the cDNA of INGl .
- CMV cytomegalovirus
- Figure 4 A shows the results when human Hs578T breast cancer cells (panels 1 and 2) and normal fibroblasts (panels 3 and 4) were transfected with the plasmids pBK (panels 1 and 3) or pINGl-S containing the INGl cDNA in the sense orientation (panels 2 and 4).
- Hs68 cells were plated on glass coverslips, deprived of serum for 12 hours, microinjected with the indicated mixture of plasmid DNA (0.1 ⁇ g/ml) plus nonspecific IgG (2 ⁇ g/ml) and were then incubated for 36 hours in complete medium containing BrdU. Fixed cells were identified by staining for injected IgG and for the incorporation of BrdU. Microinjection, fixation and staining were done as described previously [16].
- Figure 4C shows the combined results of 5 separate experiments. Each group represents 110-200 injected cells.
- normal Hs68 HDFs were injected with solutions containing pINGl-S plus non-specific rabbit IgG (panels 1 and 2) or with pINGl- ⁇ S containing the INGl cDNA in the antisense orientation plus nonspecific rabbit IgG (panels 3 and 4).
- Injected cells were grown in the presence of BrdU and were fixed and stained for the presence of co-injected IgG (panels 1 and 3) or incorporated BrdU (panels 2 and 4). Arrows identify injected cells.
- FIGS. 2 and 4 show that cells injected with pINGl-S failed to incorporate bromodeoxyuridine (BrdU, panel 2) over a 36 hour time course after injection, whereas those injected with pINGl- ⁇ S entered S phase (panel 4) as estimated by staimng with anti-BrdU antibodies.
- Figure 4C shows the results of 5 separate experiments which indicate that injection of the pBK vector or of pINGl- ⁇ S constructs had no appreciable effect upon the ability of cells to proceed through S phase.
- the CD20-expressing population that was cotransfected with pINGl-S had, on average, 63.1 % of cells in G0/G1 whereas those co-transfected with vector had 33.6% of cells in G0/G1 when cells were fixed and stained 48 hours after electroporation.
- lane 1 is MCFIOA phenotypically normal epithelial cell line from mammary gland
- lane 2 is MDA-MB-468
- lane 3 is ZR-75
- lane 4 is BT-20
- lane 5 is SK-BR-3
- lane 6 is MCFT
- lane 7 is Hs578T
- lane 8 is BT-474 (breast cancer cell lines).
- Figure 5B shows the coomassie-blue stained gel corresponding to Figure 5A.
- FIG. 6 A illustrates the Western blotting results of IMR-5 (lane 1) SK-L-C6 (lane 2); SK-N-SH (lane 3) all neuroblastoma cell lines, and W138 (lane 4) a normal diploid lung fibroblast cell line.
- Normal diploid fibroblast cells expressed low levels of p33 ING1 while immortalized neuroblastoma cells expressed considerably higher levels and in the case of the SK-N-SH neuroblastoma line a truncated protein was observed.
- RT-PCR reverse transcription polymerase chain reaction
- MCF-10 phenotypically normal epithelial cell line
- lanes 1 (primers ld-4r), 3 (ld-2r), 5 (2d-4r) and 7 (2d-3r) show the results for W138, and lanes 2 (ld-4r), 4 (ld- 2r), 6 (2d-4r) and 8 (2d-3r) show the results for the neuroblastoma cell line. Primers were
- FIG. 7 illustrates the RT-PCR results of glioblastoma (lanes GB1-GB4) astrocytoma (lanes AS1-AS3) and meningioma (MN1-MN3) as compared to a control cell line (C1-C2).
- the INGl mRNA was expressed at considerably lower levels, or not expressed at all, in the glioblastomas, astrocytomas and meningiomas as compared to the normal cell line.
- Example 7 Nuclear Localization of p33 ING1
- ⁇ p33 rabbit polyclonal antibody
- GST glutathione-S-transferase
- Hs68 cells normal human diploid fibroblasts
- the cells were fixed in 3.7% formaldehyde, washed in 0.5% Triton X-100 and in 0.05% Tween 20 for 10 minutes each at room temperature.
- Formaldehyde and detergents were diluted in phosphate buffered saline (PBS) pH 7.5.
- PBS phosphate buffered saline
- the cells were incubated with a 1 :100 dilution of rabbit p33 1NGI antiserum for 30 min, washed in PBS with 0.05% Tween, incubated with goat anti-rabbit IgG-biotin antibody and then with streptavidin conjugated Texas Red [16]. Samples were examined with a Zeiss Axiophot fluorescence microscope and images were photographed on Kodak TMAX 100 film.
- Example 5 To confirm the nuclear localization of the 33 kDa protein.
- the pINGl-s construct of Example 5 was microinjected into normal Hs68 fibroblast cells which were fixed and stained with anti-p33-antibody 24 hours after injection. Strong staining was clearly localized to the nucleus. These results corroborate staining patterns in uninjected cells and show that p33 ING1 is localized primarily, and possibly exclusively, throughout the nucleoplasm.
- DNA insert containing the gene was labelled with digoxygenin-dUTP and hybridized to synchronized human lymphocyte metaphase spreads.
- a genomic clone of the INGl gene was isolated from a lambda FIX II placental human genomic library (Stratagene, Aurora, Ontario, Canada) with nucleotides 161 to 1143 of the INGl sequence of Figure 3 using high stringency (65 °C 0. IX SSC, 0.1 % SDS) screening. The identity of the clone was confirmed by partial sequence analysis.
- FISH FISH was performed using established methods on methotrexate/thymidine synchronized, phytohemagglutinin stimulated, normal peripheral blood lymphocytes [21]. Approximately 50 metaphase spreads were examined for probe localization. Suppression for 30 minutes with a mixture of sonicated human DNA (Sigma Diagnostics, Mississauga, Ontario, Canada) and cotl DNA (Gibco/BRL, Burlington, Ontario, Canada) was required to reduce the background. The stained slides were counterstained with DAPI and actinomycin D (for a DA-DAPI banding pattern) and were mounted in antifade medium and visualized utilizing a Zeiss Axioplan 2 microscope.
- the INGl gene has been localized to an area near known sites of genomic alteration in several human cancers: primary gastric cancer [22], hematologic neoplasms [23] and head and neck squamous cell carcinomas [24] .
- Example 9 Expression levels of INGl in young and senescent fibroblasts.
- the normal human diploid fibroblast cell strain Hs68 (ATCC CRL#1635) and a phenotypically normal mouse epithelial cell line from mammary gland (NMuNG) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum.
- Hs68 cells were used at 30 ("young"), 70 ("pre-aged”) and 80 ("old”) mean population doublings (MPDs) for expression and life span experiments.
- the human diploid fibroblast cells (HDFs) were repeatedly passaged in 10 cm plates, splitting at a ratio of 1:2 when confluent.
- the retroviral vector (pLNCX) was used.
- the highly efficient ecotropic (BOSC23) and amphotropic (CAK8) packaging cell lines were used [26].
- pLNCX- ⁇ S or pLNCX alone were transfected into the BOSC23 virus-packaging cell line.
- Ecotropic and amphotropic packaging lines, and the retroviral vector were kindly provided by Dr. A. Gudkov (University of Illinois at Chicago).
- the amphotropic cells were infected by viruses from the BOSC23 supernatant.
- Fibroblasts were plated at 10 5 cells per 10 cm plate and infected with undiluted viral supernatant from amphotropic producer cells. Infection efficiencies ranged from 85 to 95% in individual trials.
- Hs68 strain of primary normal human diploid fibroblasts Senescent cells were obtained by passaging early-passage ("young") fibroblasts continuously to a point at which one population doubling required from 2 - 3 weeks to complete compared to 24 hours, on average, for young HDFs.
- Hs68s at 80 MPDs exhibited characteristics typical of senescent cells, including an inability to respond to growth factors and altered morphology including increased size and decreased saturation density.
- INGl transcript were compared to the internal control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using PCR primers specific for the p33 and GAPDH genes.
- INGl and GAPDH were amplified in the same reaction tube using the "primer dropping" approach [27] which internally controls for efficiency of reverse transcription and amplification by PCR.
- Reverse transcription (RT) with 1 ⁇ g of total RNA from young and old Hs68 cells was performed using 50 U of RNasin (Pharmacia Biotech, Inc., Quebec Canada) and 200 U of MMLV reverse transcriptase for 50 min. at 42 °C in 20 ⁇ l reaction volumes.
- Two ⁇ l of each RT reaction was amplified using 2 U of Taq polymerase.
- the two sets of primer pairs for the INGl gene and for the GAPDH gene that were used, were:
- the levels of INGl mRNA were estimated by scanning densitometry to be approximately ten fold higher in senescent fibroblasts compared to young fibroblasts.
- Western blotting experiments were performed with a rabbit polyclonal antibody that was raised against a bacterially expressed glutathione-S-transferase (GST)-p33 1NG1 fusion protein and that reacted with a 33 kDa protein in human and mouse cell lysates.
- GST glutathione-S-transferase
- Hs68 and NMuMG cells were harvested and 20 ⁇ g of total protein was used in each lane.
- Proteins were separated by electrophoresis in 12.5% polyacrylamide/SDS gels, and transferred to membranes for 1 hour using an electroblotter. The membranes were blocked in TBS(100 mM Tris, 150 mM NaCl) containing 10% nonfat dried milk and 0.1 % Tween-20 for 2 hours. Incubation of the membranes with p33 ING1 antiserum was performed in TBS containing 5 % nonfat milk and 0.1 % Tween-20 for 1 hour and then membranes were washed with TBST solution for 30 minutes. Horseradish peroxidase-conjugated goat anti-rabbit antibody was then applied to the filters for 1 hour in TBST.
- Peroxidase activity was detected using ECL (Amersham Canada, Oakville, Ontario, Canada) and relative band intensities were determined by scanning densitometry. As shown in Figure 8B, the level of p33 ING1 protein increases approximately 8 fold when cells approach the end of their in vitro replicative lifespan, consistent with results obtained using RT-PCR.
- FIG. 9C shows the results of DNA content analysis by fluorescence-activated cell sorting (FACS) in parallel cultures indicating that cells enter S phase at 16 hours under these experimental conditions. These results indicate that INGl is regulated following mitogen addition to quiescent cells, with expression reaching a peak during DNA synthesis.
- FACS fluorescence-activated cell sorting
- Amphotropic and ecotropic packaging cells that were used for infection are capable of producing retroviruses with titers higher than l(f per ml upon transient transfection which allows delivery of the retroviral construct to HDFs with efficiencies of approximately 90% as monitored by expression from a retroviral - ⁇ -galactosidase construct.
- "Young" HDFs at 30 MPDs were "pre-aged” by continuous subculturing until reaching 70 MPDs.
- Hs68 cells at 70 mean population doublings (MPDs) were infected with the retroviral vector pLNCX as a control or with pLNCX- ⁇ S and were subcultured in parallel using subculturing ratios of 1:2.
- Infected cells were propagated an additional 10 MPDs after which 10 s control pLCNX and 10 5 pLCNX- ⁇ S cells at 80 MPD were split into twelve 10 cm plates and cultivated for two months, with weekly refeeding using complete medium. Some of the cells infected with retrovirus alone were observed to divide once during this time, while cells containing the INGl- ⁇ S fragment continued to grow and created visible colonies. To confirm the effect of the antisense fragment of INGl in cells, indirect immunofluorescence with a rabbit polyclonal antibody that was raised against p33 ING1 was performed.
- Senescent vector-infected fibroblasts and fibroblasts from colonies resulting from INGl- ⁇ S retrovirus infection were grown on glass coverslips for 48 hours at 37 °C to 60% confluence. Then the cells were fixed in 3.7% formaldehyde, washed in 0.5% Triton X100 and in 0.05% Tween 20 in PBS solution for 10 minutes each at room temperature. The cells were incubated with a 1: 100 dilution of rabbit p33 ING1 antiserum for 30 min, washed in PBS with 0.05% Tween, incubated with goat anti-rabbit IgG-biotin antibody and then with streptavidin conjugated Texas Red. Samples were examined with a Zeiss Axiophot fluorescence microscope and images were photographed on Kodak TMAX 400 film.
- P19 mouse teratocarcinoma cells were grown in alpha MEM medium with 10% fetal calf serum (FCS: GIBCO/BRL, Burlington, Ontario, CANADA).
- FCS fetal calf serum
- the cells were washed twice in PBS (phosphate buffered saline; 137 mM NaCl, 2.7 mM KC1, 10.1 mM Na 2 HPO 4 , 1.8 mM KH 2 PO 4 , pH 7.4) and serum-free alpha MEM (GIBCO/BRL) was added.
- Retroviral infection of target cells was used to introduce INGl expression constructs. Because the INGl protein appears to block entry into S-phase of the cell cycle the use of standard drug resistance selection methods is precluded. Retroviral infection also has a higher efficiency than standard calcium phosphate transfection procedures.
- the retroviral vector, pLNCX (7), containing sense (S), antisense (aS; nucleotides 942 to 1124 of the INGl cDNA) or vector alone were transfected into a highly-efficient BOSC23 ecotropic virus-packaging cell line.
- the BOSC23 supernatant was then used to infect ecotropic producer cell lines.
- the target P19 cells were plated at 10 4 cells per 10 cm plate and infected with undiluted viral supernatant from ecotropic producer cells. Infection efficiency was determined to be about 60% with the PI 9 cells because these cells were prone to clumping.
- the human c-myc gene was inserted into a plasmid containing a minimal cytomegalovirus promoter preceded by several binding sites for the tetracycline transcriptional protein (TA) (36).
- This construct (hTIC-myc) was stably transfected into NIH3T3 or Ratl cells previously selected for the stable expression of the TA protein that is capable of binding to, and activating transcription of the myc gene on the hTIC-myc construct, in the absence of tetracycline. In the presence of tetracycline, the TA protein is blocked from binding and very little, if any transcription is seen from the c-myc expression construct.
- tetracycline is washed from the cells, expression of the c-myc gene increases and expression can be regulated by altering the level of tetracycline to give up to 100 fold higher expression levels.
- Transformed cell lines that showed low background expression of c-myc and a high degree of inducibility were chosen for future studies.
- the transformed rodent fibroblasts either NIH 3T3- or rat 1-derived cells containing the tetracycline-controlled human c-myc gene (tet-myc cells) were maintained in high glucose Dulbecco's MEM (GIBCO/BRL) supplemented with 10% FCS and 2 ⁇ g/ml tetracycline (Sigma, St.
- the tet-myc NIH3T3 or Ratl cells were plated at 10* cells per 10 cm plate and infected with undiluted viral supernatant from ecotropic BOSC23 cells described above. Infection efficiency was determined to be greater than 90% for NIH 3T3 tet-myc cells using a retroviral ⁇ -galactosidase construct.
- Tet-myc cells containing the retroviral constructs were seeded at a density of approximately 10 4 cells/cm 2 on glass coverslips and grown at 37 °C for 48 hours before processing as described (16).
- the cells were subsequently treated to induce c-myc expression and apoptosis. Briefly, this involved washing out the tetracycline inhibitor, elevating c-myc expression by up to 100 fold, and then transferring cells to medium without serum where apoptosis rapidly ensued. Nuclear proteins were isolated at certain timepoints and immunoblotted.
- Apoptosis was minimized in cells coexpressing the antisense INGl construct with only 5% of cells dying upon serum withdrawal.
- Cells expressing INGl protein alone showed 70% viability after serum starvation and apoptosis. This was magnified when both the INGl and the c-myc gene were coexpressed (40% viability).
- These cells exhibited several hallmarks of apoptosis including shrinkage, loss of substrate adhesion and chromatin condensation.
- internucleosomal DNA fragmentation was greatly enhanced in tet-myc cells expressing p33 ING1 compared to vector only, antisense INGl or bcl-2-expressing tetmyc cells ( Figure 13B).
- Rat tet-myc cells were seeded on coverslips as described above and injected with about 25 ⁇ g/ml of GST-INGl protein or GST protein, or with 25 ⁇ g/ml of CMV-driven INGl expression construct or vector alone (31). After allowing the cells to recover for 4-6 hours, the coverslips were washed twice with PBS and the cells were serum starved.
- Injected cells were identified through coinjection and subsequent immunostaining of a coinjected nonspecific antibody. Because the history of each injected cell could be followed, a more dramatic effect of INGl expression compared to the previous experimental approaches was apparent (45% viable at 24h), with a further decrease in surviving cells when c-myc and INGl were coexpressed (9% viable at 24h).
- the results of the microinjection of the GST-INGl protein are shown in Figure 13A. Similar results were obtained with microinjection of the CMV-INGl construct.
- INGl expression confers an increased susceptibility to death upon serum starvation. Conversely, decreasing endogenous INGl levels afforded some protection against cell death. INGl markedly influences the outcome of c-myc-induced apoptosis and may, therefore, participate in guiding the response pathway whereby c-myc overexpression activates either apoptosis or tumorigenesis.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002284730A CA2284730A1 (fr) | 1997-03-27 | 1998-03-26 | Procedes servant a moduler l'apoptose provoquee par p33ing1 |
EP98912175A EP0970210A1 (fr) | 1997-03-27 | 1998-03-26 | PROCEDES SERVANT A MODULER L'APOPTOSE PROVOQUEE PAR p33ING1 |
AU67152/98A AU6715298A (en) | 1997-03-27 | 1998-03-26 | Methods of modulating p33ing1 mediated apoptosis |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US82815897A | 1997-03-27 | 1997-03-27 | |
US08/828,158 | 1997-03-27 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1998044102A2 true WO1998044102A2 (fr) | 1998-10-08 |
WO1998044102A3 WO1998044102A3 (fr) | 1999-01-14 |
Family
ID=25251055
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CA1998/000277 WO1998044102A2 (fr) | 1997-03-27 | 1998-03-26 | PROCEDES SERVANT A MODULER L'APOPTOSE PROVOQUEE PAR p33ING1 |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP0970210A1 (fr) |
AU (1) | AU6715298A (fr) |
CA (1) | CA2284730A1 (fr) |
WO (1) | WO1998044102A2 (fr) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001036476A2 (fr) * | 1999-11-17 | 2001-05-25 | Rigel Pharmaceuticals, Inc. | Nouvelles proteines de cycle cellulaire associees a un inhibiteur de proteines de l'apoptose, compositions et procedes d'utilisation |
WO2002068468A2 (fr) * | 2001-02-27 | 2002-09-06 | Pe Corporation (Ny) | Proteines suppresseurs de tumeur humaine isolees, molecules d'acides nucleiques codant ces proteines et utilisations associees |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997021809A1 (fr) * | 1995-12-08 | 1997-06-19 | University Technologies International Inc. | Sequence d'adn codant le suppresseur tumoral ing1 |
-
1998
- 1998-03-26 EP EP98912175A patent/EP0970210A1/fr not_active Withdrawn
- 1998-03-26 WO PCT/CA1998/000277 patent/WO1998044102A2/fr not_active Application Discontinuation
- 1998-03-26 AU AU67152/98A patent/AU6715298A/en not_active Abandoned
- 1998-03-26 CA CA002284730A patent/CA2284730A1/fr not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997021809A1 (fr) * | 1995-12-08 | 1997-06-19 | University Technologies International Inc. | Sequence d'adn codant le suppresseur tumoral ing1 |
Non-Patent Citations (3)
Title |
---|
GARKAVTSEV I ET AL: "Suppression of the novel growth inhibitor p33ING1 promotes neoplastic transformation." NAT GENET, DEC 1996, 14 (4) P415-20, XP002078218 UNITED STATES * |
GARKAVTSEV I ET AL: "The candidate tumour suppressor p33ING1 cooperates with p53 in cell growth control Äsee commentsÜ" NATURE, JAN 15 1998, 391 (6664) P295-8, XP002078219 ENGLAND * |
HELBING CC ET AL: "A novel candidate tumor suppressor, ING1, is involved in the regulation of apoptosis." CANCER RES, APR 1 1997, 57 (7) P1255-8, XP002078220 UNITED STATES * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001036476A2 (fr) * | 1999-11-17 | 2001-05-25 | Rigel Pharmaceuticals, Inc. | Nouvelles proteines de cycle cellulaire associees a un inhibiteur de proteines de l'apoptose, compositions et procedes d'utilisation |
WO2001036476A3 (fr) * | 1999-11-17 | 2001-11-22 | Rigel Pharmaceuticals Inc | Nouvelles proteines de cycle cellulaire associees a un inhibiteur de proteines de l'apoptose, compositions et procedes d'utilisation |
US7420045B1 (en) | 1999-11-17 | 2008-09-02 | Rigel Pharmaceuticals, Inc. | IAPs associated cell cycle proteins, compositions and methods of use |
US7423118B1 (en) | 1999-11-17 | 2008-09-09 | Rigel Pharmaceuticals, Inc. | IAPS associated cell cycle proteins, compositions and methods of use |
WO2002068468A2 (fr) * | 2001-02-27 | 2002-09-06 | Pe Corporation (Ny) | Proteines suppresseurs de tumeur humaine isolees, molecules d'acides nucleiques codant ces proteines et utilisations associees |
WO2002068468A3 (fr) * | 2001-02-27 | 2003-04-17 | Pe Corp Ny | Proteines suppresseurs de tumeur humaine isolees, molecules d'acides nucleiques codant ces proteines et utilisations associees |
Also Published As
Publication number | Publication date |
---|---|
EP0970210A1 (fr) | 2000-01-12 |
AU6715298A (en) | 1998-10-22 |
CA2284730A1 (fr) | 1998-10-08 |
WO1998044102A3 (fr) | 1999-01-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Shaulsky et al. | Nuclear accumulation of p53 protein is mediated by several nuclear localization signals and plays a role in tumorigenesis | |
US6468985B1 (en) | Retinoblastoma protein-interacting zinc finger proteins | |
US5773583A (en) | Methods and materials relating to the functional domains of DNA binding proteins | |
US6238918B1 (en) | DNA sequence encoding the tumor suppressor gene ING1 | |
US5863757A (en) | Transcription factor DP-1 | |
US5658784A (en) | Nucleic acid encoding transcription factor p300 and uses of p300 | |
US6420136B1 (en) | Method of modulating p53 activity | |
Huang et al. | A variant form of ETS1 induces apoptosis in human colon cancer cells | |
WO1998003652A2 (fr) | Cofacteur de transcription p/caf associe a p300/cbp et utilisations | |
US6323335B1 (en) | Retinoblastoma protein-interacting zinc finger proteins | |
WO1998055151A1 (fr) | Compositions renfermant une proteine (bin1) interagissant avec myc et dependant des sequences, et leurs utilisations | |
EP0970210A1 (fr) | PROCEDES SERVANT A MODULER L'APOPTOSE PROVOQUEE PAR p33ING1 | |
US6143522A (en) | Methods of modulating apoptosis | |
AU736210B2 (en) | Brca1 compositions and methods for the diagnosis and treatment of breast cancer | |
EP0792359B1 (fr) | Facteur de transcription e2f-4 | |
US6747133B1 (en) | Antibodies against the tumor suppressor gene ING1 | |
US5965398A (en) | DNA sequence encoding a tumor suppressor gene | |
US6333407B1 (en) | Matrix-associating DNA-binding protein, nucleic acids encoding the same and methods for detecting the nucleic acids | |
WO1998001460A9 (fr) | Compositions brca1 et procedes de diagnostic et de traitement du cancer du sein | |
JP2002503466A (ja) | 網膜芽細胞腫タンパク質複合体および網膜芽細胞腫相互作用タンパク質 | |
JPH0881500A (ja) | p53as タンパク及びその抗体 | |
WO1994004567A9 (fr) | Proteine d'adn a association matricielle, acides nucleiques encodant celle-ci et procede pour detecter les acides nucleiques | |
US6982317B2 (en) | C21 polypeptide that modulates the stability of transcriptional regulatory complexes regulating nuclear hormone receptor activity | |
US7160677B1 (en) | Transcription factor DP-1 | |
MXPA99000406A (en) | Brca1 compositions and methods for the diagnosis and treatment of breast cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AU CA JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2284730 Country of ref document: CA Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 67152/98 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1998912175 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1998912175 Country of ref document: EP |
|
NENP | Non-entry into the national phase |
Ref document number: 1998541007 Country of ref document: JP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1998912175 Country of ref document: EP |